TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-5090
miRNA Sequence: CCGGGGCAGAUUGGUGUAGGGUG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000020chr127956 794 420 389 370 363 68 ------
NM_000034chr16241 24 ------
NM_000037chr892304 1952 1865 1839 1817 1705 1696 1606 237 12176 12282 --
NM_000038chr531555 1313 635 ------
NM_000053chr1341597 205 197 38 --1142 --
NM_000068chr1931247 604 586 1453 ----
NM_000076chr11172 127 ----
NM_000080chr173831 601 246 ------
NM_000081chr141869 531 451 247 ------
NM_000082chr51701 ------
NM_000084chrX136759 6718 5846 5560 5361 4956 4812 4585 4484 4216 1666 1519 1131 16696 15377 --
NM_000087chr4135 ------
NM_000088chr1761244 1137 948 533 364 355 ------
NM_000090chr21616 ------
NM_000094chr3170 ------
NM_000115chr132988 217 ------
NM_000125chr6154133 3920 3747 3705 2702 1457 1383 1241 1179 1128 1007 989 726 688 373 --22894 1193 --
NM_000134chr42576 427 ------
NM_000141chr103473 74 21 ------
NM_000161chr141332 ------
NM_000168chr72764 277 ------
NM_000170chr9139 ------
NM_000176chr522673 929 ------
NM_000188chr10128 --1217 --
NM_000192chr1241489 631 387 347 ------
NM_000202chrX52709 2630 2499 1496 37 ------
NM_000217chr1245039 4721 2050 1693 ------
NM_000238chr72275 75 190 ----
NM_000244chr117634 608 519 498 191 79 42 1134 ----
NM_000248chr332660 2380 203 ----12345
NM_000252chrX195 ------
NM_000259chr1565715 5006 4882 4257 4234 2406 --14964 --
NM_000264chr962065 1328 1122 1055 306 255 --1110 --
NM_000278chr10182204 1880 1837 1812 1736 1618 1602 898 887 821 812 748 583 444 431 307 239 107 1329 21803 603 --
NM_000304chr1731035 974 253 ------
NM_000314chr1023202 2662 --12905 --
NM_000318chr852744 551 427 278 106 ------
NM_000319chr1231044 264 134 ------
NM_000330chrX3832 486 233 1345 --1561
NM_000332chr696708 6486 5996 5731 2748 936 449 439 348 ------
NM_000337chr5126440 5605 5452 4961 4917 4734 4668 1628 1327 1230 1049 701 ------
NM_000353chr165834 451 376 246 31 ------
NM_000368chr994035 3916 3738 1312 1250 1241 1056 452 185 11501 ----
NM_000378chr113309 216 31 --1188 --
NM_000398chr226831 325 180 95 49 33 --1122 --
NM_000399chr103143 95 40 ------
NM_000408chr212598 ------
NM_000430chr1753033 2974 2505 2404 1342 --13055 --
NM_000434chr61207 ------
NM_000435chr194974 814 723 54 ------
NM_000445chr84875 849 376 197 1637 ----
NM_000448chr1122695 2319 ------
NM_000449chr11166 ------
NM_000451chrX82128 1631 1531 1514 1377 1371 455 42 --1113 --
NM_000452chr1332071 1713 1400 ------
NM_000458chr172624 221 ------
NM_000461chr3123625 3330 3305 3189 3155 1716 1310 1227 1208 1122 581 156 --13219 14381
NM_000462chr153473 164 109 ------
NM_000476chr941240 1120 1065 35 1460 196 1388
NM_000480chr1131603 1448 109 ------
NM_000489chrX33137 3103 2332 ------
NM_000495chrX2818 81 ------
NM_000525chr1161498 1311 1257 640 201 195 ------
NM_000530chr15717 287 278 218 113 --2418 292 --
NM_000537chr1371 39 27 ----1138
NM_000539chr351346 1334 1290 314 254 ------
NM_000555chrX127289 7008 6991 6797 5751 5688 5353 5025 2049 1953 1829 438 --1315 --
NM_000594chr62730 42 ------
NM_000597chr22300 34 ------
NM_000598chr71475 193 11312 --
NM_000599chr283760 3665 3560 3461 3236 3211 806 420 23141 49 --23309 1156
NM_000618chr12116279 5404 5328 5203 5165 4782 2648 2561 1477 1270 294 ------
NM_000618chr12116279 5404 5328 5203 5165 4782 2648 2561 1477 1270 294 ------
NM_000633chr1884590 4237 4140 2078 1253 995 696 558 21957 790 1505 --
NM_000660chr194228 101 52 22 ------
NM_000665chr7131 ------
NM_000671chr43554 197 90 ------
NM_000678chr205795 355 295 268 252 ----1311
NM_000682chr241739 1406 100 82 --31387 689 65 1724
NM_000719chr12196547 6413 6071 5939 4771 4455 4426 4224 4207 2392 2341 1386 664 423 398 267 247 223 72 ------
NM_000720chr32145 68 ------
NM_000721chr152045 1981 1720 307 223 11933 11785 1370
NM_000722chr7159 ------
NM_000723chr1781402 1314 1279 1219 1095 674 487 248 11616 --11512
NM_000725chr1261005 990 830 356 299 284 --1804 --
NM_000726chr21165 ------
NM_000757chr16842 730 666 245 215 108 --1630 --
NM_000759chr175852 802 606 241 232 --1620 --
NM_000767chr1941420 332 94 49 ------
NM_000800chr51264 11144 1431 --
NM_000806chr5190 ------
NM_000809chr449029 9013 1517 344 ------
NM_000810chr151189 ------
NM_000813chr595273 4817 4172 2175 1959 1897 1088 1073 255 ------
NM_000814chr1543936 3549 3126 1666 ------
NM_000817chr21880 ------
NM_000818chr10146 ------
NM_000826chr431812 1001 116 ------
NM_000827chr532164 2014 175 1844 ----
NM_000829chr1112159 164 ----
NM_000831chr1276093 6004 5781 5729 5599 5570 5392 5238 5197 5110 4396 4389 3974 3915 3907 2178 1763 1637 1259 1182 1064 570 326 285 261 140 80 15792 14443 --
NM_000832chr95831 733 562 256 239 --1684 --
NM_000836chr192990 691 ------
NM_000837chr85436 374 128 99 57 1482 ----
NM_000841chr65847 745 590 364 252 --2807 774 --
NM_000842chr111580 ------
NM_000844chr32916 274 ------
NM_000845chr72429 363 ------
NM_000868chrX1620 ------
NM_000870chr561423 1408 1097 527 515 37 ------
NM_000875chr15125890 5513 5169 2372 1593 1494 1484 720 674 417 306 126 1904 26262 852 --
NM_000880chr81195 ------
NM_000883chr78534 514 492 478 267 257 196 161 --2559 214 --
NM_000883chr78534 514 492 478 267 257 196 161 --2559 214 --
NM_000899chr1214338 ------
NM_000901chr432370 1708 537 ------
NM_000908chr51178 ------
NM_000909chr4124 ------
NM_000918chr174597 560 317 87 ------
NM_000924chr12101344 1239 1192 1162 1151 1123 967 459 382 87 ------
NM_000935chr32964 259 ------
NM_000939chr2----173 --
NM_000942chr15145 ------
NM_000944chr441870 1666 671 100 ------
NM_000949chr52145 126 ------
NM_000960chr194772 741 534 260 --132 --
NM_000961chr20123835 3325 3030 2896 2870 2557 2486 555 334 249 58 48 --11258 --
NM_000963chr132444 1631 1569 ------
NM_000964chr17121223 1210 1192 1044 971 928 386 285 198 102 88 41 --1420 11305
NM_000965chr311056 ------
NM_000966chr1271019 679 430 281 202 156 100 1821 1215 --
NM_001001132chr2111147 ------
NM_001001323chr122652 138 ------
NM_001001331chr322386 1807 --11045 --
NM_001001342chr1011057 ------
NM_001001395chr1252607 2086 1797 172 60 ------
NM_001001433chr2052734 2344 850 472 70 198 ----
NM_001001438chr213386 286 76 ------
NM_001001481chr822818 2612 ------
NM_001001484chr1032442 2356 174 1980 12124 --
NM_001001502chr54450 232 46 40 --2547 53 --
NM_001001522chr114365 169 103 73 ------
NM_001001523chr141097 938 526 24 ------
NM_001001549chr752547 2268 2229 1012 824 --1339 --
NM_001001550chr752547 2268 2229 1012 824 --1339 --
NM_001001555chr752547 2268 2229 1012 824 --1339 --
NM_001001557chr84874 656 550 409 --1700 --
NM_001001664chr214035 --12615 --
NM_001001665chr231343 473 213 ------
NM_001001694chr22102312 2248 2187 1677 1655 1542 430 361 280 28 21664 230 ----
NM_001001890chr2192716 2606 1693 1388 1378 465 218 101 29 11362 ----
NM_001001971chr10------1961
NM_001001974chr1042325 835 115 29 ----1540
NM_001002233chr821552 54 1101 ----
NM_001002259chr124330 295 216 74 ------
NM_001002762chr1092858 2824 2812 2337 1031 260 149 81 50 22834 621 2953 408 --
NM_001002814chr883385 3320 3296 3177 3115 2951 1552 54 1101 12635 --
NM_001002838chrX1698 ------
NM_001002860chr1433209 1081 514 ------
NM_001002909chr1752108 1906 1636 1544 218 ------
NM_001003407chr10105046 5015 5006 4864 4125 4103 826 761 360 51 --1525 --
NM_001003408chr10105046 5015 5006 4864 4125 4103 826 761 360 51 --1525 --
NM_001003652chr1888665 7358 7285 7270 5563 2813 2448 272 13409 12320 --
NM_001003674chr18106923 6161 5826 4929 4912 4854 2524 2355 1135 969 ------
NM_001003675chr18106923 6161 5826 4929 4912 4854 2524 2355 1135 969 ------
NM_001003676chr115247 217 146 63 25 ------
NM_001003688chr4121 ------
NM_001003694chr32558 153 --134 --
NM_001003712chr12------11387
NM_001003800chr982830 2744 1480 1423 1387 1295 348 304 1599 11316 --
NM_001003809chr183246 74 40 ------
NM_001004051chrX--151 ----
NM_001004304chr12133058 3039 3026 3019 2893 2741 2365 2284 2084 1259 1249 941 102 --12405 --
NM_001004317chr643295 1714 661 587 ----13052
NM_001004342chr1165570 5265 5072 4574 4149 3974 2418 2239 2177 1990 1925 1868 806 605 453 423 1466 11782 11175
NM_001004354chr97751 411 253 162 140 97 30 ------
NM_001004356chr451503 1125 1089 1054 219 ------
NM_001004358chr451503 1125 1089 1054 219 ------
NM_001004360chr221708 82 ------
NM_001004419chr1244277 1811 1782 1015 ------
NM_001004439chr1571190 1009 859 455 310 192 150 ------
NM_001004720chr21675 194 ----
NM_001004722chr23844 179 163 1263 ----
NM_001005271chr1741074 1055 134 34 ------
NM_001005273chr1741074 1055 134 34 ------
NM_001005291chr172383 50 ------
NM_001005366chr122737 670 ------
NM_001005377chr19152 --125 --
NM_001005386chr231969 1696 107 ------
NM_001005404chr17104069 3998 3749 3593 3358 1239 1229 966 755 722 1611 ----
NM_001005415chr191460 ------
NM_001005416chr191460 ------
NM_001005463chr1052441 2355 2260 2028 395 ------
NM_001005473chr545744 5046 1719 369 --35973 2406 774 --
NM_001005505chr3101704 1657 1163 513 455 383 360 231 92 69 1132 ----
NM_001005609chrX143577 3540 3330 3266 2578 1540 1377 1321 1100 799 759 411 122 31 ------
NM_001005743chr141395 ------
NM_001005744chr141395 ------
NM_001005745chr141395 ------
NM_001005746chr21165 ------
NM_001005747chr21165 ------
NM_001005782chr2--1339 ----
NM_001005909chr3142 ------
NM_001005920chr162862 403 ------
NM_001006115chr3152780 2149 2133 2071 2017 1930 1882 1020 964 872 502 372 350 296 264 ------
NM_001006600chr52898 396 ------
NM_001006605chr13944 211 198 ------
NM_001006605chr13944 211 198 ------
NM_001006617chr961118 1092 1062 1029 907 63 ------
NM_001006619chr961118 1092 1062 1029 907 63 ------
NM_001006620chr961118 1092 1062 1029 907 63 ------
NM_001006621chr961118 1092 1062 1029 907 63 ------
NM_001006623chr221702 277 --12035 --
NM_001006658chr12296 26 ------
NM_001006932chr6103043 2254 1340 864 792 718 691 623 153 65 --33204 2500 2259 --
NM_001006933chrX151 ------
NM_001006944chr115674 510 483 290 255 ------
NM_001006946chr251305 781 79 55 29 ------
NM_001007098chr12241 71 ------
NM_001007156chr1581707 1697 1553 663 471 385 219 194 --21735 134 --
NM_001007233chr51701 ------
NM_001007237chr132513 2095 166 ------
NM_001007257chr111217 ------
NM_001007273chr10156 ------
NM_001007277chr11--145 ----
NM_001007466chr644176 3663 3180 1061 11522 24125 67 --
NM_001007538chr134569 532 274 125 ------
NM_001007559chr1821866 1730 ------
NM_001008220chr5183903 3766 3713 3647 3640 3626 3546 3205 2638 2618 2584 1062 862 502 370 336 311 117 --22508 477 --
NM_001008222chrX61177 1128 1102 1069 245 98 1961 ----
NM_001008223chr123621 599 21 ------
NM_001008225chr71710 ------
NM_001008239chr1853508 3283 2393 618 581 ------
NM_001008392chr393326 3222 3049 2706 1414 1123 586 339 108 ------
NM_001008410chr252172 2154 1469 1463 651 12056 11864 151
NM_001008495chr821394 779 ------
NM_001008529chr1771175 1153 532 455 257 221 178 --1262 --
NM_001008539chr855106 4699 3816 1267 420 ------
NM_001008541chr1042240 1781 819 721 ------
NM_001008541chr1042240 1781 819 721 ------
NM_001008564chr131839 ------
NM_001008567chr92335 87 ------
NM_001008701chr1992778 2663 2412 2051 663 654 526 432 121 --42385 2099 1204 638 --
NM_001008711chr831653 74 49 ------
NM_001008726chr1411596 1278 ----
NM_001008777chr171229 ------
NM_001008801chr1911572 ------
NM_001008925chr423555 2926 --12948 --
NM_001008938chr11--1400 ----
NM_001009184chr85436 374 128 99 57 1482 ----
NM_001009554chr463813 3715 2903 1377 352 48 --1738 --
NM_001009554chr463813 3715 2903 1377 352 48 --1738 --
NM_001009566chr121130 271 --11331 --
NM_001009598chr1--122 ----
NM_001009955chr12502 118 ------
NM_001009955chr12502 118 ------
NM_001009993chr254197 4084 3187 1727 1659 ------
NM_001010846chr194613 4271 4032 3795 2980 1569 545 490 22 ------
NM_001010854chr14147 ------
NM_001010861chr11206 ------
NM_001010867chr1156476 6395 5871 5664 5655 5481 5250 4708 4095 2601 2130 2093 2067 1887 114 11421 31798 1711 151 11696
NM_001010888chrX44509 3971 1863 285 13880 ----
NM_001010891chr556674 5503 5447 5372 5193 --24564 2748 --
NM_001010908chr101485 ------
NM_001010926chr13581 95 53 ----1688
NM_001010938chr311676 305 297 271 222 215 193 160 116 107 79 --2763 165 --
NM_001011513chr413937 1117 ----
NM_001011537chr321952 421 --11465 1176
NM_001011553chr71625 ------
NM_001011658chrX41398 1372 612 363 ------
NM_001011666chr746029 4509 4443 1716 ------
NM_001011708chr232803 1179 344 11112 ----
NM_001011713chr141406 ------
NM_001011885chr1511719 ------
NM_001012329chr172277 2210 1937 1813 770 317 94 --1126 --
NM_001012338chr15253 38 ------
NM_001012393chr11104732 4607 4585 4160 3546 3473 2022 1501 483 257 --11948 --
NM_001012415chr93808 282 207 1705 ----
NM_001012420chr1541035 951 480 272 ------
NM_001012423chr1541035 951 480 272 ------
NM_001012426chr6133341 3238 3181 3140 2908 2653 2627 2460 1232 1072 541 454 276 --2598 517 --
NM_001012427chr6133341 3238 3181 3140 2908 2653 2627 2460 1232 1072 541 454 276 --2598 517 --
NM_001012614chr43152 94 24 --1192 --
NM_001012754chr1351890 1797 1567 1406 162 --1274 --
NM_001012755chrX61724 1493 1295 1176 1054 481 ------
NM_001012756chr1933242 2448 2422 ------
NM_001012761chr572522 2286 2271 506 492 406 243 --2798 473 --
NM_001012974chr6279 58 ----146
NM_001012977chrX31156 415 280 ------
NM_001012989chrX1560 ------
NM_001013031chr1053327 2401 940 709 681 ------
NM_001013398chr71475 193 11312 --
NM_001013415chr421350 53 ------
NM_001013620chr1267972 6416 5980 2936 2860 999 --13073 --
NM_001013622chr44766 758 233 97 --6481 419 358 172 111 49 --
NM_001013635chr1231146 891 235 ------
NM_001013690chr1292224 1969 1850 1804 1662 899 886 469 454 ------
NM_001013693chr172548 2284 1857 1828 1131 1004 623 12675 ----
NM_001013693chr172548 2284 1857 1828 1131 1004 623 12675 ----
NM_001013839chr1782049 1619 989 926 670 312 141 74 --11689 --
NM_001014283chr1331476 461 367 ------
NM_001014431chr144731 371 346 54 ------
NM_001014432chr144731 371 346 54 ------
NM_001014434chr11292 ------
NM_001014435chr165574 542 411 239 128 --1190 --
NM_001014442chr132131 43 ------
NM_001014445chr174994 769 737 721 --1791 1980
NM_001014794chr112231 89 ------
NM_001014795chr112231 89 ------
NM_001014797chr1047713 7658 6705 662 12805 ----
NM_001014809chr43799 290 195 ------
NM_001014831chr193719 678 529 --1108 1791
NM_001014832chr193719 678 529 --1108 1791
NM_001014834chr193719 678 529 --1108 1791
NM_001014835chr193719 678 529 --1108 1791
NM_001014839chr14771 422 369 240 --1384 --
NM_001014841chr14771 422 369 240 --1384 --
NM_001014987chr164458 174 108 102 --1221 --
NM_001014988chr164458 174 108 102 --1221 --
NM_001014989chr164458 174 108 102 --1221 --
NM_001015048chr1433143 2061 1100 ------
NM_001015049chr1433143 2061 1100 ------
NM_001015877chrX11014 --1825 --
NM_001015881chrX2337 258 ------
NM_001015887chr331168 181 46 ------
NM_001017395chr3102960 2853 2777 2552 2452 2272 1207 1011 959 588 --12397 11080
NM_001017396chr241766 1631 1601 444 ------
NM_001017440chr7207836 7439 7351 6643 6408 6181 5942 5563 5220 5114 2888 2844 2517 2348 2090 1993 1969 1957 1477 572 12713 32757 2077 1931 --
NM_001017523chr122129 120 ------
NM_001017916chr1761616 1526 715 232 80 49 ------
NM_001017917chr1761616 1526 715 232 80 49 ------
NM_001017923chr1421316 438 ------
NM_001017926chr821569 393 ------
NM_001017961chr11153 ------
NM_001017979chr43714 147 38 ------
NM_001017995chr5194382 4154 4026 3774 3669 3045 1649 1426 1289 1265 1149 1044 849 728 697 641 550 430 135 21335 679 61684 1664 1659 1654 1200 877 --
NM_001017999chr12535 473 ------
NM_001017999chr12535 473 ------
NM_001018000chr12535 473 ------
NM_001018000chr12535 473 ------
NM_001018001chr12535 473 ------
NM_001018005chr15150 ------
NM_001018024chrX122 ------
NM_001018025chrX2706 32 ----1352
NM_001018050chr22153109 3065 2812 2510 2436 2371 1365 1224 1076 1022 862 854 775 670 170 22192 1291 1148 --
NM_001018052chr22153109 3065 2812 2510 2436 2371 1365 1224 1076 1022 862 854 775 670 170 22192 1291 1148 --
NM_001018054chr12974 26 ------
NM_001018072chr122129 120 ------
NM_001018074chr522673 929 ------
NM_001018075chr522673 929 ------
NM_001018076chr522673 929 ------
NM_001018077chr522673 929 ------
NM_001018108chr1571927 1750 1433 780 580 332 32 --21771 796 22149 125
NM_001018111chr753230 878 571 447 117 ------
NM_001020658chr121052 115 --1229 --
NM_001020658chr121052 115 --1229 --
NM_001020825chr51148 ------
NM_001022chr19131 ------
NM_001023567chr1551718 959 482 272 184 ------
NM_001023587chr32148 60 ----1743
NM_001024024chr141159 ------
NM_001024071chr141127 ------
NM_001024094chr522673 929 ------
NM_001024226chr13759 93 34 ------
NM_001024227chr13759 93 34 ------
NM_001024228chr13759 93 34 ------
NM_001024401chr16152531 2519 2505 2296 2252 1911 1875 1844 1833 932 860 583 469 391 371 32851 680 48 ----
NM_001024455chrX112254 2247 2240 1679 781 656 532 434 421 228 79 ------
NM_001024649chr582771 2476 2270 1914 1880 977 832 462 ------
NM_001024660chr31560 ------
NM_001024666chrX5535 488 113 103 62 --1477 --
NM_001024668chr123746 336 240 ------
NM_001024808chr12122507 2394 2292 2109 1834 1035 1028 832 546 490 431 74 --11060 --
NM_001024809chr17121223 1210 1192 1044 971 928 386 285 198 102 88 41 --1420 11305
NM_001024845chr111944 858 822 777 717 376 370 165 103 90 43 ----1327
NM_001024858chr1483022 2926 2579 2391 1824 745 210 193 ------
NM_001024937chr173604 218 25 ------
NM_001024948chr143396 2614 2297 332 --22638 238 --
NM_001024959chr35871 818 803 675 181 ------
NM_001024960chr35871 818 803 675 181 ------
NM_001025076chr1094900 4841 4832 4808 4485 2303 1329 120 87 --12227 --
NM_001025077chr10116258 6199 6190 6166 5843 2687 1478 1445 1170 885 151 ----1413
NM_001025079chr311593 --21123 378 --
NM_001025081chr1851120 1078 261 219 75 11394 ----
NM_001025090chr1851120 1078 261 219 75 11394 ----
NM_001025092chr1851120 1078 261 219 75 11394 ----
NM_001025101chr1851120 1078 261 219 75 11394 ----
NM_001025107chr162678 2330 2149 1940 1662 851 ------
NM_001025107chr162678 2330 2149 1940 1662 851 ------
NM_001025201chr2170 ------
NM_001025266chr394318 3825 3799 1692 1666 695 608 108 27 13545 23871 537 --
NM_001025366chr631484 683 580 ------
NM_001025366chr631484 683 580 ------
NM_001025367chr631484 683 580 ------
NM_001025367chr631484 683 580 ------
NM_001025368chr631484 683 580 ------
NM_001025368chr631484 683 580 ------
NM_001025369chr631500 699 596 ------
NM_001025369chr631500 699 596 ------
NM_001025370chr631484 683 580 ------
NM_001025370chr631484 683 580 ------
NM_001025389chr1131603 1448 109 ------
NM_001025390chr1131603 1448 109 ------
NM_001025579chr1711960 932 879 404 253 243 192 180 174 118 75 ------
NM_001025580chrX43666 3145 738 389 ------
NM_001025595chr411648 --11270 --
NM_001025603chr11166 ------
NM_001025616chr42756 181 ------
NM_001025780chr931154 1025 999 ------
NM_001029858chr663347 3064 2570 1304 946 838 ------
NM_001029863chr622772 2456 ------
NM_001029875chr572584 2031 2025 781 259 145 135 ------
NM_001029882chr14501 131 119 111 ------
NM_001029882chr14501 131 119 111 ------
NM_001029891chrX4769 63 55 25 ------
NM_001029896chrX1276 ------
NM_001029998chr44923 455 366 91 ------
NM_001030007chr1673793 3023 2749 1011 914 525 389 ------
NM_001030055chr1413207 ------
NM_001030272chr111193 ------
NM_001030273chr111193 ------
NM_001031680chr191776 1733 969 943 937 512 410 224 81 174 11706 --
NM_001031685chr11369 --1239 --
NM_001031690chr782753 1974 1924 1176 1121 805 573 407 1365 1846 --
NM_001031695chr22105415 4845 4481 4040 1896 1768 1732 1381 1195 1058 21957 1369 ----
NM_001031702chr32754 684 ------
NM_001031716chr2143 ------
NM_001031732chr423189 503 ------
NM_001031738chr22445 173 ------
NM_001031740chr141115 264 134 79 1147 ----
