TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-509-3p
miRNA Sequence: UGAUUGGUACGUCUGUGGGUAG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000084chrX96214 5196 2602 2462 1304 1062 902 310 143 26072 4895 12514 --
NM_000090chr25652 344 227 78 66 --1221 --
NM_000176chr543689 2421 902 315 --21572 1183 1660
NM_000332chr6127213 7196 7163 6990 6225 6198 6051 4683 4485 2810 2796 2223 ----25625 889
NM_000533chrX22019 1688 ----21754 1414
NM_000555chrX167350 7343 6640 6612 6030 5765 5478 5328 5228 2607 2597 1492 1157 943 733 706 25771 5745 1549 1205
NM_000618chr1276511 5058 4705 1695 1551 852 235 22519 708 36484 5072 569 --
NM_000619chr122548 218 ----199
NM_000726chr251192 479 459 340 271 1196 3948 369 357 167
NM_000813chr5115358 5055 4973 3620 3531 1990 1640 1576 588 578 49 11408 187 --
NM_000826chr462522 2242 2073 1996 1931 739 32614 1818 874 ----
NM_000829chr1121776 778 1837 1100 1312
NM_000845chr72163 114 ----1107
NM_001001484chr1051496 403 303 101 66 1710 1531 --
NM_001001928chr2297531 6794 2945 2886 1139 961 287 218 172 46956 2924 1356 1121 --1415
NM_001002843chr1531159 172 164 --1352 --
NM_001002860chr1454469 4044 3348 86 78 1636 1411 --
NM_001003674chr1865659 5399 5206 4507 2092 1552 --15084 --
NM_001003712chr1273975 3544 3311 3302 1539 963 57 --1383 --
NM_001003800chr953765 2583 213 100 86 21182 850 --13155
NM_001005473chr596099 5618 4917 4813 4787 4754 1112 695 250 ----16665
NM_001007024chr1754253 4200 3764 3454 1674 --24330 3263 1277
NM_001007098chr13669 282 57 ----1163
NM_001008393chr472414 2113 1082 298 261 189 167 22678 2137 12211 --
NM_001009555chr441719 1557 1209 1153 --1705 --
NM_001009894chr1291691 1663 1413 1385 638 460 296 97 37 ----11303
NM_001009909chr1163731 3276 1280 926 905 522 ----2978 163
NM_001010888chrX83936 3565 1704 894 766 81 60 49 11610 11092 --
NM_001011513chr461519 1508 438 406 322 63 13633 1250 --
NM_001012393chr11115192 5058 4877 4329 4155 4020 3668 3522 3258 975 925 21558 869 33975 1934 918 --
NM_001012398chr1641083 699 309 66 --11108 --
NM_001012423chr1562794 2787 2485 2177 1906 435 --22839 2106 --
NM_001013406chr711302 ----1475
NM_001014797chr10128166 8041 7489 6504 3145 2950 2411 2166 1941 1818 597 74 45858 5731 1766 1482 11517 35956 5884 107
NM_001015048chr1432463 873 650 12804 13252 11111
NM_001017368chr1732655 572 542 ----32058 1765 397
NM_001017371chr23908 851 500 --1302 11065
NM_001017440chr775888 5675 5501 5465 5128 3045 854 12881 --28114 7949
NM_001018065chr9106061 5958 4951 4806 4245 4020 2183 2027 1893 1113 12309 1533 25287 252
NM_001029858chr643307 3256 3197 185 1725 12838 12141
NM_001029875chr562563 2116 2069 691 472 465 --12084 --
NM_001033059chr631763 721 484 11693 1500 --
NM_001034954chr1042489 2176 1226 953 1370 32402 2325 62 13112
NM_001037954chr1143503 3467 3176 1338 ----11215
NM_001039199chr2034606 1933 237 --23894 1086 44055 1881 1679 1031
NM_001040284chr1675785 5673 5455 5388 4814 3618 1541 11371 --11667
NM_001040450chr1552179 2058 952 690 673 ----178
NM_001042533chr332702 2536 814 12304 --12878
NM_001042555chr12104419 3665 3366 3194 2971 1795 1488 1094 287 186 ----1546
NM_001042599chr2137462 7120 6858 5941 5750 5338 3132 2283 1823 1711 1173 672 45 --11557 --
NM_001099678chr365732 5621 1402 1086 824 177 12073 22036 921 --
NM_001204chr286540 6017 5065 2916 2447 2209 1801 348 --26947 6914 --
NM_001259chr786180 4678 4546 4528 4294 2524 1166 179 14743 1279 --
NM_001304chr1722843 1365 11277 23843 1157 --
NM_001430chr2------21557 507
