TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-5095
miRNA Sequence: UUACAGGCGUGAACCACCGCG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr551857 1743 1501 1366 296 --11959 --
NM_000044chrX3329 125 62 ------
NM_000051chr1121087 705 1401 1933 1251
NM_000052chrX33208 2830 2370 --32405 735 426 --
NM_000067chr8--2592 232 ----
NM_000074chrX--1929 ----
NM_000081chr11535 21831 728 ----
NM_000084chrX116543 6277 5395 2550 2178 2147 1440 1428 1318 673 368 --22557 1297 --
NM_000088chr1721320 1227 ------
NM_000090chr21762 1825 1911 1607
NM_000091chr211959 12864 1724 --
NM_000109chrX22333 234 ------
NM_000112chr535524 5287 497 12146 21679 175 --
NM_000125chr643007 1681 491 339 24261 4209 --11652
NM_000129chr6144 ------
NM_000134chr421757 1091 ------
NM_000138chr1522370 2354 ----12642
NM_000141chr1041319 1145 99 85 1176 11087 --
NM_000161chr1421815 57 ------
NM_000163chr512359 ------
NM_000168chr772991 2750 2588 2223 1312 405 91 --1734 1706
NM_000176chr543747 413 328 78 21399 1316 1935 --
NM_000192chr122625 384 ------
NM_000210chr242083 2016 1888 1609 11769 ----
NM_000212chr1742080 529 177 155 --2601 37 22328 2281
NM_000214chr2041600 1188 418 107 --146 --
NM_000216chrX43975 1093 243 46 34005 3693 2642 23889 3435 --
NM_000217chr1244443 1666 1203 630 14909 11585 --
NM_000222chr442099 1451 739 670 ------
NM_000244chr11126 --1146 --
NM_000245chr722042 121 ------
NM_000248chr352988 2544 2333 302 175 1563 --1349
NM_000251chr2------150
NM_000259chr1565298 5027 4800 2441 2020 1844 34930 4192 1589 --21201 1066
NM_000264chr952244 701 472 382 112 --11025 1695
NM_000276chrX21720 259 32153 1989 601 ----
NM_000298chr12222 37 --1595 --
NM_000301chr62214 170 ------
NM_000310chr121150 274 ------
NM_000314chr1063075 2664 2549 924 713 647 ------
NM_000319chr124483 453 362 156 3844 355 23 ----
NM_000321chr132600 332 ------
NM_000332chr677026 6461 6206 5955 5029 4611 192 16907 17156 --
NM_000337chr566511 5908 4242 2105 1260 209 ------
NM_000346chr1721796 366 11831 ----
NM_000362chr2272464 1124 779 662 563 268 97 13593 ----
NM_000367chr622158 298 1865 11517 11811
NM_000368chr964846 4189 4054 4046 648 322 --23974 1672 --
NM_000391chr1131601 1467 28 ------
NM_000393chr221960 1311 ------
NM_000408chr263439 2723 2280 1389 1136 536 22832 1339 ----
NM_000415chr12298 51 ----1396
NM_000430chr1732906 2855 2551 32771 1128 473 23463 1143 --
NM_000434chr6----164 --
NM_000439chr551710 661 540 412 406 --22225 65 --
NM_000449chr171129 476 251 241 232 217 120 ------
NM_000454chr212307 225 ----1293
NM_000456chr121486 ------
NM_000459chr93877 744 230 ------
NM_000462chr1551424 477 341 285 159 ------
NM_000480chr1121648 1445 ----11397
NM_000489chrX12436 12812 --12229
NM_000494chr10192 ------
NM_000522chr721273 408 21179 310 ----
NM_000523chr211120 1448 ----
NM_000538chr1321731 1422 1121 199 --
NM_000555chrX77632 6826 6726 6630 5611 2753 347 56590 5413 1746 1436 168 21852 971 37639 5702 2562
NM_000572chr12983 854 1769 --1634
NM_000578chr211493 1192 ----
NM_000594chr6------1751
NM_000596chr73477 401 199 ------
NM_000609chr1053153 2539 2455 2393 893 22361 2234 ----
NM_000615chr1132884 2833 2412 32202 495 235 ----
NM_000618chr1246124 6050 4899 2569 ------
NM_000618chr1246124 6050 4899 2569 ------
NM_000627chr21222 ------
NM_000633chr1865234 4119 1742 1566 1151 540 11371 1991 1359
NM_000636chr62511 307 ------
NM_000663chr1633104 1144 1121 12477 ----
NM_000682chr251376 595 388 116 22 ----21839 1231
NM_000719chr12116379 6369 6121 5870 5832 5710 1689 1202 889 830 389 26658 6284 1365 --
NM_000721chr142222 984 730 513 ------
NM_000723chr1771325 1310 1209 1193 1077 559 208 --11340 --
NM_000724chr1031485 1344 46 22018 115 21802 453 11882
NM_000726chr2----11021 --
NM_000756chr8170 2408 381 ----
NM_000806chr511565 ------
NM_000808chrX1743 1786 ----
NM_000809chr488184 6729 6614 6219 6106 2967 1942 1910 37536 3444 1250 28382 6050 --
NM_000811chr52745 219 1125 ----
NM_000813chr565367 4904 4830 3713 266 135 21822 426 ----
NM_000814chr1553320 1204 408 80 62 12620 ----
NM_000817chr22361 152 11066 --1914
NM_000824chr41583 ------
NM_000826chr412266 1745 ----
NM_000827chr532328 1678 283 ------
NM_000829chr1132062 520 420 --22227 2215 12141
NM_000831chr1125621 5014 4935 4874 4828 4590 4513 4180 1951 1446 1319 118 ------
NM_000838chr632744 2428 1791 12723 12116 --
NM_000845chr73397 380 327 2406 128 ----
NM_000860chr421492 1425 ------
NM_000868chrX72586 1812 1803 1626 1008 617 140 12516 ----
NM_000870chr53647 563 70 ------
NM_000872chr1021229 998 --11458 --
NM_000875chr1587084 5935 4715 4425 1915 1611 421 100 --11255 --
NM_000876chr611353 --11335 --
NM_000891chr1733398 1289 46 ----12525
NM_000899chr1213062 11288 1405 --
NM_000901chr452531 2386 2367 351 42 11996 ----
NM_000924chr121964 11207 --1846
NM_000933chr2011150 31711 1678 548 --11362
NM_000944chr432202 2079 1748 21481 907 1970 --
NM_000945chr231869 1530 533 ----1618
NM_000963chr142498 686 615 587 41539 655 579 105 12333 --
NM_000965chr311190 ------
NM_000983chr1175 21595 1548 ----
NM_000984chr172428 66 ------
NM_000989chr8172 ------
NM_001001330chr1011284 1158 ----
NM_001001331chr331765 814 467 ------
NM_001001344chrX32493 1823 657 --12557 1522
NM_001001395chr1252747 2594 941 427 155 12216 ----
NM_001001433chr2033085 2903 2581 --22485 2434 22229 2107
NM_001001436chr162747 127 --1140 --
NM_001001481chr833200 1100 843 32968 2550 1057 --12525
NM_001001483chr11158 1350 ----
NM_001001484chr1032325 2126 1843 21916 384 ----
NM_001001502chr53601 164 152 --1141 --
NM_001001521chr21306 ------
NM_001001549chr752770 2360 946 698 63 12853 12037 12383
NM_001001550chr752770 2360 946 698 63 12853 12037 12383
NM_001001555chr752770 2360 946 698 63 12853 12037 12383
NM_001001664chr272989 2973 2952 2636 773 623 445 ------
NM_001001665chr22325 313 52978 2722 2179 478 151 22313 1315 22587 598
NM_001001669chr522252 2180 22610 1057 22422 345 --
NM_001001701chr441625 1478 748 728 1760 ----
NM_001001787chr11484 --150 --
NM_001001791chr1021581 1075 --11053 --
NM_001001852chr226826 767 653 638 626 193 ------
NM_001001872chr142214 153 ------
NM_001001924chr831376 756 686 2797 623 ----
NM_001001925chr831376 756 686 2797 623 ----
NM_001001931chr831376 756 686 2797 623 ----
NM_001001933chr11406 --1444 --
NM_001001974chr1021737 475 12214 1898 --
NM_001002032chr17183 ------
NM_001002033chr173183 49 34 ------
NM_001002243chr22643 347 ------
NM_001002257chr273410 3187 3092 3055 2542 1017 610 13568 ----
NM_001002264chr132264 96 ------
NM_001002295chr1021126 171 --1988 --
NM_001002814chr843001 2799 1427 914 1957 13441 21169 1034
NM_001002838chrX31606 1164 172 ------
NM_001002843chr153809 379 134 1974 ----
NM_001002860chr1494567 4312 4193 4129 3961 3453 320 303 22 23650 850 24718 991 --
NM_001002862chr2251716 1606 1521 838 787 --12248 11786
NM_001002914chr175964 843 801 236 197 1856 11042 --
NM_001003407chr1094983 4615 4024 4013 3946 3837 1863 1782 458 14939 --15032
NM_001003408chr1094983 4615 4024 4013 3946 3837 1863 1782 458 14939 --15032
NM_001003652chr18118653 8615 8047 5321 3434 3347 3095 2637 1405 924 531 38573 7557 2474 36262 2421 908 --
NM_001003674chr18117040 6624 5606 4960 2117 1962 1938 1843 656 637 500 12765 --16967
NM_001003675chr18117040 6624 5606 4960 2117 1962 1938 1843 656 637 500 12765 --16967
NM_001003681chr2251971 1766 597 314 263 ------
NM_001003712chr1212860 34037 2752 1048 ----
NM_001003792chr331126 997 21 ------
NM_001003793chr331126 997 21 ------
NM_001003800chr933454 1189 608 --1702 1715
NM_001003940chr1543075 3050 2950 246 12689 21236 844 --
NM_001003942chr1543075 3050 2950 246 12689 21236 844 --
NM_001003943chr1543079 3054 2954 250 12693 21240 848 --
NM_001004023chr1----1185 --
NM_001004051chrX2315 77 ------
NM_001004065chr963897 3882 3415 3288 3253 865 ------
NM_001004196chr341208 1104 910 211 ------
NM_001004298chr102797 753 ------
NM_001004304chr1253191 2361 2086 1099 1025 22217 177 ----
NM_001004317chr6114433 4264 3211 3162 3042 2747 1649 1561 822 256 216 23298 855 ----
NM_001004342chr1106044 5391 4890 4726 3955 3780 1968 1150 1091 337 --14001 130
NM_001004356chr41131 11474 ----
NM_001004358chr41131 11474 ----
NM_001004360chr211296 1307 --11455
NM_001004419chr1234554 1596 1277 23557 1484 1830 --
NM_001004720chr22733 684 1323 ----
NM_001004722chr22902 853 1492 ----
NM_001005209chr22645 268 1530 ----
NM_001005271chr1721129 1110 ------
NM_001005273chr1721129 1110 ------
NM_001005335chr19193 ------
NM_001005366chr121686 ------
NM_001005375chrY2211 202 21658 493 ----
NM_001005404chr1744436 4315 2849 1438 21641 1384 --13130
NM_001005417chr11665 ------
NM_001005463chr1052639 2566 825 697 411 ------
NM_001005473chr555653 4359 4291 2311 1944 22050 68 26564 4483 --
NM_001005474chr331572 1546 65 ------
NM_001005505chr311384 11802 1451 --
NM_001005611chrX1476 ------
NM_001005738chr19--1720 ----
NM_001005739chr22774 328 ----175
NM_001005746chr2----11021 --
NM_001005747chr2----11021 --
NM_001005782chr221015 281 --1733 --
NM_001005861chr33755 61 40 ------
NM_001006115chr372785 2759 2653 2408 1878 1754 1721 --12366 --
NM_001006610chr161906 ------
NM_001006612chrX1391 ------
NM_001006613chrX1391 ------
NM_001006614chrX1391 ------
NM_001006636chr23294 162 126 ------
NM_001006641chr941140 421 401 170 ------
NM_001006642chr941140 421 401 170 ------
NM_001006643chr941140 421 401 170 ------
NM_001006939chr102708 190 ----1718
NM_001006945chr12473 108 ------
NM_001007067chr821117 63 ------
NM_001007068chr821117 63 ------
NM_001007069chr821117 63 ------
NM_001007070chr821117 63 ------
NM_001007075chr41433 --1888 --
NM_001007097chr964048 4013 1304 1286 1101 43 25003 1586 14359 14922
NM_001007102chr631184 557 475 ------
NM_001007224chr741861 1569 474 52 12000 1335 --
NM_001007246chr21--11749 ----
NM_001007257chr131439 1221 372 ------
NM_001007466chr694900 4546 3977 2071 1503 815 471 296 252 34414 3716 1604 24326 976 --
NM_001008220chr553971 2818 2536 1402 473 ------
NM_001008225chr71263 ------
NM_001008239chr1841385 932 370 356 22886 2647 13818 --
NM_001008391chr111166 1263 ----
NM_001008405chr721748 672 ------
NM_001008495chr812079 1369 1222 --
NM_001008539chr821212 517 21516 613 --15207
NM_001008540chr22487 106 ------
NM_001008660chr1121548 1246 ------
NM_001008701chr1952497 2381 2338 2048 774 1341 12404 --
NM_001008738chr572912 2887 2630 2505 2131 2102 507 11162 --11131
NM_001008801chr1911757 3415 387 48 --11351
NM_001008860chr152753 156 ------
NM_001008892chr152753 156 ------
NM_001008894chr152753 156 ------
NM_001009554chr444737 1291 957 638 33046 1789 54 ----
NM_001009554chr444737 1291 957 638 33046 1789 54 ----
NM_001009571chr721684 277 2329 75 1116 --
NM_001009880chr2244776 3781 1102 219 34656 3349 1374 14021 --
NM_001009881chr12567 483 --1610 --
NM_001009882chr12567 483 --1610 --
NM_001009899chr375207 5112 4611 2497 2119 1451 1171 24730 1747 35481 4860 108 --
NM_001009955chr11510 --1571 --
NM_001009955chr11510 --1571 --
NM_001009958chr72436 186 ------
NM_001009959chr221874 399 --11837 --
NM_001009960chr712102 ----11833
NM_001009993chr284143 4042 1496 1440 1286 1187 1143 400 13380 13965 --
NM_001010844chr6129 ------
NM_001010853chr642718 2161 1008 79 ----12661
NM_001010854chr142598 65 ------
NM_001010888chrX43452 3446 1825 1017 23584 144 --13213
NM_001010891chr545755 5642 1382 771 --26178 166 --
NM_001010908chr103507 482 151 ------
NM_001010922chr174165 4008 3422 2863 1709 1631 1125 14229 ----
NM_001010927chr6--1207 1536 --
NM_001011513chr423232 213 12821 31294 823 520 31162 683 548
NM_001011515chr4181 1957 ----
NM_001011516chr4181 1957 ----
NM_001011537chr31204 12027 11746 --
NM_001011545chr212662 209 ------
NM_001011553chr72962 192 ------
NM_001011645chrX3329 125 62 ------
NM_001011658chrX12099 11844 12023 --
NM_001011666chr764877 4413 4113 2101 1532 281 15211 15433 --
NM_001011705chr13----1280 --
NM_001011708chr242721 2457 2298 2086 11147 22219 446 12941
NM_001011722chr1----1437 --
NM_001011722chr1----1437 --
NM_001012267chr911221 --21729 1592 --
NM_001012337chr3193 ------
NM_001012393chr1154830 3792 3293 1129 600 --11239 --
NM_001012420chr1512465 22854 2100 12136 --
NM_001012423chr1512465 22854 2100 ----
NM_001012426chr6103376 3210 3125 2905 2501 2081 1154 759 600 590 ------
NM_001012427chr6103376 3210 3125 2905 2501 2081 1154 759 600 590 ------
NM_001012506chr31129 ------
NM_001012514chr21159 --191 --
NM_001012516chr21159 --191 --
NM_001012614chr46644 486 259 194 178 162 ------
NM_001012755chrX64774 4346 3384 1729 1565 881 ------
NM_001012968chrX52744 2508 2294 960 872 2436 206 ----
NM_001012989chrX2640 620 1656 ----
NM_001013399chr62984 100 ------
NM_001013415chr421086 369 ------
NM_001013437chr182459 112 ----143
NM_001013438chr32894 629 --1211 --
NM_001013439chr31740 --157 --
NM_001013620chr1236730 895 592 47274 6950 5143 2772 --16391
NM_001013635chr121975 ------
NM_001013642chr11869 --11050 --
NM_001013843chr151897 151 ----
NM_001014764chr17--1116 --1156
NM_001014797chr1088210 7210 7137 2835 2777 2346 1681 777 28187 8158 ----
NM_001014809chr44946 690 634 351 1665 ----
NM_001014812chr15--1467 --1153
NM_001015048chr1472990 2645 2600 2480 839 537 208 22630 715 ----
NM_001015049chr1472990 2645 2600 2480 839 537 208 22630 715 ----
NM_001015053chr1751498 1388 621 261 156 --11184 --
NM_001015508chr81521 ------
NM_001015880chr1031706 427 371 ------
NM_001015881chrX21159 357 --11164 --
NM_001015887chr32675 313 1426 ----
NM_001017368chr173342 212 157 12097 1993 --
NM_001017395chr312436 --13421 --
NM_001017406chr1------2179 45
NM_001017415chr14786 669 602 231 ------
NM_001017416chr14786 669 602 231 ------
NM_001017424chr11193 11434 ----
NM_001017425chr11193 11434 ----
NM_001017926chr81334 21549 231 ----
NM_001017979chr4198 ----1539
NM_001017992chr521559 1362 ------
NM_001017999chr13910 523 40 1204 --1466
NM_001017999chr13910 523 40 1204 --1466
NM_001018000chr13910 523 40 1204 --1466
NM_001018000chr13910 523 40 1204 --1466
NM_001018001chr13910 523 40 1204 --1466
NM_001018009chr31831 --11105 --
NM_001018056chr91140 1226 ----
NM_001018065chr945030 1380 761 29 35691 4118 637 ----
NM_001018066chr945030 1380 761 29 35691 4118 637 ----
NM_001018067chr144900 4874 4695 1454 1931 13857 13770
NM_001018068chr144900 4874 4695 1454 1931 13857 13770
NM_001018069chr144900 4874 4695 1454 1931 13857 13770
NM_001018074chr543747 413 328 78 21399 1316 1935 --
NM_001018075chr543747 413 328 78 21399 1316 1935 --
NM_001018076chr543747 413 328 78 21399 1316 1935 --
NM_001018077chr543747 413 328 78 21399 1316 1935 --
NM_001018115chr3----1636 147
NM_001020658chr131605 1054 258 31577 1458 1393 ----
NM_001020658chr131605 1054 258 31577 1458 1393 ----
NM_001020818chr1961740 537 515 495 445 217 ----11231
NM_001020819chr1961740 537 515 495 445 217 ----11231
NM_001020820chr1961740 537 515 495 445 217 ----11231
NM_001020821chr1961740 537 515 495 445 217 ----11231
NM_001023560chr61878 ------
NM_001024094chr543747 413 328 78 21399 1316 1935 --
NM_001024218chr143798 727 110 2816 60 ----
NM_001024460chr641272 1136 1118 951 ------
NM_001024463chr154987 832 383 277 ------
NM_001024649chr552272 796 681 208 146 ------
NM_001024660chr331393 680 655 ------
NM_001024668chr12184 2918 816 ----
NM_001024680chr231449 1273 1120 11354 1544 21714 1579
NM_001024688chr841780 869 726 686 ------
NM_001024847chr332286 2229 674 1127 1287 --
NM_001024855chr331907 1188 217 31703 1505 500 ----
NM_001024934chr6158 --1459 --
NM_001024935chr6158 --1459 --
NM_001024936chr6158 --1459 --
NM_001024947chr51754 ----1417
NM_001024948chr153533 3316 3149 2577 249 33218 2592 2562 ----
NM_001024959chr31786 --2728 280 --
NM_001024960chr31786 --2728 280 --
NM_001025068chr341800 1776 1666 1627 ------
NM_001025069chr341800 1776 1666 1627 ------
NM_001025076chr1051784 1249 978 315 91 ----1514
NM_001025077chr1075060 2607 2336 1673 1449 565 67 ----21872 833
NM_001025079chr331312 1112 558 33956 3542 1494 ----
NM_001025108chr263009 2752 2658 1670 1232 1225 1846 2804 188 --
NM_001025201chr2174 1170 ----
NM_001025233chr1252133 1842 1092 443 52 ------
NM_001025366chr621573 332 ------
NM_001025366chr621573 332 ------
NM_001025367chr621573 332 ------
NM_001025367chr621573 332 ------
NM_001025368chr621573 332 ------
NM_001025368chr621573 332 ------
NM_001025369chr621589 348 ------
NM_001025369chr621589 348 ------
NM_001025370chr621573 332 ------
NM_001025370chr621573 332 ------
NM_001025389chr1121648 1445 ----11397
NM_001025390chr1121648 1445 ----11397
NM_001025580chrX33198 1511 678 33996 1323 942 --14247
NM_001025595chr451563 1497 576 538 268 ------
NM_001025603chr171129 476 251 241 232 217 120 ------
NM_001025616chr421582 293 --11519 --
NM_001029858chr642552 846 142 64 1736 13381 --
NM_001029859chr1151535 755 719 332 108 21762 365 11776 11894
NM_001029875chr532828 2395 952 11131 ----
NM_001029884chr642611 875 644 624 2503 371 ----
NM_001030006chr1772544 2517 1783 872 734 546 137 1182 ----
NM_001030007chr1653324 2700 1221 992 934 11141 13437 --
NM_001030055chr1454141 3624 653 561 282 2794 756 ----
NM_001030272chr11168 1426 ----
NM_001030273chr11168 1426 ----
NM_001031681chr1772240 728 620 568 468 453 173 22163 1457 1774 --
NM_001031684chr231481 1264 435 ----172
NM_001031689chr9--1125 ----
NM_001031690chr722386 279 ------
NM_001031695chr2245052 4762 4660 4626 23381 799 21265 295 --
NM_001031696chr19----1310 --
NM_001031716chr22382 327 ------
NM_001031732chr462966 2503 1153 1142 927 47 11081 ----
NM_001031740chr1--21741 1435 41569 498 280 247 1355
NM_001031804chr1633064 1568 310 ------
NM_001031812chr531944 1767 74 1384 ----
NM_001031855chrX--164 ----
NM_001032221chr991800 1790 1711 1580 1118 681 445 330 89 --1704 --
NM_001032280chr641319 1245 686 248 --11596 --
NM_001032282chr8185 ------
NM_001032288chr202440 96 31545 1079 1040 1476 --
NM_001032293chr172547 445 ------
NM_001032296chr1362864 2780 2299 1937 940 513 --12450 --
NM_001032363chr152160 1648 1549 801 158 22028 97 ----
NM_001032363chr152160 1648 1549 801 158 22028 97 ----
NM_001032380chr102361 276 21312 437 --11718
NM_001032386chr121486 ------
NM_001032387chr121486 ------
NM_001032393chrX2720 217 2589 500 ----
NM_001032999chr2074975 4249 4035 3795 1656 794 727 32143 2095 1955 14707 --
NM_001033044chr131656 1178 519 11248 ----
NM_001033045chr234212 902 165 22741 124 31372 1305 816 31215 507 370
NM_001033047chr44728 456 324 252 ------
NM_001033056chr131656 1178 519 11248 ----
NM_001033057chr382094 2070 1887 1803 1592 1551 1391 288 --11337 --
NM_001033081chr121687 1366 ------
NM_001033082chr121687 1366 ------
NM_001033087chr2033101 2897 2772 1254 11026 --
NM_001033557chr241372 1303 1245 125 ----11183
NM_001033561chr172909 902 --130 --
NM_001033659chr1711601 2478 67 1201 --
NM_001033667chr11218 ------
NM_001033756chr621507 266 ------
NM_001033756chr621507 266 ------
NM_001034841chr1655556 4050 2057 1345 284 14824 --22141 989
NM_001034852chr1432077 1697 1618 --11961 --
NM_001034853chrX11090 21075 965 ----
NM_001034954chr1072764 1152 1030 866 743 712 157 21192 456 ----
NM_001034955chr1072764 1152 1030 866 743 712 157 21192 456 ----
NM_001034956chr1072764 1152 1030 866 743 712 157 21192 456 ----
NM_001034957chr1072764 1152 1030 866 743 712 157 21192 456 ----
NM_001035chr121295 396 11052 ----
NM_001035005chr181508 168 ----
NM_001035511chr121438 425 12073 1316 --
NM_001035512chr121545 532 12180 1423 --
NM_001035513chr121545 532 12180 1423 --
