TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-509-5p
miRNA Sequence: UACUGCAGACAGUGGCAAUCA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000037chr852210 1991 1716 881 206 --12371 --
NM_000084chrX55105 4902 2635 1345 369 12302 11430 26312 6280
NM_000153chr141348 ----1630
NM_000163chr532008 1556 367 1756 1606 --
NM_000165chr6160 11277 ----
NM_000168chr763272 3066 2589 2395 1285 565 --1811 --
NM_000176chr543718 3283 3277 79 12821 13749 11364
NM_000176chr543718 3283 3277 79 12821 13749 11364
NM_000214chr2051727 437 333 240 48 ------
NM_000217chr1284950 3758 2045 1683 1586 1566 744 631 --1720 --
NM_000222chr441910 1453 1432 1315 ------
NM_000259chr1586321 5990 4609 4009 2497 2273 2014 1451 22211 799 24729 1971 15831
NM_000267chr1712708 23038 2220 11335 --
NM_000284chrX61872 1352 780 757 382 154 --21400 1245 --
NM_000301chr6------1173
NM_000314chr1042550 2359 1219 441 ----12990
NM_000332chr687067 6134 2363 2337 1274 872 365 66 --11571 --
NM_000337chr52633 565 15576 16513 --
NM_000346chr1721473 1452 ------
NM_000362chr2232273 1356 1324 --12594 --
NM_000368chr994752 4591 4150 3975 3699 3074 1063 979 433 --14115 --
NM_000408chr243417 3266 2792 1262 ------
NM_000437chr11843 ----11463
NM_000458chr172900 789 1206 ----
NM_000461chr343243 1272 1048 506 13062 ----
NM_000489chrX22458 632 ------
NM_000495chrX168 --1364 --
NM_000533chrX31248 551 147 ------
NM_000538chr133582 538 100 --1440 --
NM_000555chrX137301 6968 6855 6827 6600 4959 2066 1853 1706 1609 1088 661 348 22317 55 16808 --
NM_000599chr2----14269 --
NM_000610chr1112196 ----1556
NM_000615chr1122734 623 1652 21868 912 --
NM_000618chr1256072 5345 2159 1747 917 ----14902
NM_000620chr1221542 352 --1222 --
NM_000627chr21914 ------
NM_000633chr1854307 3862 1331 1232 97 --24737 1502 --
NM_000635chr1931178 639 208 11318 11135 --
NM_000724chr101323 --1220 --
NM_000767chr1931204 273 60 --11391 --
NM_000794chr51930 ------
NM_000811chr5----1633 --
NM_000813chr565566 5339 4905 4367 3885 1490 --14167 --
NM_000814chr1563497 1618 1260 963 755 265 ------
NM_000828chrX1346 --11410 --
NM_000833chr16----1487 --
NM_000836chr191960 ------
NM_000868chrX22310 352 ------
NM_000875chr1535700 4635 2492 ----1158
NM_000883chr72285 181 --1637 --
NM_000891chr1752442 1026 897 426 279 12566 ----
NM_000901chr431867 690 331 ------
NM_000912chr822419 1112 --183 --
NM_000933chr2031219 689 347 --11209 --
NM_000959chr14958 388 116 83 13966 ----
NM_000983chr1--11451 185 --
NM_001001132chr2151438 1136 527 218 156 ------
NM_001001331chr32815 538 ----12588
NM_001001344chrX72371 1980 1715 1699 784 563 514 --12559 --
NM_001001481chr8----1826 --
NM_001001549chr731887 1872 1110 12046 22669 983 --
NM_001001890chr2143627 3196 1642 156 ------
NM_001001924chr832073 757 53 --12056 11561
NM_001001971chr10----1912 --
NM_001001995chrX11178 --11810 170
NM_001002258chr2------184
NM_001002838chrX6636 549 389 190 184 173 --11307 --
NM_001002862chr221234 --1137 --
NM_001002909chr1731704 277 140 1872 ----
NM_001003652chr1867980 6263 2422 1485 1449 532 1430 36767 1407 1349 --
NM_001003674chr18186946 6402 5563 5527 5475 5183 4550 4482 2372 1963 1876 1636 1529 1383 1171 961 780 346 --12448 11716
NM_001003681chr2232027 96 70 ------
NM_001003698chr621924 1510 --11613 --
NM_001003712chr1224007 3238 13964 13877 --
NM_001003760chr613630 13060 --11314
NM_001003792chr3----21128 954 --
NM_001003810chr4--1316 ----
NM_001004065chr943463 3289 453 315 11465 1754 --
NM_001004127chr131236 --1914 --
NM_001004304chr1243214 2676 1190 615 1514 ----
NM_001004317chr644396 3391 3181 3069 14269 ----
NM_001004722chr21903 --1167 --
NM_001005404chr1744275 1702 1168 1161 --1886 13395
NM_001005463chr1032141 2109 621 ------
NM_001005476chr2----1232 --
NM_001005505chr311147 --11500 --
NM_001005739chr21574 --1310 --
NM_001005743chr1421219 859 --1989 --
NM_001005845chr81685 2575 251 ----
NM_001005845chr81685 2575 251 ----
NM_001006115chr352370 801 343 145 42 ------
NM_001007237chr172700 1824 1767 859 620 559 257 ----12888
NM_001007277chr113366 114 63 --136 --
NM_001007466chr655219 3218 3208 785 59 ------
NM_001008239chr1843819 3614 3062 1212 ------
NM_001008392chr373394 3297 3076 2795 2731 1135 628 --11237 --
NM_001008408chr7146082 5902 5857 5844 4944 3984 3917 2113 1734 1645 1593 1581 1525 1092 1843 36434 5165 3993 11125
NM_001008493chr121382 613 1411 ----
NM_001008541chr1021650 88 --11580 --
NM_001008564chr1331974 726 429 175 ----
NM_001009554chr483745 2923 1864 1292 1149 992 958 424 167 1154 --
NM_001009569chr102113 30 ------
NM_001009571chr71245 ------
NM_001009899chr366155 5208 4140 2050 1381 826 14024 15986 --
NM_001009993chr284068 3808 1613 1320 1188 924 69 35 --34562 2874 338 --
NM_001010867chr1114585 2570 2536 1911 1771 1339 1229 1100 1009 749 423 --31431 1381 1278 --
NM_001010888chrX31302 1292 465 11516 ----
NM_001010942chr123829 823 226 11034 ----
NM_001010986chrX21912 925 32336 2064 1770 --1777
NM_001011657chrX11068 ------
NM_001011666chr766408 4114 2107 1406 1383 38 24561 4529 ----
NM_001012279chr6--130 --196
NM_001012393chr11105184 5133 4794 4501 3283 1895 1875 637 601 67 ------
NM_001012423chr1542466 2309 784 727 ------
NM_001012761chr532683 217 186 ------
NM_001013031chr1043249 2427 2156 690 ----1719
NM_001013438chr32709 673 ------
NM_001013690chr1221765 611 --22480 599 --
NM_001013693chr152406 1151 762 396 176 --22684 1996 --
NM_001014797chr1067584 6708 6488 5851 1811 759 --31856 1378 779 --
NM_001015877chrX43058 2796 884 216 23066 1940 12335 --
NM_001017395chr333632 2437 1037 22536 1175 13567 --
NM_001017926chr81722 --1179 --
NM_001017979chr41592 --1100 --
NM_001017995chr584776 4069 3900 3880 3333 1889 1555 722 13206 11780 --
NM_001018050chr2262780 2685 2220 1328 681 36 12838 21008 188 --
NM_001018108chr151133 1458 184 --
NM_001024463chr1521142 1028 --1989 1885
NM_001024649chr5102766 2498 2453 1827 948 682 493 404 209 180 12504 11181 --
NM_001024847chr352207 1722 1673 828 491 --12288 12033
NM_001024947chr52260 85 --1195 --
NM_001025076chr1065894 5037 4329 3907 3858 2476 11847 15601 --
NM_001025079chr343789 2549 1543 820 --22718 1114 --
NM_001025108chr2102794 2771 2753 2541 1671 1641 1355 1108 906 144 23893 3827 24121 107 13752
NM_001025366chr621812 333 ------
NM_001025580chrX63501 2646 1588 425 230 38 14275 13200 --