NM_001031812chr522151 1452 --1670 --
NM_001032221chr991588 1406 1279 690 157 114 105 95 48 ------
NM_001032280chr651490 252 174 144 76 1220 ----
NM_001032288chr202567 545 ------
NM_001032289chrX4762 188 169 105 ------
NM_001032296chr1362519 2426 1181 806 717 658 12511 ----
NM_001032363chr151926 1794 1539 783 375 --21514 73 --
NM_001032363chr151926 1794 1539 783 375 --21514 73 --
NM_001033025chr131510 515 408 ------
NM_001033044chr121791 406 --1551 180
NM_001033045chr234366 3011 144 ------
NM_001033056chr121791 406 --1551 180
NM_001033081chr121179 403 ------
NM_001033082chr121179 403 ------
NM_001033087chr2053170 2073 654 503 284 ------
NM_001033117chr3124784 4761 4499 4466 4434 4104 1936 1736 1424 810 749 705 11671 11544 --
NM_001033507chr121772 613 ------
NM_001033551chr17143355 2978 2586 2555 2532 2525 1373 1367 1248 1033 944 414 363 139 ------
NM_001033557chr21565 ------
NM_001033561chr172814 332 ------
NM_001033566chr17121 ------
NM_001033568chr17121 ------
NM_001033578chr822013 100 ------
NM_001033602chr13122677 2628 2547 2481 2424 2418 2352 2240 2193 1825 92 28 --1162 12205
NM_001033677chr122388 69 ------
NM_001033723chr822332 1005 32068 851 33 148 --
NM_001033756chr631418 617 514 ------
NM_001033756chr631418 617 514 ------
NM_001033925chr1021990 1486 ------
NM_001034837chr53740 276 72 ------
NM_001034838chr53740 276 72 ------
NM_001034850chr521498 649 ------
NM_001034954chr1062395 2061 741 494 343 333 ----1635
NM_001034955chr1062395 2061 741 494 343 333 ----1635
NM_001034956chr1062395 2061 741 494 343 333 ----1635
NM_001034957chr1062395 2061 741 494 343 333 ----1635
NM_001035003chr4----11337 --
NM_001035004chr4----11337 --
NM_001035254chr9162513 2121 2102 2087 2003 1880 1819 1732 967 893 824 642 551 404 164 116 11715 2476 460 --
NM_001035256chr2----173 --
NM_001035267chr12----1206 --
NM_001035521chr22586 129 --1750 --
NM_001037164chr7196 ------
NM_001037290chr111325 ------
NM_001037317chr11206 ------
NM_001037324chr36494 303 294 194 188 171 ------
NM_001037331chr181927 --1266 --
NM_001037334chr181203 ------
NM_001037553chr21154832 4759 4575 3709 3661 3651 3615 3564 3444 3340 1629 1067 638 508 456 133 1588 --
NM_001037582chr461546 620 590 544 453 315 1422 ----
NM_001037872chr2----1613 --
NM_001038493chr23406 319 25 ------
NM_001038640chr1521024 339 ------
NM_001038707chr191628 1569 1444 826 709 446 262 138 71 ------
NM_001038707chr191628 1569 1444 826 709 446 262 138 71 ------
NM_001039140chr204409 213 171 54 --123 --
NM_001039141chr22112468 2433 2290 2060 1040 1003 694 562 537 447 385 11097 12151 --
NM_001039199chr2073198 1633 1534 1037 704 206 95 --24738 4236 --
NM_001039457chr13224 75 28 ------
NM_001039459chr76838 724 395 320 147 24 1189 ----
NM_001039479chr1492372 1755 569 528 467 366 323 175 120 ------
NM_001039548chr11167 --1166 --
NM_001039550chr21746 ------
NM_001039574chr181062 1005 986 949 912 887 383 316 --1993 --
NM_001039583chr224417 360 128 120 --1435 --
NM_001039584chr224417 360 128 120 --1435 --
NM_001039590chrX33061 2473 377 ------
NM_001039591chrX33061 2473 377 ------
NM_001039618chr1195816 5314 5027 4386 545 508 478 427 246 ------
NM_001039619chr14151 ------
NM_001039690chr1651788 1566 826 667 534 1817 153 --
NM_001039771chr1471168 1078 879 831 312 65 55 ------
NM_001039775chr1127 ------
NM_001039802chr11366 --1118 --
NM_001039840chrX65998 5681 3855 1683 769 568 ------
NM_001039877chr195850 642 610 237 82 --121 1258
NM_001039916chr121480 ------
NM_001039917chr121480 ------
NM_001039918chr121480 ------
NM_001039919chr121480 ------
NM_001039920chr121480 ------
NM_001039960chr124620 492 110 42 ------
NM_001040056chr165690 562 495 222 211 ------
NM_001040100chr31356 ------
NM_001040108chr1451320 928 433 112 51 22974 92 ----
NM_001040110chr771867 1309 1236 695 573 557 226 11379 ----
NM_001040113chr161912 ------
NM_001040134chr19101424 1305 1294 1244 1178 1033 590 540 463 425 --1599 --
NM_001040144chr1651788 1566 826 667 534 1817 153 --
NM_001040146chr1651788 1566 826 667 534 1817 153 --
NM_001040152chr765044 4461 3526 1180 81 55 ------
NM_001040172chr561423 1408 1097 527 515 37 ------
NM_001040173chr561423 1408 1097 527 515 37 ------
NM_001040214chr61534 ------
NM_001040260chr461157 979 882 873 780 64 ------
NM_001040261chr461157 979 882 873 780 64 ------
NM_001040402chr422865 2682 ------
NM_001040424chr2172772 2670 2601 1915 919 844 277 ------
NM_001040429chr1311233 ------
NM_001040439chr1671442 1267 1257 936 923 581 438 --1398 --
NM_001040451chr52471 447 ------
NM_001040452chr52471 447 ------
NM_001040624chr852637 2513 2430 2132 2003 ------
NM_001040625chr852637 2513 2430 2132 2003 ------
NM_001040626chr852637 2513 2430 2132 2003 ------
NM_001040627chr852637 2513 2430 2132 2003 ------
NM_001040628chr852637 2513 2430 2132 2003 ------
NM_001040629chr852637 2513 2430 2132 2003 ------
NM_001040630chr852637 2513 2430 2132 2003 ------
NM_001040708chr821023 330 ------
NM_001040712chr913033 ----13276
NM_001040715chr166801 400 355 237 168 31 ------
NM_001040876chr43410 337 93 ------
NM_001042355chr16105026 4570 4512 3585 3442 3436 1546 646 166 137 ------
NM_001042403chr12--11035 ----
NM_001042404chr121751 388 ------
NM_001042406chr61435 ------
NM_001042412chr16105026 4570 4512 3585 3442 3436 1546 646 166 137 ------
NM_001042413chr962591 928 438 413 190 114 ------
NM_001042425chr651490 252 174 144 76 1220 ----
NM_001042430chr143489 180 116 ------
NM_001042472chr203498 83 38 --1469 --
NM_001042486chr2051556 1518 1230 1143 406 21320 1263 11453 --
NM_001042494chr1573671 3575 3456 2618 2592 1187 936 11301 ----
NM_001042495chr1573671 3575 3456 2618 2592 1187 936 11301 ----
NM_001042496chr1573671 3575 3456 2618 2592 1187 936 11301 ----
NM_001042497chr1573671 3575 3456 2618 2592 1187 936 11301 ----
NM_001042506chrX2415 280 --11329 --
NM_001042537chrX21712 544 ------
NM_001042539chr1661038 1012 962 931 398 362 1764 ----
NM_001042555chr1234274 3154 1035 ------
NM_001042599chr297773 5794 5630 5256 4839 4786 2979 689 41 ------
NM_001042603chr1243955 1799 1451 487 1978 ----
NM_001042610chr16111351 1268 1236 1212 1177 1100 1093 934 572 433 245 2306 156 --11190
NM_001042632chr2061573 994 852 700 584 464 --1233 12364
NM_001042633chr2061573 994 852 700 584 464 --1233 12364
NM_001042663chr171376 1324 1197 1005 521 92 56 --21120 334 --
NM_001042664chr171376 1324 1197 1005 521 92 56 --21120 334 --
NM_001042665chr171376 1324 1197 1005 521 92 56 --21120 334 --
NM_001042669chr42756 181 ------
NM_001042681chr13862 825 388 12346 ----
NM_001042682chr13862 825 388 12346 ----
NM_001042682chr13862 825 388 12346 ----
NM_001042728chr1271019 679 430 281 202 156 100 1821 1215 --
NM_001043318chr14143514 2861 2717 1382 1358 1339 1033 1003 919 721 630 493 425 104 --1782 --
NM_001043351chr181895 1643 1506 782 743 700 172 30 ------
NM_001044722chr522151 1452 --1670 --
NM_001044723chr522151 1452 --1670 --
NM_001046chr51151 ------
NM_001048183chr123715 3021 12561 1374 1380
NM_001066chr182015 1532 554 390 222 138 73 46 --21355 296 --
NM_001077628chr13674 55 37 --1125 --
NM_001080418chr14219 210 124 93 ------
NM_001083620chr431810 1000 116 ------
NM_001087chr23144 110 57 ------
NM_001095chr12111936 1660 1296 1279 1202 622 503 274 254 170 71 --186 --
NM_001111chr162678 2330 2149 1940 1662 851 ------
NM_001113490chrX31344 1284 594 --11327 --
NM_001116chr1692239 1235 1119 746 630 585 269 215 95 1276 12117 12359
NM_001117chr182965 605 137 1491 --
NM_001121chr1021809 235 ------
NM_001122631chr11167 122 1650 --
NM_001128chr1673793 3023 2749 1011 914 525 389 ------
NM_001140chr172106 74 ------
NM_001144chr1651114 330 66 37 27 ------
NM_001147chr81139 ------
NM_001148chr41765 ----11724
NM_001149chr101553 ------
NM_001153chr21125 ------
NM_001173chr1413207 ------
NM_001174chrX71974 1783 475 458 445 419 183 129 ----
NM_001175chr12170 ------
NM_001178chr111193 ------
NM_001188chr641065 773 267 27 ------
NM_001189chr46948 734 151 92 46 40 1232 --1178
NM_001191chr2051394 1332 1131 1045 47 1896 11345 --
NM_001196chr2231103 901 82 ------
NM_001197chr222340 278 --152 --
NM_001198chr632254 837 265 ------
NM_001206chr91436 --23074 2833 --
NM_001220chr7155 ------
NM_001222chr1031775 1633 1314 --11664 --
NM_001241chr21402 ------
NM_001241chr21402 ------
NM_001256chr172741 61 ------
NM_001259chr746345 6302 6102 4155 11264 36375 6254 6246 --
NM_001273chr122178 61 ------
NM_001277chr114917 815 688 87 ------
NM_001278chr1021095 22 ------
NM_001280chr191175 --1516 --
NM_001292chr152845 753 1988 ----
NM_001293chr11259 32 ------
NM_001300chr101117 ------
NM_001304chr1753060 3014 2936 1119 1022 ------
NM_001308chr10141 ------
NM_001310chr1231139 1129 419 --12253 --
NM_001313chr43799 290 195 ------
NM_001315chr652162 858 350 241 87 ------
NM_001319chr1991077 930 897 834 798 738 722 367 310 --1963 1844
NM_001326chr112125 50 ------
NM_001328chr43152 94 24 --1192 --
NM_001329chr1011055 ------
NM_001331chr11122869 2054 1830 1129 1066 1054 1026 973 966 710 123 116 --2980 749 --
NM_001332chr5122 ------
NM_001343chr54293 284 146 99 ------
NM_001345chr122212 50 ------
NM_001346chr342846 2015 915 349 ------
NM_001347chr4101555 1176 1140 1061 513 467 461 407 103 42 21223 128 31646 290 251 --
NM_001350chr6123 ------
NM_001351chr321428 1186 ------
NM_001356chrX2954 188 ------
NM_001358chr41175 ------
NM_001364chr1173606 3589 3571 3504 3286 3008 984 13489 13541 --
NM_001365chr175566 319 282 256 32 ------
NM_001378chr21152 ------
NM_001382chr112181 83 ------
NM_001383chr176765 679 585 542 293 29 147 2684 227 --
NM_001387chr582590 2559 2540 2434 2236 2151 809 800 --12972 --
NM_001395chrX5303 275 191 53 32 --1269 --
NM_001396chr2131098 416 238 --11731 --
NM_001397chr1122282 2273 2102 2003 1950 955 926 880 722 705 578 106 11923 ----
NM_001399chrX143577 3540 3330 3266 2578 1540 1377 1321 1100 799 759 411 122 31 ------
NM_001400chr131122 334 220 --1440 --
NM_001402chr611430 ----11822
NM_001406chr17111507 1482 496 371 303 231 213 191 179 106 50 ------
NM_001407chr351638 1342 504 121 104 ------
NM_001408chr181670 1272 1240 1194 619 596 459 426 --3578 90 62 --
NM_001412chrX33147 3070 362 ------
NM_001416chr172404 195 ------
NM_001417chr1231792 1724 1490 --11830 --
NM_001418chr111609 ----1720
NM_001418chr111609 ----1720
NM_001419chr1963705 3575 3005 1320 528 501 13728 --14805
NM_001420chr1992666 2517 1178 1143 861 508 383 325 227 --12157 --
NM_001421chrX61690 1465 1252 1210 135 85 ------
NM_001426chr24635 526 504 90 ------
NM_001429chr222874 304 ------
NM_001430chr241436 1399 1365 1305 --11830 --
NM_001438chr143523 1418 643 583 ------
NM_001439chr131510 515 408 ------
NM_001447chr551029 579 540 534 132 ------
NM_001448chrX21403 208 ------
NM_001449chrX61251 506 422 368 359 69 ------
NM_001453chr61391 --11579 --
NM_001454chr174899 213 125 58 --2944 257 --
NM_001457chr3----11485 --
NM_001458chr72630 210 ------
NM_001493chrX5730 552 494 290 29 --1673 --
NM_001495chr821163 275 --11173 --
NM_001497chr962651 2465 2266 1786 574 172 ----12120
NM_001521chr22586 129 --1750 --
NM_001527chr664587 3941 3685 3010 1762 539 13116 ----
NM_001542chr132513 2095 166 ------
NM_001543chr5154551 4405 4149 4120 2938 1868 1824 1802 1566 1518 1383 389 325 301 249 ----11426
NM_001616chr212552 --12721 --
NM_001619chr115932 917 840 722 439 --1155 --
NM_001620chr111102 ------
NM_001621chr71550 ------
NM_001621chr71550 ------
NM_001626chr19143350 2686 2638 2570 2259 2239 746 737 583 501 444 363 179 96 12549 43485 2249 1287 1097 --
NM_001650chr1833591 2589 1059 ------
NM_001654chrX198 ----189
NM_001658chr13759 93 34 ------
NM_001659chr12152356 2215 2203 2136 2074 2066 1699 1077 648 587 368 152 143 106 63 ------
NM_001662chr73136 130 87 ------
NM_001665chr116483 473 387 193 34 28 ------
NM_001668chr12624 162 ------
NM_001670chr225592 575 524 165 126 ------
NM_001678chr1751558 1346 1269 52 41 ------
NM_001679chr33636 198 189 1551 ----
NM_001682chr1221167 366 ------
NM_001683chr322386 1807 --11045 --
NM_001690chr352541 1786 767 732 647 ------
NM_001693chr8--11059 122 --
NM_001694chr163438 175 164 ------
NM_001695chr81339 ------
NM_001699chr1981822 1771 1721 1688 1635 1456 1261 112 ------
NM_001702chr81233 --151 --
NM_001703chr1----1251 --
NM_001706chr32678 99 ------
NM_001707chr76718 701 633 297 197 31 ------
NM_001709chr1141901 1839 1150 782 ------
NM_001717chr152541 527 ------
NM_001723chr62747 193 ------
NM_001742chr721134 318 ------
NM_001743chr21555 ------
NM_001746chr582771 2476 2270 1914 1880 977 832 462 ------
NM_001754chr2192716 2606 1693 1388 1378 465 218 101 29 11362 ----
NM_001755chr1631807 856 515 ------
NM_001759chr1273870 3785 3320 3284 1068 1053 114 --14039 --
NM_001760chr66899 822 814 798 387 68 --1858 --
NM_001773chr161384 1300 1266 966 142 96 ------
NM_001777chr311593 --21123 378 --
NM_001783chr194325 299 242 26 ------
NM_001788chr71625 ------
NM_001789chr341388 1275 1123 198 ------
NM_001791chr11366 --1118 --
NM_001792chr1811112 ------
NM_001802chr162658 110 ------
NM_001806chr1932864 2401 2009 ------
NM_001810chr207766 688 574 295 236 200 23 ------
NM_001821chr151158 1111 1097 850 788 --1793 --
NM_001822chr2170 ------
NM_001823chr14129 ------
NM_001842chr92502 172 --2526 472 --
NM_001859chr973536 3523 2612 1167 1102 94 75 ------
NM_001872chr131387 ------
NM_001893chr171317 ------
NM_001894chr225313 250 225 205 183 ------
NM_001895chr2031163 1050 806 ------
NM_001896chr162319 297 ------
NM_001907chr16149 ------
NM_001915chr1761616 1526 715 232 80 49 ------
NM_001923chr113493 118 56 --149 --
NM_001924chr11370 ------
NM_001927chr23487 295 54 --1198 --
NM_001935chr2----1810 --
NM_001938chr11366 ------
NM_001945chr52338 244 ------
NM_001946chr121178 ------
NM_001949chr672125 1298 994 585 230 221 80 ------
NM_001957chr421972 1576 12289 11511 --
NM_001958chr203104 84 73 148 ----
NM_001961chr192375 30 ----195
NM_001962chr52221 189 ------
NM_001964chr52387 331 --1392 --
NM_001965chr22175 121 ------
NM_001970chr174556 530 232 175 ------
NM_001978chr85969 883 877 662 283 ------
NM_001980chr1251904 1892 1719 1481 473 ------
NM_001981chr11876 ------
NM_001999chr511123 ------
NM_002014chr124646 594 276 39 ------
NM_002015chr1323132 1036 ------
NM_002024chrX11378 ------
NM_002025chrX168838 8766 8685 8640 8389 8298 7687 7100 6255 6204 2853 2737 2284 1890 1430 913 ------
NM_002028chr1451268 1107 507 501 398 ------
NM_002035chr1841353 1274 589 336 ------
NM_002037chr64169 84 43 31 ------
NM_002045chr31330 ------
NM_002048chr92894 888 162 ----
NM_002055chr1771357 1146 489 167 159 140 123 --270 30 --
NM_002062chr641597 1331 561 186 --11263 --
NM_002063chrX134 ------
NM_002065chr121791 406 --1551 180
NM_002071chr182150 37 --1111 --
NM_002074chr121478 1341 ------
NM_002076chr1263233 3192 3041 2711 2438 2371 ------
NM_002077chr931782 425 27 ------
NM_002078chr3--145 ----
NM_002086chr1782025 1874 1770 1692 1660 1600 241 76 ------
NM_002088chr193401 391 117 ------
NM_002089chr4150 ------
NM_002092chr474799 4636 4262 4048 3802 1872 727 --14398 --
NM_002103chr197446 235 119 110 72 43 35 --11011 --
NM_002126chr1773769 3744 3505 2796 1211 414 340 --11007 --
NM_002137chr712404 ------
NM_002140chr92774 412 ------
NM_002141chr71581 --164 --
NM_002147chr173256 235 52 --1116 --
NM_002149chr23563 550 107 --180 1678
NM_002167chr11116 ----1376
NM_002176chr9121 ------
NM_002181chr2176 ------
NM_002196chr205849 386 219 105 68 ------
NM_002196chr205849 386 219 105 68 ------
NM_002199chr42636 316 ------
NM_002202chr51122 ------
NM_002205chr1231014 918 714 ------
NM_002206chr123393 331 34 ------
NM_002214chr763690 1888 1274 1248 952 52 ------
NM_002223chr1232760 1351 612 1147 ----
NM_002226chr142870 741 ------
NM_002229chr192361 304 ------
NM_002230chr174922 905 807 297 --1155 --
NM_002232chr1269 50 ------
NM_002233chr11125 ------
NM_002240chr213470 224 165 ------
NM_002247chr1031958 649 259 ------
NM_002251chr2092283 1542 883 728 491 466 390 218 32 --11551 --
NM_002254chr2112334 2250 1561 860 796 619 510 332 317 226 148 ------
NM_002264chr354752 4348 4301 3106 1642 ------
NM_002267chr132643 107 ------
NM_002270chr554549 1980 1512 1202 1013 ------
NM_002274chr17254 30 ------
NM_002280chr17281 43 ------
NM_002296chr111470 ------
NM_002298chr135505 490 472 416 62 ------
NM_002305chr22246 40 ------
NM_002313chr10105046 5015 5006 4864 4125 4103 826 761 360 51 --1525 --
NM_002314chr7101031 883 871 762 403 322 253 223 28 22 1126 ----
NM_002319chr711995 924 840 798 681 318 263 253 242 157 62 ------
NM_002332chr125702 201 97 42 24 ------
NM_002333chr1951103 498 345 74 33 --1326 --
NM_002334chr1141297 622 381 84 ------
NM_002336chr1243612 743 676 28 ------
NM_002346chr89617 598 555 530 190 171 165 153 111 --1459 --
NM_002359chr17184180 3930 3815 3808 3735 3710 3678 3614 3319 3310 3065 2802 2785 1413 1126 674 357 349 23263 517 44192 3990 662 66 --
NM_002360chr792573 2364 2145 2056 1783 1665 858 529 234 --32578 2092 546 1478
NM_002373chr1541307 1166 975 160 ------
NM_002375chr3142333 2192 1998 1749 1602 1585 1563 1548 925 722 620 530 385 327 --2691 405 --
NM_002382chr1431104 353 233 --1384 --
NM_002383chr166861 835 785 754 221 185 1587 1321 --
NM_002384chr1831000 380 207 ------
NM_002385chr1851120 1078 261 219 75 11394 ----
NM_002387chr5104444 3638 3388 2045 1780 1110 518 458 267 142 ------
NM_002390chr17121975 1662 1652 774 735 642 630 553 324 161 132 64 148 31923 1383 258 --
NM_002397chr531796 273 156 ------
NM_002398chr221052 130 ------
NM_002404chr175871 307 296 73 61 ------
NM_002419chr114486 461 386 93 --1415 --
NM_002429chr1221208 227 11040 11154 --
NM_002436chrX3323 87 33 ------
NM_002442chr1281341 1288 618 555 250 221 172 137 11406 1165 --
NM_002451chr953079 2824 2617 2567 108 --12782 12769
NM_002467chr81145 ------
NM_002473chr225551 500 131 123 113 ------
NM_002479chr12278 207 ----197
NM_002480chr122328 128 ------
NM_002494chr4----130 --
NM_002501chr19244063 3934 3897 3787 3714 3651 3641 3397 3375 3363 2939 1591 1203 997 991 972 965 951 841 789 731 629 492 371 13117 32958 2516 1014 --
NM_002505chr621434 100 ------
NM_002507chr17111917 1608 1267 496 280 249 235 226 161 51 25 --1256 --
NM_002509chr203291 214 73 1795 1773 --
NM_002515chr1421579 1538 ------
NM_002516chr192271 104 ------
NM_002522chr17113193 2756 2589 2399 1475 870 821 809 237 186 176 32658 1529 923 --12453
NM_002524chr1----1254 --
NM_002530chr15253 38 ------
NM_002537chr154997 916 761 64 ------
NM_002541chr77942 717 650 180 81 53 32 ------
NM_002545chr11104732 4607 4585 4160 3546 3473 2022 1501 483 257 --11948 --
NM_002552chr221319 1275 ------
NM_002576chr1121209 82 ------
NM_002577chr373519 3190 2598 1484 1240 442 333 ------
NM_002579chr19101424 1305 1294 1244 1178 1033 590 540 463 425 --1599 --
NM_002581chr935348 4272 4195 14362 ----
NM_002585chr13275 267 37 ------
NM_002586chr631401 997 444 11415 11078 --
NM_002587chr53464 144 76 ------
NM_002588chr581569 1461 1411 1372 1255 655 353 129 ------
NM_002589chr4279 23 ------
NM_002594chr2052503 2426 900 189 44 ------
NM_002603chr8129 ------
NM_002607chr72975 353 --11093 --
NM_002608chr2251270 1258 1150 572 61 1394 1478 --
NM_002609chr5111570 1497 1479 1233 715 530 213 151 135 114 101 --124 --
NM_002613chr16174256 4017 3670 1812 1691 1495 1433 1385 720 531 480 437 373 303 259 46 24 --31832 1317 239 1849
NM_002616chr174490 167 106 57 ------
NM_002631chr1285 57 --1270 --
NM_002632chr149813 793 670 640 560 333 292 262 88 --1126 --
NM_002634chr174855 637 606 79 149 ----
NM_002646chr182114 1853 1477 1424 845 678 433 100 --11682 1821
NM_002648chr641116 960 493 169 ------
NM_002650chr22466 49 37 28 --182 --
NM_002651chr13791 270 218 ------
NM_002653chr59905 802 677 670 661 641 325 195 82 ------
NM_002655chr821998 49 ------