NM_001037164chr721960 89 --11903 --
NM_001037165chr7118713 8464 8222 7438 6527 6358 6339 3127 2867 2047 454 18370 57688 2251 2143 1123 114 27947 2977
NM_001037172chr331402 1015 76 1451 ----
NM_001037174chr242188 1837 655 617 ------
NM_001037225chr11191 ------
NM_001037332chr532538 2452 1980 --1159 --
NM_001037333chr532538 2452 1980 --1159 --
NM_001037334chr1822022 412 --1911 22206 1860
NM_001037533chr11691 1225 180 --
NM_001037558chr112506 220 ------
NM_001037582chr421162 74 ------
NM_001037631chr211103 ------
NM_001037954chr1162824 2495 2316 673 365 312 ----22684 1265
NM_001038493chr21583 11334 ----
NM_001038702chr541056 726 622 590 12393 22717 926 --
NM_001039091chrX1443 --11348 --
NM_001039350chr741775 1393 1230 552 21172 504 ----
NM_001039395chr951897 1717 579 139 96 ------
NM_001039465chr14----1425 --
NM_001039538chr253708 3592 3515 2980 2741 32266 1483 985 ----
NM_001039547chr328063 2909 35360 5115 1008 37532 5636 855 45502 4958 2210 2080
NM_001039550chr21327 --2684 169 --
NM_001039577chr1104471 4429 3940 3914 3819 3184 1720 1441 728 257 ------
NM_001039580chr494935 4843 4531 4453 3641 1840 1459 1327 305 ------
NM_001039585chr174200 3489 2974 1559 1452 644 339 34087 4080 28 11317 13589
NM_001039590chrX43384 2629 1482 981 ------
NM_001039591chrX43384 2629 1482 981 ------
NM_001039618chr11------25790 4334
NM_001039709chr2074975 4249 4035 3795 1656 794 727 32143 2095 1955 14707 --
NM_001039802chr121335 322 1336 ----
NM_001039840chrX94592 4317 4009 3826 2348 1386 817 190 58 44020 3910 558 384 25902 4331 --
NM_001039845chr22590 189 --1628 1540
NM_001039888chr11733 ------
NM_001039937chr1333863 2762 261 --11652 --
NM_001040001chr631258 596 539 ----1831
NM_001040110chr741625 1581 1572 411 ------
NM_001040142chr212121 ----1712
NM_001040143chr212121 ----1712
NM_001040151chr1174480 3572 3265 2976 777 547 318 12779 14555 --
NM_001040153chr132381 262 ------
NM_001040157chr462882 2694 1934 1155 928 428 ------
NM_001040172chr53647 563 70 ------
NM_001040173chr53647 563 70 ------
NM_001040202chr472515 2139 2017 1981 1872 1010 160 12255 1209 --
NM_001040214chr61502 --2719 665 11643
NM_001040272chr921722 398 11885 31755 866 694 --
NM_001040284chr1655360 2317 1363 1088 1072 15634 14434 14871
NM_001040402chr4--23127 2903 --12983
NM_001040429chr1352780 2359 1376 555 213 13495 ----
NM_001040439chr1641469 1358 578 29 ------
NM_001040446chr542720 2671 1889 200 --1628 1542
NM_001040450chr1531765 254 89 ----22669 1056
NM_001040453chr1531765 254 89 ----22669 1056
NM_001040619chr131113 542 245 11595 ----
NM_001040624chr862649 1892 885 202 115 37 21842 346 12315 12532
NM_001040625chr862649 1892 885 202 115 37 21842 346 12315 12532
NM_001040626chr862649 1892 885 202 115 37 21842 346 12315 12532
NM_001040627chr862649 1892 885 202 115 37 21842 346 12315 12532
NM_001040628chr862649 1892 885 202 115 37 21842 346 12315 12532
NM_001040629chr862649 1892 885 202 115 37 21842 346 12315 12532
NM_001040630chr862649 1892 885 202 115 37 21842 346 12315 12532
NM_001040694chr114399 185 80 56 1261 1971 1900
NM_001040709chr152542 1909 983 959 273 --11951 --
NM_001040712chr943445 2714 2333 535 33435 3078 673 13554 --
NM_001042353chr201578 ------
NM_001042355chr1675401 4784 3966 3605 2150 1988 1681 21641 1411 --14286
NM_001042412chr1675401 4784 3966 3605 2150 1988 1681 21641 1411 --14286
NM_001042413chr983832 3519 3444 2969 2792 1083 836 677 ------
NM_001042425chr641319 1245 686 248 --11596 --
NM_001042453chrX31553 591 225 31715 1329 518 ----
NM_001042459chr31236 ------
NM_001042473chr1032062 1844 1736 --21513 722 --
NM_001042478chr1153 ------
NM_001042479chrX3457 138 70 ----32139 796 664
NM_001042480chrX3457 138 70 ----32139 796 664
NM_001042481chr1452471 1744 1729 770 477 ----1627
NM_001042486chr2021483 356 11535 ----
NM_001042494chr1573849 3467 3144 3102 814 155 110 11381 23679 103 11516
NM_001042495chr1573849 3467 3144 3102 814 155 110 11381 23679 103 11516
NM_001042496chr1573849 3467 3144 3102 814 155 110 11381 23679 103 11516
NM_001042497chr1573849 3467 3144 3102 814 155 110 11381 23679 103 11516
NM_001042533chr31834 1470 ----
NM_001042537chrX4916 507 206 150 ------
NM_001042548chr23684 643 587 --1787 --
NM_001042555chr1231383 1303 1108 11861 1584 11023
NM_001042599chr277739 7225 6711 6468 6373 6255 2928 27041 5797 --17349
NM_001042601chr332337 741 384 1322 ----
NM_001042603chr1295343 4959 4510 3635 3617 3270 1486 1458 581 35353 4163 1938 ----
NM_001042604chr354225 3990 1798 1571 1281 24125 238 14425 --
NM_001042669chr421582 293 --11519 --
NM_001042681chr142203 2014 1834 1825 --2970 834 1536
NM_001042682chr142203 2014 1834 1825 --2970 834 1536
NM_001042682chr142203 2014 1834 1825 --2970 834 1536
NM_001042749chrX31923 720 88 ------
NM_001042750chrX31923 720 88 ------
NM_001042751chrX31923 720 88 ------
NM_001042762chr73884 111 31 ------
NM_001042784chr4--1125 ----
NM_001043318chr1474141 3594 3176 2578 1021 996 680 --23937 3331 13838
NM_001044305chr621257 390 1626 1149 --
NM_001044385chr273749 3720 3651 2805 1577 744 622 1738 ----
NM_001044722chr531944 1767 74 1384 ----
NM_001044723chr531944 1767 74 1384 ----
NM_001046chr542442 2347 1190 458 ------
NM_001048183chr131326 1318 1070 23740 2399 1336 21189 749
NM_001049chr1422023 1948 --12046 --
NM_001050chr175999 411 388 367 162 11237 --11372
NM_001068chr3----1217 --
NM_001069chr61159 171 ----
NM_001071775chr1321921 307 21283 568 11965 --
NM_001079874chr141819 1758 1667 229 11718 12078 --
NM_001083620chr412264 1744 ----
NM_001092chr1762347 1728 1717 1635 587 167 12195 1667 11813
NM_001094chr172328 322 1672 2683 633 --
NM_001096chr175846 751 729 581 537 1801 --1757
NM_001099678chr336279 4697 4657 16438 24892 502 --
NM_001100108chr198246 7666 6410 5941 3197 3112 1089 755 69 1771 46460 5568 5244 1040 36207 6075 5435
NM_001104548chr11190 2172 165 ----
NM_001106chr3109714 9347 9231 9003 8013 7564 3094 2858 1518 21 38457 8449 1642 49271 7774 3820 3178 --
NM_001117chr1852191 1987 1612 824 24 --11581 11823
NM_001123chr101697 1642 1159 --
NM_001128chr1653324 2700 1221 992 934 11141 13437 --
NM_001146chr8----11845 11584
NM_001148chr422011 407 ------
NM_001151chr41239 ------
NM_001157chr102129 74 1638 3672 484 284 --
NM_001160chr1242762 2744 1051 500 22211 1909 1354 12427
NM_001167chrX66417 2688 2502 1885 1365 370 --56168 6126 5333 2296 1319 26036 4176
NM_001172chr141550 ------
NM_001173chr1454141 3624 653 561 282 2794 756 ----
NM_001177chr1232212 646 344 22227 567 11843 1742
NM_001178chr11168 1426 ----
NM_001179chr41192 ------
NM_001186chr2112379 32962 2766 1013 ----
NM_001198chr671984 858 721 500 269 249 218 22043 437 276 62 --
NM_001199chr81221 ------
NM_001201chr483652 3528 3081 2599 2569 1521 598 353 13636 21445 589 --
NM_001204chr246810 5179 1832 244 46908 6510 2542 546 14979 14847
NM_001222chr101185 ------
NM_001241chr252219 1912 1623 953 500 12414 --1639
NM_001241chr252219 1912 1623 953 500 12414 --1639
NM_001244chr921046 893 ------
NM_001257chr1661414 1258 1168 942 373 340 --1161 --
NM_001259chr754584 4176 1731 778 227 15188 --1820
NM_001260chr13----1299 --
NM_001280chr192678 99 ------
NM_001282chr1772544 2517 1783 872 734 546 137 1182 ----
NM_001290chr41873 ------
NM_001304chr1743848 2566 1315 990 23051 1044 12552 --
NM_001310chr122619 376 33005 540 121 ----
NM_001313chr44946 690 634 351 1665 ----
NM_001316chr201388 2479 122 ----
NM_001328chr46644 486 259 194 178 162 ------
NM_001331chr1142832 2153 2044 963 2752 176 ----
NM_001332chr561089 1041 996 988 455 107 ------
NM_001356chrX32271 1671 1538 ------
NM_001364chr1154674 4210 4189 3354 2981 34231 4010 409 --14164
NM_001385chr8----1285 --
NM_001386chr882143 2026 1566 1507 817 650 608 338 ----1114
NM_001390chr1832827 2701 95 33229 2611 318 1660 --
NM_001391chr1821021 782 21146 444 --11118
NM_001402chr62529 301 21968 1844 --11609
NM_001412chrX73386 3379 3202 2700 2450 1308 479 22539 925 21160 502 12425
NM_001417chr1221892 1243 ------
NM_001418chr111735 --1475 --
NM_001418chr111735 --1475 --
NM_001419chr1923523 883 13949 --11422
NM_001426chr23736 623 300 ------
NM_001430chr241818 364 355 67 11575 ----
NM_001432chr473518 3422 3380 2850 2440 1199 521 33645 713 353 ----
NM_001438chr123144 1394 23603 3476 ----
NM_001449chrX11225 21000 25 ----
NM_001452chr6----1643 --
NM_001453chr621726 1125 21168 401 ----
NM_001454chr171235 ------
NM_001457chr341001 204 88 53 ------
NM_001462chr19--1720 ----
NM_001483chr72411 122 ------
NM_001491chr662607 2587 1753 630 570 57 32159 1743 875 --12295
NM_001494chr101753 --1568 --
NM_001498chr631330 1146 852 --1254 --
NM_001514chr12148 46 ------
NM_001518chr7187 2850 401 ----
NM_001527chr663395 3044 1840 705 409 356 34592 1586 1477 ----
NM_001533chr19193 ------
NM_001543chr5114727 4244 4056 3805 3710 3447 3154 1638 1475 880 736 ------
NM_001546chr6----11154 --
NM_001554chr12464 261 ------
NM_001587chrX21720 259 32153 1989 601 ----
NM_001610chr113651 521 167 --1610 --
NM_001614chr173441 232 189 --1139 1560
NM_001614chr173441 232 189 --1139 1560
NM_001616chr273357 2734 2569 2275 1203 489 339 11146 --1776
NM_001621chr722835 2372 --22723 2130 11998
NM_001621chr722835 2372 --22723 2130 11998
NM_001635chr72378 260 11049 ----
NM_001650chr1864135 4122 1580 1206 793 737 11494 --13702
NM_001654chrX1461 ------
NM_001655chr1131973 1508 731 12136 ----
NM_001656chr531929 1588 672 ------
NM_001660chr3154 ------
NM_001661chr172761 536 ----2573 76
NM_001663chr1422607 472 --12681 --
NM_001668chr141838 814 580 362 174 --1490
NM_001677chr121122 280 ------
NM_001679chr32183 43 ------
NM_001683chr331765 814 467 ------
NM_001690chr322398 272 ------
NM_001694chr163311 147 116 ------
NM_001695chr841562 1492 1453 528 11577 44271 3173 851 146 1214
NM_001706chr31974 ------
NM_001709chr1142691 2645 1879 1152 11132 ----
NM_001731chr123751 668 322 --1684 1212
NM_001742chr731776 675 413 ------
NM_001743chr22473 33 178 ----
NM_001746chr552272 796 681 208 146 ------
NM_001748chr121056 814 21088 263 ----
NM_001753chr721740 1187 31852 1715 1355 ----
NM_001755chr1632067 1628 847 1882 ----
NM_001759chr1265081 4782 4385 3849 388 229 ----11199
NM_001760chr61107 ------
NM_001777chr331312 1112 558 33956 3542 1494 ----
NM_001788chr72962 192 ------
NM_001791chr121335 322 1336 ----
NM_001797chr16--1551 ----
NM_001800chr192493 477 ------
NM_001806chr1922754 30 22378 175 ----
NM_001819chr201194 ------
NM_001822chr2174 1170 ----
NM_001830chrX31104 595 291 13012 13808 --
NM_001845chr133920 361 87 --1446 --
NM_001855chr91619 ------
NM_001895chr201124 21126 1062 1928 --
NM_001896chr162330 23 ------
NM_001901chr61753 --1391 --
NM_001907chr162296 72 ------
NM_001923chr111455 ------
NM_001931chr112225 121 ------
NM_001933chr14--11356 ----
NM_001936chr741775 1393 1230 552 21172 504 ----
NM_001938chr131215 729 467 182 ----
NM_001942chr1821888 694 11831 21915 261 --
NM_001945chr511395 --11041 --
NM_001946chr124942 833 446 236 1344 1123 --
NM_001951chr8--1438 1613 --
NM_001956chr1172 --1523 --
NM_001964chr52412 402 ------
NM_001967chr3------1237
NM_001968chr42818 163 1275 ----
NM_001980chr1231924 1510 760 21403 124 ----
NM_001981chr132024 1486 361 3289 121 87 22090 274 12238
NM_001992chr532240 1912 1850 --22157 494 11716
NM_001999chr521500 1345 ----1341
NM_002006chr445544 1082 560 504 25586 4590 ----
NM_002015chr1342439 1192 592 184 12485 --1852
NM_002017chr111998 --11015 --
NM_002024chrX31687 809 441 21657 1602 ----
NM_002025chrX58991 7176 6077 5824 2302 49220 7349 2158 139 49097 7975 6181 3096 --
NM_002035chr1844002 2873 1268 591 11445 13283 --
NM_002040chr213870 669 468 ------
NM_002051chr1021126 171 --1988 --
NM_002056chr24822 816 602 233 ------
NM_002061chr161809 1524 1218 603 194 138 31858 1250 28 --41724 1382 1180 84
NM_002062chr621593 1127 --11086 --
NM_002063chrX--11223 --150
NM_002065chr131656 1178 519 11248 ----
NM_002069chr73521 387 64 21728 453 ----
NM_002076chr1263164 2056 1135 953 671 425 --174 --
NM_002086chr1792022 1810 1655 1596 1385 784 516 431 391 1127 --31825 656 92
NM_002090chr4----2552 188 --
NM_002092chr494746 4556 3244 1824 1584 1389 1140 1119 1047 44912 3767 3540 1483 --1395
NM_002107chr11475 1495 ----
NM_002114chr61451 ------
NM_002126chr1744147 3459 3370 169 --22727 717 --
NM_002128chr1332578 781 56 22197 384 ----
NM_002129chr42289 145 ------
NM_002136chr121656 ------
NM_002139chrX1239 ------
NM_002141chr71169 --1437 --
NM_002146chr1721426 1080 --1911 --
NM_002147chr174883 290 253 158 ----1766
NM_002148chr21600 1194 ----
NM_002149chr23733 651 41 ------
NM_002166chr21513 ------
NM_002192chr72627 483 ------
NM_002202chr52757 142 ------
NM_002226chr144933 679 588 162 ------
NM_002232chr131324 472 175 1513 ----
NM_002233chr112465 156 ------
NM_002241chr152336 820 612 457 138 1828 ----
NM_002247chr102597 95 ------
NM_002253chr431310 197 178 1358 ----
NM_002254chr21314 ------
NM_002264chr374975 4595 4139 1893 1863 1325 28 22009 858 11852 13920
NM_002265chr1711061 ------
NM_002266chr171167 1224 ----
NM_002267chr1322219 1662 --1752 --
NM_002268chr311615 21163 389 1742 11866
NM_002270chr545407 4847 3799 1187 31630 1299 668 12206 --
NM_002271chr132671 422 12392 11512 --
NM_002285chr263009 2752 2658 1670 1232 1225 1846 2804 188 --
NM_002290chr621443 233 ------
NM_002296chr121595 180 21253 1123 1106 --
NM_002306chr14--1110 ----
NM_002310chr596555 6440 5483 2474 2224 2078 1353 1203 299 34614 1502 95 13989 16068
NM_002313chr1094983 4615 4024 4013 3946 3837 1863 1782 458 14939 --15032
NM_002315chr113225 217 31 --1209 --
NM_002334chr1161609 1404 244 178 99 30 11945 ----
NM_002336chr1295013 4424 4026 3997 3596 3335 3069 1615 210 11394 14239 --
NM_002351chrX121 21519 123 ----
NM_002354chr22360 140 ------
NM_002356chr622778 2750 ----12868
NM_002359chr1743606 1247 1226 142 1939 13623 --
NM_002361chr191254 --1318 --
NM_002374chr253708 3592 3515 2980 2741 32266 1483 985 ----
NM_002375chr362272 2236 2194 2010 1425 719 ------
NM_002376chr141546 --1476 --
NM_002382chr1421219 36 ------
NM_002387chr565033 4309 3422 1318 812 450 55011 3743 1966 1691 352 13384 --
NM_002389chr131742 279 186 11508 ----
NM_002397chr522238 230 1817 ----
NM_002398chr211370 ------
NM_002399chr1521391 279 ------
NM_002401chr1762382 1721 1682 616 207 134 --1626 --
NM_002406chr52822 264 --187 --
NM_002408chr141538 1120 ----
NM_002409chr2252926 1990 1275 1160 656 23163 459 ----
NM_002430chr2242589 2564 649 52 12434 ----
NM_002442chr1221379 678 11738 ----
NM_002449chr52168 38 1948 11222 --
NM_002451chr993825 3819 3697 3549 2669 2569 1565 1472 1056 ------
NM_002481chr157220 6768 4867 1946 1541 --37513 2204 1528 37961 4932 2071
NM_002485chr841780 869 726 686 ------
NM_002486chr94928 920 790 90 ----11675
NM_002492chr3168 --2354 339 --
NM_002499chr1562418 2336 2279 2202 539 483 22248 845 32394 2357 200 --
NM_002500chr221257 1232 --1828 --
NM_002501chr1954048 3989 1525 1434 801 ----1518
NM_002509chr204889 752 640 603 ------
NM_002515chr1441963 1893 1266 224 1428 ----
NM_002519chr1121107 1028 ------
NM_002524chr12833 745 ------
NM_002538chr53488 458 230 ------
NM_002539chr2----1270 --
NM_002545chr1154830 3792 3293 1129 600 --11239 --
NM_002547chrX43987 1590 835 227 13587 21604 1595 --
NM_002556chr1141627 1580 1511 344 1581 --1226
NM_002563chr31169 2869 754 ----
NM_002576chr1111159 ------
NM_002581chr985322 4537 4472 4105 3731 3720 2071 590 34113 1456 1030 15698 --
NM_002586chr62413 208 21581 1169 11276 --
NM_002589chr41111 ------
NM_002590chr131472 ----1371
NM_002594chr2022086 1895 22432 2069 ----
NM_002595chr1231559 1334 338 ------
NM_002601chr2--1453 ----
NM_002607chr721183 1076 ------
NM_002613chr1655125 3711 1983 1564 593 25401 552 44983 4563 1840 1697 11751
NM_002635chr122364 35 ------
NM_002641chrX21301 267 ----11741
NM_002646chr122168 651 21845 70 22086 635 --
NM_002651chr13844 325 229 ------
NM_002655chr834121 3374 1063 25113 4990 ----
NM_002667chr6--1185 ----
NM_002687chr1461103 417 344 327 298 159 177 ----
NM_002706chr23655 586 528 ----1466
NM_002709chr233513 1253 388 12361 ----
NM_002710chr121394 135 ----
NM_002716chr1193535 3264 3223 3106 3059 2340 1478 1240 800 22782 2321 1607 --
NM_002717chr8----1455 --
NM_002719chr1462293 2190 2143 651 74 54 --1682 --
NM_002721chr9160 ------
NM_002729chr101600 ------
NM_002731chr162979 2786 2263 1952 796 201 13022 1707 12582
NM_002734chr1731985 1726 120 11403 --1509
NM_002736chr792072 1957 1815 1737 1685 1614 1493 755 26 ------
NM_002740chr352797 2710 2208 2000 131 1750 --1615
NM_002745chr22114508 4136 3919 3760 3512 3381 1829 740 721 521 211 13868 ----
NM_002747chr1861367 773 712 611 488 186 ------
NM_002748chr15----11209 --
NM_002750chr10137 ------
NM_002752chr51456 ------
NM_002753chr43875 311 34 1720 1591 --
NM_002755chr154624 606 258 79 1108 1352 --
NM_002765chrX1443 --11348 --
NM_002767chr172357 91 1110 ----
NM_002786chr11----1203 --
NM_002790chr1----1125 --
NM_002792chr20------124
NM_002809chr17----1324 --
NM_002814chrX3697 675 177 ------
NM_002823chr21619 1434 ----
NM_002829chr921082 256 --1213 --
NM_002834chr1243619 3381 3303 760 ------
NM_002835chr71680 --1246 --
NM_002837chr1254522 4371 1717 582 305 34070 1390 203 13811 --
NM_002839chr943445 2714 2333 535 33435 3078 673 13554 --
NM_002840chr121582 1187 ------
NM_002841chr33699 541 472 ------
NM_002843chr1143373 1029 902 713 13329 21036 925 --
NM_002849chr12----1280 --
NM_002851chr71262 1184 ----
NM_002855chr1133678 3411 25 ------
NM_002871chr131660 654 101 ------
NM_002874chr932484 2091 1850 1265 11726 --
NM_002881chr231395 522 87 11029 1991 --
NM_002886chr364777 3896 3570 1180 1034 168 11085 ----
NM_002890chr51971 1181 ----
NM_002892chr1421274 115 11642 ----
NM_002897chr2--1707 ----
NM_002912chr64740 698 691 109 1275 1371 --
NM_002924chr11488 1594 1496 --
NM_002926chr461167 1140 965 917 852 178 --1957 --
NM_002942chr34518 357 343 277 11446 ----
NM_002948chr32307 79 ------
NM_002956chr1221415 290 ------
NM_002957chr9102597 2482 2388 992 851 591 410 188 129 106 23800 3645 23038 2851 --
NM_002958chr33755 61 40 ------
NM_002959chr174417 4101 4019 3851 3365 2918 63 ----13179
NM_002968chr163859 760 242 --1424 --
NM_002971chr331067 1054 384 ------
NM_002973chr12--1126 ----
NM_002977chr221068 215 ----135
NM_002994chr421356 1291 --11554 --
NM_002998chr832209 1704 609 ------
NM_003001chr121545 532 12180 1423 --
NM_003010chr1732358 2234 917 21757 175 1142 12301
NM_003012chr872985 2694 2669 2370 2255 133 101 11222 1739 12486
NM_003017chr6--1895 ----
NM_003030chr3130 --11684 --
NM_003031chr161906 ------
NM_003032chr331883 1800 183 11814 22554 153 --
NM_003035chr11339 ------
NM_003036chr111169 ------
NM_003037chr1----1111 --
NM_003042chr322106 629 11585 ----
NM_003043chr364206 3957 3706 3382 983 736 --11298 --
NM_003045chr1384757 3825 3343 1612 1601 1375 883 544 2955 892 ----
NM_003046chr821212 517 21516 613 --15207
NM_003051chr1--11906 --21930 72
NM_003068chr82918 89 ----1396
NM_003069chrX1600 ------
NM_003079chr17--1778 ----
NM_003085chr53601 164 152 --1141 --
NM_003095chr12--1286 ----
NM_003106chr32982 318 1910 ----
NM_003107chr642584 2474 2199 2070 42611 2084 1950 281 12344 --
NM_003108chr297179 7173 6576 6339 5583 2258 1991 1519 458 --11553 15335
NM_003112chr722606 901 23251 2091 ----
NM_003128chr252797 2187 2071 1045 357 1665 ----
NM_003137chr652225 1699 739 267 167 11978 ----
NM_003139chr113881 128 56 ------
NM_003144chr61138 11529 ----