NM_001025780chr931502 1435 196 ------
NM_001029858chr651245 1096 847 389 98 13135 ----
NM_001029883chr242432 1995 1121 1034 11183 ----
NM_001029989chr152927 716 --2952 866 --
NM_001030007chr1653870 3299 2806 2485 375 --23647 793 --
NM_001030055chr1424327 4142 21709 1328 --24291 3119
NM_001030059chr10----185 --
NM_001031732chr453437 3214 2861 811 390 1158 ----
NM_001031804chr1674377 3794 3786 3242 1715 1578 702 ------
NM_001031812chr531793 881 707 --176 --
NM_001032282chr81528 ------
NM_001033026chr192650 279 --1424 --
NM_001033057chr352071 1858 429 421 289 --22011 442 11394
NM_001033059chr641940 1534 1435 110 ------
NM_001033557chr2----11247 --
NM_001033566chr17------1164
NM_001033602chr1352465 2062 932 772 278 --1389 --
NM_001033925chr10--1689 12135 --
NM_001034845chr421118 507 ----1318
NM_001034850chr51675 --2613 141 --
NM_001034915chr8------1128
NM_001034954chr1043201 3008 2663 1031 --13025 --
NM_001037132chr731645 733 286 ----1441
NM_001037172chr311128 --1914 11018
NM_001039091chrX21340 75 ------
NM_001039538chr243630 3413 3054 445 ----1129
NM_001039577chr173989 3685 3480 3049 1367 851 729 2957 273 ----
NM_001039577chr173989 3685 3480 3049 1367 851 729 2957 273 ----
NM_001039590chrX23819 146 --1179 --
NM_001039618chr1154970 4944 4768 4732 4542 12009 ----
NM_001039675chr15----1239 --
NM_001039690chr1652155 2129 1936 1917 325 ------
NM_001039762chr1021748 211 --11699 --
NM_001039802chr121275 931 ------
NM_001039937chr1333948 2664 1563 13357 11654 --
NM_001040001chr611607 --11915 --
NM_001040057chr71425 --1242 --
NM_001040152chr784806 4464 4306 4268 3521 3492 1681 1611 ------
NM_001040159chr431196 227 140 ------
NM_001040195chr12666 50 ------
NM_001040272chr94875 643 339 241 1910 11872 --
NM_001040284chr1695693 5460 4484 4435 4075 2094 1393 1022 938 ------
NM_001040402chr432053 1065 197 ------
NM_001040429chr1353396 3216 2902 1036 334 23568 505 ----
NM_001042370chr1----1223 --
NM_001042388chr182128 116 --1805 --
NM_001042413chr994005 2647 2612 2503 837 778 339 171 117 11655 13331 --
NM_001042537chrX21645 207 ------
NM_001042555chr1233599 3247 1924 --11252 --
NM_001042749chrX2816 654 1807 ----
NM_001044305chr631506 1258 391 11058 ----
NM_001046chr522992 2160 155 ----
NM_001106chr3159700 9570 9110 8797 8229 8014 7775 7410 6567 3912 3596 3422 2761 2596 1662 29211 1521 18007 --
NM_001148chr431995 794 495 ------
NM_001160chr1292642 2636 2607 2412 947 924 626 515 22 1109 ----
NM_001186chr2172109 1266 1058 1047 968 385 316 22840 228 ----
NM_001191chr2031462 1280 151 ------
NM_001200chr202767 413 ------
NM_001201chr473877 3837 3565 2858 2756 1446 599 11409 ----
NM_001204chr246042 5671 5175 5045 17254 24981 398 --
NM_001219chr72747 647 ------
NM_001222chr1031434 695 462 --21675 1668 --
NM_001241chr262251 1676 958 789 435 350 ------
NM_001256chr1712183 1541 ----
NM_001257chr1641448 1415 1323 84 ------
NM_001259chr751881 1306 370 195 33 15900 ----
NM_001280chr192659 478 183 ----
NM_001356chrX22394 529 1499 1223 --
NM_001364chr1174498 4222 2925 2890 538 330 109 1204 ----
NM_001379chr191274 ------
NM_001386chr842099 1989 1703 713 --22208 652 --
NM_001396chr2132611 906 706 1522 ----
NM_001401chr921433 1233 1571 ----
NM_001406chr17----11634 --
NM_001412chrX63410 3174 2280 1071 798 653 --1457 --
NM_001415chrX3631 350 280 ------
NM_001417chr1241893 1528 271 167 ------
NM_001426chr2----1738 --
NM_001430chr231856 1368 365 ------
NM_001438chr123457 3146 1723 12486 --
NM_001453chr641643 1318 1146 527 ------
NM_001455chr644227 1907 1035 999 34865 3383 439 ----
NM_001482chr15----196 --
NM_001493chrX----1314 --
NM_001616chr243290 2385 2253 1036 ------
NM_001621chr742373 2193 1983 1199 --12132 --
NM_001635chr73743 671 355 ----1381
NM_001659chr122679 551 --12621 --
NM_001663chr1462743 2682 2543 2492 2329 430 12216 --12633
NM_001678chr1741666 1584 1578 173 --11783 --
NM_001690chr362392 1890 1626 696 485 363 ------
NM_001704chr62562 523 ------
NM_001731chr121686 ----1347
NM_001759chr12114955 4745 4708 4687 4681 4386 3678 731 722 581 294 1391 14004 --
NM_001792chr18192 --1870 --
NM_001859chr963783 1214 934 888 731 35 13138 --23957 2630
NM_001873chr42616 83 146 ----
NM_001903chr53742 594 374 --2814 720 --
NM_001918chr1109075 8843 8476 7881 7861 7474 7201 6950 2575 515 38907 8318 6197 58653 5842 2516 2013 1781 17944
NM_001938chr111500 ----1470
NM_001941chr1873499 3455 3399 2950 921 862 452 12781 ----
NM_001942chr1821889 743 11516 1263 11918
NM_001945chr521042 73 ------
NM_001949chr672962 2672 654 475 355 201 72 12861 ----
NM_001981chr12918 581 1404 1363 --
NM_001987chr1254055 3019 847 484 142 --31057 664 346 --
NM_001999chr5151 1409 11106 --
NM_002006chr454138 4025 2133 1925 1696 11620 22158 1179 15290
NM_002025chrX88918 7790 7262 3097 2408 2304 2072 1865 28550 2462 38650 6719 6090 --
NM_002026chr21411 ------
NM_002069chr7280 65 --1200 --
NM_002077chr932106 1567 157 ----1103
NM_002103chr1921080 793 --1293 --
NM_002128chr132876 410 ------
NM_002131chr631315 1186 182 ------
NM_002199chr41397 --1287 --
NM_002214chr744544 4117 3469 579 --15619 --
NM_002228chr141021 787 383 229 ----1398
NM_002232chr12885 473 ------
NM_002233chr112358 68 --1467 --
NM_002235chr1241375 471 178 22 ------
NM_002246chr21998 --11211 --
NM_002254chr262350 2322 2298 2165 888 719 --11913 --
NM_002264chr334225 4140 3632 ----11855
NM_002267chr132422 154 --1287 --
NM_002268chr331801 1743 736 1367 ----
NM_002270chr554924 2207 1941 990 859 --21085 22 15628
NM_002356chr612078 12419 1891 --
NM_002382chr14----11221 --
NM_002397chr54751 516 314 39 ------
NM_002398chr221494 960 11509 ----
NM_002399chr152280 45 ----1577
NM_002401chr1752475 2436 1639 709 180 ------
NM_002430chr2222556 1604 --42003 1786 925 264 --
NM_002449chr51169 11293 ----
NM_002479chr12515 68 ------
NM_002499chr153883 775 237 --22420 2281 --
NM_002515chr1441964 1390 290 76 ----11919
NM_002595chr1221336 377 --1462 --
NM_002628chr33885 193 76 ------
NM_002635chr121428 ----1122
NM_002645chr1122162 707 ------
NM_002655chr855245 4154 1761 1064 936 --15141 --
NM_002657chr2051470 1199 647 451 415 ------
NM_002698chr1952666 2397 1106 231 146 ------
NM_002709chr221273 1227 1758 ----
NM_002715chr541075 371 291 263 ------
NM_002734chr1731865 248 83 --11987 --