NM_002657chr20123523 3252 3173 2901 2858 2446 1375 1287 1256 1157 445 71 --1879 --
NM_002660chr2051168 1085 477 330 194 1256 ----
NM_002670chr3145 ------
NM_002673chr36426 393 216 156 150 52 --1531 --
NM_002693chr154399 356 334 28 ------
NM_002698chr19132797 2459 2033 1007 994 816 751 722 519 311 98 53 43 12495 ----
NM_002699chr161086 965 952 306 276 204 ------
NM_002705chr161144 --2617 90 --
NM_002713chr131215 1184 420 --1243 --
NM_002714chr64968 855 280 49 ------
NM_002716chr1173568 3557 3383 3219 3195 2945 755 ------
NM_002717chr82512 489 ------
NM_002721chr94475 455 114 37 ------
NM_002739chr197489 470 261 200 129 91 26 ------
NM_002742chr141555 ------
NM_002745chr2264098 3915 1309 1296 900 209 --1352 --
NM_002746chr165521 393 218 53 42 ------
NM_002748chr151953 ------
NM_002752chr51131 ------
NM_002753chr42545 104 ------
NM_002758chr172375 113 ------
NM_002779chr103540 77 56 ------
NM_002814chrX144 ------
NM_002823chr21226 ------
NM_002824chr123454 350 106 ------
NM_002827chr2031328 198 121 --21296 718 --
NM_002829chr9--1476 ----
NM_002833chr1551336 1326 1306 1178 648 ------
NM_002834chr1243389 1237 1138 859 11499 ----
NM_002837chr1254230 2912 989 457 74 --13998 --
NM_002839chr913033 ----13276
NM_002840chr131278 593 43 ------
NM_002843chr1183195 2907 2686 2277 2132 898 725 708 ----2690 67
NM_002844chr611296 ------
NM_002846chr26457 431 421 169 86 40 ------
NM_002849chr122916 716 ------
NM_002850chr1961038 307 177 52 46 38 ------
NM_002851chr71500 ------
NM_002854chr22------141
NM_002855chr11223435 3306 3220 3194 3042 2701 2681 2666 2656 2457 1487 1469 1236 1208 993 968 811 770 720 452 297 280 1129 1846 --
NM_002859chr1261349 1189 576 558 538 24 ------
NM_002865chr81264 ------
NM_002867chr12505 151 ------
NM_002868chr1271823 1567 490 365 139 127 109 11965 ----
NM_002869chr1111522 ------
NM_002874chr9----1337 --
NM_002880chr34692 222 182 69 ------
NM_002885chr16894 702 381 300 136 129 --1742 1101
NM_002892chr1411165 ------
NM_002898chr124671 183 110 63 ------
NM_002899chr3124 ------
NM_002904chr63196 36 27 ------
NM_002906chr113437 380 235 1957 ----
NM_002911chr1961581 1569 1537 1244 447 254 11338 11313 --
NM_002912chr61254 ------
NM_002918chr1951028 755 425 313 87 1419 21001 247 --
NM_002940chr43410 337 93 ------
NM_002941chr321289 55 ------
NM_002956chr121156 ------
NM_002959chr1104217 3966 3930 3684 3662 3358 3092 3047 649 368 ------
NM_002966chr13218 68 42 ------
NM_002968chr163392 88 75 --1316 --
NM_002972chr223258 89 71 1114 ----
NM_002977chr232902 2723 1305 ------
NM_002984chr172199 107 ------
NM_002997chr251305 781 79 55 29 ------
NM_003002chr113234 48 40 ------
NM_003009chr192275 158 ------
NM_003010chr1721917 1801 ------
NM_003011chr961703 1360 1151 681 308 117 ------
NM_003012chr842048 1164 672 33 --165 --
NM_003013chr42104 35 123 162 --
NM_003015chr105576 527 482 52 43 --121 --
NM_003016chr1711697 ------
NM_003025chr194873 407 126 21 1972 21105 1100 --
NM_003026chr931109 1004 421 ------
NM_003029chr13272 192 33 ------
NM_003030chr331292 209 66 --134 --
NM_003043chr383996 3498 3291 3174 3038 2996 1321 870 --11257 11697
NM_003045chr13103555 3428 3319 1616 1218 920 790 599 481 191 53308 1785 1024 298 38 14937 --
NM_003046chr855106 4699 3816 1267 420 ------
NM_003047chr1111293 1252 1178 425 315 295 249 203 101 80 29 ------
NM_003051chr12776 733 ------
NM_003055chr102377 312 ------
NM_003060chr531244 890 135 ------
NM_003063chr11----140 163
NM_003068chr81692 ------
NM_003072chr191178 ------
NM_003074chr331688 1674 135 --2227 129 --
NM_003075chr121251 ------
NM_003076chr12101601 1534 1479 1079 1049 663 362 210 65 52 --1521 --
NM_003077chr176766 644 571 230 221 29 ------
NM_003085chr54450 232 46 40 --2547 53 --
NM_003088chr7101007 956 905 443 395 364 256 250 230 145 ------
NM_003091chr20131 ------
NM_003098chr201450 125 ----
NM_003107chr63681 566 341 ------
NM_003108chr2136499 5575 2879 2689 2616 2603 2560 2271 2029 1870 1812 436 268 12553 22801 2589 --
NM_003113chr21176 ------
NM_003128chr241966 1859 1063 25 ------
NM_003131chr671723 1418 470 460 428 322 177 --1586 --
NM_003132chr12245 77 --162 --
NM_003137chr61850 --1265 --
NM_003140chrY144 ------
NM_003150chr1782195 2173 2137 1770 1722 1551 369 316 ------
NM_003155chr861995 1931 906 369 281 222 ------
NM_003156chr1161224 914 489 449 326 147 --1206 --
NM_003161chr17----1875 --
NM_003162chr22314 96 ------
NM_003164chr114364 162 141 107 1466 ----
NM_003165chr981687 1505 1378 256 213 204 194 147 ------
NM_003168chr174777 392 350 45 ------
NM_003170chr173545 76 64 ------
NM_003173chrX101265 1203 1196 400 194 126 116 106 98 70 --11286 --
NM_003174chr10----1152 --
NM_003178chr332168 2062 268 ------
NM_003179chrX3286 173 61 ------
NM_003183chr21893 1706 ----
NM_003185chr203507 500 299 ------
NM_003186chr114365 169 103 73 ------
NM_003199chr1875521 5131 4777 1670 1379 803 529 ----14399
NM_003200chr19192252 2100 2092 2074 2044 2014 1972 1757 1748 1544 1537 1517 657 300 271 234 221 200 42 ------
NM_003202chr53513 394 84 --155 --
NM_003203chr221649 77 ------
NM_003204chr1731616 1582 604 --11207 11343
NM_003214chr671188 1099 1006 476 466 411 269 ------
NM_003215chr431594 1092 1001 ------
NM_003220chr651490 252 174 144 76 1220 ----
NM_003221chr633740 2783 618 --11320 --
NM_003223chr165607 539 245 239 184 ------
NM_003236chr273015 2746 2697 2400 2217 926 876 ------
NM_003239chr142708 121 ------
NM_003246chr1521278 158 ------
NM_003247chr61108 --132 --
NM_003253chr2131499 87 47 ------
NM_003255chr1781694 995 824 758 517 507 494 139 ------
NM_003257chr1531274 384 156 ------
NM_003269chr621112 297 1175 2830 251 --
NM_003275chr911173 ------
NM_003281chr1165207 5191 5026 4540 4488 4473 3817 3500 3471 3412 3298 1735 900 655 315 136 44449 3978 627 419 24824 4274 --
NM_003284chr2----122 --
NM_003286chr20179 ------
NM_003291chr131213 --1240 --
NM_003298chr3115922 4890 3990 3958 3803 3772 2163 1727 1628 1365 1070 ------
NM_003305chr41298 ------
NM_003317chr143537 86 38 ------
NM_003319chr22383 354 ------
NM_003320chr11104180 4174 3267 2708 1316 1267 968 749 166 73 --11197 --
NM_003325chr221190 --2264 167 --
NM_003339chr51206 ------
NM_003340chr4189 ------
NM_003342chr1752670 2659 2603 2104 990 ----12489
NM_003345chr16186 ------
NM_003348chr1211624 ------
NM_003349chr202567 545 ------
NM_003352chr2--1339 ----
NM_003360chr42308 114 ------
NM_003367chr193449 90 52 ------
NM_003370chr192492 69 ------
NM_003371chr991978 1356 743 540 467 412 377 323 182 157 ----
NM_003373chr1061946 752 705 607 449 331 ------
NM_003376chr631484 683 580 ------
NM_003376chr631484 683 580 ------
NM_003385chr21768 ------
NM_003392chr353119 2976 1717 1607 26 ------
NM_003399chrX51061 753 402 376 339 1255 1985 --
NM_003403chr14172 ------
NM_003405chr221545 ------
NM_003406chr8271 26 ------
NM_003410chrX22901 2038 --12364 --
NM_003412chr322923 1060 ------
NM_003413chrX1175 ------
NM_003427chr64607 569 167 65 ------
NM_003458chr3143998 3701 3574 3237 2667 1505 1235 1028 972 583 568 518 511 443 --23439 3431 --
NM_003459chr23676 620 501 ----171
NM_003468chr283488 3159 2829 2802 1636 1060 163 106 ------
NM_003471chr31121 ------
NM_003474chr1031458 536 530 ------
NM_003482chr12102204 2096 1015 770 744 483 465 378 371 233 ------
NM_003483chr1211902 ------
NM_003489chr2121163 597 ------
NM_003505chr771565 599 580 506 393 226 31 ------
NM_003549chr3271 24 ------
NM_003557chr161582 1184 284 206 140 71 ------
NM_003559chr17153656 3600 3573 2977 2849 2564 2514 2491 1162 1100 975 969 857 537 370 --33185 2810 1298 --
NM_003564chr13487 27 21 ------
NM_003574chr1853818 2209 899 563 453 ------
NM_003575chr761346 1307 1230 1221 1177 1158 31245 380 330 41456 1089 442 279 --
NM_003576chr1362519 2426 1181 806 717 658 12511 ----
NM_003581chr21675 194 ----
NM_003583chr1222799 412 ------
NM_003586chr166539 513 491 457 445 96 ------
NM_003591chr10185 ------
NM_003593chr174538 444 182 109 --1266 --
NM_003603chr41349 ----11373
NM_003607chr154218 3917 1560 1129 1100 33804 2708 1363 2832 744 --
NM_003612chr153496 424 25 ------
NM_003613chr152148 30 ------
NM_003615chr322479 1514 ------
NM_003624chr1951277 955 949 432 401 ------
NM_003629chr183501 2553 2182 1384 1376 1200 1174 1062 ------
NM_003632chr174352 251 208 56 ------
NM_003633chr542436 1926 1019 549 ------
NM_003644chr17166482 5950 5929 5375 4984 4794 4683 4420 4182 2254 1219 1085 768 681 206 82 15400 51458 1177 943 923 334 --
NM_003648chr2142480 2333 2311 2005 1806 1652 1604 994 918 742 676 416 353 101 --32376 1979 369 --
NM_003654chr114523 223 148 122 ------
NM_003655chr172234 68 ------
NM_003656chr3158 ------
NM_003660chr195648 558 485 164 84 --1602 --
NM_003663chr31993 --21342 304 --
NM_003671chr962740 2729 2638 1447 1303 314 12446 13108 --
NM_003679chr132414 738 295 ------
NM_003680chr12550 64 ------
NM_003685chr193961 608 391 ------
NM_003686chr1132 ------
NM_003693chr172262 160 --1604 --
NM_003709chr2----197 --
NM_003711chr52231 126 ------
NM_003713chr11422 ------
NM_003714chr532789 2055 381 1387 ----
NM_003716chr31279 ------
NM_003735chr581569 1461 1411 1372 1255 655 353 129 ------
NM_003736chr581569 1461 1411 1372 1255 655 353 129 ------
NM_003737chr114393 387 85 45 123 175 --
NM_003741chr33346 122 109 ------
NM_003743chr252211 1526 614 560 370 ------
NM_003744chr141395 ------
NM_003749chr1322418 183 ------
NM_003759chr483958 3923 3140 3134 3007 742 433 68 ------
NM_003760chr11550 ------
NM_003762chr121265 540 ------
NM_003763chr2052734 2344 850 472 70 198 ----
NM_003768chr131811 1163 640 --11464 --
NM_003771chr17186 133 ----
NM_003787chr1811121 ------
NM_003799chr1843778 3518 3387 257 ------
NM_003800chr612206 ------
NM_003822chr152642 2544 2273 798 100 --1521 --
NM_003825chr1521359 587 ------
NM_003827chr196570 528 472 246 213 37 1502 ----
NM_003837chr9122 ------
NM_003861chr1432638 2432 141 ------
NM_003873chr1031992 820 293 ------
NM_003877chr121801 ------
NM_003883chr52360 24 ------
NM_003884chr311473 ------
NM_003887chr221940 286 ------
NM_003888chr1541622 1173 1139 44 11580 ----
NM_003893chr104412 180 167 42 ------
NM_003897chr62480 258 ------
NM_003908chr2031413 1331 1094 ------
NM_003913chr644358 3187 2671 430 ------
NM_003918chrX2143 114 ------
NM_003924chr42275 256 ------
NM_003936chr25997 984 337 135 105 --11199 --
NM_003938chr191852 160 2279 274 --
NM_003939chr1022921 2656 ------
NM_003942chr115674 510 483 290 255 ------
NM_003947chr32351 22 ------
NM_003948chr432573 925 811 ------
NM_003949chr17121977 1912 1886 1612 1378 1352 751 638 290 277 228 41 11548 ----
NM_003954chr1771411 1395 1204 1052 191 167 135 --2981 285 170
NM_003957chr116841 438 403 301 144 111 --1352 --
NM_003958chr662895 2439 525 386 250 175 ----12542
NM_003966chr5117498 6863 6232 5053 1845 1511 1164 628 404 135 56 ------
NM_003971chr17------1485
NM_003975chr12222 65 ------
NM_003983chr1654041 4017 3458 1499 1153 --11699 --
NM_003987chr10182204 1880 1837 1812 1736 1618 1602 898 887 821 812 748 583 444 431 307 239 107 1329 21803 603 --
NM_003988chr10182281 1957 1914 1889 1813 1695 1679 1443 898 889 825 660 521 508 384 316 184 39 1406 21880 680 --
NM_003989chr10182140 1816 1773 1748 1672 1554 1538 834 823 757 748 684 519 380 367 243 175 43 1265 21739 539 --
NM_003990chr10182140 1816 1773 1748 1672 1554 1538 834 823 757 748 684 519 380 367 243 175 43 1265 21739 539 --
NM_003994chr1214338 ------
NM_004024chr14571 532 159 150 ------
NM_004028chr1833591 2589 1059 ------
NM_004035chr1745054 4416 4391 1219 ------
NM_004036chr24514 270 195 167 2283 70 ----
NM_004047chr13224 75 28 ------
NM_004050chr1482253 1857 1799 788 633 619 590 71 21779 319 12127 --
NM_004055chr11132010 1942 1887 1482 1467 1442 885 643 372 362 294 147 52 1178 --21626 169
NM_004059chr91186 125 ----
NM_004067chr73613 511 230 ------
NM_004069chr192172 27 ----1204
NM_004073chr1183 ------
NM_004082chr22223 23 --1118 --
NM_004089chrX2337 258 ------
NM_004090chr17113307 2839 2712 2312 2211 2118 1013 479 207 133 98 --1470 162
NM_004093chr1352642 774 671 367 57 11078 --151
NM_004094chr1462569 2334 2308 2302 325 159 ------
NM_004097chr21355 ------
NM_004098chr1011312 ------
NM_004100chr631991 1722 73 1387 1333 --
NM_004103chr85871 704 550 328 267 ------
NM_004104chr174607 276 162 127 ------
NM_004107chr192148 132 ------
NM_004123chr17255 37 ------
NM_004124chr1433196 2355 350 ------
NM_004132chr1061102 1065 1052 772 301 199 --11030 --
NM_004134chr51215 --1617 --
NM_004169chr172650 88 ------
NM_004171chr1179086 8957 6825 5941 3191 1692 1037 ------
NM_004176chr172383 50 ------
NM_004185chr12671 172 ------
NM_004186chr33158 115 45 ------
NM_004187chrX41354 1258 1080 409 ------
NM_004193chr101379 ------
NM_004200chr11213265 2953 2852 2743 2578 2234 2172 2101 2089 2061 2006 1050 1020 957 802 760 436 235 197 155 53 3944 937 492 12121 --
NM_004202chrY2468 127 ------
NM_004209chr1671150 860 802 442 336 252 168 ------
NM_004225chr821511 1286 --11469 --
NM_004227chr7132676 2620 2474 2012 1237 1209 747 720 212 193 158 119 100 12448 1725 --
NM_004229chrX12120 ------
NM_004230chr1972361 2257 1824 592 457 427 101 ------
NM_004261chr11359 ------
NM_004263chr23734 719 373 --21555 1257 31191 493 401
NM_004274chr1453057 2211 326 275 87 ------
NM_004276chr122388 69 ------
NM_004283chr193887 186 120 --140 --
NM_004295chr174420 322 176 156 21198 472 ----
NM_004302chr12122546 2409 2245 2227 2217 2170 2125 759 720 602 281 119 ----1379
NM_004305chr21183 --1413 --
NM_004309chr17161148 1116 1055 910 885 783 706 454 427 370 360 287 276 158 113 61 --1394 --
NM_004311chr10102722 2334 2272 2251 1263 1196 1090 1015 695 689 --12363 --
NM_004321chr273197 2292 1273 1259 422 410 175 13481 12182 13501
NM_004330chr1521203 855 ------
NM_004331chr812118 ------
NM_004338chr18106923 6161 5826 4929 4912 4854 2524 2355 1135 969 ------
NM_004339chr213780 149 49 124 ----
NM_004341chr23264 194 63 ------
NM_004349chr81892 ------
NM_004350chr191776 1733 969 943 937 512 410 224 81 174 11706 --
NM_004364chr1981249 1237 1189 977 375 153 124 25 --1145 --
NM_004370chr621563 1336 ------
NM_004377chr224467 150 118 25 ------
NM_004379chr21189 ------
NM_004380chr1621698 1629 ------
NM_004384chr522151 1452 --1670 --
NM_004385chr52260 141 ------
NM_004389chr2199 ------
NM_004391chr341566 1415 608 582 ------
NM_004392chr1322034 1062 ------
NM_004393chr3102238 2096 1977 1952 1894 1858 1748 1507 898 701 ------
NM_004394chr541419 231 33 24 1651 11604 --
NM_004395chr52125 96 ------
NM_004397chr1184080 3389 3035 1581 1166 958 884 70 ------
NM_004398chr111102 1443 ----
NM_004405chr25345 326 268 245 145 ------
NM_004407chr41372 ------
NM_004408chr94492 332 190 174 --1197 --
NM_004409chr193715 581 32 1103 ----
NM_004414chr2121590 157 ------
NM_004416chr126967 719 658 324 55 37 1186 ----
NM_004417chr5150 ------
NM_004418chr23568 417 27 ------
NM_004420chr11132406 2128 2018 1944 1895 1740 1624 968 854 760 599 447 23 22191 2081 1520 --
NM_004421chr15582 229 214 156 24 1629 1140 --
NM_004423chr34681 537 509 199 --1693 --
NM_004429chrX71274 1087 1027 308 234 183 153 ------
NM_004430chr882605 1105 941 934 656 148 103 42 --1734 --
NM_004431chr13709 625 273 ------
NM_004433chr14269 215 181 104 ------
NM_004436chr13157 77 49 ------
NM_004437chr172762 1412 1271 1154 789 565 32 1540 ----
NM_004438chr262607 2153 2118 1119 541 292 ------
NM_004439chr41128 ------
NM_004440chr611896 ------
NM_004443chr35739 733 592 585 521 ------
NM_004444chr73884 295 82 --189 --
NM_004451chr114583 472 244 223 --1592 --
NM_004454chr341643 1506 222 106 ----1746
NM_004458chrX32279 1893 370 --11760 --
NM_004459chr172474 432 ------
NM_004474chr13762 754 293 ------
NM_004475chr1781191 1179 1106 1020 806 409 351 344 ------
NM_004480chr143284 270 201 ------
NM_004484chrX130 ------
NM_004496chr142840 295 ------
NM_004499chr51107 ------
NM_004503chr122520 308 ------
NM_004505chr1732011 1650 800 ------
NM_004514chr1782804 2533 2285 2021 1156 1021 852 91 ----12716
NM_004516chr192990 85 ------
NM_004517chr112231 89 ------
NM_004529chr91478 ------
NM_004530chr162885 285 11000 1300 --
NM_004540chr211781 ------
NM_004549chr1151301 1117 1007 431 21 ------
NM_004560chr92148 38 --2997 183 --
NM_004575chr441161 1018 242 67 ------
NM_004583chr173644 316 25 ------
NM_004586chrX64992 3895 1473 344 143 104 --13456 --
NM_004588chr11133657 3382 3223 3187 2969 2894 1625 1053 951 467 456 222 54 --2602 33 12808
NM_004593chr3128 ------
NM_004598chr553187 2984 2451 1318 493 ------
NM_004603chr791041 955 873 830 397 165 132 80 53 2475 414 1380 --
NM_004608chr163457 59 24 ------
NM_004609chr202443 363 ----1437
NM_004615chrX6907 674 375 284 218 172 --1114 --
NM_004630chr114920 900 279 223 ------
NM_004631chr12974 26 ------
NM_004634chr32558 153 --134 --
NM_004637chr351252 1234 1009 491 484 ------
NM_004642chr121288 ------
NM_004651chrX5395 350 265 99 73 ------
NM_004654chrY1101 ------
NM_004655chr1721173 947 ------
NM_004656chr371194 1066 823 497 483 123 68 ----1166
NM_004658chr121389 1334 169 --
NM_004663chr151452 ----1172
NM_004687chr1731926 834 327 ------
NM_004698chr13174 147 22 ------
NM_004714chr192330 59 ------
NM_004716chr111197 ------
NM_004718chr23521 482 236 ------
NM_004719chr1222798 2579 ------
NM_004723chr13990 408 29 1912 123 --
NM_004726chrX65676 4739 4696 1941 538 274 ------
NM_004730chr5132 ------
NM_004734chr1323174 788 ------
NM_004737chr2231263 189 142 --1464 --
NM_004739chr112184 130 ------
NM_004742chr311870 --194 --
NM_004745chr8146750 6308 6028 5498 4896 4733 2498 1672 1583 541 529 311 131 71 ------
NM_004746chr183246 74 40 ------
NM_004747chr102532 395 ------
NM_004748chr1523770 401 ------
NM_004755chr141114 ------
NM_004758chr173876 835 824 1248 ----
NM_004762chr1761762 1379 1231 590 338 107 11426 2717 498 --
NM_004772chr531367 1164 583 ------
NM_004774chr1722867 1168 ------
NM_004775chr1831713 851 99 ------
NM_004776chr2072984 2396 2213 1198 883 854 374 12784 1261 --
NM_004788chr1121841 193 ------
NM_004796chr14----1252 --
NM_004798chr2063420 3207 3040 2547 437 325 ------
NM_004801chr211397 ------
NM_004805chr231351 561 239 ------
NM_004807chr292221 990 942 898 614 498 456 374 108 --12098 1509
NM_004808chr1023338 3263 ------
NM_004814chr11161 ------
NM_004815chr154147 4047 3417 3357 197 ------
NM_004821chr5294 51 ------
NM_004822chr17193826 3745 3417 3366 3354 3345 3184 3111 2893 2837 2644 1378 1366 1285 781 775 769 646 243 --32933 1472 351 --
NM_004824chr62445 433 --11121 --
NM_004831chr19191 ------
NM_004834chr223401 848 ------
NM_004840chrX6630 598 576 410 381 363 --22329 54 --
NM_004842chr621242 285 ------
NM_004845chrX134134 4126 3522 3375 3211 3075 2667 2609 1385 986 806 682 411 ------
NM_004856chr151400 ------
NM_004859chr1732739 1905 668 ------
NM_004872chr11296 ------
NM_004873chr1433143 2061 1100 ------
NM_004884chr1541628 1121 248 129 1387 ----
NM_004887chr541046 453 409 243 ------
NM_004898chr442796 2724 2333 363 ------
NM_004904chr746029 4509 4443 1716 ------
NM_004922chr104981 965 325 198 ------
NM_004925chr91197 --135 --
NM_004926chr142611 152 ------
NM_004929chr821340 420 ------
NM_004930chr12283 74 1185 ----
NM_004943chr1991193 861 832 409 346 271 206 117 36 1922 1474 --
NM_004947chr342483 745 717 546 11037 ----
NM_004948chr181446 21138 962 ----
NM_004956chr713153 ------
NM_004958chr12653 367 ------
NM_004959chr9141497 1468 1425 1366 1359 1292 1266 1251 288 273 244 144 125 83 21453 359 11036 --
NM_004961chrX41446 1389 164 120 ------
NM_004962chr101229 ------
NM_004969chr101208 ------
NM_004973chr621329 270 ------
NM_004976chr11144983 4963 4452 4231 4027 3889 3874 3768 3668 2017 1989 1895 1778 180 23451 1571 34381 2040 1794 1537
NM_004977chr194594 478 380 117 ------
NM_004978chr1121725 1668 1649 1612 1575 1550 1163 1046 528 429 401 189 --11656 --