NM_003149chr331166 567 312 11628 ----
NM_003150chr1731683 573 397 21492 405 1746 1617
NM_003155chr8--1156 1978 --
NM_003156chr1121324 33 ------
NM_003161chr1733561 3324 3318 ----1753
NM_003162chr22311 225 ------
NM_003168chr174985 781 664 262 ------
NM_003174chr101148 ------
NM_003178chr352251 1578 895 721 215 11657 1653 1192
NM_003179chrX21299 1177 --11072 11319
NM_003189chr153074 2888 2813 963 182 12792 2703 424 --
NM_003199chr1865446 5183 4558 4522 1176 831 24647 720 ----
NM_003204chr1731739 1235 1201 2330 248 ----
NM_003220chr641319 1245 686 248 --11596 --
NM_003221chr613686 23693 1439 21107 695 --
NM_003222chr202840 811 ----21202 903
NM_003236chr232905 2388 129 13413 13339 21367 120
NM_003242chr332286 2229 674 1127 1287 --
NM_003246chr151796 --11834 --
NM_003247chr631491 801 34 ------
NM_003250chr172385 315 --1420 --
NM_003253chr2151925 1812 1529 226 68 ------
NM_003255chr1761924 1830 925 871 655 22 ------
NM_003257chr1521066 343 --1948 --
NM_003262chr345091 2085 1410 731 11464 ----
NM_003269chr611262 ------
NM_003270chrX31135 1024 289 162 ----
NM_003274chr2132501 1889 703 ----21162 183
NM_003290chr19--167 1872 --
NM_003295chr13157 ------
NM_003298chr375805 5275 4567 2120 1765 1275 994 36020 5912 5732 1465 --
NM_003300chr14163 ------
NM_003304chr3------11305
NM_003315chr171225 ------
NM_003320chr1153606 2830 2822 2806 86 --43748 2945 1457 61 --
NM_003325chr222556 169 1490 ----
NM_003336chrX------11035
NM_003337chr551354 1185 662 300 151 --11492 --
NM_003338chr1041472 755 562 380 1488 ----
NM_003339chr52193 116 11439 1452 --
NM_003340chr421202 991 ------
NM_003341chr32572 35 ------
NM_003342chr1752833 2228 344 324 260 13180 23065 2840 --
NM_003345chr161522 ------
NM_003347chr2261969 1926 1559 1458 732 118 1175 ----
NM_003348chr1231248 630 610 21141 646 ----
NM_003349chr202440 96 31545 1079 1040 1476 --
NM_003352chr221015 281 --1733 --
NM_003368chr14786 669 602 231 ------
NM_003369chr1152791 2061 805 458 307 1636 ----
NM_003371chr941662 1590 451 64 ------
NM_003372chrX3942 826 235 ------
NM_003373chr102719 198 11245 1209 --
NM_003376chr621573 332 ------
NM_003376chr621573 332 ------
NM_003379chr661046 985 740 386 241 66 --1318 1286
NM_003383chr91140 1226 ----
NM_003389chr9------2488 397
NM_003390chr1161051 860 419 315 206 198 1326 ----
NM_003392chr324346 1285 13170 ----
NM_003400chr21645 2345 312 ----
NM_003403chr141759 2535 213 ----
NM_003404chr2041829 1483 1448 40 --11834 --
NM_003405chr222263 102 1611 ----
NM_003406chr821913 1709 ------
NM_003407chr191567 ------
NM_003410chrX72911 2872 2387 2279 2048 890 727 --12700 --
NM_003412chr312734 2405 362 ----
NM_003413chrX31222 705 342 ------
NM_003453chr132572 309 ------
NM_003457chr172547 445 ------
NM_003458chr364008 2763 1586 1550 1533 1237 --23382 839 --
NM_003462chr131761 1456 1404 --11242 --
NM_003463chr663293 2498 2259 374 235 164 22313 909 --11226
NM_003467chr22487 106 ------
NM_003468chr223699 681 24081 1210 11414 1691
NM_003471chr321664 695 --2923 48 --
NM_003478chr1133277 972 718 ------
NM_003482chr1232583 2267 1008 --12380 --
NM_003483chr1272897 2862 2574 2497 558 488 83 ------
NM_003487chr171280 ------
NM_003489chr2173089 3000 2851 897 594 229 63 1873 ----
NM_003498chr163777 284 249 1330 1886 1470
NM_003502chr164620 598 452 127 ------
NM_003507chr25590 477 386 280 88 41566 622 400 96 ----
NM_003557chr121386 1029 2477 468 ----
NM_003558chr91266 ----1647
NM_003559chr17123885 3612 3404 3039 3013 2907 1599 1564 1534 1132 1113 971 3847 790 295 13124 1146
NM_003566chr1223415 3215 43179 2967 869 671 ----
NM_003574chr1864579 2029 1577 1438 631 621 23927 326 11115 --
NM_003576chr1362864 2780 2299 1937 940 513 --12450 --
NM_003581chr22733 684 1323 ----
NM_003582chr1----1185 --
NM_003583chr1221476 826 11554 13564 --
NM_003590chr252950 2653 1573 1217 206 23091 2713 ----
NM_003592chr71451 ----1193
NM_003615chr332447 1024 496 22893 1033 22613 1374 --
NM_003617chr143395 1615 1472 1262 24998 32 1246 --
NM_003618chr21334 1505 ----
NM_003619chr42570 475 ------
NM_003620chr171152 --1162 --
NM_003621chr11--1515 ----
NM_003626chr1121253 1218 --1342 --
NM_003629chr162254 1202 822 728 249 94 --22413 898 --
NM_003633chr532479 2074 1976 42222 267 248 151 12146 --
NM_003644chr1776256 4928 2363 1090 925 907 328 26274 704 15251 --
NM_003654chr113617 602 544 1792 ----
NM_003663chr343311 2589 1344 538 11165 --12952
NM_003670chr341480 987 400 368 ------
NM_003671chr972976 2891 2737 1102 550 412 298 3928 463 319 11251 --
NM_003677chr1241848 1828 319 306 --11857 --
NM_003679chr143345 3315 2411 143 12773 ----
NM_003685chr194813 786 636 184 ------
NM_003704chr44585 518 508 189 ------
NM_003709chr22374 129 ------
NM_003713chr151750 1730 1514 457 265 ----1342
NM_003716chr3162 2912 40 ----
NM_003722chr342659 2213 1107 468 ------
NM_003725chr12----1407 --
NM_003743chr24906 781 530 499 --1429 11483
NM_003749chr1342025 954 585 512 1939 12401 --
NM_003750chr101137 ------
NM_003759chr421449 535 1980 --23273 643
NM_003760chr1------1731
NM_003763chr2033085 2903 2581 --22485 2434 22229 2107
NM_003774chr1213221 22775 2215 ----
NM_003780chr11665 ------
NM_003787chr181307 11459 ----
NM_003795chr61545 ----1499
NM_003796chr192465 194 ------
NM_003797chr11143 ------
NM_003799chr1894062 3790 3639 3136 2906 2821 337 160 90 11129 23120 452 11262
NM_003800chr61500 --11857 1159
NM_003822chr172812 1966 611 551 538 523 331 ------
NM_003831chr18--1134 ----
NM_003846chr13721 658 600 ------
NM_003858chr142627 97 ------
NM_003860chr11--1341 ----
NM_003861chr1442838 2663 466 195 11833 ----
NM_003862chr51246 ------
NM_003870chr1522108 751 ------
NM_003872chr252721 2559 2005 694 353 ------
NM_003873chr1032297 951 630 12414 ----
NM_003884chr31303 21623 107 --1465
NM_003885chr1772504 2006 1896 1718 810 404 322 12319 1276 --
NM_003888chr1541628 1445 61 41 1193 ----
NM_003899chr1392503 2400 2394 2315 2281 2185 794 372 125 2866 345 ----
NM_003902chr12698 329 ------
NM_003907chr3----1338 --
NM_003908chr203960 529 30 1256 ----
NM_003913chr674179 3758 2931 2651 1521 1242 459 13121 --12642
NM_003914chr131198 ------
NM_003924chr451527 1411 1173 379 359 ------
NM_003927chr182988 437 ----2732 90
NM_003930chr732508 2364 32 ------
NM_003931chr6158 --1459 --
NM_003932chr2231770 1533 279 ------
NM_003934chr921042 480 ------
NM_003936chr231195 1183 252 ------
NM_003939chr1073106 3039 1667 1548 837 560 408 13668 23362 1226 11209
NM_003941chr752285 623 507 368 63 2167 74 ----
NM_003948chr422240 427 22462 646 ----
NM_003966chr567611 7125 5187 3071 2472 1340 56365 6027 1999 1789 28 27320 52 1842
NM_003968chr32581 544 ----1183
NM_003969chr192258 234 ------
NM_003980chr61457 --1541 11339
NM_003981chr1551074 760 704 309 37 1382 ----
NM_003983chr1664161 2798 2701 1306 836 632 11048 13483 --
NM_003994chr1213062 11288 1405 --
NM_004006chrX22333 234 ------
NM_004007chrX22333 234 ------
NM_004009chrX22333 234 ------
NM_004010chrX22333 234 ------
NM_004011chrX22333 234 ------
NM_004012chrX22333 234 ------
NM_004013chrX22333 234 ------
NM_004014chrX22333 234 ------
NM_004015chrX22333 234 ------
NM_004016chrX22247 148 ------
NM_004017chrX22333 234 ------
NM_004018chrX22247 148 ------
NM_004020chrX22333 234 ------
NM_004021chrX22247 148 ------
NM_004022chrX22247 148 ------
NM_004023chrX22247 148 ------
NM_004024chr121022 451 11504 ----
NM_004028chr1864135 4122 1580 1206 793 737 11494 --13702
NM_004040chr251200 1177 935 299 190 ----1432
NM_004050chr1452678 1993 1880 1696 923 ------
NM_004059chr9165 ------
NM_004081chrY2211 202 21658 493 ----
NM_004085chrX1670 --1189 --
NM_004089chrX21159 357 --11164 --
NM_004093chr1353161 2962 2601 172 23 12408 12695 --
NM_004094chr1453026 2835 1069 695 272 12313 --11897
NM_004098chr101886 ------
NM_004100chr652455 2299 1851 861 710 12692 ----
NM_004114chrX31191 911 196 129 ----
NM_004124chr143532 513 487 21220 761 13572 --
NM_004128chr131214 2155 146 ----
NM_004130chr34673 620 226 87 ------
NM_004133chr831969 851 519 22331 322 ----
NM_004136chr1522354 2165 1246 ----
NM_004162chr331259 925 478 2939 351 ----
NM_004170chr951497 1480 1435 1352 755 11412 11392 --
NM_004171chr11139296 8976 8417 8325 6903 6800 6355 5922 2983 2385 1293 658 224 69618 9021 8773 7064 3502 3062 --33071 2975 2539
NM_004181chr41242 ----1288
NM_004227chr743012 2903 2660 1087 ------
NM_004229chrX2381 193 ------
NM_004235chr92653 204 ------
NM_004263chr21669 1263 21844 1116 21652 1545
NM_004272chr52660 444 --1185 11379
NM_004274chr1442852 2068 850 254 12173 ----
NM_004279chr751900 1473 957 778 681 --1823 11699
NM_004281chr102475 192 ------
NM_004302chr1242928 2199 1924 541 --1636 --
NM_004311chr1023128 508 12068 --11963
NM_004319chr162382 2110 1058 540 366 70 ----11956
NM_004321chr273537 3496 3399 3372 2905 154 61 1425 23426 3363 --
NM_004326chr13948 328 279 ------
NM_004327chr2272035 1855 1741 1682 1597 458 435 --12229 1656
NM_004331chr832675 2216 343 139 ----
NM_004338chr18117040 6624 5606 4960 2117 1962 1938 1843 656 637 500 12765 --16967
NM_004339chr2141726 1568 1518 471 136 --11851
NM_004342chr72275 216 ----11714
NM_004349chr821246 1219 21132 1105 ----
NM_004364chr1931234 960 497 ------
NM_004369chr22183 68 ------
NM_004370chr61533 --21543 98 1407
NM_004371chr121444 116 1294 --11050
NM_004379chr231575 689 638 21248 290 11340 21669 1534
NM_004384chr531944 1767 74 1384 ----
NM_004386chr1922257 1837 ------
NM_004389chr23205 176 131 ------
NM_004392chr1352530 467 389 363 187 ----12242
NM_004393chr362162 1898 1549 918 523 64 12374 --11911
NM_004395chr52800 210 1780 ----
NM_004396chr17128 ------
NM_004397chr1152636 1561 1200 985 348 ------
NM_004405chr22804 306 ------
NM_004412chr1085923 4727 4366 4153 2315 1469 1112 707 1452 24685 2009 --
NM_004414chr211319 21067 978 ----
NM_004415chr61626 1794 ----
NM_004416chr123943 716 402 --1316 --
NM_004419chr104982 852 443 81 ------
NM_004426chr1241952 1591 433 118 11748 11449 --
NM_004428chr12718 697 ------
NM_004429chrX2350 178 ------
NM_004437chr133195 2710 1183 ----12316
NM_004438chr232828 1168 669 ----1258
NM_004440chr621624 1260 41916 1581 1558 500 ----
NM_004447chr1221152 401 1914 --1388
NM_004449chr2121287 438 1245 ----
NM_004457chr281597 1478 1283 1249 595 524 321 181 ------
NM_004458chrX1999 ------
NM_004459chr1741977 1901 513 494 ------
NM_004475chr1741188 902 264 170 --11118 --
NM_004480chr141546 ------
NM_004481chr162691 1955 1704 1697 669 651 12030 12591 --
NM_004485chr151284 1017 473 128 51 12794 ----
NM_004491chr19124354 4059 3908 3798 3684 3552 3131 3057 2963 2859 2685 438 14380 1330 --
NM_004494chr11428 ------
NM_004500chr1432032 1942 55 31590 1484 224 ----
NM_004501chr153487 3177 2993 493 463 1265 2878 836 13369
NM_004503chr124797 636 239 77 ------
NM_004504chr21826 22880 193 13045 12320
NM_004505chr172286 54 11821 --1231
NM_004506chr6--1480 1472 --
NM_004519chr8--130 ----
NM_004520chr52649 102 ------
NM_004523chr1031196 1090 574 1260 --1133
NM_004529chr931340 1260 1200 ------
NM_004535chr2031530 442 353 11101 ----
NM_004540chr21----1121 --
NM_004560chr93991 923 121 ------
NM_004561chr1131828 1776 584 ------
NM_004569chr142493 470 1200 1486 --
NM_004571chr2143182 3020 1290 537 22871 2479 13214 --
NM_004575chr421491 225 ----11321
NM_004576chr5----1345 --
NM_004578chr13903 285 98 ------
NM_004580chr1521549 1422 11813 11729 --
NM_004586chrX53807 1377 1084 680 490 24844 1641 15413 25276 1505
NM_004588chr112408 56 13011 13641 21273 1152
NM_004596chr191153 ------
NM_004598chr5103330 2981 2971 2619 2596 842 766 637 433 148 ------
NM_004602chr2041461 1157 578 343 --1249 --
NM_004612chr944052 3016 1052 1040 11076 14036 24169 3095
NM_004615chrX4792 690 630 308 ------
NM_004622chr222468 1891 1982 --1226
NM_004626chr112133 99 ------
NM_004640chr62204 33 ------
NM_004655chr1751269 1152 1081 1068 1042 --1267 --
NM_004660chrY21898 1484 ------
NM_004663chr151276 11547 ----
NM_004665chr61305 ------
NM_004670chr1031706 427 371 ------
NM_004671chr18165 ------
NM_004694chr171200 ------
NM_004703chr1732443 2140 2124 12189 ----
NM_004709chrX41423 1392 162 67 ------
NM_004711chr2233187 936 784 --23393 300 --
NM_004713chr142534 243 ------
NM_004717chr751547 1439 1231 377 294 ------
NM_004718chr23613 280 170 ------
NM_004726chrX85702 5652 4755 4592 3886 3865 3634 159 31090 845 663 14802 1385
NM_004730chr531891 1641 300 11674 ----
NM_004742chr351688 1335 1311 443 99 ------
NM_004744chr453468 3327 898 330 34 2628 322 12477 --
NM_004745chr8106765 6449 5928 4433 4418 2666 1380 993 548 52 76788 6741 4528 1800 1784 802 592 11159 --
NM_004748chr1523467 1065 2567 48 ----
NM_004755chr1421026 435 2455 266 --1299
NM_004760chr73960 813 791 22079 352 ----
NM_004768chr111131 ------
NM_004772chr5----1440 --
NM_004774chr174930 718 542 225 1884 ----
NM_004776chr2032724 371 257 ------
NM_004779chr51836 ----11298
NM_004788chr1142744 1866 1018 457 --11856 --
NM_004794chrX189 ------
NM_004796chr14------22151 404
NM_004798chr2082508 2481 1265 894 502 495 355 321 --11377 21407 762
NM_004801chr231104 254 27 ------
NM_004817chr92284 211 1304 ----
NM_004822chr1784027 3753 3602 1467 1135 881 760 727 23973 2540 ----
NM_004834chr243074 3048 2709 2582 170 --22453 2226
NM_004844chr31831 --11105 --
NM_004849chr621600 538 2560 261 ----
NM_004850chr22626 586 1157 --21666 1532
NM_004856chr153552 199 91 ------
NM_004857chr1444755 3844 1406 1044 13113 --1792
NM_004859chr1752410 2036 1078 689 317 1102 12426 --
NM_004863chr1444142 3350 1194 304 24680 1538 34130 921 52 14815
NM_004866chr531897 1489 642 44589 3316 3246 1316 24257 1760 24120 3846
NM_004867chrX2610 195 1528 ----
NM_004869chr1841599 1437 1191 1175 ----1629
NM_004873chr1472990 2645 2600 2480 839 537 208 22630 715 ----
NM_004874chr8287 28 ------
NM_004898chr422837 2409 ------
NM_004904chr764877 4413 4113 2101 1532 281 15211 15433 --
NM_004921chr122560 138 12242 1795 --
NM_004926chr1421135 580 1379 ----
NM_004937chr1762605 985 933 833 818 538 22528 1822 --11687
NM_004938chr93999 189 29 ------
NM_004939chr2----143 --
NM_004947chr322438 1626 11610 ----
NM_004953chr31371 --1108 1422
NM_004956chr723169 328 31448 1127 539 --13920
NM_004965chr21147 --1760 --
NM_004972chr921120 748 ------
NM_004973chr61514 11262 --11131
NM_004975chr201661 2224 112 ----
NM_004976chr1195109 4528 1979 1878 1849 1520 706 507 22 11961 34001 3443 581 --
NM_004985chr1244021 1010 933 855 11696 --1227
NM_004992chrX148478 8259 8146 8089 6056 5784 5723 5523 5492 1898 1637 1453 1123 881 28518 6070 37183 3303 542 --
NM_004992chrX148478 8259 8146 8089 6056 5784 5723 5523 5492 1898 1637 1453 1123 881 28518 6070 37183 3303 542 --
NM_004993chr1431076 376 50 ------
NM_004998chr151307 ------
NM_005006chr23966 942 686 ----1315
NM_005011chr741625 1581 1572 411 ------
NM_005044chrX74474 4159 4153 3508 807 133 127 24090 1190 21494 399 --
NM_005045chr72928 796 ------
NM_005056chr12115587 5203 4754 3879 3861 3514 3432 1730 1702 825 137 45597 4407 3471 2182 ----
NM_005057chr1----21405 105 21453 1319
NM_005063chr1042713 2579 343 60 13279 ----
NM_005065chr1444988 4789 4049 776 21770 767 21495 1362 --
NM_005066chr11141 --1817 --
NM_005076chr144165 3677 2602 829 14175 13532 12570
NM_005087chr31740 --157 --
NM_005093chr2074975 4249 4035 3795 1656 794 727 32143 2095 1955 14707 --
NM_005095chr131914 1842 1651 ----11591
NM_005096chrX51186 425 207 48 42 1804 ----
NM_005102chr23684 643 587 --1787 --
NM_005104chr6--1572 ----
NM_005105chr112073 ------
NM_005109chr322148 375 11989 --1760
NM_005112chr42653 414 --1162 --
NM_005116chr20104571 3900 1617 1340 1289 1277 1060 567 426 47 --12811 --
NM_005119chr11833 ------
NM_005121chr1722795 395 --11402 --
NM_005124chr63684 415 398 ------
NM_005126chr342212 1653 1590 314 22184 134 21806 471 1587
NM_005128chr21--2481 157 ----
NM_005135chr1573849 3467 3144 3102 814 155 110 11381 23679 103 11516
NM_005137chr2242466 1678 1622 43 ------
NM_005151chr1822022 412 --1911 22206 1860
NM_005156chr995405 5279 5179 5155 5109 4942 3344 1297 471 14712 31808 1783 1775 --
NM_005157chr951958 1913 1722 1553 148 --11866 --
NM_005160chr2296838 6728 6444 6014 5883 5788 1851 932 593 35942 4255 1136 ----
NM_005168chr231618 1355 1221 ------
NM_005180chr103681 597 402 1273 ----
NM_005188chr11208244 7790 7079 6906 6497 6048 5923 5747 5707 5700 5533 5512 3062 2961 2732 2498 2368 2324 945 608 28131 1412 56879 6771 2186 1335 385 18329
NM_005190chr62984 100 ------
NM_005194chr201439 --1528 --
NM_005197chr14115923 5914 5711 4902 4458 4146 1673 808 537 326 314 25737 1337 11747 11415
NM_005202chr152209 1474 1444 598 212 ------
NM_005206chr1731116 437 328 1257 1377 21342 1208
NM_005207chr2253704 2984 2497 1432 42 13628 ----
NM_005214chr211066 ------
NM_005219chr521604 1539 --1655 1441
NM_005222chr71910 --166 --
NM_005233chr322227 1828 2415 387 1935 --
NM_005235chr277739 7225 6711 6468 6373 6255 2928 27041 5797 --17349
NM_005243chr22----1123 --
NM_005245chr42270 237 1734 1709 --
NM_005254chr1531105 435 419 2207 154 ----
NM_005256chr112895 172 --142 --
NM_005257chr1811159 11017 11037 --
NM_005261chr82870 776 ------
NM_005264chr102621 72 ------
NM_005269chr12----1140 --
NM_005277chr421512 1209 1263 ----
NM_005284chr61168 ------
NM_005308chr101185 ------
NM_005311chr752770 2360 946 698 63 12853 12037 12383
NM_005313chr1511379 21253 415 ----
NM_005316chr1111122 ------
NM_005318chr2241149 880 297 280 151 ----
NM_005327chr42648 212 --169 --
NM_005329chr1641969 867 784 241 ------
NM_005333chrX21236 1148 --1270 --
NM_005336chr272091 2074 1968 1623 799 734 344 ------
NM_005339chr464112 4058 3305 1170 667 186 34146 2976 164 1455 1436
NM_005342chrX72779 2770 2760 2611 760 574 84 12828 ----
NM_005347chr91574 ----11693
NM_005359chr1866498 6474 6131 4845 2277 774 46537 5260 4487 1900 --15747
NM_005378chr21751 --1591 --
NM_005385chr362734 1901 613 446 347 75 --1598 --
NM_005392chr941837 1365 1254 143 ------
NM_005398chr1021236 937 --2173 62 --
NM_005399chr184190 4040 4014 3713 3115 1622 1129 420 --1273 --
NM_005402chr72575 259 ------
NM_005407chr1431331 1268 139 11402 ----
NM_005425chr16123 --1127 --
NM_005429chr42118 70 ------
NM_005433chr1822443 745 12781 ----
NM_005436chr1043980 3607 3068 1268 ------
NM_005437chr1031367 1072 939 ------
NM_005439chr12128 1540 ----
NM_005455chr111673 11579 --11834
NM_005458chr942054 860 768 640 --12119 12128
NM_005460chr5--179 ----
NM_005471chr521154 1079 ------
NM_005474chr1751498 1388 621 261 156 --11184 --
NM_005475chr1253182 3129 728 177 160 ------
NM_005476chr911219 1240 --1421
NM_005479chr1011403 ------
NM_005487chr2251971 1766 597 314 263 ------
NM_005497chr1786079 5823 5780 4993 4628 2467 1042 23 45284 5149 4381 4128 15619 35491 4247 1171
NM_005499chr191552 ------
NM_005502chr982792 2707 2498 2487 2426 1113 330 209 --1896 13098
NM_005504chr1246184 1261 1051 102 16604 ----
NM_005506chr482843 2837 2274 777 686 255 96 89 11150 ----
NM_005509chr521590 1199 ------
NM_005517chr121047 576 ------
NM_005520chr51220 1582 ----
NM_005523chr731551 1519 1504 11262 ----
NM_005530chr1541323 205 177 96 ----11409
NM_005537chr1321026 200 ------
NM_005539chr1051152 901 481 194 55 --1294 --
NM_005561chr13------1978
NM_005570chr181338 ----11163
NM_005575chr51803 ----2586 47
NM_005578chr323401 3258 23112 279 --1435
NM_005585chr15--1175 ----
NM_005586chr61630 ------
NM_005593chr12--1513 ----
NM_005595chr13971 742 81 ------
NM_005596chr996077 5687 5429 4507 4205 3967 2369 1363 622 12568 ----