NM_001627chr312313 --149 1944
NM_001845chr131249 ----1952
NM_001859chr953656 1442 1233 1027 307 31451 1011 80 1596 --
NM_001949chr633262 2285 34 ----13075
NM_002006chr475231 5039 4111 3975 859 440 21 25725 5207 2798 366 --
NM_002015chr1362949 2885 2786 2162 926 393 --2989 600 --
NM_002025chrX99283 8984 8525 7195 6430 5829 2688 2493 486 28862 7299 --39023 6513 6509
NM_002033chr1152684 1659 1576 1019 281 --32869 1329 918 1148
NM_002158chr283756 3705 3527 2443 1320 660 373 102 1822 --13678
NM_002214chr765717 4567 2172 1745 750 630 23830 1759 14153 --
NM_002270chr564895 4629 4619 3712 547 117 --11000 --
NM_002356chr662885 2854 2240 1010 607 355 --11110 1701
NM_002556chr1131403 461 158 12027 --2140 122
NM_002581chr995311 4879 4587 4267 3935 1225 712 662 423 11989 --14146
NM_002645chr1192538 2445 2392 2065 1183 1057 831 743 272 1596 ----
NM_002719chr1432071 1949 488 ----186
NM_002731chr193156 3038 2811 1984 1178 747 598 406 286 ----12304
NM_002886chr385060 4257 3925 3322 1399 961 717 671 --11390 --
NM_003161chr1763232 2900 2749 1076 924 224 --1479 1166
NM_003221chr673813 2968 1225 1173 1086 883 772 13411 13928 --
NM_003262chr375174 5138 4069 3855 3689 1657 1250 25127 4180 --1339
NM_003413chrX41821 1622 1279 293 --11291 170
NM_003468chr264024 3181 2886 2645 1654 1572 24334 3524 11474 --
NM_003617chr173504 3208 1811 1300 983 722 319 1851 1632 --
NM_003679chr163372 3065 2790 2241 1111 839 --12590 23470 3029
NM_004232chr1842358 956 298 239 --21104 739 --
NM_004272chr52652 311 126 11512 1514
NM_004274chr1442755 2550 1230 414 12788 2439 426 --
NM_004537chr122584 301 --1200 11194
NM_004586chrX85484 5327 3875 1053 932 880 549 251 ----14081
NM_004660chrY21578 461 1670 1375 1702
NM_004687chr17125 ----11777
NM_004734chr1333156 2864 344 ----22978 2545
NM_004744chr483875 3446 2846 1466 1006 925 560 376 21400 1190 --168
NM_004798chr2051453 1437 631 275 172 13567 --13671
NM_004852chr182113249 12768 11976 10824 10529 9652 9515 8827 5495 4483 4431 4184 3309 3054 2134 2103 1768 1752 1563 1482 942 212344 10185 33819 3727 3224 48998 1168 1164 745
NM_004859chr1753094 2502 1065 742 287 ----1498
NM_004898chr41331 11091 --12110
NM_004956chr753655 3099 1651 916 485 ----12909
NM_004992chrX107852 5917 2502 2299 1777 1745 1349 949 590 528 46832 2336 1649 866 ----
NM_005121chr1743682 2501 1004 930 2307 268 --13209
NM_005156chr985345 5100 4758 4616 3266 1959 1340 742 1183 184 --
NM_005233chr332559 2074 1991 1872 --12452
NM_005440chr1732598 2505 334 --2598 590 13024
NM_005668chr5103873 3865 3570 3563 3133 3087 1675 1565 877 101 ----13642
NM_005862chr31134 ----2975 953
NM_005880chr161273 --187 11469
NM_005955chr135535 3857 1810 13794 1343 25222 4181
NM_006080chr721885 1054 ----1144
NM_006106chr1123343 1255 --12785 23091 336
NM_006195chr931193 451 280 2313 221 11160 --
NM_006206chr472876 2634 2571 2466 2342 919 432 22173 2136 ----
NM_006212chr175026 4779 3950 3519 1563 1433 355 1975 --180
NM_006251chr532630 1021 917 ----12374
NM_006256chr162714 2447 2094 839 281 85 12037 --1626
NM_006306chrX54046 1714 1400 1223 55 44922 4354 1192 135 25768 5082 --
NM_006313chr122533 468 ----11387
NM_006371chr374462 4373 4108 1824 1723 1172 958 --24579 858 --
NM_006380chr1764192 2762 995 601 493 115 11267 --124
NM_006540chr841482 1399 1232 62 --21514 1035 --
NM_006599chr1687944 7204 7176 6176 6099 1906 826 185 --12959 --
NM_006726chr41456 ----1261
NM_006895chr242120 1454 1379 330 11503 --1376
NM_006927chr1671855 1619 1507 849 541 288 242 3253 205 127 1162 188