NM_002736chr732140 1461 550 --128 --
NM_002737chr1786667 4731 2402 2394 1984 1954 1156 239 --1981 --
NM_002740chr332518 1067 599 --11031 --
NM_002745chr22114417 3963 2913 1830 1304 867 671 553 546 311 236 1784 1723 --
NM_002753chr42317 127 ------
NM_002775chr102186 163 ------
NM_002819chr1951434 585 443 356 297 --2978 177 --
NM_002834chr1253915 1303 1012 916 318 --1986 13721
NM_002844chr611329 ------
NM_002868chr1221835 703 1585 1961 --
NM_002869chr1121594 537 --172 --
NM_002874chr91246 1776 ----
NM_002897chr22630 496 ------
NM_002957chr972390 946 938 866 834 710 346 ----12485
NM_002971chr31385 ------
NM_002973chr121159 ------
NM_002977chr273428 3417 2689 1368 998 216 122 22132 940 ----
NM_002998chr82780 610 --1197 --
NM_003011chr92628 68 1353 ----
NM_003016chr1731655 329 166 --22007 292 --
NM_003020chr153376 346 301 ------
NM_003026chr9------11282
NM_003028chr983720 3467 3312 2362 1180 718 629 583 --1996 --
NM_003042chr331817 674 402 --1625 --
NM_003043chr374214 4148 3202 2989 2795 1426 1059 14162 ----
NM_003072chr192157 90 --1320 --
NM_003074chr32345 294 --1213 --
NM_003100chr5------1344
NM_003108chr297226 7057 6211 5783 2698 2004 703 488 68 --16052 --
NM_003112chr72328 234 23236 2723 1903 --
NM_003178chr33654 619 144 ------
NM_003194chr63580 498 116 ------
NM_003205chr1522216 1908 22132 1845 ----
NM_003211chr12147 1680 136 --
NM_003246chr1531835 1646 171 --1695 11605
NM_003262chr344460 3753 1592 1156 ------
NM_003288chr2031231 592 26 ------
NM_003298chr3106149 5993 4762 2400 2231 2149 1798 1740 1096 771 1655 15807 --
NM_003341chr3--1239 1574 --
NM_003347chr223873 843 49 --11625 --
NM_003348chr1231526 500 326 ------
NM_003350chr81883 --1394 --
NM_003385chr22829 56 ------
NM_003390chr111207 1759 1317 --
NM_003392chr364287 3016 1480 1324 1262 645 --11552 --
NM_003400chr2----1838 --
NM_003403chr14--1645 ----
NM_003404chr2021780 1651 11807 11574 --
NM_003412chr332868 1252 1130 2702 242 12022 --
NM_003453chr131180 ------
NM_003463chr642772 2725 2534 2198 1273 12613 --
NM_003469chr2----1375 --
NM_003470chr162605 380 --21843 1637 --
NM_003474chr102622 228 12276 1732 1239
NM_003478chr112973 799 23284 2928 12421 --
NM_003482chr1222268 1772 ------
NM_003483chr1212735 --32765 490 67 --
NM_003488chr173976 931 758 --2778 130 --
NM_003489chr2111214 --23449 3398 --
NM_003507chr23372 229 147 --2469 432 --
NM_003559chr1763514 3316 2915 1359 1323 139 13258 33849 2783 2445 --
NM_003566chr1253295 3216 3158 3043 2586 1593 ----
NM_003574chr1834528 2306 1414 14257 ----
NM_003591chr101294 ------
NM_003615chr353323 1375 662 551 497 ----12616
NM_003618chr2------192
NM_003620chr171944 ------
NM_003629chr163345 3275 1369 1269 1065 983 --12595 12162
NM_003633chr532327 2147 2052 --21978 1819 --
NM_003659chr2----1144 --
NM_003672chr11753 ----11432
NM_003677chr1241914 1824 486 271 11710 22272 2210 --
NM_003692chr91930 1114 --1851
NM_003743chr222248 97 ------
NM_003750chr10--1866 ----
NM_003758chr152527 412 2330 110 ----
NM_003766chr17----1616 --
NM_003768chr121485 1312 --11836 --
NM_003778chr31604 ----1793
NM_003787chr18140 ------
NM_003796chr19187 ------
NM_003800chr621879 410 --11538 12131
NM_003821chr8------1148
NM_003822chr133028 1232 935 --11931 --
NM_003825chr152500 342 ------
NM_003862chr5----1228 --
NM_003870chr1521968 1456 1308 ----
NM_003872chr232909 2293 223 ------
NM_003873chr103552 534 197 --1953 12300
NM_003877chr12------1623
NM_003885chr1782577 2505 2352 1860 1661 951 832 796 ------
NM_003887chr252264 2207 2030 2024 572 11867 11547 --
NM_003913chr672932 1522 1506 481 439 259 202 ------
NM_003934chr92862 344 --11032 --
NM_003939chr1054082 3778 3363 1411 491 151 23184 175 --
NM_003941chr75901 710 649 529 508 11591 ----
NM_003958chr652878 2755 2715 1078 634 ------
NM_004036chr2----1190 --
NM_004077chr121339 --1351 --
NM_004093chr1353197 1085 757 527 306 --1289 --
NM_004097chr21893 --1335 --
NM_004098chr10----11072 --
NM_004124chr1412632 13166 --1117
NM_004171chr11109152 8825 8720 7798 7553 7072 6283 5923 3483 757 48171 1916 1382 855 ----
NM_004211chr11------1173
NM_004236chr15--1517 1511 --
NM_004238chr22338 127 ------
NM_004274chr1442435 2315 1994 519 12643 1360 --
NM_004311chr1082113 2094 1203 1143 644 579 308 32 ----11935
NM_004326chr11280 ------
NM_004331chr812217 22494 2206 ----
NM_004337chr86841 439 423 350 174 65 11891 ----
NM_004342chr71339 1352 --11629
NM_004349chr811165 --1851 --
NM_004360chr1651326 538 515 322 131 --11906 --
NM_004370chr652143 2005 1993 1544 1514 --1663 --
NM_004386chr1922000 1838 --12242 --
NM_004392chr1321905 46 22012 852 ----
NM_004396chr17198 --1111 --
NM_004397chr1153689 1611 1421 1174 822 --21563 705 --
NM_004411chr73672 499 25 --162 --
NM_004430chr822073 1711 ------
NM_004432chr942209 1930 1892 788 ------
NM_004437chr163485 3433 3163 2883 2745 1353 1622 23421 2478 --
NM_004438chr252263 1326 1133 1107 136 ------
NM_004440chr621676 1351 --11626 --
NM_004441chr32987 485 --1319 --
NM_004450chr141352 --166 --
NM_004458chrX52592 2538 451 357 341 ------
NM_004481chr132295 1763 652 --12341 --
NM_004482chr2----172 --
NM_004496chr1421347 866 ------
NM_004501chr141590 1482 179 112 1881 23943 495 12540
NM_004504chr242688 860 600 255 --12382 1280
NM_004529chr91585 ------
NM_004566chr1052556 2400 612 553 39 ------
NM_004576chr5------1348
NM_004577chr71273 --1181 --
NM_004578chr12351 286 ------
NM_004588chr1183579 2606 2599 2493 1335 1065 822 580 ------
NM_004598chr531022 850 434 --13305 --
NM_004612chr984521 4413 4405 3944 3511 1586 235 119 24237 3221 ----
NM_004630chr1121121 1000 ------
NM_004660chrY1532 198 ----
NM_004663chr1541396 538 422 182 1980 31436 1300 1274 --
NM_004694chr17----1812 --
NM_004713chr14----2536 245 --
NM_004725chr1011211 --1253 --
NM_004733chr3139 ------
NM_004734chr1363083 2499 2438 996 715 523 --22355 2263 1409
NM_004745chr8106227 5643 5043 4629 4552 4434 1628 1597 1208 1084 11126 24358 1659 --
NM_004748chr1533649 1690 1066 --23516 3469 --
NM_004755chr141918 --11028 --
NM_004768chr1--11106 --11011
NM_004772chr521490 361 ------
NM_004774chr1732001 1075 731 1960 ----
NM_004775chr181393 ------
NM_004834chr273358 3085 2121 1315 1219 1144 917 ------
NM_004841chr11394 --1341 --
NM_004850chr221728 1162 --1568 --