NM_005599chr131168 1024 29 ------
NM_005603chr1821832 527 21981 1785 --1230
NM_005604chr622502 2404 21888 1620 11955 --
NM_005609chr11138 ------
NM_005610chr13889 768 624 ------
NM_005613chr162147 726 512 499 439 76 ------
NM_005614chr72826 165 1389 --1978
NM_005625chr821117 63 ------
NM_005627chr6--1764 1834 --
NM_005634chrX2447 114 ------
NM_005639chr12--159 1691 --
NM_005647chrX73368 3275 3257 2387 2359 860 628 12781 12798 --
NM_005651chr41360 1312 ----
NM_005655chr8185 ------
NM_005662chr8--1353 ----
NM_005665chr184360 3283 1898 1529 1242 1061 803 528 34095 3529 1145 ----
NM_005668chr533263 1752 1575 --24043 3384 14061
NM_005688chr331013 319 138 ------
NM_005707chr1511047 ----1910
NM_005708chr13--1380 ----
NM_005715chr632332 763 381 12150 --12757
NM_005717chr131167 258 85 1136 ----
NM_005718chr31786 --2728 280 --
NM_005721chr22704 373 ------
NM_005730chr1293604 2874 2417 1116 1101 1095 927 712 338 ----1853
NM_005737chr232516 2222 1004 32558 1162 443 11870 --
NM_005738chr721960 89 --11903 --
NM_005739chr155841 457 370 126 27 --11594 --
NM_005744chr15----1118 --
NM_005746chr72609 364 11871 2769 738 --
NM_005751chr71421 ------
NM_005754chr5198 ----1411
NM_005756chrX21495 364 ------
NM_005759chr264681 3474 1510 1386 1280 459 --21315 399 --
NM_005766chr1331117 997 62 ------
NM_005776chr142560 162 --197 --
NM_005779chr543604 3548 2662 382 12763 ----
NM_005783chr2--2652 399 1560 --
NM_005786chr181924 1894 ----
NM_005801chr171552 --199 --
NM_005822chr63743 712 320 ----11608
NM_005826chr11453 ------
NM_005828chr1795039 4554 3112 2030 2003 1842 1352 1117 932 --1652 24875 759
NM_005832chr34499 339 234 95 ------
NM_005839chr12948 836 ------
NM_005840chrX77709 5664 5097 3028 1518 1325 520 57546 6906 5613 4973 2296 21737 628 --
NM_005841chr411016 ------
NM_005842chr131175 1305 ----
NM_005852chr1721129 1110 ------
NM_005859chr521060 981 21119 593 ----
NM_005862chr311097 --173 --
NM_005870chr13--1194 1174 --
NM_005871chr103886 850 763 ------
NM_005876chr21807 ------
NM_005885chr52634 522 ------
NM_005888chr122364 35 ------
NM_005892chr17------1367
NM_005898chr1142415 2397 851 738 ------
NM_005899chr1731567 1117 108 1449 ----
NM_005901chr18118653 8615 8047 5321 3434 3347 3095 2637 1405 924 531 38573 7557 2474 36262 2421 908 --
NM_005907chr62470 104 ------
NM_005910chr1754068 3362 3161 1534 687 --33745 1653 752 --
NM_005911chr221368 391 1499 ----
NM_005920chr132929 1084 233 1899 ----
NM_005924chr71748 1932 ----
NM_005933chr1132520 2022 475 12253 --1855
NM_005935chr475107 4001 3678 3211 1959 1741 1553 25221 523 ----
NM_005937chr1764102 3410 3178 816 808 403 --31621 1403 119 1549
NM_005941chr853835 2786 2674 902 101 13765 ----
NM_005943chr641334 1270 671 422 ------
NM_005944chr341208 1104 910 211 ------
NM_005955chr1115081 4799 4601 4557 4487 4256 3876 3802 703 689 267 15096 ----
NM_005973chr11329 ------
NM_005986chr1352341 2331 2206 2108 890 1645 ----
NM_005990chr592608 2593 2492 2392 1927 1069 899 133 103 --2774 192 --
NM_006007chr953953 3622 1248 1143 125 22921 1260 1384 --
NM_006011chr1534269 4185 2876 ------
NM_006016chr632289 841 220 21961 618 ----
NM_006023chr10--1178 ----
NM_006030chr311384 11802 1451 --
NM_006037chr294869 4629 4041 3096 1836 1293 782 474 32 24681 3811 21665 316 --
NM_006043chr163740 658 199 ------
NM_006047chr2063453 3220 2682 1131 495 93 ------
NM_006048chr12249 189 ------
NM_006051chr53109 83 53 ------
NM_006054chr1131586 279 68 11642 ----
NM_006060chr773779 2847 1748 1316 647 527 380 12958 ----
NM_006063chr21437 1541 184 --
NM_006064chrX2321 102 1350 ----
NM_006067chr163272 216 86 --2797 93 --
NM_006079chr61144 ------
NM_006085chr11173 ----143
NM_006094chr862416 2362 1843 1706 688 347 --1183 --
NM_006095chr423671 1013 13785 21662 1040 --
NM_006100chr31111 ------
NM_006106chr1133254 2600 287 ------
NM_006108chr113428 246 69 ------
NM_006113chr141819 1758 1667 229 11718 12078 --
NM_006133chr1142474 2458 2268 51 11743 ----
NM_006135chr111444 1190 ----
NM_006141chr1642588 2302 1812 151 --12642 --
NM_006145chr1941046 982 444 398 1735 --1910
NM_006147chr12462 416 ------
NM_006148chr1792910 2883 2857 2720 2361 2186 1865 1824 111 --31152 1134 289 --
NM_006154chr1562194 1163 986 922 337 294 ------
NM_006166chr1252527 2192 665 266 255 --147 --
NM_006183chr122570 236 ------
NM_006197chr842281 857 527 84 1842 ----
NM_006201chrX3233 187 167 ------
NM_006202chr1921922 1815 11913 11462 --
NM_006206chr442576 2243 2163 1022 ------
NM_006211chr82282 102 ------
NM_006216chr21631 --1646 --
NM_006223chrX1129 ------
NM_006237chr1321972 1939 ------
NM_006241chr322283 490 149 11793 --
NM_006243chr14936 900 352 161 ------
NM_006246chr143384 79 33 ------
NM_006247chr19------1470
NM_006251chr532117 950 813 ------
NM_006252chr157559 6850 3010 1544 180 22577 191 15598 15019
NM_006258chr10--1991 1345 --
NM_006265chr8--11040 1106 11372
NM_006267chr251733 754 604 542 33 ------
NM_006282chr2084688 3930 2958 1280 1135 591 426 306 33919 1880 463 ----
NM_006283chr884494 4375 4326 4308 3490 1714 1227 141 33049 1502 1003 24299 1265 --
NM_006306chrX65104 5012 2140 1966 1404 1182 65928 4675 2307 1726 1283 917 45896 3941 1853 1584 --
NM_006313chr1221109 216 ------
NM_006315chr463186 3076 1815 1378 982 669 --13952 13988
NM_006317chr52707 569 ------
NM_006335chr12761 77 ------
NM_006352chr111862 ------
NM_006353chr621077 25 ------
NM_006359chrX4916 507 206 150 ------
NM_006363chr201216 ------
NM_006364chr1421044 485 1453 ----
NM_006366chr6--1826 11258 1536
NM_006372chr62494 370 ------
NM_006373chr1731050 1042 932 ------
NM_006377chr931146 1023 440 ----11285
NM_006379chr73829 334 164 ------
NM_006380chr1764378 4372 4300 3965 3066 1481 1613 1163 --
NM_006391chr11145 --132 --
NM_006393chr1033123 1476 1327 44360 1654 795 397 14119 --
NM_006401chr93389 344 202 1149 ----
NM_006403chr661815 1795 1437 1205 1142 666 ------
NM_006407chr341391 1259 1206 418 ------
NM_006420chr2052812 2696 2596 2378 1242 1413 --11283
NM_006421chr831194 1182 220 ------
NM_006424chr431714 1549 1494 ------
NM_006434chr1072764 1152 1030 866 743 712 157 21192 456 ----
NM_006449chr232181 1539 527 ------
NM_006451chr511047 ----1952
NM_006454chr4102779 2770 2003 1930 1168 846 499 449 433 270 --22747 2259 --
NM_006457chr423232 213 12821 31294 823 520 31162 683 548
NM_006458chr11126 ------
NM_006459chr1051900 1456 1370 1271 663 ------
NM_006464chr294587 4171 3931 3420 3207 1816 1653 1494 402 24642 3288 ----
NM_006467chr522223 2214 ------
NM_006469chr131592 639 197 11500 11165 --
NM_006482chr1221476 826 11554 13564 --
NM_006489chr1441963 1893 1266 224 1428 ----
NM_006504chr1042671 2144 2026 769 21031 490 12956 --
NM_006517chrX42188 2010 933 325 11912 ----
NM_006526chr2051805 1538 1505 824 437 1412 1780 --
NM_006527chr4187 1567 ----
NM_006538chr263496 2852 2694 1279 624 45 22722 1505 23759 841 --
NM_006540chr81231 ------
NM_006544chr1421047 345 15258 11624 --
NM_006546chr17115942 5896 5154 5015 4749 4599 4490 4452 4037 2662 578 26441 6098 ----
NM_006555chr761986 1965 1591 1282 674 268 11855 ----
NM_006557chr95440 359 309 295 168 ------
NM_006558chr83474 207 47 ------
NM_006559chr13387 178 57 ------
NM_006561chr1051784 1249 978 315 91 ----1514
NM_006565chr161803 11224 ----
NM_006572chr1763192 2584 2379 2278 508 362 --1549 13495
NM_006574chr32265 71 190 1231 --
NM_006575chr142441 129 11332 ----
NM_006591chr113615 387 107 3556 505 134 ----
NM_006593chr2--1324 --1528
NM_006599chr1687442 6837 2881 2438 1615 1405 929 165 58266 7485 2754 2514 727 ----
NM_006601chr12--11040 1691 --
NM_006603chrX31923 720 88 ------
NM_006609chr242406 2090 522 21 1675 ----
NM_006614chr332482 1095 690 12926 ----
NM_006618chr111406 ----1109
NM_006621chr131669 1436 557 ------
NM_006624chr101645 ----1761
NM_006625chr11342 21112 908 ----
NM_006625chr11342 21112 908 ----
NM_006625chr11342 21112 908 ----
NM_006628chr1594664 3418 3133 2917 1729 1634 1567 635 391 23203 833 24531 760 --
NM_006646chr1372559 2188 2165 925 674 650 605 ------
NM_006650chr553971 2818 2536 1402 473 ------
NM_006654chr1231383 1303 1108 11861 1584 11023
NM_006658chr721073 50 127 1910 --
NM_006660chr15122 ------
NM_006662chr162390 261 ------
NM_006667chrX1253 21098 384 ----
NM_006675chr1243318 2448 2348 42 --12868 --
NM_006682chr722195 661 22270 2048 1293 2485 350
NM_006693chr75866 738 200 145 77 ------
NM_006695chr173293 233 225 ------
NM_006700chr121505 1785 ----
NM_006706chr5--1758 ----
NM_006711chr162535 193 129 ----
NM_006713chr52683 28 ----1821
NM_006717chr963119 2748 2361 636 394 215 13347 ----
NM_006720chr1094983 4615 4024 4013 3946 3837 1863 1782 458 14939 --15032
NM_006721chr101697 1642 1159 --
NM_006722chr352988 2544 2333 302 175 1563 --1349
NM_006726chr42422 207 11202 21032 774 --
NM_006729chrX44903 4244 3498 1297 14021 11908 --
NM_006734chr621386 95 1473 ----
NM_006736chr231384 1337 334 --21694 1179 --
NM_006738chr1564413 4321 4160 3698 3449 1221 34674 4632 1501 24311 4293 --
NM_006750chr16127836 7672 6339 5564 5092 3068 2503 1797 1624 1345 454 376 1652 35892 5756 2623 --
NM_006759chr21306 ------
NM_006761chr172835 678 ------
NM_006763chr141998 1339 1321 242 --1634 --
NM_006766chr842685 2633 2489 1847 12547 ----
NM_006775chr633107 816 96 --12639 --
NM_006777chrX42862 2365 1167 430 52488 2131 913 725 65 --1644
NM_006788chr182617 457 1100 21906 643 --
NM_006790chr51384 ----1331
NM_006791chr152527 68 ------
NM_006800chrX1660 1627 ----
NM_006802chr12916 130 ------
NM_006803chr841405 727 604 81 --11724 --
NM_006805chr52655 356 ----11223
NM_006807chr171874 ------
NM_006809chr203945 358 162 1148 ----
NM_006811chr202720 190 --1288 --
NM_006813chr6----1146 --
NM_006816chr52251 23 ------
NM_006823chr82316 221 ------
NM_006827chr1452400 2299 2269 805 31 23360 836 13232 --
NM_006828chr61517 1436 ----
NM_006832chr142961 942 ------
NM_006838chr122460 88 21781 1755 ----
NM_006846chr54268 256 98 72 ------
NM_006851chr1212833 ------
NM_006852chr1742589 2070 207 107 --1463 11848
NM_006854chr721983 1536 21239 138 ----
NM_006884chr3130 --11684 --
NM_006885chr1641289 824 786 331 --12659 --
NM_006888chr1453332 3220 2339 552 237 33418 2931 2565 23247 2178 11298
NM_006906chr112377 355 ----1623
NM_006908chr741356 1316 1282 1005 11328 ----
NM_006922chr242093 1047 936 615 ----1652
NM_006924chr1734085 2888 363 21146 130 ----
NM_006925chr14----1425 --
NM_006931chr1211353 --1773 21854 1730
NM_006940chr1241185 624 593 387 --11731 --
NM_006950chrX2756 750 --1822 --
NM_006951chr10--1811 ----
NM_006955chr1063419 3206 1252 1198 765 78 13442 23378 2318 --
NM_006965chr181863 11186 1258 --
NM_006980chr71206 ----1294
NM_006981chr952977 2955 2032 460 121 ------
NM_006991chr3------1164
NM_006999chr531781 1378 320 --11789 --
NM_007006chr1643206 3021 2690 37 --13187 --
NM_007007chr1284822 4374 3078 1782 714 325 224 65 44149 3240 744 103 --1376
NM_007010chr1761869 1794 745 320 198 97 ------
NM_007011chr1544649 2317 1448 1367 25405 1215 25222 4317 25539 1742
NM_007015chr13----1280 --
NM_007019chr202154 58 ------
NM_007034chr12719 87 ------
NM_007035chr121613 ------
NM_007038chr2155937 5660 4189 2017 1372 14749 21908 730 --
NM_007039chr141248 ------
NM_007050chr20117804 7438 7086 6660 6566 6052 2413 823 807 609 138 18039 27121 2843 15640
NM_007054chr543589 3019 2429 489 23522 1325 --11190
NM_007064chr331393 680 655 ------
NM_007067chr1741373 565 224 66 ------
NM_007073chr643818 2955 1268 1032 12570 ----
NM_007078chr1052995 2547 2362 468 154 --33044 2684 974 --
NM_007084chr131517 11519 --1204
NM_007106chr132630 204 ----1106
NM_007107chr322194 904 --21980 47 11652
NM_007114chr322061 695 32490 2104 1122 1653 11221
NM_007118chr52618 590 1908 ----
NM_007125chrY11408 --11324 --
NM_007129chr132790 714 1861 ----
NM_007146chr1742730 2416 951 454 ------
NM_007150chrX71677 1669 1472 698 467 215 198 21545 511 ----
NM_007159chr341594 1496 632 427 ------
NM_007166chr1121548 1246 ------
NM_007170chr12819 355 ------
NM_007172chr2242538 1076 647 587 --23284 416 1580
NM_007174chr1221827 931 --1294 --
NM_007189chr72980 190 21280 1018 ----
NM_007191chr12----1182 --
NM_007200chr1564413 4321 4160 3698 3449 1221 34674 4632 1501 24311 4293 --
NM_007203chr963897 3882 3415 3288 3253 865 ------
NM_007207chr11323 ------
NM_007212chr13810 430 317 22235 631 ----
NM_007214chr611063 --11214 21132 345
NM_007220chrX54741 4050 3878 3804 1842 44882 4023 1007 873 --1384
NM_007222chr81334 21549 231 ----
NM_007246chr43393 254 94 1356 ----
NM_007249chr13149278 9058 9002 8151 8098 6487 5834 5694 3758 2771 2241 1482 788 768 15939 26620 294 12216
NM_007282chr33982 686 88 ------
NM_007285chr16137 148 ----
NM_007313chr951958 1913 1722 1553 148 --11866 --
NM_007327chr921075 229 ------
NM_007331chr452604 2140 2098 568 216 ----12460
NM_007345chr1821640 853 ------
NM_007350chr1264437 3637 1291 916 343 251 12915 ----
NM_007353chr742134 1972 1141 78 12393 1473 12745
NM_007358chr131938 1799 44 ----1534
NM_007361chr141568 1268 ----
NM_007373chr1041484 613 174 69 11300 ----
NM_007375chr142433 2005 1075 916 32367 2331 295 11753 --
NM_012064chr1211090 ------
NM_012072chr2074432 4108 4101 4074 3365 3115 1526 13651 1913 --
NM_012081chr532531 2367 761 ------
NM_012082chr83660 649 617 ------
NM_012095chr1053465 3411 3296 2991 1399 33155 3020 2486 ----
NM_012097chr242188 1837 655 617 ------
NM_012102chr142203 2014 1834 1825 --2970 834 1536
NM_012104chr11103724 3678 3614 3480 3166 957 427 397 188 91 23808 3019 13822 --
NM_012104chr11103724 3678 3614 3480 3166 957 427 397 188 91 23808 3019 13822 --
NM_012115chr63556 505 176 ------
NM_012120chr642000 874 555 310 11042 ----
NM_012141chr1333863 2762 261 --11652 --
NM_012154chr82800 193 ------
NM_012156chr2053416 2869 2690 2250 1309 --1909 --
NM_012158chr1311648 1689 11733 --
NM_012164chr995986 5976 5371 5265 1671 653 544 367 178 26709 570 1814 --
NM_012177chr63595 563 506 ------
NM_012183chr11547 ------
NM_012193chr1144254 4095 3628 2137 21630 1290 25378 2146 --
NM_012197chr931085 340 154 11406 --11035
NM_012214chr295425 4957 4865 4792 4522 3941 1784 247 233 133 --21416 1282
NM_012215chr1031949 1338 203 2657 572 ----
NM_012218chr1972845 2784 2310 983 875 385 155 22955 168 1889 --
NM_012223chr22927 270 ------
NM_012234chr333514 3373 2730 53491 3298 2721 1099 933 33749 3462 3198 --
NM_012238chr1041745 700 181 175 11148 ----
NM_012249chr21409 ------
NM_012250chr1121374 556 ------
NM_012252chr721656 1215 34727 4381 3514 11973 14654
NM_012257chr741056 766 411 284 ------
NM_012261chr204669 622 144 80 ------
NM_012262chr144642 1068 888 876 23985 3669 14077 21586 1480
NM_012268chr19----1310 --
NM_012281chr742293 1640 1490 963 1939 ----
NM_012282chrX1567 1845 ----
NM_012286chrX134 272 41 ----
NM_012287chr331055 957 236 14355 ----
NM_012288chr685541 5524 4569 4491 4349 4265 1379 262 11513 14304 195
NM_012293chr211952 42099 2052 1665 638 --1711
NM_012294chr784046 3283 2965 2782 1440 1238 666 25 2515 81 ----
NM_012297chr422102 359 ------
NM_012301chr752071 1839 1727 1472 699 22002 1558 --11671
NM_012307chr184813 752 702 100 ------
NM_012309chr1174360 3390 1205 612 454 347 88 24562 3356 ----
NM_012316chr151658 1226 1161 588 537 35092 4498 1014 21757 1481 34949 4769 4636
NM_012323chr2221579 402 11243 11376 --
NM_012325chr2031666 1388 195 1603 ----
NM_012326chr21754 ------
NM_012329chr1731574 1316 1136 ------
NM_012330chr1031536 1145 1117 --11650 --
NM_012334chr584476 4230 3683 3219 2967 1863 593 180 24060 1195 1690 14098
NM_012341chr102424 89 ------
NM_012343chr52886 95 ------
NM_012388chr1512975 12688 21138 893 33149 1006 962
NM_012395chr733048 938 126 23419 333 23370 3015 --
NM_012399chr2241834 655 516 143 --1210 --
NM_012426chr16--1350 ----
NM_012428chr151760 1150 ----
NM_012431chr773160 2894 2754 2296 926 574 466 1108 13553 13420
NM_012434chr641361 1297 112 72 ------
NM_012454chr6--1207 1536 --
NM_012471chrX2580 556 145 ----
NM_012479chr741975 1060 268 243 11720 1876 --
NM_013229chr1242762 2744 1051 500 22211 1909 1354 12427
NM_013231chr1433915 3083 542 33243 1315 133 14081 --
NM_013246chr112941 67 ------
NM_013255chr788699 8022 6044 2270 1802 1621 1016 930 37153 6539 6376 36209 2683 566 13019
NM_013261chr473106 2545 1466 1321 962 865 118 23732 2304 ----
NM_013262chr611063 11410 ----
NM_013263chr161149 ------
NM_013269chr1234481 1523 1204 23484 1411 1757 --
NM_013277chr1241017 418 81 59 11051 --1999
NM_013281chr2021312 387 ------
NM_013283chr51805 1738 ----
NM_013286chr363787 3475 2915 2702 743 256 --1598 --
NM_013293chr71508 1520 ----
NM_013300chr122209 67 ------
NM_013309chr1522617 2236 22626 2253 11682 12107
NM_013316chr72936 309 ------
NM_013341chr242721 2457 2298 2086 11147 22219 446 12941
NM_013354chr811359 --148 --
NM_013372chr152452 138 13341 22228 176 12628
NM_013373chr224993 637 250 238 ------
NM_013396chr21180 ----1399
NM_013436chr22303 56 --1605 --
NM_013437chr821346 1228 2405 160 ----
NM_013438chr931727 1534 169 1553 ----
NM_013449chr1262652 1073 1064 730 425 349 ------
NM_013450chr211130 --1829 --
NM_013986chr22----1123 --
NM_013995chrX32595 1702 841 12124 --11025
NM_014000chr102719 198 11245 1209 --
NM_014001chr1741497 1119 611 210 --1104 --
NM_014011chr222574 1680 11815 12277 --
NM_014016chr321395 537 1225 ----
NM_014021chr163159 2173 1323 1255 1248 949 11123 ----
NM_014023chr1082669 2616 2599 2459 2214 340 271 199 --1425 --
NM_014028chr622392 2100 13164 12231 --
NM_014043chr32414 402 ------
NM_014044chr2--273 64 ----
NM_014079chr32874 23 --1694 --
NM_014112chr855484 3480 3351 1998 783 24823 3910 23689 646 165
NM_014141chr754840 4400 4228 3297 216 55211 5184 1356 1047 1019 ----
NM_014153chr162661 530 --1101 1703
NM_014154chr321598 1547 ------
NM_014155chr11117330 7302 6329 5978 4958 2499 871 725 328 212 97 36526 2107 465 34934 1810 316 --
NM_014181chr231921 1857 526 ----22339 1902
NM_014191chr12----11049 --
NM_014216chr143347 331 266 --11595 --
NM_014217chr11193 11434 ----
NM_014231chr1262130 2084 1919 864 763 253 ------
NM_014234chr61143 ------
NM_014240chr343218 1118 661 354 1125 --33831 3697 3669
NM_014243chr43571 421 75 1120 ----
NM_014250chr2251971 1766 597 314 263 ------
NM_014253chrX4636 562 93 40 --12008 --
NM_014271chrX1138 ------
NM_014280chr12715 639 ----1278
NM_014283chr12603 488 --162 --
NM_014293chr2253112 2700 1324 883 142 11017 11576 11443
NM_014294chr841385 1038 368 98 ------
NM_014300chr15174 1352 ----
NM_014305chr132588 127 ------
NM_014309chr2245042 4752 4650 4616 23371 789 21255 285 --
NM_014319chr1231645 1499 349 31697 1471 1263 ----
NM_014325chr1231892 1560 807 --11658 --
NM_014333chr1152630 1053 890 789 783 ------
NM_014342chr113585 560 32 --11188 --
NM_014351chr2251275 1166 1022 531 63 --11358 1273
NM_014372chr121858 487 ----1670
NM_014376chr532538 2452 1980 --1159 --
NM_014382chr311142 1497 ----
NM_014393chr842153 923 211 57 ------
NM_014399chr71956 154 ----
NM_014411chr71146 12005 ----
NM_014415chr3139 ------
NM_014417chr193906 636 127 ----1860
NM_014423chr595659 5423 5134 3985 3906 3760 3507 2239 1850 11312 1950 14276
NM_014431chr1021399 1235 11605 ----
NM_014432chr63338 115 34 ------
NM_014447chr451562 1496 576 538 268 ------
NM_014455chr11311 1326 ----
NM_014460chr2281569 1524 1479 1338 1266 145 139 127 ------
NM_014469chr11--1301 ----
NM_014491chr72353 184 1895 ----
NM_014494chr1632382 2101 258 --193 --
NM_014504chr71222 ------
NM_014505chr122362 74 --1183 --