NM_006936chr21--2384 196 11275 11073
NM_007017chr51761 ----1770
NM_007124chr631988 64 22 1593 --11971
NM_007146chr1732324 336 145 1943 --1287
NM_007175chr853172 3043 2611 2487 267 --12261 13278
NM_007249chr13109195 7694 7592 7325 6985 6853 2149 1405 469 56 --11063 16279
NM_012137chr162918 2817 2400 2071 1980 984 ----22936 2852
NM_012164chr9137323 6928 6658 6121 5427 4776 4767 2369 1715 985 564 528 503 14660 27548 6292 --
NM_012223chr2------1143
NM_012234chr383037 2438 2298 1488 1279 1238 1153 653 13018 1522 --
NM_012262chr155176 4999 3894 616 600 1287 11030 --
NM_012300chr542549 2505 1629 840 12322 1602 --
NM_012309chr11114882 4658 4525 4135 4034 3812 3647 3610 3375 3243 360 ------
NM_013231chr1452910 1538 1292 1238 983 21474 1148 33334 1477 764 --
NM_013261chr463684 3259 2328 1382 1007 735 13453 12758 --
NM_013438chr921771 1494 --11581 11364
NM_014112chr895521 5223 5114 5045 3508 2130 1369 1100 832 14225 1871 --
NM_014243chr442147 1364 1358 365 --1298 --
NM_014253chrX21963 529 ----12558
NM_014294chr8----1344 11466
NM_014452chr641206 1177 966 956 ----11009
NM_014682chr822183 130 ----1325
NM_014686chr1942239 2207 1782 110 --12049 2934 452
NM_014707chr752121 1896 358 350 161 1754 --1274
NM_014729chr842310 2067 2059 1910 ------
NM_014838chr2212058 ----32817 1121 1098
NM_014873chr174200 4090 3409 1181 524 501 323 13017 13254 11741
NM_014903chr1272106 2042 1856 1627 920 588 517 ----1729
NM_014906chr1784004 3667 2709 2519 1573 1398 241 170 24118 1474 12760 --
NM_014991chr473120 2494 2412 1175 1004 925 893 13036 --1547
NM_015020chr1643626 1343 927 748 13535 --23426 842
NM_015044chr1643058 2661 1215 761 12242 --2649 72
NM_015045chr1042219 2138 1904 504 --22100 193 --
NM_015051chr933081 1267 382 --11180 1759
NM_015071chr596222 5251 4266 4231 2328 1525 1294 616 561 1215 15034 --
NM_015132chr722007 44 --199 2616 291
NM_015349chr672281 1932 1874 809 155 149 63 12120 --13018
NM_015393chr443847 3712 3531 3173 ----13834
NM_015396chr31959 ----21014 261
NM_015564chr5103469 3263 3223 3154 2503 933 818 371 194 84 13063 1705 --
NM_015888chr163358 3295 2618 2423 643 612 --12696 --
NM_015906chr174295 3767 3189 1317 1056 878 22 21366 766 ----
NM_016075chr1342994 2807 2283 206 2293 87 --12079
NM_016081chr452220 1618 493 431 92 ----22173 2169
NM_016156chr1152182 2073 2004 767 251 1732 1215 --
NM_016424chr1711847 ----11283
NM_016436chr2012052 ----12545
NM_016441chr211686 22146 702 --21524 706
NM_016531chr483052 2707 2694 1495 1023 874 624 177 --1316 --
NM_016559chr361478 1010 605 516 158 24 11382 ----
NM_016620chr1------11010
NM_016929chr644582 4102 861 321 14219 14570 14564
NM_017420chr1432803 2599 1166 13020 --13581
NM_017580chr1052150 1827 1689 492 223 1558 --11998
NM_017628chr474181 3363 1518 907 772 199 72 --13759 14525
NM_017798chr202803 201 ----1234
NM_017801chr33972 487 146 12547 --11792
NM_017919chr954456 3524 1611 1241 1026 1677 13735 13989
NM_017988chr122251 172 143 --1643
NM_018061chr151649 1513 1338 478 188 --1344 --
NM_018293chr32559 214 130 --22597 767
NM_018403chr363549 3303 1324 1030 876 619 11422 1885 11269
NM_018717chr442614 2376 2123 154 --12572 12719
NM_018979chr1221627 961 ----11683
NM_019022chr1853028 3006 2658 1149 468 --13132 --
NM_019072chr583506 3333 3266 1711 1066 541 370 248 --1703 --
NM_019084chr1042573 2150 1958 1646 --1531 --
NM_020066chr15745 292 251 200 149 --1383 1720
NM_020342chr22956 240 12359 12239 52363 2344 2340 2336 2332
NM_020443chr186945 6428 4911 2763 1800 1437 633 460 24483 1400 1549 --