NM_004852chr181313679 13472 12356 11131 10023 9069 8937 4967 4626 4022 1983 890 382 110162 ----
NM_004859chr1752547 2341 2046 977 521 --31080 319 22 --
NM_004866chr544462 4320 1363 203 54838 4812 793 760 515 34259 1762 1491 1338
NM_004867chrX2586 508 ------
NM_004874chr81502 ------
NM_004891chr2174 ------
NM_004906chr6------1510
NM_004926chr1421837 731 ------
NM_004939chr2----145 --
NM_004947chr31349 1265 1287 --
NM_004949chr1831320 120 110 ------
NM_004953chr3170 --1110 --
NM_004956chr731176 602 464 ------
NM_004973chr621502 76 --1198 --
NM_004982chr12------1155
NM_004985chr1244341 4077 846 280 13807 13196 --
NM_004996chr16134 11752 1505 --
NM_005044chrX113662 3624 3509 3179 1687 1563 1175 951 800 445 210 ------
NM_005065chr1434404 2109 1817 24311 3925 --14991
NM_005076chr143847 2878 2619 959 --1935 --
NM_005077chr91350 ------
NM_005097chr101226 ------
NM_005109chr322153 683 --11997 --
NM_005116chr2073286 2850 2812 1735 1721 295 172 13336 23972 49 --
NM_005121chr1723059 59 1588 1731 --
NM_005157chr921601 45 --1263 11961
NM_005180chr102403 121 --1304 --
NM_005220chr1711188 11146 11263 --
NM_005252chr141101 --1533 --
NM_005277chr41534 21656 1515 ----
NM_005313chr151535 ------
NM_005316chr112725 53 --1312 --
NM_005328chr8124 ------
NM_005339chr434113 958 945 13133 11733 --
NM_005358chr1341894 538 156 31 1221 ----
NM_005387chr111144 ------
NM_005391chrX182 ------
NM_005398chr1021314 1237 --11373 --
NM_005399chr141756 1456 307 161 13892 ----
NM_005406chr181544 11336 ----
NM_005407chr1431517 356 242 11414 1141 --
NM_005436chr1083768 3290 2676 2626 1162 1087 824 387 ------
NM_005437chr1021360 66 --11369 --
NM_005458chr992205 2055 1827 750 737 598 551 92 68 --11684 --
NM_005461chr2031942 1766 1598 ------
NM_005465chr11647 ------
NM_005504chr12106584 6260 5798 5409 2468 2080 1466 1392 422 113 1121 11257 --
NM_005509chr521677 1540 ------
NM_005570chr182327 136 --1468 1975
NM_005578chr353951 3402 3350 1170 1067 ------
NM_005587chr155398 356 313 251 217 --2407 40 --
NM_005596chr975974 4626 2096 1992 1098 623 251 --26392 4992 15823
NM_005599chr111496 --21170 94 --
NM_005600chr1----1196 --
NM_005626chr11517 ----1495
NM_005634chrX1148 ------
NM_005647chrX73262 2620 2360 1375 1226 86 65 ------
NM_005648chr8----154 --
NM_005668chr523485 795 --23391 1577 --
NM_005669chr542220 2169 272 200 --1355 --
NM_005711chr5178 --1774 --
NM_005721chr231016 697 361 --1706 --
NM_005724chr151267 ------
NM_005731chr23339 328 151 ------
NM_005736chr1011157 --21512 187 --
NM_005737chr262349 1871 1104 915 736 394 12501 ----
NM_005744chr15------1121
NM_005748chr1233284 1386 252 --1211 --
NM_005785chr1221870 1619 ------
NM_005802chr9--1638 172 --
NM_005819chr152910 2851 553 478 220 --11122 --
NM_005832chr3191 21305 968 ----
NM_005862chr31145 ------
NM_005875chr31322 ----187
NM_005907chr621500 130 ----1628
NM_005909chr544222 4124 3451 724 11542 ----
NM_005911chr22393 122 ----1270
NM_005920chr122526 316 --12951 --
NM_005923chr6------1642
NM_005933chr1152776 2446 2103 1979 621 ------
NM_005941chr842675 1618 1390 33 ------
NM_005955chr174851 4827 3538 1899 794 671 603 ------
NM_005966chr21486 11969 21544 457 --
NM_005975chr2021054 233 --2993 318 --
NM_005984chr222426 120 180 ----
NM_005986chr1342497 1056 488 28 1454 ----
NM_006011chr1553118 1409 1269 1170 1159 ------
NM_006015chr12835 502 ------
NM_006037chr263784 3474 3052 1735 1058 873 ------
NM_006039chr171366 --11055 --
NM_006060chr774106 3659 3233 3151 1415 1317 462 --13781 --
NM_006080chr742649 2351 2092 736 1676 ----
NM_006108chr112222 112 ------
NM_006141chr1652743 2685 2290 2164 1767 12737 ----
NM_006154chr1552597 2484 1164 805 667 1935 2988 22 --
NM_006156chr141201 ------
NM_006186chr22370 197 ----11152
NM_006194chr142850 188 ------
NM_006195chr931417 895 254 --1941 --
NM_006224chr1742297 2037 541 142 --2740 254 --
NM_006243chr121007 901 ----1887
NM_006251chr543049 2982 997 29 22523 209 1815 --
NM_006256chr132303 2104 906 ------
NM_006267chr23756 717 127 ------
NM_006275chr201642 --12188 --
NM_006283chr844172 4126 1926 96 ------
NM_006292chr11188 ------
NM_006311chr171348 ------
NM_006313chr121486 1152 --1463
NM_006315chr474381 3544 3151 1121 1068 397 255 --34398 3618 1334 --
NM_006317chr51769 1320 1709 --
NM_006320chr421125 194 ------
NM_006328chr112667 476 --1227 --
NM_006330chr841298 1073 439 98 147 ----
NM_006352chr121432 646 ------
NM_006380chr1784302 3933 1659 1000 957 293 164 153 23001 468 23174 430 11371
NM_006390chr12------11703
NM_006407chr351207 1010 524 45 28 ------
NM_006421chr81101 ------
NM_006449chr282182 1654 1622 873 675 529 272 90 ------
NM_006496chr121404 1259 1760 11956 --
NM_006504chr1032774 2488 2131 ------
NM_006538chr294160 4071 3355 2991 1383 1342 1090 1008 301 --1436 --
NM_006544chr1425385 4547 23745 2447 22019 544 --
NM_006546chr1765478 4504 4131 1728 579 116 --14635 --
NM_006557chr9--1248 21535 361 --
NM_006558chr8----1476 --
NM_006599chr1631464 974 930 26164 172 38277 3011 1165 --
NM_006620chr653456 3362 1292 349 67 --31813 1789 1727 --
NM_006644chr131243 --1158 --
NM_006646chr1352189 1201 871 326 290 12951 --11209
NM_006667chrX----3465 255 212 --
NM_006670chr62608 459 ------
NM_006717chr943169 3016 2977 2812 ------
NM_006726chr41147 --1209 --
NM_006742chr1631946 1575 1380 --1357 --
NM_006749chr85986 876 508 255 171 ------
NM_006750chr16105955 5742 3028 2624 2477 2363 2013 1322 446 377 15383 ----
NM_006756chr8----1164 --
NM_006775chr632571 898 568 12909 ----
NM_006788chr1851894 1816 1725 719 674 --1574 --
NM_006800chrX2495 218 --1152 --
NM_006802chr141129 839 157 105 ------
NM_006811chr202709 289 1371 ----
NM_006826chr23356 207 140 21123 198 1941 --
NM_006852chr1762505 2379 927 810 348 324 21835 952 ----
NM_006861chr1221631 450 --31445 638 35 --
NM_006896chr71767 --11038 --
NM_006908chr731434 1142 444 --21284 411 --
NM_006912chr12564 518 --136 168
NM_006948chr2112489 ------
NM_006950chrX2836 349 ------
NM_006981chr92186 122 ------
NM_007005chr92995 115 ------
NM_007008chr24644 329 299 97 --1763 --
NM_007054chr522693 1387 --23798 3021 --
NM_007124chr621940 1538 11917 11655 --
NM_007125chrY21084 337 ------
NM_007146chr1722886 705 ------
NM_007150chrX42088 1723 1481 424 --11784 --
NM_007159chr321539 129 ------
NM_007174chr1231483 490 40 --1228 --