NM_004979chrX71136 1124 956 767 307 258 108 ------
NM_004980chr11208 ------
NM_004985chr1231058 1008 110 ------
NM_004991chr31122 ------
NM_004992chrX218257 8083 8060 6993 6970 6780 6691 6494 6162 5964 5432 5172 3189 3171 3155 2644 2226 2164 1806 1369 642 32658 1416 1165 37704 2400 416 --
NM_004992chrX218257 8083 8060 6993 6970 6780 6691 6494 6162 5964 5432 5172 3189 3171 3155 2644 2226 2164 1806 1369 642 32658 1416 1165 37704 2400 416 --
NM_004995chr1461307 1060 369 250 134 45 31042 439 97 21199 180 --
NM_004996chr1661573 1440 1173 566 557 241 --1389 1252
NM_004999chr654511 3362 3131 2979 64 ------
NM_005005chr8164 ------
NM_005011chr771867 1309 1236 695 573 557 226 11379 ----
NM_005017chr3138 ------
NM_005027chr1951174 1152 1135 344 283 --1318 --
NM_005028chr1042257 1773 765 319 --22157 1723 --
NM_005032chrX4337 324 273 32 ------
NM_005045chr71926 ------
NM_005053chr191201 ------
NM_005056chr1254199 3483 2043 1695 731 11222 ----
NM_005057chr131611 1540 109 ------
NM_005060chr141097 938 526 24 ------
NM_005063chr1063601 3423 2980 1438 368 277 ------
NM_005066chr11238 ------
NM_005067chr32629 139 ------
NM_005070chr22251 77 ------
NM_005073chr132278 57 ----147
NM_005076chr1133984 3809 3499 3419 3230 1605 1590 1087 1079 749 536 477 136 1591 24007 2958 11686
NM_005078chr1561706 1651 715 285 220 133 182 2343 158 --
NM_005095chr131580 801 638 ------
NM_005096chrX51189 811 197 115 58 1108 1423 --
NM_005099chr18884 240 159 140 127 81 41 21 --41165 250 177 164 --
NM_005103chr112216 23 ------
NM_005104chr64511 71 62 32 1288 ----
NM_005110chr56732 710 595 542 113 55 ------
NM_005116chr2073963 3913 3815 1683 1545 988 214 1703 11293 --
NM_005119chr111184 ------
NM_005121chr1713321 ------
NM_005124chr61167 --147 --
NM_005135chr1573671 3575 3456 2618 2592 1187 936 11301 ----
NM_005137chr22142412 2355 2327 2282 1683 1625 892 880 865 853 829 586 432 89 1628 ----
NM_005151chr181203 ------
NM_005154chr151238 ------
NM_005156chr974179 3438 1907 1522 684 174 91 ------
NM_005157chr9101628 1515 1501 1344 564 306 289 213 187 146 --21848 252 --
NM_005160chr22116704 6421 5639 4566 4382 2442 1754 1266 1159 410 356 --36726 1133 577 --
NM_005163chr144731 371 346 54 ------
NM_005165chr17--1358 1323 --
NM_005168chr211416 ------
NM_005169chr113410 50 32 123 ----
NM_005178chr192271 96 --152 --
NM_005180chr1011456 ------
NM_005181chr83765 78 65 ------
NM_005182chr165574 542 411 239 128 --1190 --
NM_005184chr19111212 1177 1153 1141 476 451 394 306 222 202 150 --21135 399 --
NM_005186chr117668 517 452 137 125 57 31 --2279 171 --
NM_005187chr16121664 1632 1613 1575 1536 1529 1492 811 593 212 160 114 21365 279 ----
NM_005188chr11137732 7653 6965 6656 6634 6610 6362 6257 2735 1304 1233 927 113 26747 1966 ----
NM_005191chr321266 110 ------
NM_005194chr20--1407 ----
NM_005197chr1443826 1149 806 162 11699 ----
NM_005202chr141493 1408 734 634 2292 244 32207 605 26 --
NM_005207chr22123526 3439 3405 3145 3125 2773 2720 2425 1440 942 685 166 ------
NM_005219chr591756 1610 1383 1372 727 721 696 542 233 2421 346 156 --
NM_005220chr1761336 1092 554 277 183 127 ----1989
NM_005225chr206967 951 825 443 70 56 ------
NM_005229chrX31045 442 421 ------
NM_005230chr12152 ------
NM_005233chr321760 882 ------
NM_005235chr297773 5794 5630 5256 4839 4786 2979 689 41 ------
NM_005238chr1133199 2544 2534 12906 ----
NM_005241chr311238 ------
NM_005245chr41165 ------
NM_005261chr8125 ------
NM_005263chr15868 358 146 87 76 ------
NM_005264chr101203 ------
NM_005273chr72127 40 --1231 --
NM_005277chr41540 ------
NM_005281chr14907 775 670 295 ------
NM_005311chr752547 2268 2229 1012 824 --1339 --
NM_005312chr9132629 2586 2348 2333 1047 978 943 616 466 379 176 106 100 --1635 --
NM_005316chr111121 ------
NM_005318chr221101 --1796 --
NM_005324chr1712125 ------
NM_005328chr81280 ------
NM_005336chr2102109 2065 1914 878 872 650 399 315 203 130 11613 11583 --
NM_005339chr433642 746 36 ------
NM_005342chrX52533 2226 1936 444 90 ------
NM_005354chr196426 269 247 205 97 74 ------
NM_005359chr18125464 5252 5187 4903 4824 4811 4347 3992 2368 2191 2165 143 ------
NM_005368chr223479 402 37 ------
NM_005370chr1941079 325 100 26 ------
NM_005374chr1782235 1975 1779 1729 1524 800 726 357 ------
NM_005375chr611181 ------
NM_005382chr81156 ------
NM_005386chr204898 714 601 44 1334 ----
NM_005392chr9101681 763 481 244 229 146 110 90 67 51 --130 1552
NM_005397chr753230 878 571 447 117 ------
NM_005401chr1179 ------
NM_005407chr1451390 592 506 123 33 184 ----
NM_005417chr20131667 1576 1566 1370 1339 1291 752 655 611 468 448 328 72 11942 ----
NM_005424chr12260 100 --1325 --
NM_005426chr11369 --1239 --
NM_005430chr1261030 879 665 376 351 271 --1223 --
NM_005436chr1043939 3580 2994 2580 ------
NM_005440chr1743322 2926 513 477 ------
NM_005442chr32596 580 ------
NM_005455chr131588 681 298 ----11624
NM_005458chr951793 817 626 574 419 ------
NM_005461chr2051516 455 273 88 52 2542 318 134 --
NM_005497chr1764681 2446 1697 850 798 501 ------
NM_005504chr1245871 4981 349 285 ------
NM_005505chr124836 770 759 167 --2590 355 --
NM_005509chr51136 ------
NM_005512chr1152023 1842 1532 736 449 --1477 --
NM_005515chr73169 69 43 198 ----
NM_005522chr71971 ------
NM_005529chr17922 751 737 401 293 284 130 ------
NM_005550chr162248 49 --1109 --
NM_005558chr14403 319 100 69 --1997 --
NM_005563chr13715 647 595 --1584 --
NM_005565chr5138 ------
NM_005569chr2261561 1504 1232 497 59 49 ------
NM_005578chr364096 3766 3309 881 782 252 ------
NM_005587chr152228 50 ------
NM_005596chr955898 5024 4988 1405 790 ------
NM_005598chr1121591 1555 1475 1404 1371 1164 679 530 415 338 312 118 --11578 1554
NM_005599chr1--1118 133 --
NM_005604chr622350 701 ------
NM_005614chr7----1711 --
NM_005618chr6299 67 ------
NM_005626chr11376 ------
NM_005628chr193498 475 224 --127 --
NM_005629chrX81002 991 981 835 297 263 252 214 11224 ----
NM_005630chr32372 331 --21844 23 --
NM_005634chrX4545 236 223 57 ------
NM_005637chr1821866 1730 ------
NM_005638chrX31537 1376 148 ------
NM_005639chr1221776 196 ------
NM_005650chr22----2130 125 1942
NM_005652chr1641008 1001 994 197 ------
NM_005653chr122363 32 ------
NM_005659chr221472 ------
NM_005660chrX249 32 ------
NM_005662chr82328 31 ------
NM_005663chr43468 366 118 ------
NM_005665chr134209 3841 607 ------
NM_005677chr341398 999 975 85 ------
NM_005686chr1101416 1240 1221 1098 1072 1012 512 476 112 50 --1983 --
NM_005688chr32918 853 ------
NM_005698chr12115 26 ------
NM_005700chr112356 22 ------
NM_005704chr161021 417 376 179 144 80 ------
NM_005708chr131142 ------
NM_005716chr191445 --2221 154 --
NM_005717chr1----3922 83 28 --
NM_005718chr35871 818 803 675 181 ------
NM_005719chr12135 ------
NM_005721chr2------1264
NM_005722chr231969 1696 107 ------
NM_005730chr12143415 3359 3242 3096 2783 2720 2510 2381 2278 1242 1036 917 616 95 ------
NM_005734chr111257 ------
NM_005736chr1081570 1557 1501 1108 449 434 262 148 --11003 1412
NM_005737chr242696 2514 709 229 --22845 417 --
NM_005738chr7196 ------
NM_005746chr731075 604 124 ------
NM_005768chr125661 653 280 132 75 ------
NM_005779chr533629 397 366 ------
NM_005781chr311676 305 297 271 222 215 193 160 116 107 79 --2763 165 --
NM_005782chr17153 ------
NM_005789chr1721569 1471 --1499 --
NM_005796chr163369 329 78 ------
NM_005808chr393326 3222 3049 2706 1414 1123 586 339 108 ------
NM_005809chr194168 81 67 30 ------
NM_005811chr12256 22 ------
NM_005817chr192666 29 ------
NM_005819chr153416 2321 2313 1234 417 --12884 --
NM_005822chr621792 729 ------
NM_005826chr11550 ------
NM_005833chr91176 ------
NM_005840chrX137213 6483 5378 5140 2655 2036 1900 1616 1484 1242 1191 672 476 ------
NM_005851chr112409 116 ----1306
NM_005852chr1741074 1055 134 34 ------
NM_005860chr1961652 1594 1311 1222 1194 256 11131 11272 --
NM_005862chr3----1906 --
NM_005864chr145716 603 565 123 25 ------
NM_005868chr742309 2258 2083 330 ------
NM_005871chr101761 ------
NM_005875chr31370 ------
NM_005877chr22102197 2162 2061 1817 769 617 583 544 63 40 --1454 --
NM_005881chr163314 303 88 ------
NM_005884chr193719 678 529 --1108 1791
NM_005895chr12113652 2971 2941 2739 2670 2655 1665 1105 660 630 34 ------
NM_005900chr4121 ------
NM_005901chr1888665 7358 7285 7270 5563 2813 2448 272 13409 12320 --
NM_005902chr15124610 3919 3627 3564 1753 1711 1690 1358 908 541 504 475 ------
NM_005904chr185948 588 565 479 436 ------
NM_005906chr611157 --135 --
NM_005909chr563970 3590 3271 3248 2904 813 ------
NM_005910chr17113845 3663 3630 2947 1632 1625 1030 915 405 104 94 11109 23449 3022 11225
NM_005911chr241398 431 302 191 ------
NM_005920chr1143664 3504 2910 2845 2838 2623 1498 1461 1238 1182 989 896 597 371 12563 174 --
NM_005922chr61151 ------
NM_005933chr1152200 2076 2005 1929 644 --12676 --
NM_005934chr19122364 2186 1775 1621 1609 910 456 357 192 115 68 60 ------
NM_005938chrX51299 1075 1069 166 23 ------
NM_005941chr832984 2672 883 ------
NM_005943chr661485 1339 1285 1259 455 272 2640 535 11290 --
NM_005955chr1154972 4782 4617 4242 3882 3800 3767 3756 1955 1473 1335 1049 1034 476 416 --11886 11497
NM_005962chr1042240 1781 819 721 ------
NM_005962chr1042240 1781 819 721 ------
NM_005964chr172624 177 ------
NM_005966chr222430 92 ------
NM_005967chr127563 515 251 213 133 121 110 ------
NM_005984chr226483 395 386 332 195 159 --1368 --
NM_005990chr572435 1118 1009 1003 950 164 131 1326 12591 --
NM_005994chr175905 794 382 138 52 ------
NM_005997chr1------139
NM_006007chr933659 3500 207 ------
NM_006015chr1171 ------
NM_006016chr6181 ------
NM_006022chr13178 ------
NM_006030chr3101704 1657 1163 513 455 383 360 231 92 69 1132 ----
NM_006034chr11132346 1888 1846 1820 1803 1785 1611 973 814 754 116 58 24 12021 42421 839 233 101 11685
NM_006037chr234925 4454 285 --33300 3231 3042 --
NM_006040chr1661240 1077 967 482 406 139 ------
NM_006047chr2012372 ----1928
NM_006048chr111082 ------
NM_006049chr152411 369 ------
NM_006062chr241072 990 981 26 --1186 --
NM_006079chr61603 ------
NM_006082chr12238 22 ------
NM_006085chr11291 --1901 --
NM_006089chrX11368 ------
NM_006091chr1551791 1105 711 518 506 ------
NM_006094chr81806 ------
NM_006095chr443922 3300 1692 1077 ------
NM_006096chr821286 173 1351 ----
NM_006109chr14151 ------
NM_006133chr11122208 1781 934 699 687 491 398 345 319 289 70 49 --2840 736 --
NM_006135chr11341 ------
NM_006156chr142235 89 ------
NM_006160chr1761255 1046 1035 184 174 54 --11321 --
NM_006161chr5174 ------
NM_006162chr1841544 1466 1423 1234 ------
NM_006176chr116715 695 324 231 190 164 ------
NM_006177chr145972 779 741 117 50 ------
NM_006185chr113240 73 36 ------
NM_006186chr23455 226 112 ------
NM_006191chr125932 332 125 37 31 ------
NM_006194chr142831 95 ------
NM_006201chrX81112 1018 919 886 833 457 448 132 11121 ----
NM_006202chr19131818 1644 1500 1346 744 594 386 327 228 171 101 78 54 ------
NM_006206chr462899 2356 948 209 197 136 ------
NM_006212chr195167 4836 3660 3647 754 503 312 68 56 --1791 --
NM_006223chrX1124 ------
NM_006224chr17102292 2229 2065 1985 861 656 557 460 222 159 --1506 --
NM_006228chr82310 166 ------
NM_006237chr1342205 864 178 77 ------
NM_006243chr12714 159 ------
NM_006244chr111487 ------
NM_006245chr691019 868 798 702 274 263 197 75 43 --2680 56 --
NM_006246chr1411100 ------
NM_006247chr196391 348 304 195 84 61 ------
NM_006255chr141764 ------
NM_006256chr122566 462 ------
NM_006258chr101130 ------
NM_006259chr42836 370 ------
NM_006267chr21608 ------
NM_006278chr112463 161 ------
NM_006281chr8197 ------
NM_006281chr8197 ------
NM_006282chr20114648 4268 3420 3367 3281 3146 1648 1608 926 453 66 ------
NM_006283chr874598 4160 3360 899 874 170 89 13322 2741 145 --
NM_006284chr11131 ------
NM_006285chr91280 ------
NM_006289chr94431 166 148 138 ------
NM_006293chr155892 656 399 368 70 ------
NM_006301chr124520 492 242 108 ------
NM_006306chrX84931 4462 4349 3693 1960 900 45 24 --11114 --
NM_006309chr3131 ------
NM_006311chr17188 ------
NM_006313chr1211340 ------
NM_006317chr51197 ------
NM_006328chr113469 246 118 ------
NM_006329chr142238 30 1137 ----
NM_006336chr991444 1378 1359 1280 1123 1070 614 551 457 --21038 935 --
NM_006338chr13444 188 155 1176 181 --
NM_006357chr21529 ------
NM_006359chrX21712 544 ------
NM_006361chr1751900 1699 1571 1379 674 ------
NM_006364chr14----1286 --
NM_006366chr631145 977 158 ----1441
NM_006367chr12816 27 ------
NM_006373chr1791299 919 524 459 347 259 212 153 107 --2943 371 --
NM_006377chr92511 185 1835 ----
NM_006378chr911118 --130 --
NM_006380chr1763552 3147 2811 2672 1457 985 ------
NM_006383chr156585 556 544 263 216 200 --148 --
NM_006389chr1161362 1166 876 851 336 96 ------
NM_006405chr14----149 --
NM_006411chr67928 790 725 673 266 176 33 172 1207 --
NM_006420chr2011341 --1679 --
NM_006434chr1062395 2061 741 494 343 333 ----1635
NM_006439chr41507 ------
NM_006449chr221924 1463 --1152 11410
NM_006451chr51432 ------
NM_006454chr4122751 2708 2542 2420 2404 2331 2146 2117 2111 2006 245 184 22097 729 22852 2809 --
NM_006457chr413937 1117 ----
NM_006459chr1051904 1894 1809 1794 140 ------
NM_006471chr18173 ------
NM_006477chr221300 1115 ----
NM_006480chr53409 195 96 --177 --
NM_006482chr1222799 412 ------
NM_006483chr192330 59 ------
NM_006484chr192330 59 ------
NM_006489chr1421579 1538 ------
NM_006494chr193766 687 110 --274 30 1739
NM_006497chr175692 667 644 312 43 ------
NM_006500chr1161352 539 474 376 172 107 ------
NM_006516chr151511 1420 518 343 31 --11395 --
NM_006521chrX8504 485 409 353 292 264 183 67 --31185 525 100 --
NM_006526chr2021407 268 ------
NM_006532chr1981630 1392 769 663 608 421 237 149 11493 31696 722 458 --
NM_006539chr162374 22 2493 429 ----
NM_006540chr82184 138 ------
NM_006544chr1465674 5279 5253 4555 4385 507 ------
NM_006546chr17155993 5888 5157 4333 4313 4123 4116 2490 2223 1920 1038 1018 866 783 214 24735 2005 15428 --
NM_006547chr742091 1724 1582 387 ------
NM_006549chr1222448 2183 22405 113 ----
NM_006561chr1094900 4841 4832 4808 4485 2303 1329 120 87 --12227 --
NM_006565chr1621308 518 --1850 --
NM_006578chr1551687 1618 1557 1530 1225 --11467 --
NM_006582chr1173 ------
NM_006589chr13486 166 128 ------
NM_006591chr1151845 1660 1335 478 327 --1344 --
NM_006593chr23788 73 24 ------
NM_006595chr1122038 137 ------
NM_006599chr1625904 5636 --16798 --
NM_006609chr222211 25 ------
NM_006618chr111307 ------
NM_006624chr101168 ------
NM_006625chr12973 331 ------
NM_006625chr12973 331 ------
NM_006625chr12973 331 ------
NM_006628chr1584476 4010 3853 3802 3682 3546 3520 1153 ------
NM_006633chr52719 606 ------
NM_006640chr1781853 1393 1311 611 428 373 268 33 --1536 --
NM_006650chr5183903 3766 3713 3647 3640 3626 3546 3205 2638 2618 2584 1062 862 502 370 336 311 117 --22508 477 --
NM_006651chr4111412 1284 1278 1053 930 462 308 201 195 128 23 ------
NM_006653chr6253 31 ------
NM_006654chr1234274 3154 1035 ------
NM_006662chr161249 ------
NM_006668chr141382 --2461 92 --
NM_006670chr6176 ------
NM_006675chr12183279 3256 3149 3106 3001 2895 2322 2135 850 371 339 316 310 277 149 142 123 32 --32900 1260 40 13215
NM_006690chr20121908 1841 1811 1639 1609 1511 953 859 707 576 462 187 --11579 --
NM_006693chr72244 39 122 1760 --
NM_006698chr204543 316 233 96 --1919 --
NM_006717chr932349 1232 102 ------
NM_006720chr10105046 5015 5006 4864 4125 4103 826 761 360 51 --1525 --
NM_006722chr332660 2380 203 ----12345
NM_006724chr61151 ------
NM_006734chr611219 ------
NM_006736chr221756 758 --1317 --
NM_006742chr1682007 1818 1731 1247 601 486 325 75 --11297 --
NM_006749chr821322 128 ------
NM_006756chr821298 996 ------
NM_006761chr17----1135 --
NM_006762chr12149 47 11027 ----
NM_006766chr822446 1044 ------
NM_006769chr11148 ------
NM_006772chr6101691 1402 1236 1219 463 311 249 221 116 104 ------
NM_006775chr61549 ------
NM_006802chr121160 1028 ------
NM_006805chr51115 --1682 --
NM_006811chr201914 ------
NM_006813chr6----1252 --
NM_006815chr1221378 220 ------
NM_006823chr821112 527 1293 ----
NM_006825chr127996 903 698 691 684 102 80 ------
NM_006826chr21973 ------
NM_006827chr1463030 2731 2596 1161 756 431 ------
NM_006838chr1221750 1240 ------
NM_006839chr22299 84 ------
NM_006841chr34716 608 67 43 ------
NM_006851chr1222576 866 --12475 --
NM_006852chr1762559 2528 1987 871 220 194 ------
NM_006854chr72713 676 ------
NM_006856chr1241026 734 293 203 ------
NM_006861chr1291950 703 664 634 587 539 518 478 213 21732 1413 ----
NM_006874chr41208 ------
NM_006875chrX2872 312 ------
NM_006876chr112608 212 ------
NM_006884chr331292 209 66 --134 --
NM_006885chr1642865 1077 1050 341 ------
NM_006888chr1453372 2576 2539 2451 192 ----1567
NM_006896chr741072 1060 283 238 1880 ----
NM_006897chr122632 22 ------
NM_006898chr22322 286 --1112 --
NM_006899chr203315 301 84 ------
NM_006902chr132492 557 61 ------
NM_006904chr82913 369 ------
NM_006906chr115681 372 236 90 68 --173 --
NM_006908chr72999 32 ------
NM_006922chr211666 ------
NM_006924chr1763778 3649 1554 1376 692 144 --1272 --
NM_006940chr1221233 1183 ------
NM_006941chr2251035 995 981 975 42 --158 1158
NM_006943chr2093029 2825 2619 1335 1000 817 600 157 115 --1363 --
NM_006946chr111442 ------
NM_006950chrX1647 2370 53 ----
NM_006981chr922918 29 ----1814
NM_006990chr1132399 1870 1764 1756 1664 1573 860 656 568 513 501 373 202 11639 ----
NM_006997chr101296 ------
NM_006999chr541592 794 436 56 1739 21867 48 --
NM_007005chr921093 344 ------
NM_007011chr15166365 6041 5067 4625 4418 4237 4166 2557 2400 2374 2250 1161 711 559 463 251 --24556 934 16617
NM_007013chr81401 ------
NM_007014chr16111705 1530 1473 1423 1393 1303 537 512 168 110 76 11188 --11761
NM_007017chr51138 1180 ----
NM_007019chr201140 ------
NM_007026chr173391 63 49 ------
NM_007030chr5155172 5065 4694 4469 4453 4284 1796 1790 1511 1244 1183 175 156 111 36 1389 1240 --
NM_007032chr22112468 2433 2290 2060 1040 1003 694 562 537 447 385 11097 12151 --
NM_007039chr141470 11480 2242 237 --
NM_007040chr197918 715 374 234 142 124 77 --21053 61 --
NM_007050chr20127158 6656 2810 2669 2340 2015 750 468 416 377 198 136 ------
NM_007051chr11122 ------
NM_007052chrX2386 106 ------
NM_007064chr31560 ------
NM_007067chr1721104 1071 1146 1964 --
NM_007073chr643529 1556 1334 678 ------
NM_007075chrX1276 ------
NM_007084chr132984 558 ------
NM_007106chr1322518 2354 ------
NM_007108chr164541 373 227 64 ------
NM_007111chr132567 288 ------
NM_007124chr62636 47 ------
NM_007126chr91106 ------
NM_007144chr172958 507 --11280 --
NM_007146chr1742804 1849 1058 928 ------
NM_007150chrX5740 728 136 72 60 ------
NM_007159chr31425 ------
NM_007162chr61578 --1113 --
NM_007170chr12654 245 ------
NM_007174chr1232216 622 552 11992 1212 --
NM_007178chr122490 449 ------
NM_007182chr35711 571 252 206 155 ----1241
NM_007185chr16779 338 274 231 171 66 --189 --
NM_007192chr1441086 1030 908 750 ------
NM_007197chr1211009 ------
NM_007219chr205956 811 728 241 119 1714 ----
NM_007221chr13367 329 284 ------
NM_007222chr821569 393 ------
NM_007232chr209974 793 379 366 352 221 106 73 66 --21001 811 --
NM_007236chr1552091 1831 1560 626 364 --11722 --
NM_007238chr20134767 4547 4535 4503 4463 4317 4272 4092 4021 3877 3413 1391 1348 1306 13772 --
NM_007243chr66489 449 428 120 72 26 ------
NM_007245chr166883 747 721 178 109 25 ------
NM_007249chr1399135 8145 7945 7901 3261 1619 1197 855 806 --1740 26658 618
NM_007270chr731215 1165 469 11492 ----
NM_007271chr621631 645 ------
NM_007274chr1------2223 29
NM_007275chr31353 --137 --
NM_007282chr32797 71 ------
NM_007286chr572130 2077 2070 2021 1749 1306 683 ------
NM_007292chr1745054 4416 4391 1219 ------
NM_007294chr1721159 72 ------
NM_007295chr1721159 72 ------
NM_007296chr1721159 72 ------
NM_007297chr1721159 72 ------
NM_007298chr1721159 72 ------