NM_014506chr931102 1031 100 ------
NM_014515chr1221021 875 ----1284
NM_014517chr331717 1661 466 11582 11299 --
NM_014522chrX----1207 --
NM_014548chr1511502 21483 1332 --21449 1081
NM_014554chr1242126 1974 879 625 ------
NM_014563chrX12099 11844 12023 --
NM_014574chr1431528 1025 615 --1232 --
NM_014577chr221217 3833 765 734 1709 --
NM_014584chr142592 25 ------
NM_014585chr21345 --11099 --
NM_014603chr1751621 1603 1553 1489 682 ------
NM_014607chr21477 ------
NM_014612chr921205 1185 ------
NM_014613chr553005 1077 768 257 201 --31155 1039 898 --
NM_014614chr241442 1311 579 573 1358 ----
NM_014615chr1653436 3335 2687 782 340 --11221 --
NM_014616chr342123 1229 522 291 33079 2341 406 --1651
NM_014630chr1583076 2642 2589 2565 1082 1058 921 261 13151 ----
NM_014636chr954309 4283 3772 3483 654 1360 2998 138 13157
NM_014646chr1832535 2126 2096 31109 1018 398 1474 1732
NM_014647chr162472 130 21530 579 2613 486 --
NM_014659chr154987 832 383 277 ------
NM_014660chr73946 169 142 --2432 236 --
NM_014661chr10123916 3908 3614 3382 3280 3071 2572 2406 2400 683 352 301 1558 ----
NM_014666chr531060 825 414 ------
NM_014667chr332393 1752 1624 12371 --11976
NM_014671chr71599 ------
NM_014673chr8------162
NM_014674chr373640 3561 3347 3083 2959 2910 1178 43898 3848 3250 1251 13111 --
NM_014676chr131605 1054 258 31577 1458 1393 ----
NM_014680chr171143 ------
NM_014682chr821758 813 ------
NM_014683chr1762023 1854 1639 1401 874 745 --11564 --
NM_014686chr1932129 2021 1029 12084 21903 1596 --
NM_014690chr722386 279 ------
NM_014701chr1533138 749 153 ------
NM_014702chr613071 32514 2129 698 --13511
NM_014709chr22527 430 1463 ----
NM_014711chr161818 1751 21921 796 --
NM_014717chr194642 335 75 44 ------
NM_014721chr6147327 7237 6902 6845 5860 5768 5025 4977 4881 2272 1865 1794 1188 164 1959 11301 12192
NM_014723chr2042160 2070 2057 677 1750 12194 12478
NM_014725chrX3294 225 135 11119 ----
NM_014727chr191310 ------
NM_014729chr822026 136 --1895 --
NM_014730chr12115031 4990 4939 4507 4320 4185 1810 1694 739 622 73 ------
NM_014730chr12115031 4990 4939 4507 4320 4185 1810 1694 739 622 73 ------
NM_014733chr542181 1419 425 206 ------
NM_014735chrX31620 616 600 11471 1421 --
NM_014736chr15----1889 1756
NM_014739chr633877 3723 1069 ------
NM_014741chr1122181 1546 --2661 558 --
NM_014742chr2011147 --21767 164 --
NM_014743chr431158 1066 269 13126 ----
NM_014746chr274101 3796 3704 3505 2807 1671 1191 11705 ----
NM_014747chr174824 4572 4475 1238 422 116 69 11403 1407 14502
NM_014751chr842119 2096 1983 737 --11712 --
NM_014752chr1141946 1712 1336 543 21904 1352 ----
NM_014755chr263175 3159 1643 1303 686 448 13833 ----
NM_014761chr1651171 1116 751 438 250 176 ----
NM_014765chr172682 2404 2144 1029 666 618 96 1975 --11019
NM_014767chr1062565 2487 943 799 528 303 12414 13419 --
NM_014770chr1231178 884 329 1906 ----
NM_014774chr172945 2619 2609 2430 2157 2004 886 ----12424
NM_014779chr311118 ------
NM_014781chr81327 1894 ----
NM_014787chr182760 2578 2284 2129 1747 1065 902 35 ------
NM_014803chr10--11923 22535 980 --
NM_014810chr163643 3100 2397 1132 980 107 33693 3610 1074 ----
NM_014819chr521823 1531 ----1321
NM_014820chr332001 775 207 --12045 --
NM_014822chr41645 ----1585
NM_014824chr1131734 1256 284 ------
NM_014827chr131627 478 141 ----1559
NM_014828chr1432388 1955 60 22298 1627 ----
NM_014832chr1321797 1418 1575 ----
NM_014836chr102361 276 21312 437 --11718
NM_014838chr2252749 1792 918 344 222 1453 158 --
NM_014840chr1273043 3020 2905 2221 945 671 423 ------
NM_014841chr631097 424 347 1869 ----
NM_014847chr12531 149 ------
NM_014848chr1511852 22181 694 ----
NM_014857chr1----1216 --
NM_014860chr252474 1761 959 347 312 11840 ----
NM_014872chr992204 2133 2116 2087 940 768 708 438 388 11722 ----
NM_014873chr154656 1100 1085 527 504 13107 ----
NM_014874chr181895 1473 1278 1227 600 507 488 467 --21454 392 --
NM_014877chr1786902 4967 1976 1869 1690 1178 727 412 21789 1339 ----
NM_014881chr10150 ------
NM_014890chr31236 ------
NM_014892chr61162 153 ----
NM_014893chrY22216 1585 ------
NM_014899chr532460 1141 786 11058 ----
NM_014900chr221029 451 ------
NM_014902chr2021483 356 11535 ----
NM_014903chr1232444 2077 1551 --12226 12404
NM_014904chr1093937 3777 3514 3388 3306 3076 898 499 364 1144 ----
NM_014905chr22366 268 11991 ----
NM_014906chr1742879 2643 2546 1115 32540 634 224 13024 --
NM_014912chr101337 1577 ----
NM_014913chr1841464 1157 566 424 1474 ----
NM_014921chr1952497 2381 2338 2048 774 1341 12404 --
NM_014923chr13165 12161 ----
NM_014924chr1432947 722 264 32998 2707 2311 --31262 1127 177
NM_014934chr1323649 1290 24003 2780 23753 2921 --
NM_014939chr1831215 1175 190 ------
NM_014949chr11262 --186 --
NM_014950chr1421686 494 ------
NM_014951chr1012444 11940 ----
NM_014952chr1551992 1657 498 377 150 --1117 --
NM_014953chr1364171 3462 3428 2886 1582 524 24293 272 11308 --
NM_014978chr1031707 1274 706 ------
NM_014982chr1465286 4771 4407 3429 2085 858 11173 --15327
NM_014988chr422290 1072 ------
NM_014989chr662029 1643 1549 1537 1308 610 --21520 119 --
NM_014991chr433180 828 768 13016 2620 35 1473
NM_014994chr151366 1665 2872 160 21738 1605
NM_014996chr32114 43 ------
NM_014997chr742306 1896 1117 976 32966 2625 144 ----
NM_015000chr1241146 1054 504 390 1531 42565 881 731 308 --
NM_015001chr12880 190 ------
NM_015002chr1282112 2057 1544 1497 1481 349 260 254 1315 22048 247 --
NM_015008chr312436 --13421 --
NM_015020chr1643679 2620 822 575 22478 1018 13222 --
NM_015024chr841357 1238 323 23 11434 ----
NM_015025chr222035 928 ------
NM_015026chr1253803 3591 1897 884 524 11590 --11031
NM_015032chr1322615 2252 62813 2777 2559 1130 845 255 1303 12235
NM_015033chr9113246 3084 2935 2713 2430 1328 842 794 519 87 57 13312 43300 2633 2406 765 --
NM_015039chr174080 3675 1201 1065 839 576 515 ------
NM_015040chr253398 2953 2923 598 196 21229 437 2819 208 --
NM_015042chr1544127 2851 2656 785 33947 3768 3450 --1699
NM_015044chr1642961 2797 2782 587 --12929 --
NM_015045chr1011381 22088 1470 ----
NM_015052chr741183 934 511 260 --1226 --
NM_015059chr1573936 3630 3075 728 620 600 135 --12964 --
NM_015061chr91555 ------
NM_015071chr565753 5288 4976 4634 4191 593 25062 1691 --12229
NM_015074chr1124876 4647 4601 3761 3311 3217 1796 1485 398 174 104 92 --23998 854 33864 1229 1097
NM_015075chrX52251 1542 1410 597 433 ------
NM_015076chr624127 2980 2875 276 ----
NM_015077chr1743480 3276 1700 252 34484 3430 539 33963 3158 3072 --
NM_015079chr1573202 3034 2511 541 468 406 385 --22855 803 1648
NM_015082chr552481 1687 1645 1612 105 11654 ----
NM_015086chr122215 99 ------
NM_015092chr1654507 3659 2999 1295 369 14378 11671 23785 1536
NM_015093chr62373 58 --1599 --
NM_015094chr2284507 3709 3622 1303 866 424 418 398 13978 2579 269 13571
NM_015097chr321714 728 41834 1533 629 152 ----
NM_015107chrX42276 1748 718 300 ------
NM_015113chr1751551 945 898 629 86 ----12372
NM_015115chr4--23127 2903 --12983
NM_015116chr1311654 11669 ----
NM_015124chr2231748 551 130 22443 2364 1769 1721
NM_015129chrX31791 1576 647 ------
NM_015132chr731221 453 143 --11835 --
NM_015133chr1641469 1358 578 29 ------
NM_015137chr862596 2388 2374 1718 1619 992 2865 645 21034 875 --
NM_015138chr1552736 2728 2430 2221 665 21769 138 --11138
NM_015141chr342380 2017 1820 725 12231 ----
NM_015143chr41433 31261 1226 590 1276 --
NM_015144chr1663379 3033 3005 2651 2580 675 12902 ----
NM_015149chr132149 1956 131 --11793 --
NM_015153chr61162 159 1652 --
NM_015155chr1023099 908 22835 804 1115 1401
NM_015156chr1463872 3534 3475 3374 1096 143 12858 --21243 836
NM_015163chr1441293 1268 512 30 11925 ----
NM_015172chr111108 --1200 198
NM_015176chr111494 ----11226
NM_015187chr4----2879 812 --
NM_015192chr2032794 2716 2313 12996 12449 --
NM_015196chr4141 ------
NM_015199chr352787 2751 2722 2227 1117 ------
NM_015200chr422396 2136 22537 801 ----
NM_015206chr1533824 3731 2840 23188 955 153 --
NM_015208chr1833456 1258 730 63485 3338 857 614 553 464 23962 3137 13826
NM_015209chr13910 523 40 1204 --1466
NM_015213chr111747 --1313 --
NM_015215chr132222 2174 1983 ----11262
NM_015216chr5--11453 ----
NM_015230chr42406 288 2378 213 ----
NM_015231chr115884 850 348 170 74 --1899 --
NM_015236chr421076 205 ------
NM_015239chr91181 ------
NM_015247chr1675401 4784 3966 3605 2150 1988 1681 21641 1411 --14286
NM_015251chr1621610 418 2753 151 11752 21678 893
NM_015264chr2244776 3781 1102 219 34656 3349 1374 14021 --
NM_015265chr262470 2179 2075 1966 1035 137 --12374 --
NM_015267chr123823 685 569 12198 ----
NM_015268chr31572 ------
NM_015269chr12567 483 --1610 --
NM_015270chr1242176 2146 1898 357 --21728 754 --
NM_015271chr454343 4047 3748 678 176 33924 3542 345 ----
NM_015278chr653218 2138 384 349 305 22609 644 22683 879 --
NM_015282chr292944 2643 2399 1118 582 441 288 260 153 --1194 --
NM_015285chr1862550 2462 2434 2367 924 648 ------
NM_015288chr533843 3599 2418 12778 23098 2395 --
NM_015289chr1521820 1430 ----11603
NM_015291chr153322 3040 2143 381 320 2863 54 12646 --
NM_015296chr1351238 1227 1084 960 841 ------
NM_015299chr1463964 3700 1363 1323 548 249 23410 3322 21545 694 12765
NM_015308chr112762 311 1863 ----
NM_015310chr8108271 8183 6722 2696 2641 2517 1366 1313 154 99 46567 1811 1723 1442 25068 2168 --
NM_015313chr1144849 4790 1910 714 24530 3091 --34040 1526 116
NM_015315chr563127 2880 2736 2204 1151 956 --23354 1157 --
NM_015317chr222889 2559 1320 1258 --
NM_015321chr1933583 3081 96 1315 24734 4406 --
NM_015326chr152842 2178 2141 1927 910 12325 --12658
NM_015328chr772809 2408 2191 1238 848 162 124 --1168 --
NM_015332chr753248 2688 2467 2241 1260 12613 11180 --
NM_015335chr1241769 560 360 344 --32366 2147 423 --
NM_015336chr1232311 2216 55 22627 2226 ----
NM_015338chr2061939 1801 1588 1548 708 71 ------
NM_015339chr203852 698 645 ------
NM_015344chr842057 1878 1789 1594 ------
NM_015355chr173773 627 219 11906 ----
NM_015359chr82967 506 12977 ----
NM_015361chr22364 297 ------
NM_015365chrX33198 1511 678 33996 1323 942 --14247
NM_015375chr194994 4694 4510 4464 3456 3275 1804 1523 1308 ----2849 715
NM_015385chr1072764 1152 1030 866 743 712 157 21192 456 ----
NM_015387chr231929 427 239 1321 ----
NM_015396chr321133 329 ------
NM_015397chr961809 1293 1273 745 421 158 21869 524 2585 478 --
NM_015416chr12184 2918 816 ----
NM_015430chr112489 36 --2395 48 1100
NM_015435chr821181 1060 1462 11165 --
NM_015446chr131616 1375 1361 ------
NM_015455chr543976 1191 794 340 33214 2651 38 1975 1582
NM_015458chr8105140 5088 5024 3821 2066 1791 1524 1336 206 196 --34659 4061 43 23928 801
NM_015461chr183697 189 129 ------
NM_015470chr25846 488 480 241 97 ------
NM_015481chr12----1837 --
NM_015485chr1--1333 ----
NM_015493chr1921440 247 --21988 866 1732
NM_015497chr15172 1302 --1402
NM_015508chr341344 1319 1024 266 11474 ----
NM_015509chr1241491 289 182 170 1319 ----
NM_015520chr382792 2768 2585 2501 2290 2249 2089 986 --12035 --
NM_015530chr23731 396 103 1115 1212 --
NM_015534chr121127 812 ------
NM_015541chr33988 583 97 ------
NM_015542chr1031081 993 34 11184 ----
NM_015554chr1521061 454 ----12162
NM_015557chr193566 2987 1411 1352 992 737 541 459 22 13554 1793 --
NM_015564chr553562 3218 3175 3042 452 13097 12681 --
NM_015565chr2162232 2080 1901 1834 661 531 11815 ----
NM_015568chr2034078 3856 225 ----24303 880
NM_015569chr124582 1495 23146 2933 14793 --
NM_015570chr721745 739 1126 ----
NM_015571chr621828 497 --1118 1172
NM_015576chr332482 1148 871 22746 1017 ----
NM_015609chr152137 2061 1177 791 657 ----12311
NM_015626chr172242 126 ------
NM_015630chr22971 26 41070 445 381 185 ----
NM_015640chr144900 4874 4695 1454 1931 13857 13770
NM_015641chr741215 1172 1142 948 ------
NM_015649chr19----1263 --
NM_015678chr1321428 484 --1613 --
NM_015695chr611778 ----12094
NM_015702chr2------1238
NM_015726chr151779 1604 1191 1149 597 ------
NM_015850chr862038 1735 978 624 367 138 22270 2137 ----
NM_015866chr131439 1221 372 ------
NM_015878chr841457 864 534 47 1372 11983 --
NM_015879chr1887054 5503 3222 3142 3127 2662 2214 1030 38447 6937 873 27118 579 --
NM_015885chr113353 212 195 1791 ----
NM_015886chr885689 5129 4403 3603 1722 1412 1261 883 1333 ----
NM_015888chr163410 3141 3047 2532 2441 293 ------
NM_015902chr81358 ------
NM_015904chr23760 580 220 ------
NM_015906chr194671 4417 3694 3547 3043 1027 957 837 208 11294 --14740
NM_015912chr822476 1697 11833 1784 --
NM_015949chr72976 136 ------
NM_015967chr111044 ------
NM_015990chr41433 --1888 --
NM_015994chr141485 1202 ----
NM_015995chr15115322 5149 4946 4865 4308 2178 1472 1052 999 424 309 --1417 11518
NM_015999chr1193 ------
NM_016002chr12306 84 178 ----
NM_016018chr842668 2225 1812 327 --11935 --
NM_016021chr612101 22508 130 ----
NM_016023chr832123 1551 342 ------
NM_016037chr12393 30 1175 ----
NM_016038chr7170 ------
NM_016047chr21163 ------
NM_016061chr22493 265 --11045 --
NM_016072chr1241868 1765 809 328 12293 --22204 100
NM_016073chr151983 ------
NM_016076chr122576 288 22880 2868 ----
NM_016083chr633754 3587 213 43844 1222 1112 443 --13648
NM_016097chr181177 ------
NM_016121chr121149 862 ------
NM_016128chr32220 99 1326 ----
NM_016132chr1512908 ------
NM_016133chr231411 1324 1104 1193 ----
NM_016152chr311190 ------
NM_016156chr1122143 885 1951 --12361
NM_016169chr1053082 2751 2675 2511 1130 23271 981 22770 2204 --
NM_016185chr173183 49 34 ------
NM_016205chr421277 315 ----11380
NM_016206chr358480 6813 3562 2116 572 27821 1133 --12501
NM_016226chr122398 337 1164 ----
NM_016227chr12603 488 --162 --
NM_016231chr1741377 1279 1146 134 1181 188 --
NM_016242chr41141 ------
NM_016258chr11611 ------
NM_016260chr2117617 7327 7142 6788 6780 6238 5104 2868 2546 1315 234 21218 667 17432 --
NM_016261chr171660 2756 73 1168 --
NM_016269chr431009 409 83 2775 370 --1748
NM_016270chr192303 180 ------
NM_016271chr181604 1572 ----
NM_016272chr2252761 2115 1997 638 313 ----1217
NM_016284chr162964 916 1333 ----
NM_016289chr2--22338 655 ----
NM_016301chr122410 35 ------
NM_016303chrX1391 ------
NM_016306chr31358 ------
NM_016311chr1184 ------
NM_016312chr12--2447 422 ----
NM_016322chr962535 2089 1231 409 85 47 22581 2409 ----
NM_016339chr1731400 681 158 ------
NM_016352chr751278 1203 509 240 86 ----11427
NM_016357chr121911 ----1258
NM_016374chr151405 1132 1083 1045 359 --1282 --
NM_016374chr151405 1132 1083 1045 359 --1282 --
NM_016376chr1793793 3638 2977 1674 1631 1546 1508 1200 732 13839 23481 2799 --
NM_016396chr1542708 1102 498 309 23046 709 12215 --
NM_016403chr11--1611 --1243
NM_016410chr9--2581 28 ----
NM_016413chr131438 ------
NM_016424chr1721765 1338 1557 --1762
NM_016436chr2032711 2705 1716 11729 --22306 2171
NM_016441chr211727 12279 --1255
NM_016470chr20144 ------
NM_016475chr1451248 1224 1135 1126 868 1188 ----
NM_016488chr1241720 717 483 39 ------
NM_016507chr1732953 2516 2050 1973 ----
NM_016516chr22774 328 ----175
NM_016531chr454074 3643 3471 1121 1071 1423 ----
NM_016542chrX31553 591 225 31715 1329 518 ----
NM_016544chr233358 2958 216 43916 1359 433 273 1833 --
NM_016548chr92621 439 ------
NM_016577chr343925 3691 646 42 ------
NM_016578chr11----1492 --
NM_016605chr562688 2606 2542 2498 2187 2007 ----1615
NM_016612chr81494 ------
NM_016613chr412752 12741 ----
NM_016621chr1134507 3448 141 --13402 13069
NM_016626chr1821424 225 --11374 --
NM_016628chr103688 203 137 ------
NM_016631chr212787 212 1282 ----
NM_016643chr16------3948 749 246
NM_016644chr51556 ------
NM_016654chr1531105 435 419 2207 154 ----
NM_016656chrX2321 102 1350 ----
NM_016823chr173986 307 198 1127 1247 21212 1078
NM_016830chr122492 446 ------
NM_016834chr1754068 3362 3161 1534 687 --33745 1653 752 --
NM_016835chr1754068 3362 3161 1534 687 --33745 1653 752 --
NM_016836chr2--1707 ----
NM_016839chr2--1707 ----
NM_016841chr1754068 3362 3161 1534 687 --33745 1653 752 --
NM_016929chr631414 1099 80 13570 --11152
NM_016946chr143555 1447 1038 599 13451 32837 991 76 1845
NM_016952chr1173959 3627 3310 2581 1179 1155 609 11401 1726 --
NM_017415chr594355 4335 4072 4042 3626 3418 1192 670 104 24467 1290 33312 3124 1091 151
NM_017420chr1433208 3036 1415 11406 ----
NM_017423chr452211 2134 620 578 100 11479 ----
NM_017447chr2144398 3295 3082 482 1645 ----
NM_017452chr2041461 1157 578 343 --1249 --
NM_017453chr2041461 1157 578 343 --1249 --
NM_017454chr2041461 1157 578 343 --1249 --
NM_017455chr151760 1150 ----
NM_017481chr111209 ------
NM_017491chr42653 414 --1162 --
NM_017519chr621020 195 ------
NM_017520chr133168 134 127 ----2146 106
NM_017544chrX1163 ------
NM_017545chr202368 26 ----192
NM_017551chr1032223 1776 134 --12323 --
NM_017553chr1531257 1177 993 --1200 --
NM_017563chr386129 4291 2412 1524 1186 1168 370 278 36326 4613 1482 36169 4687 857 25850 5716
NM_017577chr311658 --11321 --
NM_017578chr3195 ------
NM_017580chr1052044 1803 1741 1595 770 144 ----
NM_017582chr121796 1143 11462 11199 11302
NM_017594chr951260 1073 922 758 562 22953 809 ----
NM_017610chr1551924 1860 286 255 222 --11422 11885
NM_017617chr931307 514 53 ----11255
NM_017628chr445192 1868 939 78 1171 --11851
NM_017629chr141919 1871 1448 378 21819 1544 ----
NM_017632chr41467 ----1421
NM_017633chr653373 968 924 826 23 --1520 23087 2964
NM_017634chr861919 1875 1716 1660 1394 139 --11266 --
NM_017637chr9179453 9336 8466 6577 6440 6134 3630 3047 2832 2811 2533 2435 2122 1418 1362 925 793 29433 526 19132 15841
NM_017641chr124445 176 75 49 --2983 467 11150
NM_017643chr1752906 2877 2035 904 622 11927 ----
NM_017645chr922945 813 33159 2090 279 ----
NM_017649chr1021054 90 --21260 1242 --
NM_017650chr7106104 5627 4608 4523 3906 1845 1698 1602 1589 567 16010 --12202
NM_017651chr651599 1590 1546 1502 363 1639 --1501
NM_017657chr22643 347 ------
NM_017658chr1453873 3694 1505 1456 42 14647 11105 --
NM_017660chr1963290 2949 2762 2722 732 599 12670 12891 --
NM_017661chr153809 379 134 1974 ----
NM_017664chr133418 161 97 ------
NM_017672chr151497 ------
NM_017693chr131132 11299 1155 --
NM_017694chr231758 1657 779 ------
NM_017719chr382348 2301 2291 2214 1784 824 782 698 11875 ----
NM_017724chr3--1718 ----
NM_017737chr132242 2025 1858 11927 ----
NM_017738chr911248 ------
NM_017741chr41147 21792 194 --32225 2089 329
NM_017742chr183777 637 141 ------
NM_017762chr1511823 21790 231 ----
NM_017769chr1432233 2205 911 12641 --1644
NM_017770chr622120 49 1549 ----
NM_017778chr851329 1050 495 447 40 ------
NM_017779chr122737 88 22616 2422 ----
NM_017780chr8--2669 106 ----
NM_017784chr341156 889 855 100 ------
NM_017786chr82556 145 ------
NM_017787chr1092861 2756 2025 1897 1105 976 582 532 485 ------
NM_017798chr2031167 1069 189 ------
NM_017801chr322078 2038 177 ----
NM_017813chr875459 3816 1802 1343 1094 739 278 23823 154 ----
NM_017831chr1834125 2999 484 34753 3145 697 --1557
NM_017848chrX114629 4406 4386 4018 3980 3542 1730 1281 886 187 159 13767 ----
NM_017849chr253050 2928 2814 2184 1969 23040 1958 ----
NM_017856chrX3457 138 70 ----32139 796 664
NM_017890chr831689 607 30 11615 ----
NM_017902chr10104780 4753 4735 4378 3713 3697 1537 871 312 296 43785 3568 1260 638 ----
NM_017905chr132206 39 1433 ----
NM_017913chr91420 ------
NM_017918chr4--1117 ----
NM_017922chr142441 88 ------
NM_017925chr941430 1349 1328 1289 ----1442
NM_017933chr251566 1488 1338 1066 508 ------
NM_017938chrX52149 1445 509 288 254 11697 ----
NM_017943chr144838 794 261 109 1421 ----
NM_017944chr1132615 2522 824 32942 2506 1974 --11018