NM_007175chr873526 2800 2415 1072 847 488 375 --1917 --
NM_007189chr761318 1180 1003 341 303 288 --31483 1427 594 --
NM_007212chr1------1460
NM_007246chr42858 241 --1256 --
NM_007247chr172822 163 1885 --1293
NM_007249chr1367501 7071 5883 3034 1457 820 23744 3124 39004 2097 770 13101
NM_007276chr7--11058 1210 --
NM_007282chr3189 --1688 --
NM_007358chr141688 1398 453 45 1706 ----
NM_007361chr141138 --1570 --
NM_012095chr1043278 3246 3217 534 --1306 1674
NM_012157chr31146 ----1832
NM_012158chr13----21138 69 --
NM_012214chr295645 4980 4655 2308 2236 2131 1628 1617 113 35251 1102 489 14225 14525
NM_012215chr1031950 300 192 --11340 --
NM_012218chr1992917 2850 2598 2262 2021 996 876 848 261 ------
NM_012234chr353751 2974 1339 1327 1084 ----12739
NM_012262chr145244 5042 3417 889 14014 1534 --
NM_012281chr722119 91 ----1645
NM_012297chr412642 11023 --12322
NM_012300chr512495 ----1928
NM_012301chr762048 1664 1474 776 620 283 21968 1566 21841 871 --
NM_012302chr13485 319 148 ------
NM_012328chr72431 373 ------
NM_012329chr172565 536 --21138 659 --
NM_012399chr222211 115 --11469 11837
NM_012434chr611384 ------
NM_012479chr772611 2448 2289 1068 932 585 244 --145 --
NM_013230chrY--1632 --11463
NM_013231chr1423552 3505 ------
NM_013233chr211046 ------
NM_013246chr111925 1795 ----
NM_013261chr453107 2974 2546 1072 822 13752 23460 867 --
NM_013279chr1141725 1438 839 95 --12079 --
NM_013309chr1522325 1628 --22297 42 12239
NM_013316chr72918 394 1958 1938 --
NM_013374chr322536 120 1201 ----
NM_013392chr2156 --1379 --
NM_013396chr2121067 161 1280 ----
NM_013437chr821205 281 --1272 --
NM_013446chr741416 1397 1172 1154 ------
NM_013943chr132245 110 78 12437 11189 --
NM_013952chr252387 2130 1982 1952 969 --2777 78 --
NM_013995chrX42422 475 361 94 1848 ----
NM_014011chr271045 1009 771 736 547 526 430 --22301 1682 --
NM_014016chr32314 254 --11397 --
NM_014034chr631224 1188 121 ----1962
NM_014106chr1532371 622 400 --12292 12836
NM_014112chr845316 4780 4368 721 34879 4470 1673 44439 3482 2000 785 --
NM_014117chr1652616 945 710 456 232 --12707 --
NM_014157chr1643616 3190 3128 950 --23036 859 --
NM_014240chr363893 3334 3311 3082 1639 512 ------
NM_014263chr1011030 2378 61 ----
NM_014278chr42360 189 ------
NM_014283chr1----11522 165
NM_014289chrX3579 360 170 11334 11417 --
NM_014294chr821386 1284 --11302 --
NM_014325chr1231582 614 186 1468 1854 --
NM_014342chr11----134 --
NM_014363chr1341072 911 427 112 --1871 --
NM_014372chr131949 630 136 21563 1311 --11605
NM_014382chr3140 --11510 --
NM_014388chr165458 4514 4303 4276 3771 2262 14888 ----
NM_014423chr555145 4143 2139 1783 221 13725 13762 --
NM_014445chr311856 --1375 --
NM_014480chr191649 --1588 --
NM_014494chr1642079 1836 665 77 --1632 --
NM_014521chr21194 11811 11402 --
NM_014552chr231125 132 71 ------
NM_014575chr3----1351 --
NM_014600chr241096 500 165 133 --21641 1434 --
NM_014603chr171683 --11623 --
NM_014612chr921186 189 --178 --
NM_014613chr542992 2667 879 411 ------
NM_014633chr111516 ----1249
NM_014634chr2263467 3377 3073 2824 563 456 1870 1977 --
NM_014636chr974161 3797 1668 1445 1121 919 218 --13622 --
NM_014646chr1883244 2847 2500 2155 1181 566 440 180 --12252 --
NM_014647chr16----1615 --
NM_014663chr11894 --1171 --
NM_014665chr893410 3247 3232 2782 2671 2653 2508 1434 1252 --32798 166 38 --
NM_014666chr521061 826 ------
NM_014667chr341753 1642 1626 717 --22334 761 --
NM_014683chr17197 ------
NM_014702chr612858 2500 446 13120 --
NM_014705chr711739 11535 ----
NM_014711chr162774 414 ------
NM_014730chr1245309 5167 1951 1031 1497 11887 --
NM_014751chr842100 1468 738 723 1423 ----
NM_014752chr1121763 1713 --1203 --
NM_014755chr234274 3954 1276 --2755 573 --
NM_014757chr52957 895 --21920 844 --
NM_014762chr171932 1628 987 925 865 688 321 --1413 --
NM_014764chr12195 ------
NM_014765chr162667 2597 2390 2150 1652 635 11880 ----
NM_014795chr21116 --11025 --
NM_014803chr1022640 2512 1691 ----
NM_014810chr133101 1275 552 --12399 --
NM_014820chr341713 1280 192 184 1658 1555 --
NM_014832chr1322115 1313 11412 ----
NM_014839chr141944 424 262 158 21960 405 1608 --
NM_014872chr942143 1576 551 242 1149 12206 --
NM_014892chr6----1562 --
NM_014893chrY1645 11623 ----
NM_014897chr1733232 2515 969 ----12386
NM_014906chr1734047 1172 375 --21253 687 --
NM_014920chr663390 2647 2469 1467 1105 706 2395 191 ----
NM_014926chr31400 ------
NM_014932chr3--143 --11594
NM_014935chr163736 2730 2532 1179 893 693 --23337 2495 --
NM_014946chr22325 24 ----1765
NM_014947chr162424 2330 2186 965 464 49 ------
NM_014949chr13987 779 111 --1183 --
NM_014950chr1411461 --1496 --
NM_014961chr41416 1850 --12235
NM_014969chr141082 752 243 223 ------
NM_014977chr142453 23 --1430 --
NM_014988chr422595 403 11718 ----
NM_014989chr631613 1336 611 11700 11328 1122
NM_014991chr493176 3112 2694 2631 2229 2047 898 872 36 ------
NM_015001chr1------149
NM_015020chr1653886 3800 3224 2583 182 --23059 2611 --
NM_015025chr262216 2117 2069 2022 942 170 ------
NM_015026chr1253580 3500 1173 675 91 11599 ----
NM_015032chr1332616 1025 319 12412 12660 --
NM_015039chr1124052 3870 2691 1536 1406 1390 1110 985 559 516 253 146 13960 ----
NM_015040chr263121 2954 2913 2731 1078 209 13061 32215 1292 821 --
NM_015045chr1011413 1249 11979 --
NM_015069chr16------1632
NM_015076chr674345 3443 3354 2789 1669 639 327 14216 ----
NM_015091chr141131 ------
NM_015092chr1643081 3004 1734 307 --21673 1010 --
NM_015094chr2294656 4585 3765 3373 1464 1293 757 452 315 --1868 --
NM_015132chr721864 1836 ------
NM_015138chr1532305 864 778 21124 647 12432 --
NM_015155chr1053165 2350 2109 613 100 --33126 3040 2497 --
NM_015156chr1453986 3551 3510 978 687 --1389 13537
NM_015161chr1631512 373 294 ------
NM_015187chr4----1703 --
NM_015192chr2052460 2331 2152 529 276 --1599 12719
NM_015199chr32907 264 --12753 --
NM_015215chr152287 2278 654 626 165 --1145 1891
NM_015265chr252472 2338 2086 2043 576 12550 1870 12078
NM_015271chr433551 3334 402 1916 1230 --
NM_015272chr1641989 1822 1713 583 ----11859
NM_015278chr663055 2880 2191 2128 394 204 ----1947
NM_015282chr2112591 2509 2458 2345 2315 2021 1970 1175 301 200 154 ------
NM_015291chr163298 3086 3035 3002 2819 1090 --13254 --
NM_015294chr172456 239 --2748 57 --