NM_007299chr1721159 72 ------
NM_007300chr1721159 72 ------
NM_007302chr1721159 72 ------
NM_007303chr1721159 72 ------
NM_007304chr1721159 72 ------
NM_007305chr1721159 72 ------
NM_007313chr9101628 1515 1501 1344 564 306 289 213 187 146 --21848 252 --
NM_007322chr192432 401 ------
NM_007326chr226831 325 180 95 49 33 --1122 --
NM_007327chr9101146 1048 877 822 794 199 189 183 87 27 --1999 --
NM_007347chr1533045 2338 2312 ------
NM_007350chr1243740 3219 2893 108 ------
NM_007353chr762582 2291 1030 804 748 525 --1114 --
NM_007361chr141575 ------
NM_007363chrX2808 431 --1353 --
NM_007365chr191463 777 681 672 300 209 150 97 27 2247 200 ----
NM_007368chr135460 298 242 204 116 ------
NM_007375chr132246 1716 686 ------
NM_012074chr142967 148 1745 ----
NM_012081chr533729 3089 607 ------
NM_012090chr12194 47 11074 ----
NM_012095chr10122928 2900 2853 2829 1346 977 944 937 586 579 559 479 ----1435
NM_012102chr13862 825 388 12346 ----
NM_012104chr1153386 1136 530 393 132 1290 1955 --
NM_012104chr1153386 1136 530 393 132 1290 1955 --
NM_012115chr61402 ------
NM_012118chr42398 159 ------
NM_012124chr112829 168 ------
NM_012134chr191486 1432 1421 1269 1203 749 375 341 111 ------
NM_012137chr132202 734 593 ------
NM_012154chr82631 262 ------
NM_012156chr2053369 2493 2214 1279 414 --13386 --
NM_012166chr961132 1099 1017 593 413 114 ------
NM_012175chr111129 ------
NM_012189chr184536 463 446 248 ------
NM_012192chr1172221 2123 1984 1680 698 257 128 ------
NM_012193chr1154627 4469 4012 2175 143 14948 --25302 4655
NM_012197chr921088 88 ------
NM_012199chr1103165 1826 1794 1605 1099 1066 657 598 366 213 1249 ----
NM_012214chr266075 5765 2514 2315 1713 1123 ------
NM_012215chr101398 --11836 --
NM_012234chr362745 2462 1124 1117 752 254 ------
NM_012249chr233096 2750 392 ------
NM_012259chr6------1332
NM_012261chr202464 34 ------
NM_012281chr732148 1947 37 ------
NM_012284chr124309 299 293 210 ------
NM_012287chr343626 1346 935 415 ------
NM_012288chr685332 4985 4278 4169 4063 985 688 78 12138 1102 15489
NM_012290chr2----11326 --
NM_012296chr1143525 3298 1495 241 12423 ----
NM_012297chr421828 765 --12159 --
NM_012300chr541696 1576 742 688 ------
NM_012301chr73673 614 32 ------
NM_012308chr11162584 2484 2456 2285 2117 2011 1906 1812 954 833 819 412 344 338 189 125 ------
NM_012309chr1183548 1385 913 547 524 488 428 291 ------
NM_012311chr102641 593 ------
NM_012316chr1124487 4419 4103 2049 1989 1901 1858 1761 1707 1564 1400 86 --2144 119 1417
NM_012317chrX4593 100 36 21 ------
NM_012325chr2011574 --1600 --
NM_012326chr27863 788 772 661 311 56 44 ----1687
NM_012329chr171171 ------
NM_012330chr1031671 1634 555 ------
NM_012333chr141688 1559 1476 1445 ------
NM_012334chr564144 3129 1705 1588 1562 1322 ------
NM_012347chr642643 1881 627 319 --12919 --
NM_012382chr553547 3280 1784 1514 45 ------
NM_012396chr12171 104 --1729 --
NM_012398chr19192840 2790 2683 2675 2510 2323 2205 1984 1929 1917 667 594 522 491 437 210 186 107 54 2646 478 21123 46 --
NM_012399chr2221519 1443 --11511 1719
NM_012402chr113926 315 98 --2346 196 --
NM_012407chr224417 360 128 120 --1435 --
NM_012410chr165451 363 152 96 85 --1379 --
NM_012423chr194450 157 111 41 --159 --
NM_012429chr2241258 1252 1164 393 11130 1925 --
NM_012434chr6125 1645 ----
NM_012446chr53434 428 216 ------
NM_012448chr1752478 2269 1865 1681 433 1845 ----
NM_012461chr143657 472 286 ------
NM_012464chr422866 293 ----11854
NM_012471chrX31592 99 93 ------
NM_012478chr174882 850 166 21 ------
NM_012479chr732655 1845 997 ------
NM_012482chr11111 ------
NM_013233chr22454 38 ------
NM_013235chr52827 319 ------
NM_013246chr118964 834 709 698 211 154 65 43 ----1672
NM_013257chr822013 100 ------
NM_013261chr413012 --12784 --
NM_013269chr1244204 1738 1709 942 ------
NM_013275chr162245 90 ------
NM_013279chr1172305 2284 2011 1765 1525 662 368 1339 22022 312 --
NM_013305chr183738 291 51 175 1249 --
NM_013309chr153958 904 139 ------
NM_013316chr7140 ------
NM_013341chr232803 1179 344 11112 ----
NM_013346chrX123 ------
NM_013357chr81236 ------
NM_013372chr1551283 1128 946 340 119 ------
NM_013377chr12----171 --
NM_013386chr1------1264
NM_013390chr941515 1452 539 461 ------
NM_013392chr23389 68 42 123 ----
NM_013399chr16101725 1622 1450 1252 748 709 620 310 146 57 ------
NM_013400chr74923 365 242 154 --2263 256 --
NM_013403chr195850 642 610 237 82 --121 1258
NM_013423chrX1936 ----132
NM_013427chrX1936 ----132
NM_013433chr1961542 1489 1460 1419 674 179 --189 --
NM_013436chr2----1649 --
NM_013438chr911704 ------
NM_013446chr761423 1318 1086 426 361 53 ------
NM_013449chr12102844 2364 2276 746 701 501 357 193 145 133 --187 --
NM_013450chr211065 ------
NM_013943chr112905 --1796 --
NM_013958chr8198 ------
NM_013959chr8198 ------
NM_013961chr8198 ------
NM_013962chr8198 ------
NM_014000chr1061946 752 705 607 449 331 ------
NM_014001chr17101628 1486 1363 1307 1122 614 554 438 129 72 --1273 290 50
NM_014007chr911251 ------
NM_014010chr91551 ------
NM_014011chr211950 ------
NM_014014chr25595 531 438 427 131 ------
NM_014015chr163257 158 141 --152 --
NM_014021chr123189 2751 ------
NM_014028chr612729 ------
NM_014034chr611151 ------
NM_014057chr911516 ------
NM_014079chr3181 1187 ----
NM_014089chr131839 ------
NM_014096chr11174 128 ----
NM_014106chr152681 412 ------
NM_014109chr81448 ------
NM_014110chr131215 1184 420 --1243 --
NM_014112chr834806 1362 640 --13922 --
NM_014117chr1662566 2252 1965 1042 694 172 --1526 --
NM_014155chr1176208 6141 6111 5647 1394 1359 1081 1424 ----
NM_014157chr1663243 2863 2613 2480 1244 693 13344 ----
NM_014159chr3180 ------
NM_014169chr141234 ------
NM_014178chr142568 240 ------
NM_014182chr122557 499 ------
NM_014188chr11340 ------
NM_014190chr4111652 1331 1283 1243 548 504 494 360 219 199 74 1177 ----
NM_014191chr121758 ------
NM_014221chrX122 ------
NM_014231chr1241841 1770 164 57 ------
NM_014232chr1781648 1625 1618 1340 1263 1235 434 132 --2444 21 --
NM_014232chr1781648 1625 1618 1340 1263 1235 434 132 --2444 21 --
NM_014233chr1761823 1791 1605 534 96 89 --1514 --
NM_014246chr2282118 2111 1733 1657 860 635 355 70 --1805 --
NM_014251chr71802 --1788 --
NM_014253chrX21772 534 ------
NM_014263chr1011249 ------
NM_014267chr111758 ------
NM_014271chrX1596 1580 ----
NM_014280chr12887 216 ------
NM_014284chr14771 422 369 240 --1384 --
NM_014286chr9153572 3468 2992 2915 2809 2751 2688 2548 2435 956 950 922 451 145 128 2763 70 1289 --
NM_014289chrX41210 1119 1000 587 ------
NM_014292chr2281402 1389 1300 749 603 280 80 63 --21691 592 --
NM_014293chr22183992 3754 3493 3432 3277 3140 2979 2858 2792 2769 1028 991 559 394 188 181 123 106 --2169 164 --
NM_014294chr8129 ------
NM_014297chr19122 ------
NM_014299chr19111895 1696 1545 1509 1410 1383 1352 392 184 141 131 11973 1605 12054
NM_014309chr22105405 4835 4471 4030 1886 1758 1722 1371 1185 1048 21947 1359 ----
NM_014328chr12523 345 ------
NM_014333chr111864 ------
NM_014338chr227898 784 716 440 357 201 102 ------
NM_014343chr75260 118 104 40 22 ------
NM_014368chr941808 1726 496 48 ------
NM_014372chr11259 ------
NM_014374chr74923 365 242 154 --2263 256 --
NM_014381chr1451320 928 433 112 51 22974 92 ----
NM_014388chr1134785 4560 4477 4236 4175 4148 2026 2000 1231 1164 931 485 163 --24486 1793 --
NM_014393chr82628 165 ------
NM_014394chr1021000 151 ------
NM_014400chr193536 410 46 ------
NM_014405chr17132177 1971 1868 1811 1697 1598 1492 875 856 825 726 243 214 11887 1619 --
NM_014408chr13211 73 64 ------
NM_014415chr311381 --1440 --
NM_014417chr191122 --1131 --
NM_014423chr564781 1970 1846 1652 1402 23 ------
NM_014430chr143326 319 21 ------
NM_014431chr1031588 584 484 185 ----
NM_014437chr13790 680 45 ------
NM_014445chr32872 106 ------
NM_014447chr411647 --11269 --
NM_014449chr122159 82 ------
NM_014452chr611071 ------
NM_014454chr62882 872 ------
NM_014455chr11198 ------
NM_014458chr11114 ------
NM_014470chr123709 558 251 ------
NM_014488chr11--1154 --143
NM_014494chr1652136 1844 919 692 446 ------
NM_014501chr19146 ------
NM_014504chr721774 564 ------
NM_014507chr2231079 843 290 --21200 1174 --
NM_014515chr121873 --1784 --
NM_014516chr192190 68 --173 --
NM_014517chr311885 ------
NM_014520chr172345 33 ------
NM_014562chr25687 654 527 515 202 156 193 --
NM_014563chrX41398 1372 612 363 ------
NM_014564chr93921 777 45 --1859 --
NM_014572chr13363 50 34 ------
NM_014575chr3----1410 --
NM_014584chr1421624 1500 ------
NM_014592chr53740 276 72 ------
NM_014600chr241541 1468 1297 1286 ------
NM_014612chr911439 ------
NM_014613chr592997 2923 2707 2068 984 973 703 441 319 --42212 1072 671 633 --
NM_014614chr2197 ------
NM_014615chr1643338 2769 1155 398 --13495 --
NM_014620chr124189 139 36 23 --1788 --
NM_014630chr1561080 993 826 526 248 90 22763 2534 22703 60 1136
NM_014632chr11158 ------
NM_014634chr22103557 3372 3304 2789 2427 581 523 447 253 22 --22522 2481 --
NM_014636chr993688 3455 3390 3069 1196 1002 611 587 443 ------
NM_014646chr18132623 2573 2553 2336 2122 2094 1245 1106 1093 1079 777 530 128 ------
NM_014661chr10123548 2770 2664 2649 1508 1186 1179 917 750 466 327 291 --13266 --
NM_014663chr12970 377 ------
NM_014665chr8153554 2739 2580 2368 2323 2307 1372 1049 1043 674 654 224 196 171 34 --1253 --
NM_014666chr51386 ------
NM_014667chr322301 256 --11686 1296
NM_014670chr21467 ------
NM_014671chr71623 ------
NM_014674chr393594 3565 3559 3501 2601 2590 706 466 240 --1196 --
NM_014676chr121052 115 --1229 --
NM_014677chr821147 171 1373 ----
NM_014682chr811471 ------
NM_014686chr1952218 2175 809 205 65 ------
NM_014690chr782753 1974 1924 1176 1121 805 573 407 1365 1846 --
NM_014693chr36494 303 294 194 188 171 ------
NM_014701chr1521383 1208 ------
NM_014702chr633245 2742 2475 ------
NM_014712chr163468 176 103 ----152
NM_014717chr19137 ------
NM_014720chr101106 ------
NM_014723chr20142751 2667 2409 2385 2373 2273 2050 1283 1268 1130 972 315 287 148 --2405 383 22529 988
NM_014726chr1741137 910 218 99 --11206 --
NM_014727chr19161 --1198 --
NM_014729chr811537 ------
NM_014730chr12115230 3961 3844 3738 3596 3435 3238 2105 2055 1709 1303 ------
NM_014730chr12115230 3961 3844 3738 3596 3435 3238 2105 2055 1709 1303 ------
NM_014731chr2091622 1499 1115 634 334 272 179 159 63 11155 ----
NM_014732chr16114776 3919 3734 1987 1468 1386 1264 1020 836 214 128 --25735 4272 --
NM_014735chrX42121 1807 1535 41 ------
NM_014741chr1191988 1798 1434 771 757 648 548 501 77 --1281 --
NM_014746chr294357 4053 4042 3224 3198 3148 336 108 33 ------
NM_014747chr1195257 5081 3964 3952 3856 3793 3768 1463 1457 1368 1289 1272 1253 1242 1165 773 650 578 430 44212 3628 924 912 23659 1414 --
NM_014748chr24163 142 70 25 --158 --
NM_014755chr263502 2796 1361 1200 1000 764 --23841 446 13513
NM_014756chr11--1400 ----
NM_014757chr572324 2039 1863 1845 941 371 146 --11828 --
NM_014759chr8121636 1561 1542 1116 610 576 569 470 392 124 102 94 --21003 299 --
NM_014761chr162401 156 ------
NM_014765chr142687 2506 851 767 ------
NM_014766chr753797 2844 1464 1291 776 ------
NM_014767chr10183581 3547 3530 3040 3030 2852 2737 2708 2324 1216 1059 946 802 663 531 484 261 107 1419 43610 2723 1385 779 --
NM_014770chr1251287 1143 1096 463 334 ------
NM_014772chr18143354 3242 2956 2867 2599 2460 1335 1315 1167 369 258 183 90 45 --1892 --
NM_014781chr81513 ------
NM_014784chr16823 803 710 428 335 287 ------
NM_014798chr1791729 1704 1634 1548 294 278 238 183 107 11876 ----
NM_014800chr76838 724 395 320 147 24 1189 ----
NM_014802chr1221085 199 ------
NM_014806chr92175 138 ------
NM_014807chr116608 596 522 279 241 119 ------
NM_014810chr172559 1413 1267 1045 791 688 58 ------
NM_014812chr121751 388 ------
NM_014820chr31543 ------
NM_014824chr1121881 1437 ----1562
NM_014826chr154218 3917 1560 1129 1100 33804 2708 1363 2832 744 --
NM_014827chr131671 673 110 ------
NM_014828chr142998 95 ------
NM_014829chr522166 422 ------
NM_014830chr1253425 2799 2659 1414 1404 ------
NM_014832chr1351707 1614 1349 570 33 ------
NM_014840chr1252484 1034 647 410 219 --12108 --
NM_014847chr13152 135 107 ------
NM_014850chr3124784 4761 4499 4466 4434 4104 1936 1736 1424 810 749 705 11671 11544 --
NM_014851chr1102083 1937 1624 1607 718 659 548 492 63 27 --21688 1591 --
NM_014853chr17131484 1323 1281 1202 1108 981 971 935 601 421 260 188 42 --11186 --
NM_014859chr1721360 253 --124 --
NM_014869chr351183 1158 951 462 24 ------
NM_014871chr121589 ------
NM_014872chr922035 1874 --1885 --
NM_014876chr2251511 1439 371 347 80 --11806 --
NM_014891chr771110 649 535 489 461 403 364 --181 --
NM_014897chr1722574 915 ------
NM_014900chr231140 1043 408 ------
NM_014901chr581992 1897 1419 711 692 415 247 100 ------
NM_014902chr2051556 1518 1230 1143 406 21320 1263 11453 --
NM_014903chr1231951 623 360 1110 ----
NM_014904chr1022971 568 ------
NM_014912chr1042753 1036 423 68 ------
NM_014921chr1992778 2663 2412 2051 663 654 526 432 121 --42385 2099 1204 638 --
NM_014925chr123748 371 181 ------
NM_014926chr331137 91 76 ------
NM_014931chr194654 634 211 95 1515 ----
NM_014934chr1353815 3276 2878 1305 71 ------
NM_014935chr172727 2478 915 514 443 218 114 --41306 1159 1060 324 --
NM_014939chr1811222 ------
NM_014944chr121130 271 --11331 --
NM_014945chr52279 167 --1628 --
NM_014947chr163030 2557 1159 1024 628 218 --1944 --
NM_014949chr12669 132 ------
NM_014952chr1531521 1364 393 --21498 595 11827
NM_014963chr196383 367 222 164 115 25 ------
NM_014974chr1031646 1456 364 --11526 --
NM_014978chr1021340 491 ------
NM_014982chr1464923 4762 4073 3621 1988 158 --14880 --
NM_014988chr432767 2405 52 --11107 --
NM_014989chr61142 ------
NM_014991chr442434 2082 914 60 ------
NM_014992chr141241 ------
NM_014994chr15172329 2261 2204 2185 2166 2159 1987 1938 1906 1538 1468 567 293 213 191 65 35 ----12033
NM_014996chr321001 255 ------
NM_014999chr1241106 480 345 53 ------
NM_015000chr1232319 1082 485 ------
NM_015002chr1222178 137 1447 ----
NM_015008chr3102960 2853 2777 2552 2452 2272 1207 1011 959 588 --12397 11080
NM_015009chr3----164 --
NM_015015chr19132047 2041 1843 1837 1828 1733 1269 652 620 599 293 131 93 --31989 1677 56 --
NM_015017chr11334 ----150
NM_015020chr1673642 3575 1015 405 360 192 74 ------
NM_015023chr1171743 1701 1681 1611 1541 1296 1268 688 636 557 436 361 314 297 276 251 194 1214 21810 52 --
NM_015024chr81943 --1594 --
NM_015025chr241688 914 467 44 ------
NM_015032chr1331166 685 605 ------
NM_015033chr9153079 2553 2272 2096 1288 1068 817 698 592 475 304 162 151 80 22 --185 12780
NM_015035chr20126534 6116 5108 2447 2237 2200 1780 1771 1457 1249 539 473 14951 26306 2418 14751
NM_015037chr101200 ------
NM_015039chr153080 572 448 392 69 ----11271
NM_015042chr15104372 3926 3688 3632 3288 3268 3127 908 845 675 11618 13838 --
NM_015044chr1693267 3200 3054 3048 2859 1129 429 330 324 ------
NM_015045chr10----1763 11594
NM_015051chr912354 ------
NM_015057chr131642 ------
NM_015059chr15103636 3218 2872 2830 958 581 351 233 126 40 --23934 153 --
NM_015063chr196967 530 520 422 372 168 --1157 --
NM_015064chr12113142 3100 3018 2982 1459 1430 1284 1266 1016 771 350 ----2671 322
NM_015074chr154153 3825 3224 1674 1348 --13729 --
NM_015075chrX162276 2089 2005 1984 1853 1747 1724 1592 704 609 593 549 389 317 286 177 --32058 1643 322 --
NM_015076chr694407 4358 3641 3602 3180 2848 1771 1244 527 ------
NM_015080chr118916 400 266 221 207 198 108 34 ------
NM_015082chr5102460 2391 2142 2103 1814 1648 871 763 358 21 ----1390
NM_015086chr122969 26 ------
NM_015087chr1322552 430 ------
NM_015090chr1255802 5708 5662 5651 5217 5131 4674 4594 4554 4089 3983 2503 2394 2131 1356 1301 1236 1215 1123 960 766 748 594 316 197 14476 25844 620 --
NM_015091chr141310 ------
NM_015092chr1644526 3935 3289 3276 ------
NM_015099chr177560 473 281 275 267 157 39 --1193 --
NM_015101chr142763 2621 1877 76 --2836 831 --
NM_015103chr34665 330 295 206 1848 ----
NM_015104chr112376 44 ------
NM_015107chrX72387 1504 851 584 526 483 456 --2934 89 --
NM_015112chr1147 ------
NM_015115chr422865 2682 ------
NM_015125chr194516 510 465 134 ------
NM_015132chr731882 538 244 ------
NM_015133chr1671442 1267 1257 936 923 581 438 --1398 --
NM_015138chr1532485 500 37 ------
NM_015143chr431286 1114 247 ------
NM_015144chr1643591 3363 3231 2640 ------
NM_015155chr1072889 2478 1139 890 823 817 472 --23144 3111 --
NM_015156chr141147 ------
NM_015161chr1631316 309 121 --146 --
NM_015171chr162209 135 ------
NM_015172chr12590 423 ------
NM_015176chr121467 91 ------
NM_015185chrX81898 1101 1095 1031 1007 608 598 309 12618 1675 --
NM_015187chr41308 ------
NM_015194chr1761592 1411 707 444 124 70 --31978 308 227 --
NM_015199chr332744 2559 986 --1798 --
NM_015200chr442131 1814 1779 83 ------
NM_015206chr153870 547 486 ------
NM_015209chr12535 473 ------
NM_015215chr133139 779 735 ------
NM_015219chr1782049 1619 989 926 670 312 141 74 --11689 --
NM_015225chr962970 2364 1245 964 294 211 ------
NM_015229chr173982 933 36 --1165 --
NM_015233chr13122677 2628 2547 2481 2424 2418 2352 2240 2193 1825 92 28 --1162 12205
NM_015247chr16105026 4570 4512 3585 3442 3436 1546 646 166 137 ------
NM_015250chr92496 35 ------
NM_015252chr21644 ------
NM_015254chr8112441 2245 2147 2056 1275 597 570 558 508 212 54 170 12546 --
NM_015265chr232477 2052 635 ------
NM_015267chr123595 221 197 ------
NM_015268chr31470 ------
NM_015270chr12112239 2217 2035 1924 1877 1865 1712 883 635 531 163 ------
NM_015272chr1611312 ------
NM_015277chr1821353 268 --11713 --
NM_015282chr253062 2501 2451 2408 49 --1611 --
NM_015284chr1112063 1871 1752 1655 1583 853 784 647 388 354 161 ------
NM_015288chr5133311 3303 2736 2666 2642 2495 2473 657 409 240 215 94 28 --33748 258 33 --
NM_015291chr1103281 2938 2513 1282 821 486 451 424 293 49 ------
NM_015294chr173937 730 337 ------
NM_015296chr13----11207 --
NM_015299chr1483268 2618 1590 1519 803 455 412 30 11580 23670 1300 --
NM_015305chr1481470 1446 748 742 731 498 238 193 --11785 --
NM_015310chr8107879 7834 7429 7108 6255 5470 2958 2688 525 490 16782 15651 --
NM_015313chr1164415 4400 4143 1581 935 461 21179 693 ----
NM_015315chr5142991 2836 2750 2743 2202 2130 1214 1201 1059 656 569 436 399 348 ----11399
NM_015317chr242495 2384 2157 655 1210 ----
NM_015326chr172700 2525 2313 2152 2065 779 192 11951 ----
NM_015327chr151250 1189 1115 263 51 ------
NM_015328chr752805 2553 2167 659 257 ----1199
NM_015332chr7123537 3512 3414 3094 1087 1035 962 833 614 578 509 61 --13482 11111
NM_015335chr1212221 ------
NM_015343chr171112 --2132 77 --
NM_015344chr82587 125 ------
NM_015345chr652718 2436 2424 852 288 --1218 --
NM_015347chr1252642 2154 2107 548 524 ------
NM_015349chr652541 2277 2087 2040 604 131 12270 --
NM_015353chr1762451 2323 1917 1049 1034 676 ------
NM_015355chr1711568 ------
NM_015356chr8265 40 ------
NM_015361chr23636 253 42 ------
NM_015365chrX43666 3145 738 389 ------
NM_015378chr172433 2339 2307 2131 1203 965 776 --42456 2331 2085 282 --
NM_015381chr22111879 1419 1360 808 586 426 385 334 298 84 25 --11873 --
NM_015385chr1062395 2061 741 494 343 333 ----1635
NM_015392chr92118 30 ------
NM_015393chr463499 2968 2343 1280 662 108 --1600 --
NM_015401chr124326 320 273 34 ------
NM_015416chr123746 336 240 ------
NM_015417chr204685 499 451 138 150 1474 --
NM_015444chr3--1227 ----
NM_015449chr11519 ------
NM_015457chr113984 827 281 1185 ----
NM_015458chr845271 1767 884 67 ------
NM_015460chr3136 ------
NM_015464chr711018 ------
NM_015466chr31188 ------
NM_015469chr91763 ------
NM_015470chr261092 1012 221 135 120 54 --11191 --
NM_015472chr31120 ------
NM_015472chr31120 ------
NM_015477chr152993 700 --1246 --
NM_015481chr1241118 876 798 758 ------
NM_015483chr72281 131 ------
NM_015488chr2141595 1513 1462 1368 1337 1331 1292 1179 627 541 519 402 379 224 ------