NM_017946chr711347 ----11214
NM_017954chr721684 277 2329 75 1116 --
NM_017958chr272866 2234 2044 1962 1940 645 43 --1904 1771
NM_017966chr114602 462 280 109 --11520 --
NM_017982chr1153 1973 ----
NM_017988chr122737 322 ------
NM_017994chr742819 2322 2252 2200 ----1143
NM_018003chr1522010 197 11973 11690 11556
NM_018011chr131124 ------
NM_018014chr251257 491 433 315 65 ------
NM_018017chr1042748 725 230 126 --1261 11020
NM_018028chr191871 ------
NM_018043chr1131363 933 220 ------
NM_018045chr162842 2548 2360 1182 814 121 1189 22064 1985 --
NM_018047chr52246 91 1725 ----
NM_018051chr71117 132 ----
NM_018060chr12362 302 ------
NM_018061chr121111 109 --1260 --
NM_018070chr11510 --1571 --
NM_018086chr21524 ------
NM_018098chr31477 181 ----
NM_018121chr1022070 926 22456 523 1965 --
NM_018125chr1----1437 --
NM_018133chr322187 110 ------
NM_018137chr131334 1157 276 11098 1502 --
NM_018144chr10------1236
NM_018155chr343418 3222 600 550 ------
NM_018157chr1263171 3025 1153 728 161 53 ------
NM_018182chr1762227 1930 1663 1619 760 246 ------
NM_018184chr352160 1986 1895 1739 1510 11652 ----
NM_018198chr131071 355 327 11307 1952 --
NM_018199chr143874 778 283 11252 1100 --
NM_018200chr1592604 2542 2350 2256 1775 1595 1041 620 120 1856 ----
NM_018202chr11772 1188 ----
NM_018227chr433212 3141 2078 ------
NM_018243chr491266 987 909 596 588 334 291 283 255 --22881 2729 12595
NM_018246chr82571 543 22866 931 1669 --
NM_018265chr162090 1998 1527 748 664 264 1208 11390 --
NM_018275chr74578 519 222 131 1527 ----
NM_018287chr1041315 1274 457 22 11146 ----
NM_018293chr311847 11835 ----
NM_018299chr833200 1100 843 32968 2550 1057 --12525
NM_018312chr1142174 772 590 427 ----1257
NM_018313chr342585 2377 2329 2137 12505 12108 --
NM_018315chr421086 369 ------
NM_018325chr911496 --1591 1156
NM_018330chr10--11520 1570 --
NM_018351chr12--33713 3613 2879 ----
NM_018362chr1132954 1592 1077 1430 ----
NM_018364chr153847 3364 3119 1598 1391 14110 ----
NM_018365chr151103 ------
NM_018372chr12473 108 ------
NM_018374chr755219 1903 1897 1451 665 25109 158 ----
NM_018375chr1411705 1365 ----
NM_018400chr1174480 3572 3265 2976 777 547 318 12779 14555 --
NM_018403chr343868 3674 3560 3162 ------
NM_018413chr12----1206 --
NM_018416chr122768 757 --2608 95 --
NM_018424chr921746 171 11806 ----
NM_018425chr1052386 2228 1814 1660 720 --22064 384 --
NM_018427chr1651605 1315 515 266 74 ----11359
NM_018434chr51180 ------
NM_018440chr877636 5976 5622 3368 1915 1516 466 38587 7877 3009 26297 3218 26160 32
NM_018444chr842197 1962 1901 811 ------
NM_018448chr1221094 428 21274 314 ----
NM_018452chr6_random51398 1042 535 491 31 23622 2833 ----
NM_018464chr10132 1364 ----
NM_018489chr1--1589 12197 --
NM_018566chr174806 3788 3752 3706 3247 430 323 2474 367 ----
NM_018584chr161253 1188 1059 862 846 132 ------
NM_018602chr1551692 1458 1114 413 107 11235 ----
NM_018638chr12114902 4462 4444 3732 3546 2256 1964 1849 1141 733 42 45670 4758 4744 1658 --14089
NM_018639chr121286 ----11381
NM_018640chr1252747 2594 941 427 155 12216 ----
NM_018644chr1132192 2079 675 ------
NM_018650chr141809 1537 294 190 11566 --194
NM_018667chr1642664 2652 1760 322 ----21904 693
NM_018682chr7--137 189 --
NM_018683chr2071653 1635 1482 1244 1081 283 78 --11344 --
NM_018689chr1532638 2559 2391 21844 479 ----
NM_018698chrX41898 1871 1649 405 ------
NM_018700chr531608 1352 1193 ------
NM_018704chr13833 674 114 1871 ----
NM_018712chr1131413 1304 989 1511 ----
NM_018713chr11164 ------
NM_018718chr741673 1630 393 337 11873 2754 595 --
NM_018834chr52714 140 1932 ----
NM_018844chr711990 --1189 --
NM_018890chr741356 1316 1282 1005 11328 ----
NM_018898chr582256 1996 1469 775 651 322 222 139 11562 ----
NM_018899chr582256 1996 1469 775 651 322 222 139 11562 ----
NM_018900chr582256 1996 1469 775 651 322 222 139 11562 ----
NM_018901chr582256 1996 1469 775 651 322 222 139 11562 ----
NM_018902chr582256 1996 1469 775 651 322 222 139 11562 ----
NM_018903chr582256 1996 1469 775 651 322 222 139 11562 ----
NM_018904chr582256 1996 1469 775 651 322 222 139 11562 ----
NM_018905chr582256 1996 1469 775 651 322 222 139 11562 ----
NM_018906chr582256 1996 1469 775 651 322 222 139 11562 ----
NM_018907chr582256 1996 1469 775 651 322 222 139 11562 ----
NM_018908chr582256 1996 1469 775 651 322 222 139 11562 ----
NM_018909chr582256 1996 1469 775 651 322 222 139 11562 ----
NM_018910chr582256 1996 1469 775 651 322 222 139 11562 ----
NM_018911chr582256 1996 1469 775 651 322 222 139 11562 ----
NM_018945chr631258 1052 858 1797 13536 12798
NM_018963chr2131437 1375 161 --21024 213 --
NM_018970chr742930 1264 775 307 22739 545 12854 --
NM_018976chr1252841 2530 2389 1777 188 12463 ----
NM_018977chrX1939 ------
NM_018979chr1222333 1951 32577 1712 345 12113 --
NM_018992chr1621544 1370 ------
NM_018993chr2031373 1285 389 --11008 --
NM_018999chr1044257 3408 1590 1512 31127 776 423 11077 24893 1183
NM_019001chr354225 3990 1798 1571 1281 24125 238 14425 --
NM_019004chr711676 --1783 --
NM_019008chr2233656 3535 356 13246 ----
NM_019027chr41549 ----12143
NM_019028chr11158 1350 ----
NM_019035chr44790 713 187 120 11509 ----
NM_019041chr642542 1837 1716 1041 1442 ----
NM_019044chr274452 4302 3727 3192 3145 1268 305 --11757 --
NM_019046chr102842 239 --1685 --
NM_019053chr101779 11058 --11036
NM_019072chr563792 3685 3401 2626 1025 562 13495 ----
NM_019074chr152311 195 1663 ----
NM_019080chr1331523 1200 1070 31114 576 61 --1352
NM_019089chr163379 2617 2500 822 789 629 11314 --43337 2957 2823 1017
NM_019091chr211007 11037 ----
NM_019094chr1243109 682 519 318 ------
NM_019102chr71146 --1169 --
NM_019102chr71146 --1169 --
NM_019106chr2282181 1354 989 719 628 270 130 103 53412 2531 2510 493 249 1193 --
NM_019116chr1633668 3152 1244 23767 2855 --1670
NM_019555chr371517 1265 360 210 176 139 45 21503 419 ----
NM_019557chr13862 298 197 ------
NM_019593chr2063104 3082 2812 2759 2689 484 ------
NM_019594chr941630 1516 223 136 ------
NM_019597chrX2720 217 2589 500 ----
NM_019857chrX21396 240 ----139
NM_019859chr1021260 1029 --11489 --
NM_019885chr262878 2635 2377 2328 1987 68 12236 1842 --
NM_019891chr11367 ------
NM_019896chr21193 ------
NM_020116chr431758 1732 1395 11175 11808 --
NM_020122chr2125835 5613 5549 5527 4274 4205 2219 688 670 618 233 102 45495 5274 3648 1649 25136 655 24854 4724
NM_020144chr732077 1959 1843 11949 ----
NM_020148chr1822536 2269 11103 --12594
NM_020150chr1022240 2133 ------
NM_020154chr15----1196 --
NM_020159chr441607 1523 1172 427 11713 ----
NM_020177chr542262 914 831 654 12916 ----
NM_020193chr1131084 427 65 1322 ----
NM_020198chr1731239 1083 484 138 21145 619 --
NM_020205chr132683 983 573 ------
NM_020228chr11143 ------
NM_020229chr111148 ------
NM_020235chr31114 ------
NM_020238chr114399 185 80 56 1261 1971 1900
NM_020240chr541056 726 622 590 12393 22717 926 --
NM_020245chr694806 4452 3883 1977 1409 721 377 202 158 34320 3622 1510 24232 882 --
NM_020318chr1--1369 ----
NM_020337chr472994 2969 2560 464 456 377 76 --1715 --
NM_020338chr10103630 3302 3190 1481 1456 1450 1191 1167 1007 672 --182 --
NM_020341chr2021317 455 11941 192 --
NM_020342chr242282 1605 203 65 ----11036
NM_020346chr1121269 1120 1171 21372 1350 --
NM_020348chr1022663 1926 ------
NM_020381chr611984 1268 1343 1512
NM_020384chrX21874 38 11893 --11565
NM_020390chr374898 4523 4442 3153 852 306 229 13686 1461 --
NM_020401chr121184 ------
NM_020403chr1321110 699 1505 ----
NM_020420chrY2211 202 21658 493 ----
NM_020432chr731980 658 71 1588 ----
NM_020443chr187032 6701 6344 6164 5523 4706 2172 1837 24314 554 ----
NM_020463chr221382 402 31528 1266 997 ----
NM_020473chrX21301 267 ----11741
NM_020630chr101668 ------
NM_020640chr32837 192 --136 --
NM_020647chr821760 630 22257 819 ----
NM_020651chr241743 1616 1320 1183 ------
NM_020654chr33533 394 332 ------
NM_020666chr51844 ------
NM_020673chr2085824 5669 5577 4905 3004 2419 1908 181 --37558 2375 1263 --
NM_020686chr1633104 1144 1121 12477 ----
NM_020689chr2061580 1518 1459 1418 1409 110 ------
NM_020693chr11----1148 --
NM_020697chr82388 326 ------
NM_020708chr2032200 153 101 12274 ----
NM_020711chr221874 399 --11837 --
NM_020718chr1696247 5483 2052 1872 1849 1127 1027 998 80 2350 31 ----
NM_020727chr2153546 3277 3049 1551 769 ----12947
NM_020728chr762551 1958 1237 810 296 254 22919 1264 23031 2767 12628
NM_020732chr621020 195 ------
NM_020734chr1243160 2967 1347 739 134 ----
NM_020739chr1523467 1065 2567 48 ----
NM_020742chrX82366 2285 2059 1082 1015 930 745 558 1223 --12291
NM_020746chr2011093 11115 ----
NM_020747chr51210 ------
NM_020748chr1741341 355 298 173 11492 --1393
NM_020749chr831376 756 686 2797 623 ----
NM_020752chr1012696 ------
NM_020755chr61141 ------
NM_020766chrX44386 3779 3211 1164 ------
NM_020772chr17157773 7388 7063 6687 6671 5777 3427 3224 2697 2582 2121 1305 1148 847 416 21884 1001 ----
NM_020773chr42854 745 1802 42621 2186 1870 1847 --
NM_020774chr1864867 4552 2152 1635 1233 1003 24616 4481 --13964
NM_020783chr1842394 2374 1572 749 ------
NM_020792chr322521 2201 1610 11826 --
NM_020801chr512575 ------
NM_020805chr1831845 466 208 1632 ----
NM_020806chr143798 727 110 2816 60 ----
NM_020808chr14888 836 809 341 1698 ----
NM_020810chr1443425 2311 741 106 --1473 --
NM_020825chr1652799 794 776 663 448 13822 32536 1313 291 13143
NM_020830chr263321 3215 3181 1190 853 200 1684 ----
NM_020832chr11618 ------
NM_020834chr143477 453 28 ------
NM_020839chr371263 1197 1066 1003 610 578 400 ------
NM_020841chr1212860 34037 2752 1048 ----
NM_020843chr151306 1319 ----
NM_020844chr857525 5245 2929 2301 817 ----36993 982 693
NM_020845chr12102518 2501 2416 2401 2226 2011 1828 1701 293 193 ------
NM_020851chr1541529 1515 1226 548 11538 21783 1171 --
NM_020854chr1841078 525 330 61 --1221 --
NM_020856chr1911126 ------
NM_020858chr1552359 2136 853 612 464 12352 195 --
NM_020866chr133984 289 115 ------
NM_020868chr211296 1307 --11455
NM_020870chr442151 1764 1420 224 ------
NM_020872chr341793 1770 1588 601 ------
NM_020888chr161791 1500 1256 663 516 459 --11532 --
NM_020899chr1722535 569 ------
NM_020909chr234126 423 84 43860 3172 2664 1223 11150 --
NM_020917chr1983963 3590 2701 2651 1392 1027 866 575 43515 975 962 308 --23847 3713
NM_020918chr1073623 3511 2957 2467 1216 982 51 12380 1827 12343
NM_020922chrX31606 1164 172 ------
NM_020926chrX2381 101 ----1301
NM_020927chr161235 32277 854 625 ----
NM_020940chr1011107 12901 21143 394 --
NM_020947chr1641974 1885 712 629 ------
NM_020948chr173385 2885 2465 801 757 652 322 11382 ----
NM_020951chr1952446 1920 361 133 108 ------
NM_020962chr1561814 1803 884 427 366 63 --22385 91 --
NM_020964chr1884763 3164 1764 1592 994 940 776 658 11865 21252 1093 23129 1784
NM_020977chr422011 407 ------
NM_020983chr1242176 2146 1898 357 --21728 754 --
NM_021003chr141299 ------
NM_021007chr212121 ----1712
NM_021012chr1763076 2948 2846 2707 2439 2308 12744 22559 2213 --
NM_021035chr20--1975 --2261 128
NM_021038chr332482 2457 466 --33280 2646 394 --
NM_021072chr532493 2456 1824 12411 1944 --
NM_021079chr1742872 2638 2302 770 33037 910 848 22689 1062 --
NM_021083chrX32295 817 768 23449 961 ----
NM_021090chr2263794 3163 3085 1488 339 115 23581 3503 ----
NM_021097chr263027 2724 1977 1127 969 136 ------
NM_021111chr921343 1322 ------
NM_021120chrX52913 2765 872 432 374 ------
NM_021132chr1031334 1204 279 ------
NM_021136chr142677 161 ------
NM_021145chr721026 938 ------
NM_021148chr712104 ------
NM_021155chr1943003 2946 2531 161 --11181 --
NM_021161chr141546 ------
NM_021183chrX52590 2044 575 444 344 ----1912
NM_021190chr12470 233 ------
NM_021192chr21438 --1311 --
NM_021202chr2062435 2200 2127 2023 1141 964 --23026 517 --
NM_021215chr2052271 2199 1638 1509 406 12078 ----
NM_021218chr9------2904 768
NM_021222chr111030 1949 21366 1080 --
NM_021226chr10253 26 --173 --
NM_021229chr1241201 1088 899 508 --1463 --
NM_021238chr1241918 1673 1323 769 11578 11985 --
NM_021239chr1441356 1133 520 159 2301 100 ----
NM_021242chrX----2743 289 --
NM_021249chr1441263 1044 597 179 ------
NM_021252chr1021291 55 1663 11592 --
NM_021255chr1454137 4076 3931 699 491 ------
NM_021260chr1421144 500 ------
NM_021569chr921075 229 ------
NM_021574chr2272035 1855 1741 1682 1597 458 435 --12229 1656
NM_021619chr921284 415 11193 ----
NM_021622chr1021737 475 12214 1898 --
NM_021629chr375008 4495 4073 3672 3343 3138 1460 23212 1873 ----
NM_021637chrX2955 144 ------
NM_021643chr221878 229 --11476 --
NM_021647chr444737 1291 957 638 33046 1789 54 ----
NM_021648chr672472 2428 1792 814 679 563 358 --2730 175 --
NM_021724chr17136 ------
NM_021738chr101148 ------
NM_021813chr6105602 5471 5459 5216 4530 4396 4033 3986 2086 245 15686 164 15279
NM_021911chr565367 4904 4830 3713 266 135 21822 426 ----
NM_021912chr1553320 1204 408 80 62 12620 ----
NM_021923chr41131 11474 ----
NM_021935chr321005 978 148 ----
NM_021940chr621257 390 1626 1149 --
NM_021943chr632069 2009 85 12183 ----
NM_021946chrX51380 541 435 418 358 --1493 --
NM_021947chr1711142 --1937 --
NM_021949chrX32788 2118 952 --12852 1817
NM_021954chr1342890 1437 1199 321 1956 12377 --
NM_021961chr11117129 7114 6898 6866 6645 6093 5693 5175 2695 2675 31 11670 21316 1131 12014
NM_021962chr1762347 1728 1717 1635 587 167 12195 1667 11813
NM_021963chrX4552 537 87 76 ------
NM_021964chr376401 6367 5713 4136 4018 1843 820 ------
NM_021965chr941338 1182 1140 217 ------
NM_021967chr511168 ----11276
NM_021988chr202440 96 31545 1079 1040 1476 --
NM_022048chr1596234 6209 5360 5004 4953 4181 2360 1838 652 36370 6310 599 1542 12426
NM_022075chr12627 140 ------
NM_022080chr2042522 2429 1001 147 1490 2587 122 12359
NM_022085chr631551 1517 1377 ------
NM_022112chr1152090 1506 595 336 302 ----21709 1423
NM_022114chr184639 4457 4424 4171 3812 1718 1410 1156 11422 1925 --
NM_022116chr73884 111 31 ------
NM_022130chr52951 432 179 ----
NM_022133chr831716 1666 1491 ------
NM_022137chr1432077 1697 1618 --11961 --
NM_022138chr631351 1322 237 --1371 --
NM_022143chr731085 579 90 1188 ----
NM_022144chrX1121 ------
NM_022170chr741283 454 204 133 ------
NM_022171chr3----1205 1400
NM_022336chr282387 2333 1855 1758 1551 817 617 158 11471 1218 --
NM_022343chr951297 975 107 92 85 ------
NM_022367chr11709 ------
NM_022373chr71861 ----1349
NM_022374chr2------1424
NM_022442chr202440 96 31545 1079 1040 1476 --
NM_022459chr1366286 5012 4472 1785 1623 1049 25904 5295 ----
NM_022463chr1721500 1262 --1566 --
NM_022465chr1213076 12278 ----
NM_022470chr32897 39 --21158 796 11025
NM_022477chr2051449 658 619 383 338 ------
NM_022484chr721370 112 11004 ----
NM_022491chr1262874 2705 2527 1436 1426 976 --13306 --
NM_022497chr362840 2784 2536 437 318 145 --33651 1119 274 42846 1477 1461 986
NM_022648chr274604 4277 4239 1197 656 450 45 33739 1646 1279 24036 3567 --
NM_022650chr51971 1181 ----
NM_022652chr124942 833 446 236 1344 1123 --
NM_022728chr72203 68 ------
NM_022742chr72261 64 1316 ----
NM_022753chr142787 2693 615 212 1854 ----
NM_022756chr111050 1178 --1129
NM_022758chr661107 1088 721 683 677 459 1808 ----
NM_022763chr363173 3064 2724 2056 605 394 1401 1639 --
NM_022771chr1221080 795 ----1827
NM_022776chr321617 1400 1442 1577 --
NM_022780chr241666 1196 754 99 ------
NM_022781chr943296 2386 2169 1153 33183 2342 983 ----
NM_022782chr121293 ------
NM_022818chr1631411 1293 228 31540 1138 336 ----
NM_022822chr11291 82 ------
NM_022828chr511484 11503 ----
NM_022841chr1562684 2584 2268 2007 1917 517 12288 ----
NM_022842chr343093 2111 581 457 ----1260
NM_022843chr1371488 1449 1429 1333 1272 984 223 1529 ----
NM_022845chr1632021 1582 801 1836 ----
NM_022893chr293127 2322 2233 1208 781 614 271 172 90 22902 497 12304 --
NM_022894chr251682 556 444 293 166 11205 ----
NM_022898chr1484798 4718 4023 3613 3184 229 147 30 14435 ----
NM_022903chr3146 ------
NM_022912chr222804 1233 22976 442 12954 22608 2498
NM_022917chr941272 1235 1005 409 1890 --11105
NM_022970chr1041319 1145 99 85 1176 11087 --
NM_022977chrX1999 ------
NM_022978chr511168 ----11276
NM_023000chr1421274 115 11642 ----
NM_023001chr1421274 115 11642 ----
NM_023008chr19----1237 1122
NM_023010chrX2813 557 ------
NM_023015chr11717 1267 ----
NM_023016chr242167 1092 676 205 12887 11831 --
NM_023018chr141664 119 90 80 ------
NM_023072chr1931001 772 171 ------
NM_023079chr1761697 1679 1170 460 422 168 11237 ----
NM_023105chr862038 1735 978 624 367 138 22270 2137 ----
NM_023106chr862038 1735 978 624 367 138 22270 2137 ----
NM_023110chr862038 1735 978 624 367 138 22270 2137 ----
NM_023111chr862038 1735 978 624 367 138 22270 2137 ----
NM_023923chr131326 1318 1070 23740 2399 1336 21189 749
NM_023929chr842759 2311 1007 524 12809 ----
NM_023931chr1631596 1244 478 --1518 --
NM_024007chr533189 2132 246 --22052 476 --
NM_024061chr72436 186 ------
NM_024071chr143457 416 103 ------
NM_024076chr1962336 2315 1898 840 354 335 11803 ----
NM_024077chr91179 2776 601 123 --
NM_024086chr1763809 3324 2408 973 772 703 1962 33640 2450 57 22769 2636
NM_024095chr1211411 31038 969 613 --2565 430
NM_024294chr661107 1088 721 683 677 459 1808 ----
NM_024295chr8--11652 ----
NM_024297chr171229 ------
NM_024324chr221176 ------
NM_024325chr2051245 1117 1069 830 98 ------
NM_024332chrX31854 1783 1343 ----1668
NM_024336chr16177 193 ----
NM_024337chr52277 254 ------
NM_024345chr986093 5345 5090 2096 1441 1371 893 710 35646 4703 1698 --11565
NM_024411chr2051518 1258 539 363 180 ------
NM_024415chr5124 ------
NM_024423chr1811081 12678 ----
NM_024490chr152590 557 ------
NM_024511chr433140 791 663 22736 955 23451 1142 13319
NM_024520chr21100 ------
NM_024523chr711243 ------
NM_024524chr392948 2779 2306 718 630 521 482 397 75 ----12170
NM_024529chr12876 476 --11000 1203
NM_024539chrX21196 849 1838 ----
NM_024545chr23710 702 601 ------
NM_024556chr112506 199 ------
NM_024557chr1141108 1067 647 78 2355 178 ----
NM_024561chr1341198 873 330 232 41240 568 433 130 --11252
NM_024565chr551629 1620 1226 1068 129 11188 ----
NM_024567chr81108 ------
NM_024569chr152815 2694 2417 436 49 22291 1799 12215 --
NM_024574chr43370 110 104 ------
NM_024582chr4--21128 425 ----
NM_024595chr1--1324 --21133 996
NM_024612chr1711004 ------
NM_024613chr821597 1178 1123 ----
NM_024628chr311116 ------
NM_024638chr332484 671 401 32469 1737 587 142 --
NM_024639chr652883 2342 1134 908 638 ----12757
NM_024646chr133234 679 419 12890 --22757 1570
NM_024657chrX143 ------
NM_024659chr23294 162 126 ------
NM_024665chr331723 1555 194 34263 3651 714 ----
NM_024676chr121295 893 --31352 1096 863 --
NM_024700chr11357 1106 ----
NM_024711chr741861 1569 474 52 12000 1335 --
NM_024713chr1521548 1057 ------
NM_024721chr83877 708 651 --1209 --
NM_024725chr11169 2151 38 --1225
NM_024738chr1211782 2318 201 22000 1890 --
NM_024740chr1154121 1560 1481 961 187 34170 3998 3162 34027 1436 1403 184
NM_024742chr1641597 1288 1266 221 129 ----
NM_024745chr1621057 440 --193 --
NM_024751chr432026 1642 526 ------
NM_024753chr22693 310 1743 ----
NM_024755chr151897 151 ----
NM_024757chr91910 ------
NM_024759chr82750 101 ------
NM_024763chr13474 65 27 ------
NM_024770chr286723 6489 5712 4924 971 800 252 220 45340 2449 2072 666 24628 4486 --
NM_024778chrX--164 ----
NM_024817chr1575817 5494 4483 2018 1996 909 495 15072 25681 775 15691
NM_024828chr931548 384 142 ------
NM_024837chr1541274 692 588 534 31226 430 322 ----
NM_024852chr13539 458 271 1447 ----