NM_015310chr8217815 7111 7066 6877 6723 6668 6133 5910 5833 5625 5369 5072 3270 3202 1773 1367 1301 1157 813 788 297 --37564 1064 399 15721
NM_015326chr11120 --1230 --
NM_015327chr141102 845 471 145 --280 23 --
NM_015328chr722192 1038 --32078 1171 170 --
NM_015335chr1242462 2284 1690 243 --1162 --
NM_015347chr1222058 906 ------
NM_015349chr642973 2137 1945 641 ------
NM_015350chr11604 ------
NM_015354chr91364 ------
NM_015355chr1731497 1286 504 ------
NM_015359chr821133 948 --12855 --
NM_015379chr71224 ------
NM_015440chr6----170 --
NM_015444chr3----191 1430
NM_015447chr92810 246 ------
NM_015455chr563787 3316 1588 1179 795 341 ----13803
NM_015475chr22944 349 ------
NM_015483chr72870 798 ------
NM_015488chr221452 374 ------
NM_015554chr1522861 2804 ------
NM_015560chr322297 1990 --12052 1478
NM_015569chr133443 3013 1499 21125 73 ----
NM_015576chr32104 80 ------
NM_015577chr511660 --21782 356 --
NM_015578chr1952060 1415 726 365 170 ----11838
NM_015630chr241164 1086 1037 41 ------
NM_015691chrX62458 2391 2299 2082 2059 618 1437 1581 --
NM_015878chr821903 36 1784 1480 --
NM_015879chr1882924 2677 2667 2649 2302 1283 702 334 --48509 6615 2216 1605 --
NM_015886chr854328 1713 1492 1413 884 ----25132 3629
NM_015904chr21585 ------
NM_015906chr114648 ------
NM_015938chr31210 ----1281
NM_016037chr13824 394 268 --1832 --
NM_016059chr6----1745 --
NM_016083chr653117 3009 2428 1384 932 ------
NM_016125chr17------1578
NM_016127chr83716 570 230 ------
NM_016132chr1552986 2963 2942 796 771 --13164 --
NM_016206chr388497 7955 7439 5988 3611 2710 2703 30 1650 ----
NM_016248chr1323698 228 1845 ----
NM_016258chr13127 119 24 ------
NM_016263chr1942807 2629 2123 599 ------
NM_016269chr41928 ------
NM_016271chr1831537 939 435 11957 ----
NM_016272chr2262537 1053 1036 967 421 277 --11073 11748
NM_016322chr922540 2185 --1828 --
NM_016374chr141407 1257 622 283 --1518 --
NM_016396chr1531879 1133 722 --2311 267 --
NM_016424chr173613 546 173 ------
NM_016441chr21266 11615 --1593
NM_016453chr33665 432 27 ------
NM_016470chr20----1401 --
NM_016529chr132787 461 11283 1218 --
NM_016530chr1583998 3838 3147 2851 2816 2575 265 24 --13851 --
NM_016531chr464119 4018 3808 3568 598 509 --13645 --
NM_016604chr511178 --11169 --
NM_016618chr21440 ------
NM_016620chr11332 11305 ----
NM_016623chr8264 27 ------
NM_016628chr101709 ------
NM_016631chr212758 296 ------
NM_017415chr564152 3647 3125 1681 1569 597 12796 24044 1709 --
NM_017420chr1431496 370 189 ------
NM_017423chr422135 2017 --1181 --
NM_017450chr1711149 --21483 301 --
NM_017544chrX3722 195 78 ------
NM_017548chr342016 1555 273 42 ----1567
NM_017590chr2261800 1709 1681 706 659 192 ------
NM_017599chr1241864 1833 407 394 ------
NM_017610chr152829 302 --158 11697
NM_017628chr483817 3582 2107 1996 1511 1443 940 111 11174 11241 --
NM_017633chr653769 3688 2834 2389 598 13123 ----
NM_017634chr841779 1736 1717 1246 1419 ----
NM_017637chr988492 6578 5787 2731 2710 2123 1809 1782 23230 2344 11397 --
NM_017672chr1511022 ------
NM_017714chr201360 --1149 --
NM_017742chr182631 118 --11733 --
NM_017758chr1751490 1447 1345 1067 551 ------
NM_017769chr1412234 --12253 --
NM_017780chr81187 ----1929
NM_017784chr3------11159
NM_017799chr1421254 629 --11572 --
NM_017824chr102950 693 --22205 25 --
NM_017848chrX13138 13820 ----
NM_017893chr103372 259 137 --1517 --
NM_017902chr1095070 4247 4083 3597 1875 1800 1435 1122 487 --14468 --
NM_017905chr132201 132 1221 ----
NM_017925chr9--1279 1574 --
NM_017926chr144857 596 585 311 ------
NM_017944chr1193071 2911 2122 1159 1140 1061 1051 776 587 --23015 668 --
NM_017964chr21267 --1277 --
NM_018013chr622233 2138 --12909 --
NM_018018chr1221772 150 ------
NM_018045chr142791 2430 1183 1009 11035 12550 --
NM_018061chr121591 110 182 ----
NM_018084chr2------1471
NM_018086chr211740 11843 21386 590 1533
NM_018110chr1641287 1227 370 48 --161 --
NM_018177chr411097 163 --1825
NM_018181chr1831580 1557 623 175 11372 --
NM_018227chr443075 2989 1080 533 ------
NM_018243chr423209 2792 147 23791 2731 --
NM_018254chr1------126
NM_018330chr103669 294 57 11415 ----
NM_018362chr1153216 3033 2745 2607 1078 ------
NM_018364chr133697 1506 456 --11580 --
NM_018370chr1242286 2211 1705 110 --41903 1781 1719 204 --
NM_018374chr715221 25059 4415 24720 150 11906
NM_018387chr91407 --1467 --
NM_018388chrX21392 110 --1510 --
NM_018388chrX21392 110 --1510 --
NM_018403chr373704 3480 3249 2968 2574 2565 630 11257 ----
NM_018433chr21439 1179 ----
NM_018440chr847417 6145 1965 620 --36299 2274 1518 --
NM_018448chr1231242 1194 1095 11180 ----
NM_018482chr812074 1378 22456 473 --
NM_018489chr132198 1750 1640 --1781 --
NM_018490chr1131605 1356 460 1265 ----
NM_018566chr133790 3495 3162 24817 3770 ----
NM_018569chr4----11317 --
NM_018639chr1241033 526 433 304 ------
NM_018685chr71331 1139 ----
NM_018710chr821352 1128 11182 ----
NM_018717chr422234 123 --12659 --
NM_018963chr212214 205 11459 ----
NM_018970chr733094 2709 2504 --22461 134 --
NM_018993chr2051260 968 507 364 117 --11224 --
NM_018999chr1074620 4398 4258 3227 798 343 227 --13375 14829
NM_019004chr72784 299 12101 12027 --
NM_019071chr72671 612 ------
NM_019072chr554115 3802 3122 2647 1545 13795 23403 714 --
NM_019080chr1311209 --1500 --
NM_019084chr1011009 ----1538
NM_019098chr831325 655 167 1254 ----
NM_019116chr1662780 1379 1358 982 211 67 ------
NM_019556chrX31230 1045 170 ----11177
NM_020122chr2105137 4915 4340 4071 3710 2123 954 728 689 386 --24276 576 --
NM_020134chr22900 72 --2886 215 --
NM_020177chr562638 2235 1261 678 655 504 1853 ----
NM_020193chr112302 148 ------
NM_020205chr133408 984 217 1100 ----
NM_020336chr2042965 2893 2571 1158 ----1927
NM_020337chr442863 1978 716 445 --1270 1124
NM_020342chr232413 624 425 ------
NM_020346chr1121718 581 11375 ----
NM_020381chr641877 592 553 385 --1235 --
NM_020382chr121287 1531 --1154
NM_020433chr2041531 559 528 59 --11789 --
NM_020647chr831644 1487 478 --2694 62 --
NM_020673chr2087508 6542 6333 5382 5091 2865 889 162 15483 17460 --
NM_020699chr131243 507 82 1516 ----
NM_020708chr2042202 875 869 623 --12138 --
NM_020718chr1655997 5071 4767 4167 1964 --26249 2240 1865
NM_020724chr442678 2001 402 176 ----11051
NM_020734chr1243393 2374 2331 505 ------
NM_020742chrX12664 11042 ----
NM_020748chr1751937 1813 1521 1325 504 ------