NM_020689chr2041380 1103 585 333 11325 11647 --
NM_020760chr22671 387 1229 --11560
NM_020772chr17107234 6529 6441 6371 5847 5834 5295 3357 1754 1361 28402 5407 --36162 6137 449
NM_020776chr1862237 2206 2164 734 641 552 1176 --12632
NM_020809chr1111931 --22105 1721 2548 456
NM_020988chr1641326 1310 1274 1080 --11055 11147
NM_021072chr532324 1943 702 ----1414
NM_021101chr342491 2447 1553 850 --11919 11652
NM_021961chr1187485 2666 2368 1946 1481 791 691 518 36509 2596 1733 36523 4703 683 --
NM_021970chr4----156 2647 555
NM_022351chr893575 3551 3291 2489 1325 1300 1247 199 161 --12878 12936
NM_022454chr81349 ----1867
NM_022459chr1356065 5807 4671 2445 560 15530 --25466 804
NM_022474chr1492660 2476 2469 2386 1819 682 631 484 53 --12586 12202
NM_022763chr373116 2005 1043 996 921 818 704 22760 824 --1370
NM_022841chr1552381 2040 1853 1823 351 ------
NM_024713chr154586 570 503 152 ----1392
NM_024947chr368679 8541 8424 2738 2300 1106 --28942 8891 --
NM_024989chr267697 5557 2633 2511 1428 611 --17096 15025
NM_025134chr1672456 2425 1574 680 567 518 89 21976 561 ----
NM_030625chr1022316 898 2766 480 11701 --
NM_030627chr564110 3552 2824 2800 1090 956 --23796 3541 --
NM_032145chr6----1327 21500 1479
NM_032291chr151936 1865 1790 1279 94 --21410 175 --
NM_032307chr9----21058 930 1912
NM_032373chr1044582 4483 1517 426 1567 25164 634 --
NM_032440chr1012870 21171 22 1489 --
NM_032457chr453189 2617 1392 759 750 --12839 --
NM_032833chr152604 2320 956 373 218 --12670 --
NM_033224chr7137858 7607 7426 7241 7038 6316 6105 5854 5702 4891 2751 2577 1782 57227 5620 3205 3093 3002 23130 2889 11529
NM_033285chr874477 3948 3014 2836 810 424 241 11433 24250 98 23688 110
NM_052832chr82480 409 11104 13016 --
NM_052851chr1332305 1807 211 --1398 12385
NM_052879chr1232611 659 308 1205 13422 1716
NM_057175chr462177 1954 922 812 681 286 ------
NM_130386chr181585 ----1117
NM_133265chrX33196 2495 944 1959 23340 173 1892
NM_133334chr444295 2557 914 488 ----1180
NM_138468chr254823 2112 1322 1048 41 25431 2085 --11234
NM_138473chr1265022 4924 4805 4732 4321 1765 24930 3556 14860 15186
NM_138799chr231710 1554 338 --21269 53 --
NM_139207chr12----2874 150 11868
NM_144571chr486113 5561 5435 4579 2722 1543 1196 838 --25452 290 --
NM_145117chr1143240 2706 2660 2323 22299 667 23298 965 --
NM_145307chr1034515 400 111 ----24408 1018
NM_152470chr1873927 2880 2598 1235 666 564 336 13342 --13346
NM_152556chr7144 12179 22224 58 --
NM_152594chr1521838 401 ----12201
NM_152622chr573318 3308 2221 475 334 171 39 --1469 1862
NM_152716chr11163 1428 --11534
NM_152756chr533563 3092 2671 ----1698
NM_153020chr631720 56 48 --2559 219 --
NM_172071chr152833 1864 1572 440 431 21628 39 26550 712 --
NM_173470chrX52904 2856 2711 2095 968 1163 11922 12628
NM_173495chrX32185 1780 742 1473 --12387
NM_173808chr163706 1795 1389 652 419 62 13353 21593 1251 --
NM_173851chr823761 567 --1840 1183
NM_178313chr211703 --12057 11958
NM_178539chr1221849 517 ----1636
NM_181706chr112542 378 ----22292 2105
NM_181787chr833692 3654 474 --1715 --
NM_182485chr453751 3649 3310 200 122 ----11201
NM_182487chr994360 4298 4044 2754 1693 1510 587 444 78 13280 --14231
NM_194291chr852527 1052 459 229 36 --12614 --
NM_194314chr185083 4390 4275 3886 3778 3640 1539 611 14961 11686 --
NM_198270chrX63361 3225 1026 774 624 494 22349 739 12911 --
NM_206853chr623872 2791 ----1255
NM_206854chr665133 4052 3555 3303 1208 759 ----21516 51
NM_206933chr121858 767 --22850 2542 11108
NM_207647chr922263 1689 ----22474 66