NM_024854chr1221476 521 1589 ----
NM_024875chr1031777 1549 1529 --1503 --
NM_024894chr25493 439 331 148 120 21160 24 1451 --
NM_024900chr441698 1676 702 84 ----12259
NM_024900chr441698 1676 702 84 ----12259
NM_024915chr871891 1089 762 676 626 575 236 ------
NM_024920chr41278 21193 50 11256 --
NM_024930chr552803 2262 2095 854 430 --1109 --
NM_024939chr164468 290 171 105 ------
NM_024941chr511469 2173 120 11432 --
NM_024943chr4----1740 1608
NM_024947chr348349 2546 2381 2362 157 49369 8772 6499 1944 19465
NM_024953chr1232705 2522 1737 ------
NM_024989chr278081 8053 7859 5096 1740 285 268 --56457 5085 3075 1516 1489 --
NM_024991chr1072764 1152 1030 866 743 712 157 21192 456 ----
NM_025027chr19127 ------
NM_025054chr853950 3821 1382 1158 96 23896 2913 24043 888 --
NM_025058chr12218 139 --1706 --
NM_025090chr1721360 178 11508 ----
NM_025106chr131730 712 605 11664 11875 11496
NM_025133chr21873 1795 ----
NM_025134chr1652489 2378 2005 1590 854 ------
NM_025135chr182410 149 ------
NM_025137chr152309 29 1405 ----
NM_025138chr1321168 476 --1348 --
NM_025141chr151111 --1514 --
NM_025146chr322482 35 1537 ----
NM_025147chr21165 ------
NM_025160chr141553 1001 638 368 ------
NM_025164chr1121907 668 1795 1193 --
NM_025184chrX1640 ------
NM_025191chr133496 1197 850 --13372 --
NM_025195chr851902 1855 1630 1624 1612 ------
NM_025203chr211258 ----11369
NM_025219chr2061552 800 614 586 401 260 12448 ----
NM_025222chr372987 2583 2203 1161 880 469 27 12276 11013 --
NM_025235chr1022224 1554 --31488 247 110 11526
NM_025263chr651236 640 462 409 66 --31554 1385 211 --
NM_025264chr2--138 --1430
NM_030571chr53512 319 253 31428 1252 200 1616 --
NM_030621chr1454267 3068 2620 2608 1339 33868 3216 2629 ----
NM_030623chr21184 11408 ----
NM_030625chr1042353 1781 553 304 12545 ----
NM_030627chr511065 11151 --1112
NM_030647chr736197 4660 2025 14949 11680 --
NM_030648chr474810 1906 1426 1167 963 491 280 11285 ----
NM_030650chr253046 1319 953 305 106 33357 2868 1597 22663 1546 24165 4031
NM_030651chr6--1690 --1679
NM_030660chr1431076 376 50 ------
NM_030661chr721416 618 1425 ----
NM_030664chr1032325 2126 1843 21916 384 ----
NM_030674chr1254882 3582 2032 1281 405 15723 ----
NM_030762chr1231644 505 379 ------
NM_030777chr2011516 32430 2393 2274 1905 --
NM_030784chr6136 ------
NM_030791chr1431467 661 549 --1412 --
NM_030806chr168673 8293 6910 5785 2642 2435 16091 --13555
NM_030809chr1262435 2091 927 777 511 323 12043 --1639
NM_030810chr631551 1517 1377 ------
NM_030816chr163499 3388 2896 2881 2451 568 13031 ----
NM_030820chr621032 285 1235 ----
NM_030884chr362272 2236 2194 2010 1425 719 ------
NM_030906chr11----1101 --
NM_030912chr103906 846 265 ------
NM_030915chr232278 2025 1915 12299 11721 11990
NM_030917chr41185 ------
NM_030918chr165303 4614 4027 3870 1291 1128 14119 1327 --
NM_030920chr11170 ------
NM_030922chr152753 156 ------
NM_030926chr21159 --191 --
NM_030938chr172369 100 11077 ----
NM_030949chr631543 1123 430 ------
NM_030963chr61243 149 ----
NM_030964chr543140 2787 2428 171 12363 22671 1209 --
NM_030978chr92348 168 ------
NM_031157chr121656 ------
NM_031216chr1842264 2084 1917 41 12091 --11848
NM_031268chr1655125 3711 1983 1564 593 25401 552 44983 4563 1840 1697 11751
NM_031271chr821703 1375 1464 ----
NM_031298chr17--1116 --1156
NM_031305chr421582 293 --11519 --
NM_031306chr11846 ----2348 222
NM_031314chr1432032 1942 55 31590 1484 224 ----
NM_031362chr211885 12790 1650 --
NM_031365chr212021 12926 1786 --
NM_031366chr212021 12926 1786 --
NM_031371chr151405 1132 1083 1045 359 --1282 --
NM_031371chr151405 1132 1083 1045 359 --1282 --
NM_031407chrX2479 193 ------
NM_031411chr582256 1996 1469 775 651 322 222 139 11562 ----
NM_031418chr1132688 2507 170 ------
NM_031419chr331572 1546 65 ------
NM_031422chr183398 82 27 ------
NM_031424chr201578 ------
NM_031431chr1321762 34 ----21249 381
NM_031435chr1233133 1269 337 --11066 --
NM_031442chrX33012 2804 932 11103 ----
NM_031445chr233010 2917 2147 12953 11040 21008 968
NM_031453chr1052536 1912 1826 237 48 12126 --1169
NM_031459chr151345 1295 528 504 115 ------
NM_031461chr82875 220 42282 2270 2047 1943 11835 --
NM_031476chr1672708 2523 2506 2464 1838 1809 1120 12812 22637 143 --
NM_031478chr162529 272 ------
NM_031483chr202474 65 2762 79 12334 --
NM_031844chr153487 3177 2993 493 463 1265 2878 836 13369
NM_031845chr253708 3592 3515 2980 2741 32266 1483 985 ----
NM_031847chr253708 3592 3515 2980 2741 32266 1483 985 ----
NM_031849chr582256 1996 1469 775 651 322 222 139 11562 ----
NM_031857chr582256 1996 1469 775 651 322 222 139 11562 ----
NM_031858chr1731567 1117 108 1449 ----
NM_031860chr582256 1996 1469 775 651 322 222 139 11562 ----
NM_031862chr1731567 1117 108 1449 ----
NM_031866chr102834 825 1680 ----
NM_031889chr441914 606 571 434 ------
NM_031904chr1182077 1577 1384 1358 819 783 683 201 ------
NM_031911chr422146 350 ----1544
NM_031942chr231025 862 105 31194 884 50 ----
NM_031953chr4134 ------
NM_031954chr1272720 2271 1171 595 578 503 70 22090 866 ----
NM_031966chr5298 62 ------
NM_031992chr741283 454 204 133 ------
NM_032013chr2051449 658 619 383 338 ------
NM_032021chr1131088 279 172 --1363 --
NM_032041chr862649 1892 885 202 115 37 21842 346 12315 12532
NM_032042chr532870 1784 65 ------
NM_032047chr352388 1857 1617 978 841 12135 ----
NM_032102chr1173059 2012 1937 1070 986 738 631 ----12039
NM_032117chr4135 ------
NM_032121chrX52504 2445 2400 413 87 22592 2362 11842 --
NM_032145chr611664 ----1728
NM_032153chr322233 335 12686 --12311
NM_032160chr1863392 3284 1423 1341 1271 726 32840 1545 331 ----
NM_032169chr31331 2758 700 ----
NM_032189chr1354981 4718 1831 1811 537 13699 24076 232 --
NM_032192chr172155 145 ------
NM_032195chr213495 489 469 ------
NM_032199chr1043584 3507 2918 559 33640 3076 2822 ----
NM_032208chr253629 3384 3368 2887 456 12644 ----
NM_032217chr411138 ------
NM_032221chr2042002 1729 1579 94 136 ----
NM_032229chr1331096 394 201 162 ----
NM_032231chr15--1343 --129
NM_032283chr14660 459 303 33 --2609 287 11854
NM_032288chr31204 12027 11746 --
NM_032293chr91102 1218 ----
NM_032300chr1221284 1109 2322 263 ----
NM_032307chr93846 808 58 11049 --2300 167
NM_032329chr2124214 3880 3506 2855 2758 1331 1316 1179 800 706 366 164 --1861 --
NM_032360chr1------129
NM_032373chr10105825 5703 5384 4305 3858 3781 3714 1207 1134 306 1575 15002 24048 3914
NM_032382chr163497 438 122 ------
NM_032408chr741159 1134 896 410 21252 445 ----
NM_032410chr821027 155 --1370 --
NM_032424chr112252 244 11480 ----
NM_032429chr103622 595 23 ------
NM_032436chr134962 828 688 210 1193 ----
NM_032438chr631184 557 475 ------
NM_032440chr1052719 2558 1946 1813 406 12083 1290 --
NM_032445chr1512608 --1516 --
NM_032446chr543583 2798 2378 1212 1930 ----
NM_032457chr453907 3358 3233 3081 2756 --13180 --
NM_032471chr6----11130 1273
NM_032491chr1241281 1112 251 224 11209 ----
NM_032499chr1521157 305 ------
NM_032505chr322718 1741 ----11733
NM_032509chr831757 1746 234 12384 ----
NM_032520chr16192 1173 ----
NM_032521chr2053244 2986 2691 251 48 --12078 --
NM_032523chr22536 466 ------
NM_032547chr42564 511 11110 ----
NM_032552chr931942 331 261 --11252 --
NM_032557chr43759 641 135 ------
NM_032558chr911307 1317 ----
NM_032582chr173298 114 54 11833 --1243
NM_032590chr122858 776 ------
NM_032626chr161288 ------
NM_032632chr1441988 1979 1714 734 ------
NM_032638chr321459 1259 ----21523 1290
NM_032646chr1731805 1332 693 ------
NM_032682chr373029 2955 2580 2457 2442 696 379 ------
NM_032711chr1743606 1247 1226 142 1939 13623 --
NM_032778chr31834 1470 ----
NM_032781chr112377 355 ----1623
NM_032782chr531012 973 192 ------
NM_032784chr61252 1775 --1789
NM_032793chr11347 ------
NM_032800chr172703 2590 2563 2195 1873 1842 240 22680 263 ----
NM_032801chr1122511 640 1341 11830 --
NM_032802chr151220 ------
NM_032808chr152906 677 21000 311 ----
NM_032810chr1031124 435 229 ------
NM_032818chr912486 11870 --22005 201
NM_032827chr221125 993 ------
NM_032837chr1762125 2035 820 656 538 106 ------
NM_032842chr731460 1148 362 ------
NM_032859chr1323974 2916 23193 412 185 --
NM_032860chr6--1172 ----
NM_032866chr1563028 2491 2297 2280 1045 1039 --1403 --
NM_032873chr1184422 4185 3256 3117 2891 1370 1301 858 12871 ----
NM_032898chr3------1383
NM_032906chr41641 ------
NM_032918chr1211063 ------
NM_032949chr131472 ----1371
NM_032961chr44999 532 477 254 --11030 --
NM_032968chrX84241 4215 3091 1413 1387 1372 561 236 --1831 --
NM_032969chrX84241 4215 3091 1413 1387 1372 561 236 --1831 --
NM_032973chrY74233 4207 3086 1413 1372 561 236 --1831 --
NM_032975chr1832827 2701 95 33229 2611 318 1660 --
NM_032978chr1821021 782 21146 444 --11118
NM_032979chr1821021 782 21146 444 --11118
NM_032980chr1832827 2701 95 33229 2611 318 1660 --
NM_032981chr1821021 782 21146 444 --11118
NM_032999chr7187 2850 401 ----
NM_033000chr7187 2850 401 ----
NM_033001chr7187 2850 401 ----
NM_033018chrX3233 187 167 ------
NM_033020chr194671 4417 3694 3547 3043 1027 957 837 208 11294 --14740
NM_033023chr721159 1052 ------
NM_033025chr191793 ------
NM_033027chr331161 1147 1083 153 11140 --
NM_033081chr2031393 1123 978 --1463 --
NM_033083chr342939 2320 643 227 11264 --12427
NM_033088chr12136 55 ----1636
NM_033118chr202860 245 1869 ----
NM_033121chr1211235 --11435 --
NM_033132chr1331553 584 245 ------
NM_033133chr1733404 3300 1084 31218 141 123 ----
NM_033138chr72275 216 ----11714
NM_033139chr72275 216 ----11714
NM_033140chr72275 216 ----11714
NM_033141chr1411430 ----22121 1984
NM_033157chr72275 216 ----11714
NM_033181chr633754 3587 213 43844 1222 1112 443 --13648
NM_033201chr1641032 473 240 168 --11019 --
NM_033211chr541785 1333 402 75 ------
NM_033222chr931222 579 341 --11029 --
NM_033224chr777480 6764 6568 5712 2544 2377 2126 27555 6403 27833 5231 37927 7573 5111
NM_033225chr853108 2696 1959 579 240 12754 13170 --
NM_033227chr52459 118 ------
NM_033228chr52499 158 ------
NM_033254chr3--3589 543 130 ----
NM_033255chr132508 340 ------
NM_033260chr61761 ------
NM_033272chr2------1151
NM_033274chr533377 889 616 12955 ----
NM_033278chr11126 ------
NM_033281chr53867 755 148 ------
NM_033285chr894271 3410 3134 1677 1565 1260 1072 956 443 1731 14006 1761
NM_033309chr1621092 102 ------
NM_033310chr11166 ------
NM_033331chr972976 2891 2737 1102 550 412 298 3928 463 319 11251 --
NM_033337chr31287 ------
NM_033360chr1244142 1131 1054 976 11817 --1348
NM_033389chr1794786 4395 4361 4191 3811 1689 1670 1322 698 23734 900 ----
NM_033425chr1162824 2495 2316 673 365 312 ----22684 1265
NM_033427chr73547 321 196 1649 ----
NM_033430chr424091 3590 --33752 91 80 --
NM_033437chr424091 3590 --33752 91 80 --
NM_033449chr531517 1372 630 ------
NM_033503chr1543075 3050 2950 246 12689 21236 844 --
NM_033505chr2126566 6219 5963 5804 4978 4764 4485 1940 1869 1846 1015 915 35726 2586 838 --55170 5124 5033 757 47
NM_033512chr863094 2510 2490 2031 658 564 --32893 816 558 --
NM_033540chr31128 149 1959 --
NM_033542chr205749 584 305 202 148 ------
NM_033546chr181164 ------
NM_033549chr52213 102 ------
NM_033551chr563127 2880 2736 2204 1151 956 --23354 1157 --
NM_033624chr1282112 2057 1544 1497 1481 349 260 254 1315 22048 247 --
NM_033631chr153849 3672 1552 552 380 ----22540 1449
NM_033632chr421086 369 ------
NM_033637chr1073106 3039 1667 1548 837 560 408 13668 23362 1226 11209
NM_033642chrX31191 911 196 129 ----
NM_033656chr2165929 5067 4708 1527 1417 959 26001 1358 ----
NM_044472chr12524 138 ------
NM_052820chr9------2488 397
NM_052832chr842795 2709 670 460 21847 404 ----
NM_052834chr1862550 2462 2434 2367 924 648 ------
NM_052840chr1531288 1274 1009 --11422 --
NM_052849chr152640 534 1727 ----
NM_052864chr432159 440 47 11405 --1151
NM_052869chr1731805 1332 693 ------
NM_052879chr1254061 2917 641 520 488 2819 414 ----
NM_052896chr152515 2480 1603 996 860 12071 1128 --
NM_052898chr811767 11314 ----
NM_052900chr811169 11510 ----
NM_052901chr941140 421 401 170 ------
NM_052906chr2285063 4983 4658 4232 4118 1385 1076 652 14882 43650 3637 1735 1090 --
NM_052925chr19----1162 --
NM_052927chr531592 654 26 --22131 846 --
NM_052936chrX2267 29 1700 ----
NM_052937chr832702 1914 791 ------
NM_052971chr51111 ------
NM_053016chr9138011 7990 7840 7561 6747 6212 5810 5153 2466 1122 960 635 514 47793 3008 2830 374 137 26605 3148
NM_053023chr1123142 758 1335 ----
NM_053044chr41228 1329 1918 --
NM_053056chr1173079 3030 2940 2902 2810 2547 557 13037 --22397 714
NM_053281chrX138 ------
NM_054016chr12227 123 1511 --21621 644
NM_054016chr12227 123 1511 --21621 644
NM_054016chr12227 123 1511 --21621 644
NM_054025chr1132192 2079 675 ------
NM_054027chr511396 22166 608 --12031
NM_054114chr6131 257 42 170 --
NM_057164chr22183 68 ------
NM_057165chr22183 68 ------
NM_057166chr22183 68 ------
NM_057167chr22183 68 ------
NM_057175chr442660 2514 654 611 ------
NM_057178chr173342 212 157 12097 1993 --
NM_057180chr122398 337 1164 ----
NM_058170chr11158 11085 ----
NM_058241chr252119 1812 1523 853 400 12314 --1539
NM_058241chr252119 1812 1523 853 400 12314 --1539
NM_058243chr193723 596 172 1584 ----
NM_078470chr1032351 1897 1782 12335 ----
NM_078474chr151111 --1514 --
NM_078483chr563946 3815 3406 3363 1573 232 --13989 13699
NM_078488chr61305 ------
NM_078629chrX1660 1627 ----
NM_078630chrX1660 1627 ----
NM_079421chr192493 477 ------
NM_080546chr9----1417 --
NM_080594chr162535 193 129 ----
NM_080599chr1031081 993 34 11184 ----
NM_080617chr2031091 183 140 ------
NM_080632chrX2813 557 ------
NM_080645chr61533 --21543 98 1407
NM_080654chr112121 37 --1163 --
NM_080669chr17104791 3901 3805 3785 3577 3501 1941 1562 1271 1117 24638 1535 14837 14423
NM_080676chr2033101 2897 2772 1254 11026 --
NM_080686chr6----136 --
NM_080717chr122625 384 ------
NM_080725chr2021356 657 12051 ----
NM_080738chr131354 712 159 ------
NM_080743chr642171 1988 1972 913 1952 ----
NM_080759chr1352530 467 389 363 187 ----12242
NM_080760chr1352530 467 389 363 187 ----12242
NM_080792chr201908 ----21939 791
NM_080832chrX21794 230 ----11176
NM_080867chr1454897 4717 4225 3231 879 14444 34973 4040 3198 11143
NM_080872chr843789 3356 2805 2537 43733 3659 3568 1201 ----
NM_080881chr52800 210 1780 ----
NM_080927chr33548 417 201 31352 570 352 ----
NM_100264chr103688 203 137 ------
NM_100486chr103688 203 137 ------
NM_130391chr943445 2714 2333 535 33435 3078 673 13554 --
NM_130392chr943445 2714 2333 535 33435 3078 673 13554 --
NM_130393chr943445 2714 2333 535 33435 3078 673 13554 --
NM_130435chr1042671 2144 2026 769 21031 490 12956 --
NM_130438chr2143099 2175 1268 565 12197 12742 --
NM_130440chr121582 1187 ------
NM_130797chr741775 1393 1230 552 21172 504 ----
NM_130799chr11126 --1146 --
NM_130800chr11126 --1146 --
NM_130801chr11126 --1146 --
NM_130802chr11126 --1146 --
NM_130803chr11126 --1146 --
NM_130804chr11126 --1146 --
NM_130838chr1551424 477 341 285 159 ------
NM_130839chr1551424 477 341 285 159 ------
NM_130846chr12----1280 --
NM_130847chr1175765 5731 5342 5280 1146 463 437 35362 5142 950 25689 312 --
NM_133170chr20117804 7438 7086 6660 6566 6052 2413 823 807 609 138 18039 27121 2843 15640
NM_133172chr53109 83 53 ------
NM_133173chr53109 83 53 ------
NM_133174chr53109 83 53 ------
NM_133264chr1723527 2887 --11097 --
NM_133334chr466227 6137 5853 4784 2502 2122 26385 5638 14977 15395
NM_133370chr462966 2503 1153 1142 927 47 11081 ----
NM_133372chr572912 2887 2630 2505 2131 2102 507 11162 --11131
NM_133433chr52621 308 ------
NM_133445chr943735 3308 2654 1067 ------
NM_133468chr722282 1585 51966 1884 1752 242 99 1382 --
NM_133473chr1911797 --21730 195 --
NM_133478chr242079 884 475 280 42550 1945 1733 593 --1750
NM_133496chr144490 3321 1028 710 44015 3814 1283 1017 ----
NM_133499chrX2826 820 --1892 --
NM_133633chr2231093 931 105 1792 ----
NM_133634chr2121328 601 11602 ----
NM_133638chr51156 ------
NM_133646chr285407 3587 2007 1787 1340 1030 959 551 --172 25113 3809
NM_133647chr1573849 3467 3144 3102 814 155 110 11381 23679 103 11516
NM_134265chr172242 126 ------
NM_134421chr23733 651 41 ------
NM_134442chr231575 689 638 21248 290 11340 21669 1534
NM_134447chr192465 194 ------
NM_138270chrX12436 12812 --12229
NM_138288chr1432206 1402 202 22007 525 ----
NM_138292chr1121087 705 1401 1933 1251
NM_138317chr141546 ------
NM_138318chr141546 ------
NM_138328chr1723367 2436 --1621 --
NM_138333chr942321 2026 883 504 ------
NM_138335chr42275 169 ------
NM_138348chr555948 5261 2652 2575 2479 12533 ----
NM_138360chr141302 ------
NM_138373chr1961740 537 515 495 445 217 ----11231
NM_138437chrX2315 77 ------
NM_138444chr1344916 4098 4055 1533 --33589 941 702 13059
NM_138457chr6103376 3210 3125 2905 2501 2081 1154 759 600 590 ------
NM_138459chr652618 2510 722 90 35 ------
NM_138462chr91150 ------
NM_138468chr235675 4995 4492 25007 4970 21514 777 53877 2343 2208 1743 1381
NM_138473chr1244772 1375 576 175 --15165 --
NM_138479chr142026 2010 1880 252 11535 12053 --
NM_138492chr51386 ----21398 1263
NM_138494chr712102 ----11833
NM_138555chr153552 199 91 ------
NM_138559chr251247 481 423 305 55 ------
NM_138576chr1484798 4718 4023 3613 3184 229 147 30 14435 ----
NM_138619chr1741497 1119 611 210 --1104 --
NM_138621chr263496 2852 2694 1279 624 45 22722 1505 23759 841 --
NM_138713chr1687442 6837 2881 2438 1615 1405 929 165 58266 7485 2754 2514 727 ----
NM_138714chr1687442 6837 2881 2438 1615 1405 929 165 58266 7485 2754 2514 727 ----
NM_138735chr231104 254 27 ------
NM_138771chr741447 1215 201 157 ------
NM_138782chr5187 ------
NM_138795chr13599 349 314 1996 ----
NM_138806chr32732 156 ------
NM_138927chr21198 1265 ----
NM_138931chr31974 ------
NM_138967chr1572512 2464 2210 1553 643 618 252 --1164 12064
NM_138970chr14------22151 404
NM_138971chr11103724 3678 3614 3480 3166 957 427 397 188 91 23808 3019 13822 --
NM_138971chr11103724 3678 3614 3480 3166 957 427 397 188 91 23808 3019 13822 --
NM_138972chr11103724 3678 3614 3480 3166 957 427 397 188 91 23808 3019 13822 --
NM_138972chr11103724 3678 3614 3480 3166 957 427 397 188 91 23808 3019 13822 --
NM_138973chr11103724 3678 3614 3480 3166 957 427 397 188 91 23808 3019 13822 --
NM_138973chr11103724 3678 3614 3480 3166 957 427 397 188 91 23808 3019 13822 --
NM_138980chr42744 180 1589 1460 --
NM_138981chr43875 311 34 1720 1591 --
NM_138982chr42744 180 1589 1460 --
NM_139014chr631832 783 250 1471 --1623
NM_139035chrX1600 ------
NM_139046chr10137 ------
NM_139070chr51456 ------
NM_139076chr411331 31502 1354 304 ----
NM_139136chr1211019 --2891 258 --
NM_139168chr51267 1473 ----
NM_139182chr42406 288 2378 213 ----
NM_139215chr171280 ------
NM_139244chr62641 318 ------
NM_139246chr922221 672 ------
NM_139266chr2164 --178 --
NM_139276chr1731683 573 397 21492 405 1746 1617
NM_139279chr263471 2823 2386 1004 246 122 43517 3504 3341 2680 1256 1758
NM_139280chr1741359 1313 1143 1128 --21191 175 --
NM_139283chr122674 130 ----11651
NM_139316chr72378 260 11049 ----
NM_139318chr14----1197 --
NM_139321chr2074207 4176 3911 3100 2921 1545 720 1872 13143 --
NM_139323chr2041829 1483 1448 40 --11834 --
NM_144568chr144673 565 501 475 ----1680
NM_144571chr4127016 6980 6965 6564 5554 5317 2518 1358 1158 765 725 47 25664 1803 15596 --
NM_144578chr1475215 4515 3406 1196 1160 918 151 ------
NM_144582chr252343 2261 981 910 325 ------
NM_144595chr132381 262 ------
NM_144599chr1555514 4186 3824 960 937 --24973 437 15000
NM_144609chr1741214 1184 1111 263 ------