NM_020772chr1795778 3041 2684 1499 1300 1110 908 801 34 26541 6490 16689 11598
NM_020791chr1711265 ----11321
NM_020796chr53913 607 111 ------
NM_020801chr52661 351 ----1673
NM_020830chr21267 --13036 --
NM_020832chr11263 1621 1493 --
NM_020839chr321411 401 1435 ----
NM_020851chr1561789 1554 1516 1494 567 211 ------
NM_020856chr1951424 1335 528 214 112 --129 --
NM_020871chrX52008 1993 760 564 299 ------
NM_020872chr321322 71 ------
NM_020873chr31870 ------
NM_020899chr1732536 2316 165 ------
NM_020909chr243631 3258 2532 1637 14052 33362 1601 845 --
NM_020919chr2----2417 72 --
NM_020927chr161920 1187 2122 95 --
NM_020935chr253317 3156 1592 1093 687 11781 11622 13494
NM_020972chr46926 385 192 172 111 68 ------
NM_021033chr1383477 1068 1052 1007 918 116 84 75 --13306 --
NM_021038chr363282 3030 2993 2648 936 395 ----13350
NM_021079chr1742267 882 771 668 --12429 --
NM_021083chrX22657 569 --13601 --
NM_021132chr10----11221 --
NM_021136chr14--1580 1679 --
NM_021151chr711074 1256 2775 714 --
NM_021155chr1932078 1015 409 --11037 11184
NM_021156chr202445 331 --165 --
NM_021183chrX52045 1575 691 607 96 --12550 12368
NM_021237chr31287 ------
NM_021238chr1242003 1986 587 130 --11675 11873
NM_021252chr1042016 1906 192 92 ------
NM_021643chr21318 --11273 --
NM_021813chr645397 4762 4513 825 22149 1345 13623 --
NM_021914chr142413 269 12043 ----
NM_021943chr631455 857 107 --1151 12021
NM_021946chrX21095 90 ----1438
NM_021951chr93916 738 264 ------
NM_021956chr61288 --1417 --
NM_021960chr152761 2632 2239 899 67 --1387 --
NM_021961chr11117383 7062 6674 6646 4538 2890 2844 2444 1317 899 317 17295 ----
NM_021963chrX189 ------
NM_021964chr356416 5278 4802 4709 821 --11656 --
NM_021979chr141309 1392 ----
NM_022048chr15106007 5005 4783 4475 2411 1391 920 612 413 57 25917 1477 1638 --
NM_022062chr1131745 1412 556 ------
NM_022143chr71466 ------
NM_022166chr16136293 6246 6158 5718 5442 3953 2504 2451 2062 2033 1634 662 196 --15250 --
NM_022340chr373593 3455 2884 2671 1430 1252 993 1404 1932 --
NM_022459chr1366216 4495 879 777 468 308 11393 14044 --
NM_022469chr152802 2525 2158 1069 898 --12303 --
NM_022491chr1263521 3150 2706 2581 2476 1403 --1136 --
NM_022574chr7276 31 11397 ----
NM_022648chr264426 4220 4037 1304 1187 155 ------
NM_022720chr2231429 449 304 ------
NM_022726chr621600 576 1631 ----
NM_022735chr1------11323
NM_022763chr311098 --13175 --
NM_022781chr921009 534 ------
NM_022826chr21458 --1332 --
NM_022841chr1582555 1928 1012 518 500 421 197 123 12722 ----
NM_022893chr232747 2633 91 22695 2600 ----
NM_022898chr1454115 3952 1433 930 564 --34025 3939 989 --
NM_022912chr222511 683 --12956 --
NM_022918chr1132059 2005 1906 --1230 1471
NM_023016chr232767 1894 358 12501 11833 1679
NM_023071chr12----21127 915 --
NM_024015chr172980 320 ------
NM_024081chr111974 1245 1182 --
NM_024092chr1111004 --11188 --
NM_024102chr121209 993 1870 1173 --
NM_024106chr191316 ------
NM_024415chr51187 ------
NM_024423chr1873713 3669 3613 3164 1135 1076 666 12995 1127 --
NM_024496chr14----1797 --
NM_024556chr113377 319 155 ------
NM_024567chr8199 ------
NM_024680chr111484 ------
NM_024721chr83960 659 591 --175 --
NM_024757chr941058 197 156 147 11008 ----
NM_024761chr943549 3420 1916 699 --1889 --
NM_024762chr193741 345 66 --1370 --
NM_024769chr1121090 1064 ------
NM_024814chr7151 ------
NM_024873chr41349 --1442 --
NM_024920chr421437 279 ------
NM_025079chr12577 163 --1253 --
NM_025134chr1652471 2314 2006 442 310 11820 12491 --
NM_025138chr13--1906 --11055
NM_025146chr332699 2483 257 ------
NM_025160chr124189 507 ------
NM_025164chr1111390 22112 2096 11770 --
NM_025191chr1--11295 ----
NM_025219chr2082439 2376 1814 1553 1541 1533 1510 353 1183 172 1502
NM_025222chr372473 1956 1200 767 654 598 585 --21163 611 --
NM_025235chr101475 11547 1811 --
NM_030571chr531060 288 69 --1321 1633
NM_030579chr1633630 2460 71 ------
NM_030621chr14104180 4170 4118 3968 3582 3389 2739 1042 868 196 1430 --1447
NM_030625chr1042577 2424 2358 39 22258 828 --1753
NM_030627chr573458 3433 3253 3232 3088 3044 2957 13921 12549 --
NM_030648chr495484 4462 4437 4385 1907 1736 1494 1427 1235 1463 23403 2169 --
NM_030650chr244227 3971 954 552 --21548 633 --
NM_030751chr1051571 1416 736 539 240 --21699 1431 --
NM_030912chr10----1848 --
NM_030918chr164615 4364 3934 3507 2138 1589 --11582 15296
NM_030934chr121265 393 --168 --
NM_030939chr61761 ------
NM_030964chr553573 3460 2470 327 70 --11486 --
NM_031283chr22912 259 ------
NM_031418chr1162586 2388 724 591 388 223 --1300 --
NM_031442chrX83185 3148 2522 2309 2194 2026 772 340 --11113 --
NM_032021chr1121080 999 --1942 --
NM_032102chr1183099 2388 1938 1204 1193 791 770 636 12627 1988 --
NM_032160chr1833663 1281 1136 13561 1973 --
NM_032208chr222387 574 23358 2830 ----
NM_032228chr111985 ------
NM_032239chr431415 952 534 ------
NM_032246chr151236 ----1165
NM_032268chr1663098 2470 2386 2098 1298 1281 --22923 2776 --
NM_032312chr21176 ------
NM_032316chr362430 2376 2098 1694 695 344 11861 --11586
NM_032320chr111125 ------
NM_032352chr1411196 --11083 --
NM_032373chr1065737 4826 4110 1215 625 368 11078 --11137
NM_032440chr1062437 2189 1104 945 291 113 1191 12543 --
NM_032444chr1641117 863 339 61 ------
NM_032445chr15124 ------
NM_032458chrX53388 3126 1214 546 226 33396 2270 82 12665 --
NM_032505chr31136 12701 22712 1099 --
NM_032547chr411412 ------
NM_032557chr41642 1773 ----
NM_032632chr1441939 1874 1536 489 ------
NM_032682chr363216 2877 2860 2814 1054 394 --21460 338 13563
NM_032842chr71433 11157 --11366
NM_032873chr1134397 1371 941 11449 13119 --
NM_032885chr19----1264 --
NM_032947chr511021 ----1141
NM_032961chr421311 206 --1534 --
NM_032983chr752911 1020 765 223 40 --21353 1066 13268
NM_033133chr1773405 3134 3125 3078 1262 582 559 ------
NM_033224chr7137834 7595 6646 6431 6195 5294 2955 2944 2545 2323 2273 2214 444 37758 2519 2459 25233 2429 --
NM_033316chr31549 ------
NM_033407chr12590 123 ------
NM_033449chr552015 1969 1944 1545 635 ------
NM_033495chrX----129 --
NM_033505chr296451 6420 6105 5977 5791 5232 4512 1144 733 16697 15806 --
NM_033631chr133192 3076 2621 --13158 13895
NM_033656chr2175944 5332 4521 4267 3654 1609 342 --25469 3674 15932
NM_044472chr12490 51 --1532 --
NM_052832chr822923 2282 12613 12938 --