NM_015493chr1952129 2000 1581 895 52 1161 1536 --
NM_015497chr153972 846 235 ------
NM_015503chr162263 151 ------
NM_015508chr321391 593 ------
NM_015509chr1221409 384 --11164 --
NM_015514chr144414 386 198 88 ------
NM_015520chr321983 1866 ------
NM_015526chr1931449 1434 390 31407 1265 67 --11162
NM_015527chr166790 615 584 536 242 100 ------
NM_015534chr11808 ------
NM_015545chr73579 307 171 1105 ----
NM_015553chr6104717 4271 4265 4146 4120 3622 3537 3293 1984 1559 --34844 4529 1951 --
NM_015554chr1532763 2271 2104 --12247 --
NM_015557chr1223513 3468 3109 3103 3064 3040 2798 2739 2579 1301 1169 1075 1062 1042 985 799 766 740 517 499 266 243 21235 960 4997 990 869 457 --
NM_015565chr2142228 2057 1395 600 ------
NM_015576chr321982 1937 ------
NM_015577chr561642 1577 1418 711 365 28 ----11140
NM_015584chr175498 425 409 348 209 ------
NM_015602chr141265 721 392 29 ------
NM_015609chr1102706 2677 2600 2441 2415 2011 1844 1126 1033 229 --62722 2682 2667 2163 1057 142 --
NM_015635chr951821 1622 1615 1403 223 ------
NM_015638chr204492 484 108 69 --2617 74 --
NM_015649chr194380 282 35 28 ------
NM_015651chr961659 860 629 397 325 283 --1134 --
NM_015680chr22563 250 --187 --
NM_015686chrX102433 2416 2247 2241 2195 1720 790 603 514 361 1323 21817 955 --
NM_015704chr22123 ------
NM_015711chr193701 552 291 ------
NM_015713chr843132 1366 996 279 ------
NM_015716chr173604 218 25 ------
NM_015726chr151696 1572 1542 197 70 ------
NM_015831chr77775 615 603 361 278 157 98 ------
NM_015840chr162678 2330 2149 1940 1662 851 ------
NM_015841chr162678 2330 2149 1940 1662 851 ------
NM_015844chr1831000 380 207 ------
NM_015845chr182778 158 ------
NM_015846chr1831000 380 207 ------
NM_015847chr1831000 380 207 ------
NM_015850chr881819 1715 1608 965 727 595 479 92 ----2983 459
NM_015853chr112149 141 ------
NM_015866chr111217 ------
NM_015872chr18705 683 661 595 427 387 277 267 --1375 --
NM_015878chr811673 ------
NM_015879chr18168582 8371 8363 7566 6457 6248 5943 3296 3290 2611 1929 1627 693 523 298 45 --12746 --
NM_015898chr1972124 1913 1741 1593 750 377 230 11538 ----
NM_015904chr22280 200 ------
NM_015906chr154564 4321 4197 3343 3271 ------
NM_015963chr2146 ------
NM_015964chr162293 37 ------
NM_015980chr521543 1220 ------
NM_015981chr592793 2363 2083 2017 1021 618 534 524 435 ------
NM_015982chr172319 90 ------
NM_016006chr31263 ------
NM_016021chr632185 664 310 ------
NM_016022chr141066 742 447 429 --1371 --
NM_016032chrX61177 1128 1102 1069 245 98 1961 ----
NM_016037chr131031 891 861 ------
NM_016045chr2011626 --1393 --
NM_016057chr1271172 960 888 383 315 282 146 ----1292
NM_016072chr121717 --11763 --
NM_016073chr151239 ------
NM_016075chr1311285 ------
NM_016076chr142613 2321 1220 203 1557 ----
NM_016083chr643154 2940 2657 743 ----12817
NM_016084chr171453 --1175 --
NM_016097chr181718 ------
NM_016107chr51267 ----1204
NM_016120chrX11220 ------
NM_016129chr41321 ------
NM_016131chr232253 1795 1774 ------
NM_016132chr1523244 515 ------
NM_016140chr162293 37 ------
NM_016141chr3154 ------
NM_016147chr115979 853 845 410 229 ----1958
NM_016148chr192120 26 ------
NM_016151chr161358 ------
NM_016152chr311056 ------
NM_016156chr1142277 2123 2099 715 ------
NM_016169chr10163255 3080 2957 2825 2787 2554 2349 2135 2079 1995 1144 1115 994 696 319 45 12180 ----
NM_016188chr7127 ------
NM_016194chr1551687 1618 1557 1530 1225 --11467 --
NM_016201chr352330 909 768 714 80 --3334 95 51 --
NM_016206chr347498 3054 2645 2142 ------
NM_016223chr112115 107 185 ----
NM_016231chr1711219 ------
NM_016242chr41144 ------
NM_016250chr141775 ------
NM_016252chr21121 ------
NM_016257chr182856 2812 2792 2679 2500 2152 573 277 ------
NM_016258chr11242 ------
NM_016260chr246784 2916 2400 2023 ------
NM_016272chr226742 535 474 352 345 162 ------
NM_016287chr12272 190 --1759 --
NM_016289chr212335 ------
NM_016290chr51104 ------
NM_016291chr3142 ------
NM_016316chr2----1613 --
NM_016319chr125658 281 231 85 54 1319 ----
NM_016322chr943024 2570 2550 72 ------
NM_016338chr521167 24 ------
NM_016339chr17101562 1555 1536 1517 1510 1314 604 226 190 113 --21766 666 11527
NM_016353chr831908 602 106 ------
NM_016357chr123929 818 57 ------
NM_016364chr10156 ------
NM_016373chr164534 88 48 38 --1834 --
NM_016376chr1754332 3994 3026 2961 1159 12919 11128 1508
NM_016377chr621242 285 ------
NM_016418chr22113764 3451 2941 2696 1448 1321 1177 1121 1115 955 787 31135 442 36 ----
NM_016422chr113528 507 143 ------
NM_016423chr143465 432 376 ------
NM_016424chr172249 235 ------
NM_016427chr182166 154 ------
NM_016436chr2011876 --1528 --
NM_016441chr211621 ------
NM_016463chr5125 ------
NM_016470chr201553 ------
NM_016496chr191460 ------
NM_016506chr112245 120 ------
NM_016507chr1711086 ------
NM_016519chr4154 ------
NM_016522chr1131670 1323 351 --11342 --
NM_016530chr1533970 3898 606 ------
NM_016531chr443961 2655 583 63 --1420 13214
NM_016547chr15673 527 228 209 176 --1239 --
NM_016559chr321207 388 --11001 --
NM_016564chr115941 708 691 625 217 1638 1696 --
NM_016577chr373739 3502 2854 2768 1263 764 689 --23923 3507 11413
NM_016588chr62344 50 ------
NM_016596chr124326 320 273 34 ------
NM_016598chr311249 1411 ----
NM_016603chr511641 ------
NM_016604chr51156 --11175 --
NM_016605chr582714 2576 2193 2045 947 842 833 486 2246 117 ----
NM_016621chr11144479 4194 4141 4040 3744 3626 3618 3565 3292 3101 3034 1162 671 611 13250 ----
NM_016626chr181687 ------
NM_016733chr2261561 1504 1232 497 59 49 ------
NM_016823chr173965 276 150 ------
NM_016824chr1021809 235 ------
NM_016830chr122203 132 ------
NM_016834chr17113845 3663 3630 2947 1632 1625 1030 915 405 104 94 11109 23449 3022 11225
NM_016835chr17113845 3663 3630 2947 1632 1625 1030 915 405 104 94 11109 23449 3022 11225
NM_016841chr17113845 3663 3630 2947 1632 1625 1030 915 405 104 94 11109 23449 3022 11225
NM_016929chr684141 3969 3405 3258 1667 1127 689 664 1946 ----
NM_016936chr1672041 1893 1886 1814 1349 520 158 --1207 --
NM_016937chrX6804 650 370 349 82 61 ------
NM_016938chr113403 380 306 ------
NM_016946chr163218 2204 1307 1253 182 165 --23139 559 --
NM_017409chr123722 698 230 ------
NM_017415chr584351 3803 3795 3567 3450 1776 830 454 ----1214
NM_017420chr1423703 3204 --13258 --
NM_017423chr43792 734 545 ------
NM_017447chr2113945 --128 --
NM_017450chr1761329 1294 553 229 182 123 --11474 --
NM_017456chr1761762 1379 1231 590 338 107 11426 2717 498 --
NM_017488chr261491 1267 599 404 366 234 ------
NM_017514chrX8858 838 793 777 354 185 140 98 --1251 1744
NM_017519chr62121 113 ------
NM_017522chr12974 26 ------
NM_017530chr16297 22 ------
NM_017544chrX1227 ------
NM_017548chr31541 ------
NM_017549chr761220 1180 988 512 486 454 ------
NM_017551chr1072209 2108 662 656 446 433 418 --1580 12114
NM_017553chr1531009 996 944 --181 --
NM_017563chr3106222 5617 5402 3903 2280 2124 1803 1587 153 43 --34039 2219 1683 --
NM_017573chr193281 69 30 ------
NM_017575chr1791390 1189 1141 650 638 580 566 505 164 --11599 --
NM_017580chr1062197 1820 871 688 166 70 ------
NM_017582chr151743 672 629 309 84 ------
NM_017593chr41367 ------
NM_017596chr1264472 4320 4313 4247 4191 4116 3774 3504 3468 3211 3144 3044 1753 1642 1630 1421 1394 1257 1018 922 888 760 703 597 396 168 12864 64477 4097 4062 3940 1343 160 --
NM_017602chrX3378 224 92 --2900 217 --
NM_017610chr1531664 1382 25 ------
NM_017611chr11174 128 ----
NM_017612chr12194 ------
NM_017626chr1071696 1662 1650 1175 416 254 160 11672 ----
NM_017633chr673137 2428 945 900 571 334 129 ------
NM_017634chr821917 497 ------
NM_017637chr978764 7871 6567 6370 6360 3129 2626 16059 28489 6052 16962
NM_017640chr6----1344 --
NM_017643chr1723121 2813 ------
NM_017662chr921794 1510 --136 --
NM_017668chr162709 215 ----1589
NM_017670chr113212 174 34 --127 --
NM_017679chr175657 539 455 192 63 ------
NM_017707chr171080 266 246 162 126 117 25 ------
NM_017724chr32290 31 ------
NM_017728chr17162607 2384 2341 1976 1197 1189 916 769 760 657 455 409 393 380 245 84 --22662 1895 --
NM_017737chr122105 330 ------
NM_017738chr93855 842 93 ------
NM_017739chr11163 ----1393
NM_017748chr172864 345 ------
NM_017749chr1131034 323 24 --2407 187 --
NM_017753chr91380 ----1167
NM_017754chr684650 4308 4216 3532 1120 1113 1018 426 --21193 225 --
NM_017758chr1741083 1018 516 52 11514 ----
NM_017763chr174350 184 75 36 ------
NM_017766chr15185 167 107 78 25 ------
NM_017772chr681625 1495 1321 1140 1133 470 319 262 ------
NM_017779chr112454 ------
NM_017784chr3136 ------
NM_017786chr83206 107 35 ------
NM_017789chr24821 664 571 200 ------
NM_017798chr2031121 1065 89 ------
NM_017799chr1441698 1531 1423 1374 ------
NM_017801chr332073 1024 61 ------
NM_017811chr952450 2336 2068 628 160 --131 --
NM_017813chr835167 2052 1339 15380 15804 --
NM_017814chr19288 65 2216 28 ----
NM_017824chr1031838 347 107 11990 ----
NM_017845chr42253 42 ------
NM_017848chrX54598 4329 4014 1110 709 ------
NM_017849chr292622 2387 2361 1253 1216 1036 613 427 234 13136 3552 503 394 --
NM_017851chr1561130 1110 990 297 240 74 ------
NM_017866chr82430 424 ------
NM_017893chr10101384 1306 522 467 413 237 220 132 66 48 --1256 --
NM_017902chr10145327 5109 4717 3846 3813 1555 1535 1169 782 524 433 236 215 206 ------
NM_017919chr984678 4418 3928 3762 1566 739 622 199 --1730 --
NM_017933chr261484 1323 1151 1013 500 277 ------
NM_017938chrX31432 343 279 ------
NM_017944chr1142758 2429 917 131 ------
NM_017955chr1431137 273 248 --31119 910 104 --
NM_017966chr1131368 377 104 ------
NM_017982chr1133 ------
NM_017983chr171124 ------
NM_017987chr1041988 634 502 476 ------
NM_017988chr121674 ------
NM_017994chr742624 2325 1206 797 --1209 --
NM_018010chr331610 456 365 ------
NM_018027chr1073120 1317 1008 896 558 304 162 ------
NM_018030chr1831019 947 743 ------
NM_018032chr164970 920 290 213 ------
NM_018050chr122242 116 ------
NM_018064chr61307 ------
NM_018070chr12502 118 ------
NM_018071chr142546 85 --1155 --
NM_018085chr1148067 7773 7455 7279 6995 6828 6377 2494 2108 1978 1524 771 127 27 --2467 347 17378
NM_018086chr221391 383 ------
NM_018092chr1621688 307 ------
NM_018095chr112245 120 ------
NM_018096chr174994 769 737 721 --1791 1980
NM_018107chr144820 290 34 24 ------
NM_018110chr1631235 135 124 --1880 --
NM_018113chr121399 ------
NM_018121chr1031141 689 289 ------
NM_018133chr31842 --11835 --
NM_018150chr14853 759 47 24 ------
NM_018154chr193808 729 22 --1839 --
NM_018156chr172433 2339 2307 2131 1203 965 776 --42456 2331 2085 282 --
NM_018157chr1242533 487 287 91 ------
NM_018178chr141682 1303 659 583 ------
NM_018182chr1762015 2005 763 593 355 95 ------
NM_018184chr311356 ------
NM_018198chr131395 370 325 1278 1957 1294
NM_018203chr12683 673 --129 --
NM_018207chr161619 1428 1201 1101 409 56 1340 ----
NM_018208chr14772 734 396 220 ------
NM_018223chr1251200 825 762 284 189 1787 ----
NM_018227chr422525 593 ------
NM_018234chr252172 2154 1469 1463 651 12056 11864 151
NM_018240chr15854 565 205 186 91 1163 ----
NM_018244chr2021029 424 1244 ----
NM_018254chr11343 11715 ----
NM_018263chr262509 2371 2108 2034 1719 770 1626 11795 1737
NM_018270chr201598 ------
NM_018275chr74466 94 80 67 ------
NM_018286chr171355 ------
NM_018299chr822818 2612 ------
NM_018302chr44484 475 158 63 ------
NM_018307chr17121 ------
NM_018315chr421350 53 ------
NM_018334chr71154 ------
NM_018354chr203172 89 61 ------
NM_018361chr824077 2894 ------
NM_018362chr1133416 3280 2968 ------
NM_018364chr123065 2827 ------
NM_018367chr1162170 1704 1017 613 262 204 ------
NM_018374chr765175 4664 4157 2085 1147 925 ------
NM_018383chr241327 818 215 193 1103 ----
NM_018388chrX11478 ------
NM_018403chr343503 974 615 559 --23558 627 --
NM_018416chr1262513 2102 1923 573 283 182 ------
NM_018425chr1062223 2174 1898 1766 1689 186 21703 621 11658 --
NM_018440chr898212 7632 7150 6958 3432 510 354 203 132 --15718 --
NM_018445chr151175 ------
NM_018448chr1211269 ------
NM_018460chr21112 ------
NM_018469chr172348 128 ------
NM_018471chr21149 --1548 --
NM_018482chr821824 194 --11884 --
NM_018486chrX1433 ------
NM_018488chr17240 25 ------
NM_018489chr13599 308 60 ------
NM_018490chr111481 ------
NM_018509chr1721223 25 ------
NM_018534chr2------160
NM_018553chr1731819 1533 28 1386 ----
NM_018557chr211064 ------
NM_018566chr174426 4028 3711 3331 3252 817 219 --1728 --
NM_018590chr102244 83 ------
NM_018593chr61555 ------
NM_018638chr1245313 2245 368 130 ------
NM_018640chr1252607 2086 1797 172 60 ------
NM_018644chr1192089 1793 832 638 551 516 429 353 279 ------
NM_018650chr11118 ------
NM_018652chr1521026 339 ------
NM_018653chr173354 115 59 146 ----
NM_018660chr842289 2255 526 35 ------
NM_018667chr1672473 2145 1994 1809 1072 1032 65 ------
NM_018679chr6121 ------
NM_018686chr121325 ------
NM_018689chr1551939 723 549 278 177 2356 130 11798 --
NM_018695chr52898 396 ------
NM_018698chrX21958 168 ------
NM_018712chr1121111 42 ------
NM_018717chr462407 920 900 742 632 384 --1304 --
NM_018718chr76758 735 648 568 396 139 --12138 --
NM_018719chr711306 1898 ----
NM_018841chr143928 3348 984 845 ------
NM_018890chr72999 32 ------
NM_018898chr532167 292 79 --2327 320 --
NM_018899chr532167 292 79 --2327 320 --
NM_018900chr532167 292 79 --2327 320 --
NM_018901chr532167 292 79 --2327 320 --
NM_018902chr532167 292 79 --2327 320 --
NM_018903chr532167 292 79 --2327 320 --
NM_018904chr532167 292 79 --2327 320 --
NM_018905chr532167 292 79 --2327 320 --
NM_018906chr532167 292 79 --2327 320 --
NM_018907chr532167 292 79 --2327 320 --
NM_018908chr532167 292 79 --2327 320 --
NM_018909chr532167 292 79 --2327 320 --
NM_018910chr532167 292 79 --2327 320 --
NM_018911chr532167 292 79 --2327 320 --
NM_018912chr581569 1461 1411 1372 1255 655 353 129 ------
NM_018913chr581569 1461 1411 1372 1255 655 353 129 ------
NM_018914chr581569 1461 1411 1372 1255 655 353 129 ------
NM_018915chr581569 1461 1411 1372 1255 655 353 129 ------
NM_018916chr581569 1461 1411 1372 1255 655 353 129 ------
NM_018917chr581569 1461 1411 1372 1255 655 353 129 ------
NM_018918chr581569 1461 1411 1372 1255 655 353 129 ------
NM_018919chr581569 1461 1411 1372 1255 655 353 129 ------
NM_018920chr581569 1461 1411 1372 1255 655 353 129 ------
NM_018921chr581569 1461 1411 1372 1255 655 353 129 ------
NM_018922chr581569 1461 1411 1372 1255 655 353 129 ------
NM_018923chr581569 1461 1411 1372 1255 655 353 129 ------
NM_018924chr581569 1461 1411 1372 1255 655 353 129 ------
NM_018925chr581569 1461 1411 1372 1255 655 353 129 ------
NM_018926chr581569 1461 1411 1372 1255 655 353 129 ------
NM_018927chr581569 1461 1411 1372 1255 655 353 129 ------
NM_018928chr581569 1461 1411 1372 1255 655 353 129 ------
NM_018929chr581569 1461 1411 1372 1255 655 353 129 ------
NM_018951chr71100 ------
NM_018953chr126775 746 650 255 203 49 ------
NM_018957chr222285 120 ------
NM_018963chr2121449 73 ------
NM_018964chr2141038 734 259 82 1347 ----
NM_018970chr723190 234 ------
NM_018976chr1222517 782 ------
NM_018977chrX2884 878 ------
NM_018992chr164472 245 231 143 ------
NM_018999chr1034038 1934 525 ------
NM_019000chr521498 649 ------
NM_019009chr11132483 2422 2362 2328 2322 1912 963 770 475 248 137 75 28 ------
NM_019027chr442570 1740 778 752 ------
NM_019035chr41806 ------
NM_019036chr61435 ------
NM_019057chr52115 86 145 ----
NM_019064chr172780 239 --1568 --
NM_019074chr155846 687 652 305 36 --1267 --
NM_019083chr121533 1246 ------
NM_019096chr63863 133 34 --171 1222
NM_019102chr72120 107 ------
NM_019102chr72120 107 ------
NM_019106chr22113156 2779 2559 2505 2353 2199 1276 319 299 229 93 11013 ----
NM_019114chr932115 1715 1651 ------
NM_019556chrX1440 ------
NM_019557chr15827 773 294 83 35 1654 ----
NM_019558chr21286 ------
NM_019593chr2042742 2234 2081 2067 --12847 --
NM_019594chr951244 1090 629 295 107 --11121 --
NM_019605chr11295 ------
NM_019606chr76487 386 173 154 76 37 ------
NM_019613chr172286 70 --1926 --
NM_019845chr23755 597 65 ------
NM_019849chr19----1181 --
NM_019858chr122159 82 ------
NM_019862chr1661573 1440 1173 566 557 241 --1389 1252
NM_019884chr193476 436 134 --188 --
NM_019885chr2121038 997 941 834 715 663 634 523 393 331 128 118 22058 1131 12263 --
NM_019898chr1661573 1440 1173 566 557 241 --1389 1252
NM_019899chr1661573 1440 1173 566 557 241 --1389 1252
NM_019900chr1661573 1440 1173 566 557 241 --1389 1252
NM_019903chr1021809 235 ------
NM_020039chr12111936 1660 1296 1279 1202 622 503 274 254 170 71 --186 --
NM_020062chr205990 417 270 251 204 1349 ----
NM_020064chr95662 583 447 139 105 ------
NM_020066chr11865 ------
NM_020122chr295846 5433 5389 4618 4262 745 637 616 551 15960 ----
NM_020126chr194436 415 115 109 1203 ----
NM_020131chr141625 1563 281 25 ------
NM_020132chr21154832 4759 4575 3709 3661 3651 3615 3564 3444 3340 1629 1067 638 508 456 133 1588 --
NM_020141chr122300 133 ------
NM_020142chr126604 594 526 483 177 153 --1106 --
NM_020144chr72473 27 ------
NM_020145chr96450 222 190 131 125 60 ------
NM_020150chr1032053 1930 199 ------
NM_020151chr241731 1468 144 41 ------
NM_020159chr41675 ------
NM_020163chr392202 2090 1862 1530 842 761 190 132 109 11683 ----
NM_020168chr1581249 1152 1117 1108 550 174 143 83 ------
NM_020177chr543234 2697 2444 897 ------
NM_020178chr1741092 1079 862 72 ------
NM_020180chr1811215 ------
NM_020200chr103742 277 82 --1883 --
NM_020204chr11292 ------
NM_020211chr1561321 1177 1029 250 108 32 ------
NM_020214chr15151 ----190
NM_020225chr41358 ------
NM_020239chr191628 1569 1444 826 709 446 262 138 71 ------
NM_020248chr172277 2210 1937 1813 770 317 94 --1126 --
NM_020309chr198892 815 748 692 249 167 102 87 --11085 --
NM_020310chr17132733 2044 2028 1928 1810 1120 1001 959 863 841 702 344 52 --1349 --
NM_020318chr1132 --1321 --
NM_020336chr2023751 3744 ------
NM_020337chr432414 1093 844 --12355 --
NM_020338chr10162962 2950 2344 2327 1410 1302 1290 1205 1195 1187 904 837 403 366 98 86 22923 480 11487 --
NM_020341chr2011650 ------
NM_020346chr1121648 1557 ------
NM_020374chr1221372 629 ------
NM_020381chr61643 --1778 --
NM_020382chr1241295 575 430 59 ------
NM_020383chr101320 ----1283
NM_020390chr363162 1867 1167 1030 1004 802 ------
NM_020416chr43526 433 165 12586 ----
NM_020418chr32142 54 ------
NM_020423chr11185 ------
NM_020426chr17183 ------
NM_020429chr792771 2519 2476 2469 2436 2244 2107 1103 93 1325 12057 --
NM_020433chr2091649 1471 1217 422 335 295 289 263 108 ------
NM_020443chr1126844 6359 6225 5645 4575 4469 2589 2117 1880 1478 665 219 ------
NM_020449chrX2579 146 ------
NM_020452chr191462 1437 1369 1329 801 794 449 389 310 --2317 21 --
NM_020456chr1331742 1482 618 ------
NM_020457chr162497 491 --1197 --
NM_020463chr22442 337 ------
NM_020466chr635015 4539 3554 ------
NM_020475chr892241 1889 1802 1776 1754 1642 1633 1543 174 12113 12219 --
NM_020476chr892241 1889 1802 1776 1754 1642 1633 1543 174 12113 12219 --
NM_020477chr892241 1889 1802 1776 1754 1642 1633 1543 174 12113 12219 --
NM_020478chr892304 1952 1865 1839 1817 1705 1696 1606 237 12176 12282 --
NM_020480chr892241 1889 1802 1776 1754 1642 1633 1543 174 12113 12219 --
NM_020482chr62825 568 ------
NM_020526chr181847 1790 1429 1385 1136 299 219 108 --11178 --
NM_020546chr572863 2756 976 716 426 204 77 --21945 516 --
NM_020631chr171376 1324 1197 1005 521 92 56 --21120 334 --
NM_020638chr122451 317 ----1475
NM_020644chr111935 ------
NM_020648chr1822855 197 ------
NM_020676chr3288 42 ------
NM_020689chr2041513 1454 1341 214 ------
NM_020692chr1431028 358 149 ------
NM_020697chr83358 54 45 --11183 --
NM_020699chr1125070 4796 4708 3819 3755 2147 1643 1561 1325 1049 169 24 --1174 --
NM_020703chr12234 31 ------
NM_020708chr20112458 2384 989 942 714 638 410 256 237 180 49 11590 ----