NM_144632chr211739 11830 ----
NM_144633chr331027 233 210 ------
NM_144642chr331264 1133 973 11368 ----
NM_144643chr41103 1175 ----
NM_144664chr1132537 2363 2278 22324 1743 --12436
NM_144721chr41522 --12432 22683 1719
NM_144728chr11323 ------
NM_144729chr11323 ------
NM_144767chr1564413 4321 4160 3698 3449 1221 34674 4632 1501 24311 4293 --
NM_144775chr1774888 4319 3745 3348 1871 1799 1793 134 11507 1674
NM_144778chr1352544 2382 1825 973 907 22647 2154 11777 --
NM_144949chr222574 1680 11815 12277 --
NM_144963chr81766 ----1527
NM_144973chr1255130 4607 3307 1481 858 21338 292 11788 --
NM_144982chr12194 ------
NM_144992chr21531 --1134 --
NM_145000chr51573 ------
NM_145011chr1031894 738 157 1317 ----
NM_145013chr1162847 2595 1031 841 128 27 --11111 --
NM_145037chr311505 1256 --11566
NM_145049chr521010 190 ------
NM_145055chr1841385 932 370 356 22886 2647 13818 --
NM_145112chr1421219 36 ------
NM_145113chr1421491 308 ------
NM_145115chr742280 2159 2021 280 21846 726 ----
NM_145159chr144933 679 588 162 ------
NM_145173chr1962581 2448 1974 1806 967 311 --1226 --
NM_145174chr2221378 276 --11088 --
NM_145185chr1931460 782 723 ------
NM_145206chr1053278 2926 800 786 40 ----12099
NM_145245chr1911221 --1232 --
NM_145259chr276807 5681 5030 4956 2751 2242 1722 14737 --16072
NM_145268chr7------2934 325
NM_145276chr19------2972 329
NM_145284chrX21839 1775 ------
NM_145290chr4--1269 1295 --
NM_145296chr191634 1176 1785 --
NM_145307chr1074654 4349 3886 3743 3386 3291 1273 ------
NM_145313chr1021557 1498 ------
NM_145647chr8------1166
NM_145649chr662607 2587 1753 630 570 57 32159 1743 875 --12295
NM_145655chr662607 2587 1753 630 570 57 32159 1743 875 --12295
NM_145686chr243074 3048 2709 2582 170 --22453 2226
NM_145687chr243074 3048 2709 2582 170 --22453 2226
NM_145690chr821913 1709 ------
NM_145693chr232504 1777 1587 ------
NM_145698chr1032062 1844 1736 --21513 722 --
NM_145701chr142526 270 ------
NM_145716chr11510 --1571 --
NM_145725chr14163 ------
NM_145726chr14163 ------
NM_145733chr22--31201 320 299 ----
NM_145735chr1342336 602 411 33 12432 22020 774 --
NM_145739chr22536 466 ------
NM_145753chr331506 599 335 ------
NM_145756chr183511 444 140 1207 ----
NM_145793chr102621 72 ------
NM_145799chrX53122 2907 1978 464 56 ------
NM_145805chr151609 ------
NM_145808chr752766 2468 841 62 43 11069 --12132
NM_145810chr231025 862 105 31194 884 50 ----
NM_145861chr131354 712 159 ------
NM_145868chr102129 74 1638 3672 484 284 --
NM_145869chr102129 74 1638 3672 484 284 --
NM_147147chr643818 2955 1268 1032 12570 ----
NM_147150chr963897 3882 3415 3288 3253 865 ------
NM_147156chr1021312 943 ------
NM_147171chr71421 ------
NM_147175chrX31968 1630 1604 --11704 --
NM_147185chr71421 ------
NM_147189chr841471 925 137 108 ------
NM_147190chr122462 39 ------
NM_147223chr23964 713 682 --1612 11666
NM_147233chr24906 781 530 499 --1429 11483
NM_148170chr1175475 3876 1814 1802 1006 521 94 25599 800 ----
NM_148174chr841457 864 534 47 1372 11983 --
NM_148178chr9251 21 ------
NM_148179chr9251 21 ------
NM_148571chr1731679 1622 644 2832 122 11717 --
NM_148898chr72353 184 1895 ----
NM_148899chr72353 184 1895 ----
NM_148976chr11----1203 --
NM_152133chr6131 257 42 170 --
NM_152233chr1441263 1044 597 179 ------
NM_152240chr32897 39 --21158 796 11025
NM_152253chr2284141 4012 3780 3460 1609 1354 495 195 --2417 295 --
NM_152261chr1232489 1588 763 ------
NM_152263chr155244 4727 4165 1614 569 --44988 4227 1422 1413 34856 4032 1118
NM_152280chr132880 2805 2736 13499 13415 --
NM_152282chr331402 1015 76 1451 ----
NM_152284chr81894 2928 337 1292 --
NM_152287chr1622666 1847 11859 1938 32270 2139 307
NM_152300chr1761869 1794 745 320 198 97 ------
NM_152305chr331433 312 291 11766 11716 --
NM_152309chr1041843 474 419 58 ------
NM_152330chr1452471 1744 1729 770 477 ----1627
NM_152384chr221871 1828 22006 119 ----
NM_152388chr273749 3720 3651 2805 1577 744 622 1738 ----
NM_152409chr512231 12805 --21054 570
NM_152410chr61189 ------
NM_152424chrX74693 3771 3599 3312 1675 1551 924 21257 132 ----
NM_152441chr122258 105 ------
NM_152442chr1231374 968 145 ------
NM_152450chr152733 66 1519 ----
NM_152470chr1864155 3844 3660 3455 3082 1053 --13617 --
NM_152475chr1932407 2209 743 --12713 --
NM_152493chr121454 1148 11348 ----
NM_152519chr261863 1817 1654 1542 356 150 11621 11383 --
NM_152520chr211222 11206 --1415
NM_152529chr234212 902 165 22741 124 31372 1305 816 31215 507 370
NM_152536chr3--126 ----
NM_152538chr32675 313 1426 ----
NM_152556chr711763 ------
NM_152564chr831689 607 30 11615 ----
NM_152594chr1532226 1607 725 ----11670
NM_152605chr1921321 490 ------
NM_152616chr3--1152 ----
NM_152621chr41256 ------
NM_152624chr5117247 7130 7000 6199 5864 5660 5448 5438 5313 4506 830 37409 1635 699 21930 622 --
NM_152629chr983832 3519 3444 2969 2792 1083 836 677 ------
NM_152636chr1132092 2013 1218 12947 --22457 2331
NM_152641chr1221109 902 22653 616 ----
NM_152653chr32708 33 ----1655
NM_152660chr11880 1665 ----
NM_152666chr12624 32 ------
NM_152678chr3--12487 --2933 798
NM_152688chr62835 164 --149 --
NM_152716chr11123 1613 ----
NM_152721chr183557 53 38 ------
NM_152736chr61878 ------
NM_152739chr72757 397 --1290 --
NM_152744chr783556 3184 2517 2424 2411 835 684 645 11424 ----
NM_152745chr741119 977 960 839 --11124 --
NM_152754chr753802 2693 1545 1177 1141 ------
NM_152756chr553206 2857 1466 994 114 34189 1496 1484 --11280
NM_152758chr842928 2246 1864 1214 12982 ----
NM_152765chr842375 1578 739 26 1398 ----
NM_152772chr12--1293 ----
NM_152774chr722100 1818 ------
NM_152780chrX31280 1136 877 1394 ----
NM_152787chrX43593 3490 3426 2584 23819 2696 23414 687 --
NM_152793chr774672 3961 3286 1427 1356 822 653 25036 1156 24373 1735 --
NM_152829chr741215 1172 1142 948 ------
NM_152835chr142707 2611 2156 480 12080 ----
NM_152836chr831716 1666 1491 ------
NM_152837chr831716 1666 1491 ------
NM_152838chr2063453 3220 2682 1131 495 93 ------
NM_152857chr61347 ----1145
NM_152858chr61347 ----1145
NM_152878chr2221579 402 11243 11376 --
NM_152902chr141538 1454 182 113 ------
NM_152910chr131116 ------
NM_152924chr1544649 2317 1448 1367 25405 1215 25222 4317 25539 1742
NM_152989chr1241185 624 593 387 --11731 --
NM_152991chr113573 221 50 ------
NM_152995chr42284 114 ------
NM_152996chr131804 405 125 21484 1314 ----
NM_153000chr181406 1637 ----
NM_153026chr122481 433 ------
NM_153029chr16134111 3848 3405 2801 2563 1469 1292 1283 1140 1067 1052 246 64 11105 24102 2674 --
NM_153035chr162970 2302 778 680 462 50 --13106 13151
NM_153050chr2263794 3163 3085 1488 339 115 23581 3503 ----
NM_153051chr2263794 3163 3085 1488 339 115 23581 3503 ----
NM_153182chr31834 1470 ----
NM_153183chrX2217 193 1851 1245 --
NM_153184chr321311 486 ------
NM_153188chr545407 4847 3799 1187 31630 1299 668 12206 --
NM_153207chr1264070 3887 3873 3291 3018 2515 ----11089
NM_153215chr33866 273 267 1572 ----
NM_153235chr642337 1838 1819 61 --11706 --
NM_153240chr31177 11217 --2509 370
NM_153257chr192795 369 ----11181
NM_153260chr151397 21351 1075 --1942
NM_153261chr1631478 1015 199 11576 ----
NM_153262chr162681 2638 2416 789 781 198 22122 1140 ----
NM_153273chr372785 2759 2653 2408 1878 1754 1721 --12366 --
NM_153341chr1--140 ----
NM_153354chr53820 147 129 ------
NM_153365chr432689 2409 1055 --21084 1018 --
NM_153367chr1093957 3815 3809 3164 832 443 347 93 63 --12679 12949
NM_153371chr1321721 363 22422 1602 ----
NM_153377chr121349 ------
NM_153442chr1095912 5865 5349 4924 4743 4174 2275 1073 1026 11020 1136 --
NM_153456chr1376201 5844 5796 5551 4878 2207 1179 22407 293 15781 --
NM_153464chr19--1180 ----
NM_153499chr1253071 2741 2483 2014 1119 --22715 1084 --
NM_153500chr1253071 2741 2483 2014 1119 --22715 1084 --
NM_153607chr551985 786 607 568 446 --1474 --
NM_153616chr1552359 2136 853 612 464 12352 195 --
NM_153617chr1552359 2136 853 612 464 12352 195 --
NM_153618chr1552359 2136 853 612 464 12352 195 --
NM_153619chr1533597 3374 2435 13590 11333 12403
NM_153620chr721427 1126 ----11501
NM_153631chr721416 618 1425 ----
NM_153632chr721416 618 1425 ----
NM_153634chr1221097 371 174 ----
NM_153645chr2242538 1076 647 587 --23284 416 1580
NM_153686chr42578 560 31981 667 99 ----
NM_153687chr1211147 1665 21501 1141 --
NM_153689chr21171 ------
NM_153693chr124797 636 239 77 ------
NM_153705chr1132060 498 25 ------
NM_153748chr1211019 --2891 258 --
NM_153756chr12564 134 ------
NM_153810chr1085132 5078 3623 3481 1056 853 833 706 --24919 3546 --
NM_153812chr132055 1815 400 --21644 464 --
NM_170606chr741783 1722 1615 34 1639 11455 --
NM_170665chr12104285 3920 3784 3648 3613 3590 3520 2931 669 293 44117 3279 1452 1133 21470 660 13255
NM_170672chr2--11653 --21215 341
NM_170674chr1521391 279 ------
NM_170675chr1521067 281 ------
NM_170676chr1521067 281 ------
NM_170677chr1521391 279 ------
NM_170696chr1541628 1445 61 41 1193 ----
NM_170697chr1541628 1445 61 41 1193 ----
NM_170706chr174080 3675 1201 1065 839 576 515 ------
NM_170710chr422438 2201 42611 2013 1010 875 --12669
NM_170719chr1321168 476 --1348 --
NM_170721chr1761145 933 367 231 122 109 21316 1264 ----
NM_170731chr1142691 2645 1879 1152 11132 ----
NM_170732chr1142691 2645 1879 1152 11132 ----
NM_170733chr1142691 2645 1879 1152 11132 ----
NM_170734chr1142691 2645 1879 1152 11132 ----
NM_170735chr1142691 2645 1879 1152 11132 ----
NM_170750chrX3843 821 323 ------
NM_170768chr11124 11238 ----
NM_170780chr32732 156 ------
NM_171998chrX11809 22393 535 12537 --
NM_171999chr18--1144 1765 --
NM_172020chr732032 1803 276 --11488 --
NM_172037chr821355 249 11381 ----
NM_172070chr242141 1649 455 375 11564 ----
NM_172071chr186536 5689 5633 2475 1799 1345 1238 379 24672 4659 ----
NM_172103chr652455 2299 1851 861 710 12692 ----
NM_172105chr652455 2299 1851 861 710 12692 ----
NM_172159chr321664 695 --2923 48 --
NM_172160chr321664 695 --2923 48 --
NM_172169chr101185 ------
NM_172170chr101185 ------
NM_172171chr101185 ------
NM_172173chr101185 ------
NM_172226chr1253071 2741 2483 2014 1119 --22715 1084 --
NM_172236chr203836 558 168 ------
NM_172315chr1521391 279 ------
NM_172316chr1521391 279 ------
NM_172354chr131742 279 186 11508 ----
NM_173054chr72928 796 ------
NM_173082chr611551 21584 515 ----
NM_173084chr341981 511 292 39 12216 ----
NM_173156chr152198 1825 813 711 646 1568 11467 --
NM_173172chr221457 1082 1432 ----
NM_173198chr952977 2955 2032 460 121 ------
NM_173200chr952977 2955 2032 460 121 ------
NM_173201chr161104 ------
NM_173214chr1687442 6837 2881 2438 1615 1405 929 165 58266 7485 2754 2514 727 ----
NM_173216chr331883 1800 183 11814 22554 153 --
NM_173217chr331883 1800 183 11814 22554 153 --
NM_173353chr121598 1140 ----
NM_173468chr496004 5516 5467 4857 4849 2425 1186 296 121 15961 ----
NM_173470chrX32813 1938 1852 12737 12368 22864 717
NM_173473chr103684 334 138 21915 606 12299 22216 2078
NM_173475chr1621744 126 --1462 --
NM_173495chrX72497 2445 1971 1602 793 481 455 ------
NM_173500chr1541147 499 463 69 ------
NM_173505chr182776 124 21174 228 ----
NM_173508chr12802 88 31145 1039 953 ----
NM_173510chr2241925 861 495 47 31953 528 125 1766 --
NM_173511chr253984 3923 2961 2455 766 11147 ----
NM_173515chr63824 237 204 ------
NM_173533chr11292 ------
NM_173552chr362460 2023 1657 656 413 319 ------
NM_173557chr181735 1638 ----
NM_173570chr352111 1821 1693 1506 225 12205 1177 --
NM_173582chr1185204 4451 1392 1158 808 584 542 336 11611 --46248 5252 5118 1260
NM_173602chr1263207 3188 2891 2640 837 131 --1608 --
NM_173631chr1911341 21288 1257 ----
NM_173642chr197885 7375 7281 6317 5848 3160 2289 1973 954 17662 39133 3209 2841 28705 2729
NM_173644chr2021814 277 ------
NM_173681chr711547 ------
NM_173698chrX41944 1828 153 44 11378 ----
NM_173797chr51420 11292 --11135
NM_173808chr133808 1119 132 2596 558 --14100
NM_173822chr231975 1832 507 1211 --11852
NM_173851chr853952 3718 2565 1369 457 13376 ----
NM_174916chr1532378 2157 958 1814 ----
NM_174934chr1163142 3001 2973 2682 2276 218 ------
NM_175056chr352015 1705 1618 520 136 ------
NM_175061chr712043 1137 ----
NM_175610chr1521066 343 --1948 --
NM_175634chr821246 1219 21132 1105 ----
NM_175635chr821246 1219 21132 1105 ----
NM_175636chr821246 1219 21132 1105 ----
NM_175736chr12117818 6263 5621 5472 5293 2821 2353 1991 1936 1862 1715 37753 6985 1960 1172 11322
NM_175748chr1441998 1890 614 553 22154 832 ----
NM_175767chr521508 326 2278 209 --1186
NM_175852chr173083 2690 1944 1210 1029 304 265 32944 2710 207 12113 --
NM_175854chr1352128 2106 1906 539 283 1514 ----
NM_175858chr212343 77 ------
NM_175859chrX21396 240 ----139
NM_175863chr621020 195 ------
NM_175884chr71405 1991 ----
NM_175895chr1231075 745 94 ------
NM_175920chr51803 ----2586 47
NM_176081chr1085923 4727 4366 4153 2315 1469 1112 707 1452 24685 2009 --
NM_176083chr1085923 4727 4366 4153 2315 1469 1112 707 1452 24685 2009 --
NM_176814chr721203 566 ------
NM_176822chr111161 1152 ----
NM_176871chr852554 2408 2301 589 275 ----13172
NM_177414chr151750 1730 1514 457 265 ----1342
NM_177422chr13539 458 271 1447 ----
NM_177424chr141992 416 243 50 31976 1632 110 ----
NM_177438chr1454267 3068 2620 2608 1339 33868 3216 2629 ----
NM_177452chr1432382 1921 473 12509 ----
NM_177553chr112895 172 --142 --
NM_177559chr201124 21126 1062 1928 --
NM_177560chr201124 21126 1062 1928 --
NM_177925chr1223133 2607 ------
NM_177937chr92621 439 ------
NM_177952chr141299 ------
NM_177968chr251852 1623 542 243 186 21921 1490 1198 12054
NM_177969chr23655 586 528 ----1466
NM_177972chr1153606 2830 2822 2806 86 --43748 2945 1457 61 --
NM_177985chr242188 1837 655 617 ------
NM_177990chr2021317 455 11941 192 --
NM_177996chr2053416 2869 2690 2250 1309 --1909 --
NM_178009chr13179 ------
NM_178010chr1241185 624 593 387 --11731 --
NM_178011chr10--33230 628 286 ----
NM_178120chr21405 11156 ----
NM_178126chr1752289 2207 1867 1837 1722 ------
NM_178140chr531755 240 128 12744 22696 508 --
NM_178151chrX77632 6826 6726 6630 5611 2753 347 56590 5413 1746 1436 168 21852 971 37639 5702 2562
NM_178152chrX77632 6826 6726 6630 5611 2753 347 56590 5413 1746 1436 168 21852 971 37639 5702 2562
NM_178153chrX77632 6826 6726 6630 5611 2753 347 56590 5413 1746 1436 168 21852 971 37639 5702 2562
NM_178154chr141546 ------
NM_178155chr141546 ------
NM_178156chr141546 ------
NM_178157chr141546 ------
NM_178169chr122198 124 ------
NM_178190chr12265 38 ------
NM_178191chr141606 1379 1044 593 ------
NM_178270chrX2267 29 1700 ----
NM_178313chr222174 1831 1452 11863 --
NM_178426chr141938 914 680 462 1174 --1590
NM_178427chr141838 814 580 362 174 --1490
NM_178441chr1421144 500 ------
NM_178454chr11720 2516 24 ----
NM_178505chr1012498 32471 1396 877 ----
NM_178539chr1212000 21333 233 ----
NM_178548chr11608 ------
NM_178554chr323038 1113 ------
NM_178558chr71418 --196 --
NM_178566chr921561 1223 ------
NM_178585chr433180 828 768 13016 2620 35 1473
NM_178586chr1462293 2190 2143 651 74 54 --1682 --
NM_178812chr831325 991 405 ------
NM_178815chr1051999 1964 1933 1716 992 1277 ----
NM_178826chr121296 1652 1729 --
NM_178839chr2192 ------
NM_181050chr164620 598 452 127 ------
NM_181077chr1522121 1663 11887 11422 --
NM_181093chr11138 ------
NM_181265chr422438 2201 42611 2013 1010 875 --12669
NM_181332chrX82366 2285 2059 1082 1015 930 745 558 1223 --12291
NM_181351chr1132884 2833 2412 32202 495 235 ----
NM_181354chr82422 334 21688 1270 1120 --
NM_181358chr123152 676 12899 24212 3041 --
NM_181361chr34499 339 234 95 ------
NM_181442chr203852 698 645 ------
NM_181457chr21208 ------
NM_181458chr21341 ------
NM_181481chr18117040 6624 5606 4960 2117 1962 1938 1843 656 637 500 12765 --16967
NM_181482chr18117040 6624 5606 4960 2117 1962 1938 1843 656 637 500 12765 --16967
NM_181483chr18117040 6624 5606 4960 2117 1962 1938 1843 656 637 500 12765 --16967
NM_181486chr122625 384 ------
NM_181504chr533951 1028 340 ------
NM_181505chr172155 145 ------
NM_181521chr16107206 6321 5539 2296 2007 1787 1778 1706 1486 41 25561 2236 17049 --
NM_181523chr533951 1028 340 ------
NM_181524chr533951 1028 340 ------
NM_181552chr71891 ------
NM_181571chr103905 732 240 ------
NM_181672chrX11479 1704 191 --
NM_181673chrX11479 1704 191 --
NM_181674chr5----1345 --
NM_181675chr5----1345 --
NM_181676chr5----1345 --
NM_181677chr5----1345 --
NM_181678chr5----1345 --
NM_181702chr82870 776 ------
NM_181706chr11--22173 1759 --1568
NM_181714chr61408 ------
NM_181723chr82673 622 1876 ----
NM_181746chr12627 140 ------
NM_181762chrX------11035
NM_181777chrX------11035
NM_181782chr631951 1720 699 11466 ----
NM_181784chr252466 933 569 451 270 1287 ----
NM_181787chr823868 3101 12692 12825 --
NM_181794chr6----11130 1273
NM_181795chr6----11130 1273
NM_181802chr202154 58 ------
NM_181809chr163682 3371 1386 1374 1303 715 --1244 11553
NM_181836chr542681 2508 1015 871 ------
NM_181838chr52193 116 11439 1452 --
NM_181839chr82316 221 ------
NM_181844chr1741533 1361 566 306 2615 334 ----
NM_181861chr1242762 2744 1051 500 22211 1909 1354 12427
NM_181868chr1242762 2744 1051 500 22211 1909 1354 12427
NM_181869chr1242847 2829 1136 585 22296 1994 1439 12512
NM_181871chr12222 37 --1595 --
NM_181886chr421202 991 ------
NM_181887chr421202 991 ------
NM_181888chr421202 991 ------
NM_181889chr421202 991 ------
NM_181890chr421202 991 ------
NM_181891chr421202 991 ------
NM_181892chr421249 1038 ------
NM_181893chr421202 991 ------
NM_182485chr453652 3398 2471 1030 753 13680 ----
NM_182487chr944179 3376 3142 3101 24224 1594 33023 1678 1535 --
NM_182493chr1653982 3895 3666 2017 640 53459 3353 2051 681 204 --11273
NM_182515chr1966204 6000 4157 2490 1388 1163 16655 --24702 950
NM_182543chr10149 ------
NM_182546chr7------166
NM_182551chr273410 3187 3092 3055 2542 1017 610 13568 ----
NM_182557chr1152199 1919 1390 905 125 --12224 --
NM_182641chr1741977 1901 513 494 ------
NM_182643chr862416 2362 1843 1706 688 347 --1183 --
NM_182646chr453652 3398 2471 1030 753 13680 ----
NM_182663chr132286 1601 530 11496 ----
NM_182664chr132416 1731 660 11626 ----
NM_182665chr132286 1601 530 11496 ----
NM_182666chr32572 35 ------
NM_182685chr12718 697 ------
NM_182691chr72955 464 1492 ----
NM_182692chr72955 464 1492 ----
NM_182700chr721389 65 ------
NM_182718chr103905 732 240 ------
NM_182719chr103905 732 240 ------
NM_182724chr103905 732 240 ------
NM_182725chr103905 732 240 ------
NM_182757chr653374 3010 679 394 187 21202 971 13323 --
NM_182758chr1573821 3743 3186 2893 2869 768 620 ----13749
NM_182763chr132274 2036 411 ----1665
NM_182765chr1022324 1461 1782 22280 1869 --
NM_182769chr103905 732 240 ------
NM_182770chr103905 732 240 ------
NM_182771chr103905 732 240 ------
NM_182772chr103905 732 240 ------
NM_182789chr511047 ----1952
NM_182796chr51805 1738 ----
NM_182797chr2011170 31731 1698 568 --11382
NM_182830chr1431756 1737 392 11429 ----
NM_182850chr103905 732 240 ------
NM_182898chr764877 4413 4113 2101 1532 281 15211 15433 --
NM_182899chr764877 4413 4113 2101 1532 281 15211 15433 --
NM_182907chr671984 858 721 500 269 249 218 22043 437 276 62 --
NM_182917chr31371 --1108 1422
NM_182918chr2121287 438 1245 ----
NM_182920chr32120 113 1367 ----
NM_182931chr7--137 189 --
NM_182948chr162979 2786 2263 1952 796 201 13022 1707 12582
NM_182970chr2052798 1560 1366 766 575 13301 13546 14002
NM_182972chr172145 2134 2032 1939 1001 882 408 ------
NM_182977chr52886 95 ------
NM_182978chr182772 107 ------
NM_18300