NM_052879chr1253843 3059 3036 2633 286 ------
NM_052896chr12550 237 ----22488 999
NM_052905chr241581 1353 1303 83 1661 1530 --
NM_052937chr832413 380 307 --1793 --
NM_052978chr1441772 1601 1494 1442 --1213 1355
NM_052998chr1----2180 137 --
NM_053025chr32715 514 --11758 --
NM_053042chr432574 127 93 ------
NM_054027chr552230 1850 568 341 26 --11416 --
NM_054035chr172856 214 --1161 --
NM_057175chr411653 --1978 --
NM_080391chr12564 551 ------
NM_080415chr173988 769 233 1269 --1290
NM_080927chr34549 517 321 235 12784 13252 --
NM_130469chr14----1871 --
NM_130474chr111870 --2718 76 --
NM_133171chr203986 830 401 --1102 --
NM_133329chr2----191 --
NM_133367chr632977 2365 2342 --23289 132 --
NM_133446chr10----123 --
NM_133468chr722560 1615 11772 --178
NM_138286chr1931679 746 550 34200 1432 558 ----
NM_138554chr922210 1013 --1453 --
NM_138782chr51722 --1673 --
NM_138799chr252049 1649 1405 843 673 ----1459
NM_139207chr1262110 1812 1598 1533 809 435 ------
NM_139279chr273488 3037 1357 1261 1064 123 102 ----12519
NM_139283chr1211948 ------
NM_144571chr457017 6565 5468 2454 1881 35584 5572 4336 ----
NM_144604chr16168 ------
NM_144633chr32163 114 ------
NM_144664chr1132445 1848 661 183 22486 2280 --
NM_144778chr1351892 958 570 529 126 --12520 --
NM_144963chr811779 --21700 98 --
NM_145011chr102622 363 12099 ----
NM_145012chr101881 --1688 --
NM_145044chr331459 1234 89 --11484 --
NM_145277chr1----1143 --
NM_145351chr1762295 2111 2084 1077 800 227 --1512 --
NM_145753chr331485 1355 653 11629 11508 --
NM_145798chr172784 582 ------
NM_145799chrX22780 57 --13049 --
NM_145808chr762895 2693 2565 2030 2018 1241 12139 12470 --
NM_145891chr1621383 235 178 ----
NM_147161chr121082 450 ----1215
NM_147202chr932316 2099 1817 22713 1827 ----
NM_152253chr2283817 3781 3365 2799 2730 149 128 40 --13198 --
NM_152265chr131502 1422 223 ------
NM_152272chr81354 1540 31056 394 279 --
NM_152284chr81649 ------
NM_152375chr142426 835 208 194 ------
NM_152409chr521371 1116 ------
NM_152418chr831916 1626 1493 ------
NM_152437chr1221631 716 --12077 --
NM_152608chr132064 532 152 --12467 --
NM_152622chr542735 900 441 347 21324 1035 1984 --
NM_152624chr5137199 7074 5661 5314 5165 4518 2583 1931 1791 1014 685 623 179 --17002 --
NM_152641chr1252398 2299 762 656 253 --22360 2263 --
NM_152678chr33995 463 322 --1309 --
NM_152699chr363398 3092 2735 990 543 279 12551 ----
NM_152739chr731017 417 402 ------
NM_152756chr521097 1013 --13227 --
NM_152758chr82972 406 1515 ----
NM_152793chr733280 1724 412 11828 14167 --
NM_153035chr162915 2784 681 371 173 135 --1196 23215 724
NM_153184chr321249 559 ------
NM_153207chr1241471 1461 1139 557 1677 22608 47 --
NM_153260chr1521295 1137 ----11274
NM_153267chr92375 281 ------
NM_153331chr31566 1659 ----
NM_153367chr1053791 2427 1180 232 119 ------
NM_153487chr654024 3779 3710 3603 1701 --34843 1734 1555 --
NM_153687chr1251573 1360 1295 1050 489 ------
NM_170606chr751603 1348 734 624 76 ------
NM_170607chr1711562 --11338 --
NM_171999chr182766 547 ----1337
NM_172070chr212175 ------
NM_172071chr147378 6580 2932 2247 --26435 4751 --
NM_172127chr411944 --12050 --
NM_173083chr121234 1084 1211 ----
NM_173470chrX61939 1162 1019 620 395 173 ------
NM_173495chrX62066 1680 1043 761 456 351 --11604 --
NM_173519chr821625 761 2447 281 21838 136 --
NM_173531chr1933363 962 773 21354 563 ----
NM_173576chr10--11622 1818 --
NM_173797chr511254 1880 1502 11219
NM_173808chr141684 354 325 133 --1333 --
NM_173825chr352801 2131 1951 1177 297 1272 12466 --
NM_173851chr842984 1186 223 62 --13913 --
NM_173854chr132199 1688 247 ------
NM_174890chr101276 ------
NM_174934chr1133370 2258 27 --1119 --
NM_175624chr1247649 7620 1498 42 26960 4823 27632 3041 --
NM_175738chr171545 ----1611
NM_175767chr511547 --11387 --
NM_175768chr61492 --2621 54 --
NM_175854chr1321082 421 ------
NM_175866chr1--1991 1567 1539
NM_175874chr12----1149 --
NM_175884chr721328 233 ------
NM_177968chr232116 1671 452 ------
NM_178011chr1033054 2923 2902 1208 ----
NM_178123chr22195 28 ------
NM_178314chr123739 203 130 1826 ----
NM_178502chr123610 189 102 ------
NM_178505chr1042964 927 759 24 ----13604
NM_178812chr83605 321 130 --1993 --
NM_178815chr1031738 1102 426 ------
NM_178826chr122191 113 ------
NM_181291chr142555 154 ----1222
NM_181358chr151646 1626 1340 191 124 --21496 281 --
NM_181457chr211292 11346 ----
NM_181504chr521282 99 --12893 --
NM_181672chrX41732 1406 525 107 --11481 --
NM_181704chr2141386 1283 189 89 ------
NM_181715chr11359 ------
NM_181782chr642297 1952 1529 151 1512 ----
NM_181784chr232260 398 202 12277 2627 527 --
NM_182485chr453130 3024 1066 1049 674 ------
NM_182488chr13--1341 1856 --
NM_182515chr19116205 6001 5560 4764 4158 2491 1531 1344 1013 936 62 32248 1352 1273 ----
NM_182569chr17----1683 --
NM_182691chr731422 1139 989 ------
NM_182700chr761843 1495 1479 1352 749 256 --11213 --
NM_182717chr1041311 1065 990 325 ------
NM_182830chr1431961 1757 1718 ------
NM_183397chr2021717 122 --31930 135 70 --
NM_183425chr203673 297 281 1262 ----
NM_194247chr282755 1237 552 443 398 242 160 66 14410 33342 3293 1717 --
NM_194282chr442988 2802 807 412 12127 22818 2772 --
NM_194285chr1142925 2848 2603 138 12400 ----
NM_194292chr111661 ------
NM_197941chr532520 1044 706 ------
NM_198243chr151888 --1775 1649
NM_198270chrX32411 1228 758 12396 23140 209 --
NM_198459chr11711 ----1165
NM_198463chr31335 ------
NM_198465chrX1784 ------
NM_198467chr72592 198 --1407 --
NM_198506chr4------11119
NM_198513chr82733 551 --22007 1722 --
NM_198516chr111207 ------
NM_198581chr266132 5519 5191 4774 1874 1242 --21489 884 1202
NM_198859chr354169 3916 3421 3376 1640 --11619 --
NM_199320chr411843 --11173 --
NM_201280chr641566 1301 1088 310 ------
NM_203390chr82670 444 140 1364 --
NM_203394chr1222166 877 --1409 --
NM_203434chr941108 276 268 201 --1819 --
NM_203463chr264511 4041 998 917 718 74 13893 1376 --
NM_206853chr683847 3806 2952 2508 1392 756 311 270 23287 649 1843 --
NM_206854chr6105108 5067 4213 3769 3723 2017 1572 1531 631 409 24548 1910 12104 1793
NM_207396chr131806 1633 1251 ------
NM_207645chr11--31105 1091 170 --11345
NM_207647chr952080 2059 2022 161 57 1178 ----
NM_212464chr1551887 1546 1350 679 141 11407 ----
NM_212467chr1582464 2123 1927 1820 857 764 679 43 11984 2960 25 --