NM_020713chr20253103 3096 3076 3053 2890 2720 2554 2438 2385 2163 1965 1173 1062 895 865 786 765 675 637 564 555 352 337 253 70 23110 1186 12875 12620
NM_020718chr1686159 5486 5381 5360 2609 1870 1823 61 --1996 --
NM_020724chr472546 2519 1897 1680 567 122 62 ------
NM_020732chr62121 113 ------
NM_020737chr6--1234 ----
NM_020739chr1523770 401 ------
NM_020742chrX4908 323 122 34 ------
NM_020750chr641278 1017 229 154 11052 ----
NM_020752chr101999 ----1282
NM_020753chr175759 513 265 114 51 1710 ----
NM_020764chr1671264 1197 1041 403 281 229 109 ------
NM_020766chrX33975 2929 970 1954 ----
NM_020772chr1787952 7148 5992 2723 1265 915 526 78 --21947 1719 16129
NM_020774chr1832398 2331 900 ------
NM_020775chr12182 26 ------
NM_020777chr4122383 2121 2017 1837 1782 1763 1551 875 565 533 257 215 ------
NM_020783chr1821693 962 ------
NM_020786chr1661636 1500 1451 730 691 190 ------
NM_020794chr11364 ------
NM_020795chr1781873 1827 1738 1727 1291 1244 565 556 11853 ----
NM_020796chr532632 2533 652 ----183
NM_020801chr522047 187 ------
NM_020802chr1122617 328 ------
NM_020804chr6102499 2448 2417 2202 2124 1995 1636 917 842 375 1296 2512 420 --
NM_020807chr1651588 1375 576 344 62 11440 ----
NM_020808chr1247 40 1157 ----
NM_020814chr251177 1170 1061 283 127 ------
NM_020819chr611207 ------
NM_020826chr1173602 3333 2753 2598 1302 1124 69 22458 38 ----
NM_020830chr223250 2070 --13213 --
NM_020831chr222784 215 --2979 794 --
NM_020836chr145639 618 203 155 53 2594 500 2770 102 --
NM_020839chr331277 1253 199 ------
NM_020841chr12------11387
NM_020845chr12162472 2445 1989 1826 1712 1699 1649 987 976 939 930 596 519 151 110 57 --3667 291 159 --
NM_020850chr16103100 2738 2671 2601 2510 2471 2220 1318 880 613 --160 --
NM_020856chr19----11514 --
NM_020858chr1521727 412 ------
NM_020868chr221708 82 ------
NM_020886chr1141122 1059 924 46 ------
NM_020888chr181684 1280 813 806 712 667 521 166 1306 --12015
NM_020895chr192310 56 ------
NM_020898chr123554 313 196 --1143 --
NM_020899chr1772359 2010 827 696 688 347 83 ------
NM_020918chr1022397 858 --1108 1114
NM_020920chr141158 ------
NM_020922chrX1698 ------
NM_020924chr91182 ------
NM_020927chr165746 435 375 196 76 ------
NM_020935chr254316 3781 1859 1137 163 ------
NM_020940chr1022933 2898 ------
NM_020951chr1911745 --11875 --
NM_020956chr19274727 4454 4309 4027 3863 3770 3644 3215 3171 2903 1475 1428 1416 1109 1045 1039 1008 978 951 753 605 570 555 267 91 77 36 34263 1353 1271 44134 1281 780 745 14210
NM_020962chr158924 877 719 708 652 554 364 341 --1953 11939
NM_020964chr18134129 4005 3919 3892 3618 3479 3257 3100 3089 3061 823 755 299 1795 24386 3774 --
NM_020971chr193617 333 186 1316 ----
NM_020972chr41252 ------
NM_020977chr41765 ----11724
NM_020981chr21749 ------
NM_020983chr12112239 2217 2035 1924 1877 1865 1712 883 635 531 163 ------
NM_020987chr101553 ------
NM_020993chr12122507 2394 2292 2109 1834 1035 1028 832 546 490 431 74 --11060 --
NM_021005chr151858 ------
NM_021012chr17142832 2396 2217 2104 2058 2042 1960 1246 1193 1085 993 363 70 51 12073 23092 99 12815
NM_021033chr1323202 2383 ----22598 1216
NM_021035chr2021285 29 11052 ----
NM_021038chr313390 ------
NM_021061chr893872 3001 1684 1554 1548 1068 1044 750 379 14013 ----
NM_021064chr661401 1266 1236 1122 445 417 ------
NM_021069chr41349 ----11373
NM_021078chr171185 125 176 --
NM_021088chr241766 1631 1601 444 ------
NM_021090chr22104956 4664 4185 3904 1964 1481 1371 701 654 174 13815 21486 518 23314 860
NM_021097chr242178 1037 828 600 ------
NM_021104chr12----1206 --
NM_021106chr98694 591 484 282 254 195 71 63 --1214 --
NM_021116chr7228721 7174 7043 3378 2710 2696 2621 2363 2357 2348 2323 1647 1557 1450 1402 1068 720 627 486 448 439 425 26969 1483 22533 48 15818
NM_021120chrX4849 410 110 77 --1904 --
NM_021132chr101166 --11266 --
NM_021135chr6103043 2254 1340 864 792 718 691 623 153 65 --33204 2500 2259 --
NM_021140chrX1169 ------
NM_021155chr19152961 2933 2868 2600 2529 2394 1973 1072 999 984 818 681 655 300 136 ------
NM_021159chr41314 ------
NM_021161chr141532 ------
NM_021165chr15851 666 639 611 98 ------
NM_021173chr11282 25 ------
NM_021174chr82688 257 ------
NM_021189chr191000 880 837 827 801 310 214 111 38 ------
NM_021195chr16297 23 --1583 --
NM_021202chr20102874 2701 1131 831 806 542 331 305 237 172 1871 ----
NM_021222chr13995 440 100 ------
NM_021227chr4141 ------
NM_021238chr1231502 702 189 ------
NM_021249chr1421630 1384 ------
NM_021253chr61904 ------
NM_021255chr1453794 3620 3531 3025 1282 ----1734
NM_021259chr1661034 915 830 775 449 82 2469 403 1797 --
NM_021260chr1431355 1342 1317 ------
NM_021267chr19151256 1059 971 436 427 386 366 345 336 326 222 202 183 148 98 --11276 --
NM_021569chr9101146 1048 877 822 794 199 189 183 87 27 --1999 --
NM_021575chr192172 27 ----1204
NM_021622chr1042325 835 115 29 ----1540
NM_021633chr131028 329 251 ------
NM_021637chrX2909 864 ------
NM_021638chr465022 3154 1097 1033 334 149 --34055 3445 415 --
NM_021643chr241690 1621 641 347 ------
NM_021647chr463813 3715 2903 1377 352 48 --1738 --
NM_021648chr662629 2298 1947 1734 1079 797 ------
NM_021705chr621434 100 ------
NM_021738chr10----1152 --
NM_021813chr684960 4124 2220 1803 1653 1356 1318 499 11449 24394 4011 187
NM_021905chr6132240 2079 1742 1719 1562 1555 1474 880 778 625 574 563 381 --11697 --
NM_021911chr595273 4817 4172 2175 1959 1897 1088 1073 255 ------
NM_021912chr1543936 3549 3126 1666 ------
NM_021913chr1981822 1771 1721 1688 1635 1456 1261 112 ------
NM_021914chr1432087 1863 261 ------
NM_021923chr451503 1125 1089 1054 219 ------
NM_021926chr112227 156 1217 ----
NM_021931chr203918 803 61 ------
NM_021945chr663588 3017 2658 1237 946 100 --13337 11245
NM_021946chrX81413 1330 1307 1184 1015 930 342 267 ----1363
NM_021947chr1731067 336 270 ------
NM_021948chr13276 253 244 --141 --
NM_021954chr1363716 2567 1292 1282 908 622 ------
NM_021960chr11176 --12111 --
NM_021961chr11115292 4553 2759 2034 2025 1967 1959 1913 1585 1098 324 1126 1119 --
NM_021963chrX135 122 ----
NM_021965chr93542 404 87 ------
NM_021967chr551264 1255 997 299 273 ------
NM_021973chr42184 94 ------
NM_021984chrX41446 1389 164 120 ------
NM_021987chrX41446 1389 164 120 ------
NM_021988chr202567 545 ------
NM_021990chrX41446 1389 164 120 ------
NM_021991chr175625 608 510 227 165 ------
NM_022036chr173354 115 59 146 ----
NM_022037chr21707 ------
NM_022039chr104381 106 96 22 ------
NM_022041chr1612514 158 ----
NM_022042chr43841 216 32 11056 1130 --
NM_022048chr15145826 5169 4362 4241 4176 2556 2378 1632 1606 1375 1027 648 138 30 ------
NM_022051chr11489 --1274 --
NM_022060chr1441293 1172 1045 868 1920 ----
NM_022062chr1141223 664 608 354 ------
NM_022066chr175299 288 119 99 91 ------
NM_022067chr144867 573 314 29 ------
NM_022075chr12654 623 ------
NM_022080chr2032770 2717 2320 ------
NM_022100chr12585 501 ------
NM_022114chr1254759 4345 4128 4081 3874 3760 3601 3488 3470 3420 3324 3151 3141 3066 1906 1784 1626 1135 1086 985 821 776 666 88 74 --43611 1109 992 279 1702
NM_022117chrX3534 479 60 ------
NM_022119chr163249 226 75 ------
NM_022123chr14133 --1428 --
NM_022130chr51534 ------
NM_022166chr16166125 5640 5456 4961 4589 4517 4358 2350 2337 1525 1512 1467 1409 1338 1159 568 --24157 2090 --
NM_022169chr1151268 1198 454 293 30 --11320 --
NM_022173chr21707 ------
NM_022343chr961329 1183 1011 1005 944 88 --11172 --
NM_022442chr202567 545 ------
NM_022450chr16294 32 ------
NM_022455chr5136 ----1105
NM_022458chr722133 67 11948 ----
NM_022459chr1325899 1001 --16156 --
NM_022465chr1272244 1176 1131 859 569 491 66 ----143
NM_022473chr1554288 4277 4141 3954 1638 ------
NM_022474chr1422401 221 ------
NM_022477chr2061461 1384 1341 1206 1180 274 ------
NM_022479chr7101345 1318 1305 1267 1250 1234 977 545 168 50 --31354 1239 76 --
NM_022484chr711298 ------
NM_022497chr352887 2793 793 744 96 ------
NM_022557chr171176 ------
NM_022572chr2141595 1513 1462 1368 1337 1331 1292 1179 627 541 519 402 379 224 ------
NM_022574chr782167 2056 2048 2024 1625 1601 1423 454 --11455 --
NM_022640chr171175 1187 ----
NM_022644chr173457 446 30 ------
NM_022648chr2184555 4411 4231 4127 4113 3838 3766 3685 3101 3039 1243 1174 1088 1037 1024 874 665 559 --11834 --
NM_022652chr121178 ------
NM_022658chr1251321 336 281 275 260 ----11313
NM_022719chr22133733 3313 3227 3114 3090 2514 2394 1414 1356 1102 740 288 275 --22903 313 --
NM_022735chr11351 ------
NM_022737chr19111258 1245 1146 1137 1119 993 470 407 99 93 49 --158 --
NM_022744chr1681167 1149 1055 957 904 825 425 216 --1898 --
NM_022745chr152704 2471 2219 535 119 --11835 --
NM_022748chr7102874 2338 2256 1835 991 895 670 333 46 35 --12598 12237
NM_022749chr881200 1075 962 556 479 106 56 45 1382 ----
NM_022753chr162761 2179 1991 1818 1094 281 12713 ----
NM_022755chr972181 964 931 808 253 207 133 11913 ----
NM_022756chr121088 41 ------
NM_022758chr693128 2586 2533 2317 2201 2130 2060 1222 924 --23074 541 --
NM_022763chr362934 2778 2669 1256 894 513 ------
NM_022780chr241707 559 167 119 ------
NM_022781chr923026 2331 ------
NM_022802chr1011055 ------
NM_022817chr241834 1427 319 311 ------
NM_022821chr1273 37 ------
NM_022822chr117736 711 696 667 615 165 62 --3765 672 86 --
NM_022836chr12571 438 ------
NM_022841chr1542629 236 161 73 ------
NM_022842chr3103179 3159 2717 2322 1022 986 584 340 310 227 --12547 --
NM_022843chr1321131 369 ------
NM_022844chr161912 ------
NM_022845chr1631761 810 469 ------
NM_022893chr253178 2647 1057 964 400 --12978 --
NM_022894chr221643 710 ------
NM_022898chr1494445 4429 4258 4005 3984 1140 109 76 22 22982 707 1903 --
NM_022970chr103473 74 21 ------
NM_022977chrX32279 1893 370 --11760 --
NM_022978chr551264 1255 997 299 273 ------
NM_023000chr1411165 ------
NM_023001chr1411165 ------
NM_023009chr14284 260 254 122 --2481 82 --
NM_023018chr131177 660 39 ------
NM_023019chr22223 23 --1118 --
NM_023039chr5127 ------
NM_023067chr341032 259 186 62 --1521 --
NM_023068chr2081523 1283 1179 1071 598 581 294 159 ------
NM_023076chr1672401 815 765 741 294 276 153 --22598 2512 --
NM_023079chr1731795 1748 493 1141 21401 1234 --
NM_023105chr881819 1715 1608 965 727 595 479 92 ----2983 459
NM_023106chr881819 1715 1608 965 727 595 479 92 ----2983 459
NM_023110chr881819 1715 1608 965 727 595 479 92 ----2983 459
NM_023111chr881819 1715 1608 965 727 595 479 92 ----2983 459
NM_023923chr123715 3021 12561 1374 1380
NM_023925chr124330 295 216 74 ------
NM_023929chr821048 882 ------
NM_024007chr542322 1062 912 736 --12963 --
NM_024015chr175953 427 119 101 87 ------
NM_024016chr174311 269 98 52 ------
NM_024017chr1751498 1458 1379 1251 168 --1300 --
NM_024019chr44862 100 84 54 ------
NM_024043chr16111351 1268 1236 1212 1177 1100 1093 934 572 433 245 2306 156 --11190
NM_024046chr3101231 1151 1065 972 813 438 365 342 114 98 ----1413
NM_024050chr192479 40 --1605 --
NM_024052chr1772708 2462 738 605 555 463 348 32639 2090 384 ----
NM_024085chr23942 929 696 --2887 52 1863
NM_024117chr961118 1092 1062 1029 907 63 ------
NM_024293chr26759 644 323 315 288 280 ------
NM_024294chr693128 2586 2533 2317 2201 2130 2060 1222 924 --23074 541 --
NM_024297chr171234 ------
NM_024306chr168889 857 828 813 460 123 40 27 1155 ----
NM_024308chr175495 429 211 55 48 ------
NM_024332chrX11299 ----1478
NM_024345chr944939 1300 336 228 14917 ----
NM_024416chr911516 ------
NM_024424chr113309 216 31 --1188 --
NM_024425chr113309 216 31 --1188 --
NM_024426chr113309 216 31 --1188 --
NM_024430chr1841410 1384 1334 213 --11547 --
NM_024482chr1173 ------
NM_024494chr12671 172 ------
NM_024496chr142525 28 ------
NM_024511chr442203 783 427 401 ------
NM_024522chr181748 1731 1433 516 504 352 83 30 ------
NM_024524chr31107 ------
NM_024541chr1071501 1334 1188 667 476 87 34 ------
NM_024551chr1242043 1725 635 114 ------
NM_024551chr1242043 1725 635 114 ------
NM_024567chr82535 157 --1265 --
NM_024595chr12905 220 ------
NM_024599chr176613 251 137 64 32 23 --1474 --
NM_024607chr843410 3219 3143 114 14022 13198 13502
NM_024613chr81135 ------
NM_024617chr91868 --1900 --
NM_024627chr22144705 4419 4380 3601 3261 1990 491 475 452 277 206 200 96 30 --1412 --
NM_024639chr622926 163 ------
NM_024643chr143461 152 88 ------
NM_024652chr152809 452 ------
NM_024665chr344606 3225 237 61 ------
NM_024674chr142199 2173 617 502 ------
NM_024689chrX41746 1512 460 234 ------
NM_024698chr1161307 1294 1209 541 502 257 --31154 946 269 --
NM_024704chr20198 2205 58 ----
NM_024721chr8----1649 --
NM_024742chr16101586 1516 1344 1254 1211 771 587 465 202 145 3739 711 508 31331 406 74 2536 89
NM_024757chr92448 173 --1439 --
NM_024770chr2126765 6406 5084 4874 4858 4796 4662 4580 4536 2159 1670 847 ------
NM_024786chr52105 22 ------
NM_024787chr84281 190 177 42 ------
NM_024792chr174967 350 166 41 --21079 77 --
NM_024798chr1562906 2224 707 572 46 26 --12155 --
NM_024808chr132281 173 ------
NM_024811chr1151906 1625 689 448 150 ------
NM_024825chr191293 ------
NM_024830chr582121 1591 1412 437 309 289 137 83 ------
NM_024834chr1011881 ------
NM_024850chr52654 44 ----1733
NM_024859chrX3816 722 426 ------
NM_024874chr161273 1135 1110 1089 1023 87 1113 ----
NM_024875chr1051829 1247 216 138 107 ------
NM_024877chr1931100 835 69 21093 1047 31182 1013 175 --
NM_024884chr1464187 4064 1170 1034 1008 468 24474 1222 --14409
NM_024887chr182050 1914 1759 1497 861 778 519 41 --21453 30 --
NM_024909chr631510 1443 1020 11340 1569 --
NM_024911chr12543 101 ------
NM_024917chrX3865 404 268 ------
NM_024922chr1631606 1520 1410 2811 323 ----
NM_024923chr351179 893 526 475 43 --1111 --
NM_024939chr1621280 461 ------
NM_024944chr2121297 1289 ------
NM_024947chr387412 6736 3057 2861 2479 2245 1810 1139 11470 13540 --
NM_024948chr102693 683 ------
NM_024954chr104678 497 487 31 ------
NM_024969chr22885 756 ------
NM_024991chr1062395 2061 741 494 343 333 ----1635
NM_024993chr221613 1349 ------
NM_025083chr1541861 1401 43 33 ------
NM_025109chr173149 99 40 ------
NM_025138chr132408 382 ------
NM_025140chr124418 249 172 142 ------
NM_025146chr322030 1942 ------
NM_025151chr821552 54 1101 ----
NM_025158chr52471 447 ------
NM_025160chr184021 3964 3752 3591 3507 3378 3255 1179 --1645 --
NM_025164chr1141935 1924 1797 89 11608 ----
NM_025179chr1144481 3952 3924 3910 3783 3211 1919 1752 1376 1364 983 413 295 109 --11882 --
NM_025182chr96828 739 304 205 178 50 ------
NM_025184chrX1616 ------
NM_025187chr1641364 521 313 21 --130 --
NM_025191chr132789 1365 196 ------
NM_025202chr25290 237 229 223 37 --1657 150
NM_025221chr4----11337 --
NM_025222chr353005 2599 2581 646 435 --1773 --
NM_025224chr2092195 2094 1768 737 694 688 655 552 153 --21627 33 --
NM_025235chr102841 318 ------
NM_025236chr6142 ------
NM_025237chr173323 252 37 2148 44 ----
NM_025238chr1511516 ------
NM_025248chr17153038 3021 2938 2813 2796 2694 2180 2152 2133 2112 2065 1212 603 548 31 2568 108 32248 1221 23 1122
NM_025251chr8111167 1150 1113 462 384 359 337 318 249 138 104 31190 441 277 ----
NM_025261chr6_qbl_hap22318 22 ------
NM_030576chr17112567 2460 2452 2016 1949 1667 559 534 488 339 149 2843 828 21884 1708 --
NM_030621chr1443436 3265 2606 2592 --11550 12690
NM_030627chr521630 1506 ------
NM_030629chr1631566 1275 1212 1415 1102 11287
NM_030630chr174825 252 233 138 1126 1688 --
NM_030647chr754771 4431 1742 1090 76 ------
NM_030648chr475455 4574 4319 3712 3419 2104 1683 --14652 --
NM_030661chr761444 1284 267 247 131 98 --11244 --
NM_030664chr1032442 2356 174 1980 12124 --
NM_030665chr1771244 505 446 219 182 140 102 ------
NM_030674chr1243681 1767 1384 179 --11554 --
NM_030761chr1112648 2462 2276 2144 2093 1882 1706 1088 925 681 671 ----22592 514
NM_030762chr1221394 311 --1500 --
NM_030766chr121215 --128 --
NM_030789chr202343 299 ------
NM_030795chr8170 ------
NM_030799chr512042 ------
NM_030802chr171143 ------
NM_030806chr1139252 9093 8424 8391 7987 7162 6398 6251 6232 2285 1876 1429 422 11574 18338 12253
NM_030808chr1711874 846 793 416 318 167 157 106 94 88 32 ------
NM_030809chr1241961 1549 98 22 ------
NM_030816chr122992 2446 ----23713 2513
NM_030884chr3142333 2192 1998 1749 1602 1585 1563 1548 925 722 620 530 385 327 --2691 405 --
NM_030913chr14552 518 148 96 ------
NM_030914chr95915 772 119 89 69 --1634 --
NM_030916chr14889 774 653 109 ----1737
NM_030935chr75335 147 95 87 61 ------
NM_030937chr151138 1118 477 83 62 ------
NM_030939chr61363 ------
NM_030952chr121063 205 1138 ----
NM_030957chr194401 152 79 53 --2586 524 --
NM_030964chr583491 3390 3275 2415 1351 645 629 532 --22806 2502 --
NM_030981chr11111119 1106 1059 1036 976 473 314 269 246 169 52 --21071 407 1163
NM_031205chr122388 69 ------
NM_031212chr10177 ------
NM_031231chr206677 588 457 275 44 28 --1485 --
NM_031232chr206677 588 457 275 44 28 --1485 --
NM_031243chr712404 ------
NM_031262chr92717 355 ------
NM_031263chr92774 412 ------
NM_031266chr51107 ------
NM_031268chr16174256 4017 3670 1812 1691 1495 1433 1385 720 531 480 437 373 303 259 46 24 --31832 1317 239 1849
NM_031289chr121806 ------
NM_031297chr9266 37 ------
NM_031305chr42756 181 ------
NM_031309chr881999 1743 1544 854 764 638 235 145 1189 1769 --
NM_031407chrX2141 132 ------
NM_031411chr532167 292 79 --2327 320 --
NM_031417chr1982310 2215 1030 964 745 413 224 144 133 1175 --
NM_031426chr982698 2526 2276 2203 701 527 520 61 --12145 --
NM_031433chr116546 501 407 191 181 22 --2519 484 --
NM_031442chrX42918 659 490 321 ------
NM_031444chr2281728 884 829 757 719 624 489 294 1285 31613 609 72 --
NM_031445chr283385 2496 2409 2160 2126 732 143 72 12667 ----
NM_031453chr1011957 --1210 --
NM_031468chr7207836 7439 7351 6643 6408 6181 5942 5563 5220 5114 2888 2844 2517 2348 2090 1993 1969 1957 1477 572 12713 32757 2077 1931 --
NM_031477chr162349 251 ------
NM_031483chr2043541 2256 2214 1364 ------
NM_031492chr11----166 --
NM_031849chr532167 292 79 --2327 320 --
NM_031857chr532167 292 79 --2327 320 --
NM_031860chr532167 292 79 --2327 320 --
NM_031890chr2292828 2673 2640 2350 2209 2152 698 551 392 ------
NM_031892chrX3113 103 62 ------
NM_031911chr411724 ----1286
NM_031938chr111325 ------
NM_032012chr965011 4686 3395 1706 1380 78 13562 ----
NM_032013chr2061461 1384 1341 1206 1180 274 ------
NM_032017chr1121904 1679 1556 1550 1523 1443 1330 1286 713 621 375 80 11309 ----
NM_032041chr852637 2513 2430 2132 2003 ------
NM_032042chr542658 2183 269 32 --12795 1303
NM_032047chr322187 670 ------
NM_032052chr224968 507 402 245 ----1147
NM_032088chr581569 1461 1411 1372 1255 655 353 129 ------
NM_032092chr581569 1461 1411 1372 1255 655 353 129 ------
NM_032102chr111678 ------
NM_032109chr561195 1157 118 91 42 25 155 196 --
NM_032124chr181897 ------
NM_032144chr211379 ------
NM_032147chr12--11035 ----
NM_032153chr341932 1049 53 36 ------
NM_032156chr124330 295 216 74 ------
NM_032160chr1843315 1538 1495 1403 ------
NM_032174chr141012 304 142 53 1480 ----
NM_032195chr211122 ------
NM_032199chr1043391 2371 1275 413 --13425 --
NM_032208chr233563 1411 391 ------
NM_032217chr4179 ------
NM_032221chr2031965 1814 779 ------
NM_032229chr1321026 204 ------
NM_032236chr12147 109 ----1954
NM_032242chr3183048 2920 2872 2713 2650 2604 2306 1170 945 939 788 762 668 466 441 383 161 145 --32818 2294 848 --
NM_032256chr121728 ------
NM_032268chr1673249 2619 1195 1076 478 429 52 12252 12095 --
NM_032271chr1651176 585 354 140 42 --31119 230 99 --
NM_032281chr1992666 2517 1178 1143 861 508 383 325 227 --12157 --
NM_032283chr171772 1750 1653 744 301 175 168 ------
NM_032287chr22133475 3086 2881 1703 1456 1185 1029 527 518 376 169 118 92 ------
NM_032288chr321952 421 --11465 1176
NM_032289chr571826 1732 1700 1307 617 549 514 ------
NM_032298chr191122 ----1341
NM_032320chr111500 ------
NM_032352chr141211 ------
NM_032353chr174426 377 172 74 ------
NM_032375chr195795 622 616 38 22 1572 2200 134 --
NM_032403chr581569 1461 1411 1372 1255 655 353 129 ------
NM_032408chr721119 1023 ------
NM_032410chr821126 927 ------
NM_032420chr53773 751 560 --1745 --
NM_032429chr101583 --1401 --
NM_032430chr192323 53 --1128 --
NM_032431chr114970 738 329 241 ------
NM_032432chr461485 1407 1143 1127 1016 335 --1329 11423
NM_032440chr1032144 870 817 ------
NM_032452chr1461439 1204 511 333 135 41 ------
NM_032457chr41136 ------
NM_032458chrX11344 --11155 --
NM_032499chr1511188 ----196
NM_032508chrX21335 64 ------
NM_032514chr207413 300 156 120 89 53 42 ------
NM_032536chr95635 166 110 54 46 ------
NM_032538chr6222675 2642 2570 2341 2293 2285 2161 2036 1985 1975 1897 1857 779 745 648 434 393 303 241 226 204 170 ------
NM_032547chr42418 403 ------
NM_032552chr9131694 1670 1649 1450 1412 1378 717 679 441 365 274 104 84 --1138 --
NM_032560chr141238 ------
NM_032569chr163758 678 468 2747 663 ----
NM_032575chr16171634 1549 1541 1493 1355 1284 826 582 524 456 395 357 244 230 213 53 29 31701 1606 1307 21401 487 --
NM_032578chr1041147 982 299 291 --11336 --
NM_032580chr173413 204 191 ------
NM_032581chr731664 611 260 1107 ----
NM_032582chr17--1121 ----
NM_032595chr17121561 1359 1331 1291 1226 1220 991 620 614 536 398 233 --11078 1111
NM_032603chr24747 555 521 208 ------
NM_032632chr1421652 1443 ------
NM_032638chr351167 1068 593 390 189 ----11245
NM_032646chr17121413 1318 1278 1265 1154 624 398 296 279 244 226 24 --31243 716 204 --
NM_032682chr312578 ----11283
NM_032687chr8165 --134 --
NM_032689chr1931417 1405 626 11471 ----
NM_032711chr17184180 3930 3815 3808 3735 3710 3678 3614 3319 3310 3065 2802 2785 1413 1126 674 357 349 23263 517 44192 3990 662 66 --
NM_032741chr67928 790 725 673 266 176 33 172 1207 --
NM_032777chr831577 416 243 ------
NM_032781chr115681 372 236 90 68 --173 --
NM_032782chr521210 188 --1894 --
NM_032786chr123524 500 34 ------
NM_032796chrX1146 ------
NM_032810chr1021512 1073 ------
NM_032833chr131843 1706 976 1186 ----
NM_032836chr1961019 998 401 177 87 22 21010 121 ----
NM_032840chr125907 767 314 125 23 --1896 --
NM_032842chr72492 466 1597 1177 --
NM_032846chr1421295 1221 11493 21474 412 --
NM_032854chr176766 707 687 292 206 51 170 ----
NM_032859chr131131 ------
NM_032870chr61417 ------
NM_032871chr11111361 1254 1223 772 675 395 240 225 213 159 33 --31228 274 38 1257
NM_032876chr142711 615 ------
NM_032883chr204859 273 243 81 ------
NM_032900chr1073361 3196 2524 1453 998 380 212 --13018 --
NM_032905chr101212 ------
NM_032924chr72905 89 --1856 --
NM_032926chrX151 ------
NM_032951chr76480 410 211 115 105 97 --136 --
NM_032953chr76480 410 211 115 105 97 --136 --
NM_032961chr41234 ------
NM_032982chr731937 740 99 ------
NM_032983chr772751 2116 913 720 568 329 51 ------
NM_033008chr32142 54 ------
NM_033009chr32142 54 ------
NM_033010chr32142 54 ------
NM_033014chr911516 ------
NM_033016chr2251270 1258 1150 572 61 1394 1478 --
NM_033018chrX81112 1018 919 886 833 457 448 132 11121 ----
NM_033020chr154564 4321 4197 3343 3271 ------
NM_033025chr195910 770 668 657 322 --166 --
NM_033027chr361113 1039 887 759 743 733 ----1951
NM_033036chr113470 80 67 --136 --
NM_033044chr12194 47 11074 ----
NM_033058chr83948 935 134 ------
NM_033088chr12544 86 ----1193
NM_033089chr2051169 1075 390 311 232 ------
NM_033102chr1136 ------
NM_033102chr1136 ------
NM_033103chr1931355 980 471 130 ----
NM_033116chr141228 ------
NM_033127chr12504 124 ------
NM_033129chr20111652 1619 1459 1432 823 749 608 492 459 88 48 1501 ----
NM_033132chr132912 455 ------
NM_033133chr17193631 3561 3238 3112 2805 2655 2626 2595 2391 1330 1118 1108 958 947 862 718 383 56 25 1588 13215 --
NM_033143chr464510 4372 4103 1518 1243 51 1101 ----
NM_033181chr643154 2940 2657 743 ----12817
NM_033201chr161353 --1928 --
NM_033211chr51576 ------
NM_033224chr767942 6705 6679 5065 1967 1715 ------
NM_033225chr842310 2092 371 303 ------
NM_033226chr163247 146 97 ------
NM_033259chr37880 853 800 587 92 39 27 --1337 --
NM_033274chr573027 1311 1155 787 520 436 163 1302 12905 --
NM_033284chrY1151 ------
NM_033300chr12974 26 ------
NM_033310chr111247 --1208 --
NM_033315chr17121989 1931 1881 1857 1770 1430 1386 740 461 197 186 107 11698 11375 --
NM_033326chr1121674 519 ------
NM_033331chr962740 2729 2638 1447 1303 314 12446 13108 --
NM_033360chr1231179 1129 231 ------
NM_033375chr1771465 1457 1422 1219 1132 585 440 ------
NM_033380chrX2818 81 ------
NM_033381chrX2818 81 ------
NM_033387chr982550 2469 2460 2387 2374 2350 253 139 12526 11794 --
NM_033389chr17104816 4687 4639 4272 4227 4065 3821 3373 1016 323 14445 13722 --
NM_033393chr442738 707 187 24 22516 2195 12590 --
NM_033396chr113364 115 96 --1387 --
NM_033401chr161159 ------
NM_033419chr17111544 1530 1442 1427 1392 1106 1057 567 47 40 23 ------
NM_033420chr19111035 978 953 908 427 390 213 186 179 140 90 ------
NM_033448chr122108 21 ------
NM_033449chr5102117 2007 1846 1491 1455 1354 794 570 146 40 ------
NM_033480chr642643 1881 627 319 --12919 --
NM_033481chr642643 1881 627 319 --12919 --
NM_033496chr10128 --1217 --
NM_033497chr10128 --1217 --
NM_033498chr10128 --1217 --
NM_033500chr10128 --1217 --
NM_033505chr266642 5434 4306 2429 2032 1072 --15723 --
NM_033512chr84368 252 156 41 ------
NM_033540chr331113 1031 126 ------
NM_033551chr5142991 2836 2750 2743 2202 2130 1214 1201 1059 656 569 436 399 348 ----11399
NM_033624chr1222178 137 1447 ----
NM_033626chrX81487 1470 623 564 401 323 291 259 ----21259 1143
NM_033631chr1113726 2855 2489 2375 1323 1053 560 247 64 34 27 ------
NM_033632chr421350 53 ------
NM_033637chr1022921 2656 ------
NM_033644chr541696 1576 742 688 ------
NM_033645chr541696 1576 742 688 ------
NM_033656chr2135888 5035 4910 ------
NM_044472chr1141 ------
NM_048368chr181575 2532 67 ----
NM_052832chr822562 2519 ------
NM_052837chr12115 26 ------
NM_052840chr151592 ------
NM_052845chr12133213 2920 2914 2899 2887 2824 2625 2403 897 849 195 126 67 ----23175 2775
NM_052855chr17183 ------
NM_052867chr131341 --11005 --
NM_052869chr17121413 1318 1278 1265 1154 624 398 296 279 244 226 24 --31243 716 204 --
NM_052874chr163690 148 89 ------
NM_052880chr223912 199 158 ------
NM_052885chr1221779 536 --177 --
NM_052892chr16150 ------
NM_052896chr172009 1989 1955 931 480 161 40 --1417 --
NM_052897chr122783 675 --1846 --
NM_052898chr831696 1638 314 ------
NM_052904chr63944 453 77 ------
NM_052905chr22501 319 ------
NM_052906chr22214991 4866 4702 4687 4585 4549 4457 4270 4255 4235 4042 3848 3542 3413 3357 3293 1690 1094 1079 754 650 14359 1610 --
NM_052907chr1283649 3516 3372 3189 2865 1508 397 189 ----11608
NM_052910chr1341424 414 314 300 ------
NM_052911chr182938 891 ------
NM_052918chr1053526 2600 1139 908 880 ------
NM_052925chr196980 678 662 352 195 138 ------
NM_052932chr112617 44 11825 ----
NM_052937chr841899 1729 640 587 ------
NM_052954chr21290 59 ------
NM_052970chr202131 41 1913 ----
NM_052971chr51427 --150 --
NM_052978chr1441300 498 474 249 ------
NM_052998chr1----1149 --
NM_053002chr321168 89 ------
NM_053023chr1162612 2603 1262 723 419 190 ------
NM_053024chr31171 ------
NM_053041chr205564 112 101 40 29 --1583 --
NM_053046chr194179 109 74 55 ------
NM_053064chr1432394 955 783 --1420 --
NM_054025chr1192089 1793 832 638 551 516 429 353 279 ------
NM_054027chr55487 396 359 281 253 --1669 --
NM_054035chr172688 133 ----1344
NM_057175chr422352 1838 ------
NM_057749chr81105 ------
NM_058004chr22466 49 37 28 --182 --
NM_058164chr192291 75 ------
NM_058170chr11380 11115 ----
NM_058172chr42668 637 ------
NM_058240chr1451416 1346 398 347 148 --195 --
NM_058241chr21302 ------
NM_058241chr21302 ------
NM_058243chr193280 203 103 ------
NM_078625chr651197 1115 908 487 217 ------
NM_080415chr175839 711 603 65 34 ------
NM_080422chr181117 ------
NM_080423chr181117 ------
NM_080491chr1143525 3298 1495 241 12423 ----
NM_080538chr341398 999 975 85 ------
NM_080539chr341398 999 975 85 ------
NM_080541chr341398 999 975 85 ------
NM_080546chr932174 2088 1452 ------
NM_080597chr1831019 947 743 ------
NM_080618chr204980 132 82 30 ------
NM_080621chr2051265 1197 1009 318 77 --31297 480 191 --
NM_080645chr621563 1336 ------
NM_080647chr224431 376 72 27 2141 44 ----
NM_080654chr114460 204 94 87 ----11301
NM_080666chr1411596 1278 ----
NM_080669chr1793618 3444 3429 1589 1434 1000 939 833 671 1728 21577 1557 --
NM_080670chr55789 677 598 581 98 ------
NM_080676chr2053170 2073 654 503 284 ------
NM_080686chr61137 ------
NM_080717chr1241489 631 387 347 ------
NM_080732chr194179 109 74 55 ------
NM_080738chr141708 1626 1535 1505 ------
NM_080744chr72712 101 --2502 497 --
NM_080759chr1322034 1062 ------
NM_080760chr1322034 1062 ------
NM_080764chr2253202 2767 791 583 545 --1758 --
NM_080792chr2071495 749 709 505 341 300 50 ----1354
NM_080862chr361275 1253 1138 465 429 196 --1378 11103
NM_080867chr141122 ------
NM_080872chr843653 1161 1082 373 12914 ----
NM_080881chr52125 96 ------
NM_080927chr332812 783 687 --12912 --
NM_130385chr1173081 2940 2895 2663 2536 2239 276 --2205 27 --
NM_130387chr331237 508 38 ------
NM_130388chrX133 ------
NM_130391chr913033 ----13276
NM_130392chr913033 ----13276
NM_130393chr913033 ----13276
NM_130436chr2131098 416 238 --11731 --
NM_130438chr212993 815 --12308 --
NM_130439chr1042240 1781 819 721 ------
NM_130439chr1042240 1781 819 721 ------
NM_130440chr131278 593 43 ------
NM_130442chr76838 724 395 320 147 24 1189 ----
NM_130443chr112356 22 ------
NM_130459chr971514 1507 1482 1359 1325 201 71 --1478 1257
NM_130466chr1261360 1187 611 501 466 21 ------
NM_130795chr98694 591 484 282 254 195 71 63 --1214 --
NM_130798chr1521359 587 ------
NM_130799chr117634 608 519 498 191 79 42 1134 ----
NM_130800chr117634 608 519 498 191 79 42 1134 ----
NM_130801chr117634 608 519 498 191 79 42 1134 ----
NM_130802chr117634 608 519 498 191 79 42 1134 ----
NM_130803chr117634 608 519 498 191 79 42 1134 ----
NM_130804chr117634 608 519 498 191 79 42 1134 ----
NM_130808chr3--1172 ----
NM_130830chr3113961 3402 2716 2551 2462 1166 1118 523 488 233 69 ------
NM_130838chr153473 164 109 ------
NM_130839chr153473 164 109 ------
NM_130846chr122916 716 ------
NM_133170chr20127158 6656 2810 2669 2340 2015 750 468 416 377 198 136 ------
NM_133171chr201268 ------
NM_133177chr161021 417 376 179 144 80 ------
NM_133178chr161021 417 376 179 144 80 ------
NM_133264chr17123651 3335 3226 3142 2966 2540 1285 1011 943 816 585 247 1965 13093 --
NM_133265chrX31344 1284 594 --11327 --
NM_133328chr192576 229 --1821 --
NM_133369chr57854 731 725 684 670 329 133 --1754 --
NM_133370chr423189 503 ------
NM_133378chr22383 354 ------
NM_133379chr2121 ------
NM_133432chr22383 354 ------
NM_133437chr22383 354 ------
NM_133445chr963719 3660 2814 2619 2476 1170 --11050 --
NM_133476chr121480 ------
NM_133498chr193115 95 58 ------
NM_133499chrX1717 1123 ----
NM_133509chr145463 431 274 254 235 ------
NM_133631chr321289 55 ------
NM_133642chr2231263 189 142 --1464 --
NM_133647chr1573671 3575 3456 2618 2592 1187 936 11301 ----
NM_134268chr1751093 1036 987 869 329 1935 ----
NM_134325chr15530 300 287 263 45 ------
NM_134421chr23563 550 107 --180 1678
NM_134424chr1231003 368 328 ------
NM_134427chr98694 591 484 282 254 195 71 63 --1214 --
NM_134442chr21189 ------
NM_138270chrX33137 3103 2332 ------
NM_138277chr62176 143 ------
NM_138300chr151646 1557 1477 356 238 --11598 --
NM_138317chr141532 ------
NM_138318chr141532 ------
NM_138338chr22153109 3065 2812 2510 2436 2371 1365 1224 1076 1022 862 854 775 670 170 22192 1291 1148 --
NM_138350chr171443 1397 1231 1070 950 923 576 1512 --1468
NM_138356chr155577 571 450 291 42 ------
NM_138357chr101390 ------
NM_138360chr141271 --142 1202
NM_138370chr23671 305 246 ------
NM_138391chr11229 133 ----
NM_138411chr191116 ------
NM_138415chr226739 704 510 302 193 187 --1714 --
NM_138423chr1521527 521 ----12273
NM_138437chrX--151 ----
NM_138444chr1363227 1739 287 101 87 76 ------
NM_138457chr6133341 3238 3181 3140 2908 2653 2627 2460 1232 1072 541 454 276 --2598 517 --
NM_138473chr12135051 5029 4801 4744 4563 4376 4365 4286 3981 3700 3585 188 162 ------
NM_138479chr131741 1526 1411 ------
NM_138492chr52391 305 ------
NM_138555chr151400 ------
NM_138558chr131215 1184 420 --1243 --
NM_138576chr1494445 4429 4258 4005 3984 1140 109 76 22 22982 707 1903 --
NM_138578chr2051394 1332 1131 1045 47 1896 11345 --
NM_138619chr17101628 1486 1363 1307 1122 614 554 438 129 72 --1273 290 50
NM_138633chr621242 285 ------
NM_138638chr1432087 1863 261 ------
NM_138693chr7155 ------
NM_138713chr1625904 5636 --16798 --
NM_138714chr1625904 5636 --16798 --
NM_138732chr118916 400 266 221 207 198 108 34 ------
NM_138734chr118916 400 266 221 207 198 108 34 ------
NM_138735chr211379 ------
NM_138779chr13160 ------
NM_138782chr522241 823 ------
NM_138795chr181601 1503 1457 1112 270 250 236 189 --1571 --
NM_138799chr2----21402 276 --
NM_138811chr71430 ------
NM_138927chr211142 ------
NM_138931chr32678 99 ------
NM_138959chr1145267 5013 4868 4763 4593 1425 1364 1309 1156 755 737 718 683 301 --35125 1025 629 --
NM_138966chr181217 ------
NM_138967chr15152510 2403 2220 2135 1904 1522 998 985 977 710 695 565 357 348 257 --1231 --
NM_138969chr83902 520 415 11262 1560 1302
NM_138970chr14----1252 --
NM_138971chr1153386 1136 530 393 132 1290 1955 --
NM_138971chr1153386 1136 530 393 132 1290 1955 --
NM_138972chr1153386 1136 530 393 132 1290 1955 --
NM_138972chr1153386 1136 530 393 132 1290 1955 --
NM_138973chr1153386 1136 530 393 132 1290 1955 --
NM_138973chr1153386 1136 530 393 132 1290 1955 --
NM_138981chr42545 104 ------
NM_138994chr161159 ------
NM_139012chr652162 858 350 241 87 ------
NM_139014chr652242 938 430 321 167 ------
NM_139015chr1251572 1357 1287 1167 178 11529 ----
NM_139062chr171399 ------
NM_139067chr121251 ------
NM_139068chr51262 ----1105
NM_139069chr51262 ----1105
NM_139070chr51131 ------
NM_139071chr12101601 1534 1479 1079 1049 663 362 210 65 52 --1521 --
NM_139125chr331557 1175 28 ------
NM_139135chr1171 ------
NM_139136chr121236 ----1143
NM_139159chr1931041 974 418 2157 132 1111 --
NM_139201chr121538 ------
NM_139244chr61815 ------
NM_139276chr1782195 2173 2137 1770 1722 1551 369 316 ------
NM_139312chr1011249 ------
NM_139343chr21183 --1413 --
NM_139344chr21183 --1413 --
NM_139345chr21183 --1413 --
NM_139346chr21183 --1413 --
NM_139347chr21183 --1413 --
NM_139349chr21183 --1413 --
NM_139350chr21183 --1413 --
NM_139351chr21183 --1413 --
NM_144488chr98694 591 484 282 254 195 71 63 --1214 --
NM_144489chr98694 591 484 282 254 195 71 63 --1214 --
NM_144568chr141252 1268 ----
NM_144571chr414300 ------
NM_144578chr1495218 4476 3623 3413 2210 1370 941 450 146 ------
NM_144579chr2102641 2623 2587 2437 2383 2302 2266 2098 1063 957 --12197 11842
NM_144582chr2102284 2227 1939 1873 971 734 598 565 300 269 --1106 --
NM_144586chr22947 454 ------
NM_144590chr1042117 2091 519 402 ------
NM_144599chr1565464 5181 4951 4579 3636 943 ------
NM_144600chr1651330 466 331 305 66 ------
NM_144628chr20102733 2658 2369 2272 2131 1987 398 387 329 222 --1130 --
NM_144629chr2129 ------
NM_144631chr22214 195 ------
NM_144632chr21942 ------
NM_144633chr331331 321 74 ------
NM_144635chr33488 401 202 ------
NM_144685chr195287 280 262 215 75 ------
NM_144691chr19----1260 --
NM_144707chr221068 842 1107 ----
NM_144726chr52836 289 ------
NM_144732chr197918 715 374 234 142 124 77 --21053 61 --
NM_144949chr211950 ------
NM_144973chr1262148 1864 1381 920 113 38 --13857 --
NM_144976chr194583 483 445 211 ------
NM_144982chr121224 ------
NM_144997chr179968 942 515 374 290 149 110 75 59 ------
NM_145008chr118750 553 345 133 89 56 38 23 ------
NM_145013chr11122654 2021 1941 969 950 861 845 760 487 416 31 25 ------
NM_145055chr1853508 3283 2393 618 581 ------
NM_145065chr115451 417 305 263 139 --11119 1363
NM_145112chr1431104 353 233 --1384 --
NM_145113chr1441376 625 505 256 ------
NM_145117chr1123262 1316 1149 ----
NM_145159chr142870 741 ------
NM_145171chr14186 --126 --
NM_145178chr10255 49 143 ----
NM_145185chr19121997 1973 1828 1809 1566 1537 1234 463 412 332 324 162 ------
NM_145206chr1032329 746 477 12804 ----
NM_145234chrX3702 148 90 ------
NM_145239chr163195 154 92 ------
NM_145253chr164676 553 207 114 ------
NM_145259chr265249 2323 1966 1373 1316 557 ------
NM_145260chr26586 526 284 199 164 128 ------
NM_145263chr421510 83 ----11906
NM_145284chrX41931 1842 751 281 ------
NM_145296chr192834 637 ------
NM_145305chrX21098 168 ------
NM_145307chr1033942 3382 2988 1635 11271 --
NM_145313chr1071315 1296 1159 1061 493 364 209 ------
NM_145330chr2142 ------
NM_145349chr1791895 1862 1836 1786 1656 1554 861 192 169 1743 21998 349 --
NM_145350chr17111247 1214 1188 1138 1008 493 483 366 349 315 213 2462 95 11350 --
NM_145686chr223401 848 ------
NM_145687chr223401 848 ------
NM_145690chr8271 26 ------
NM_145716chr12502 118 ------
NM_145733chr224945 348 294 142 ------
NM_145793chr101203 ------
NM_145798chr178916 866 812 281 229 123 101 48 --1777 --
NM_145800chrX2952 214 ------
NM_145802chrX2901 163 ------
NM_145804chr1151058 1040 1024 168 129 ------
NM_145805chr15141 ----1206
NM_145808chr732872 1216 960 ------
NM_145861chr141708 1626 1535 1505 ------
NM_145891chr1631559 1506 1192 ------
NM_145892chr1631559 1506 1192 ------
NM_145893chr1641681 1628 1314 115 ------
NM_145912chr22224416 4400 4257 3785 3616 3588 1714 1575 1501 1443 1433 1384 1300 1212 1017 897 864 825 330 319 177 162 11153 33705 1268 32 --
NM_146388chr1941007 860 838 473 ------
NM_147147chr643529 1556 1334 678 ------
NM_147161chr171169 1121 941 297 200 104 47 1127 ----
NM_147164chr92502 172 --2526 472 --
NM_147181chr4----11337 --
NM_147182chr4----11337 --
NM_147183chr4----11337 --
NM_147192chr1111329 1264 623 560 423 409 333 244 192 52 40 --1133 --
NM_147202chr992550 2178 1073 762 616 577 404 101 93 12354 1283 --
NM_147223chr252394 1709 797 743 553 ------
NM_147233chr252211 1526 614 560 370 ------
NM_148174chr811673 ------
NM_148918chr172650 88 ------
NM_152221chr225313 250 225 205 183 ------
NM_152222chr11111361 1254 1223 772 675 395 240 225 213 159 33 --31228 274 38 1257
NM_152233chr1421630 1384 ------
NM_152237chr22141779 1583 1514 1400 692 479 465 457 449 362 351 292 187 54 21230 666 21452 1276 --
NM_152245chr224467 150 118 25 ------
NM_152247chr224950 718 686 593 ------
NM_152253chr22154336 4104 4072 3979 3909 3778 3300 3076 2969 2903 1558 812 491 421 112 23340 1725 ----
NM_152263chr185801 5671 5641 5355 5304 2221 238 35 ------
NM_152264chr1171000 819 760 418 273 238 28 --2910 341 --
NM_152271chr811055 ------
NM_152272chr861260 1072 995 450 191 178 --11213 --
NM_152275chr22733 235 ------
NM_152277chr531804 1412 39 ------
NM_152280chr1103442 3186 2977 2896 2732 2395 2305 845 473 311 --12719 --
NM_152305chr371981 1832 699 684 365 358 296 ------
NM_152310chr102230 125 ------
NM_152335chr152207 131 ------
NM_152342chr162215 147 --275 42 --
NM_152344chr1741502 962 948 306 --11300 --
NM_152345chr178947 883 818 403 351 338 196 117 1722 21013 740 --
NM_152380chr131619 1299 1257 ------
NM_152384chr291630 1532 1490 1454 1406 1315 1279 627 489 --11345 --
NM_152399chr451154 407 325 299 208 --1115 --
NM_152409chr532651 2201 1277 ------
NM_152410chr61450 --1358 --
NM_152424chrX94002 3337 1854 1752 888 536 483 476 161 --14214 --
NM_152441chr12----1146 1585
NM_152450chr1541965 434 409 246 --11956 --
NM_152470chr1893440 3401 3093 2889 2587 1394 1263 1081 207 ------
NM_152493chr141504 1270 1008 151 --1585 --
NM_152527chr241835 1489 271 165 ------
NM_152529chr234366 3011 144 ------
NM_152536chr32415 156 ------
NM_152538chr331168 181 46 ------
NM_152550chr5162 --1165 --
NM_152553chr61187 ------
NM_152556chr722054 628 -----