TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-5096
miRNA Sequence: GUUUCACCAUGUUGGUCAGGC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000217chr1274816 4715 4409 3868 3861 3750 174 21800 1356 11212 24217 560
NM_000719chr1296637 6286 5590 4783 4648 4554 4512 4086 1963 25540 4497 36202 5434 2306 14125
NM_001003652chr1898683 8136 6866 6691 6424 6068 1805 1411 149 36962 6505 6453 28235 7799 --
NM_001004419chr1283151 3028 2915 2866 1723 983 941 683 53844 1526 1365 1341 1125 24004 1849 13433
NM_001007094chr1064062 3457 3391 1060 506 221 44041 741 490 206 34249 289 39 --
NM_001008726chr1431556 1173 649 31634 1360 541 --21256 138
NM_001011666chr755792 4004 2141 1781 903 15362 14899 24218 1191
NM_001013659chr1985351 4823 4789 4171 2181 1834 1683 962 34849 4023 881 24338 3624 --
NM_001013746chr732059 1747 564 72191 1677 887 481 401 233 64 --2869 132
NM_001014797chr10157671 7115 6983 6716 6194 6015 5464 5184 2732 1348 1129 1041 957 903 652 27338 3258 17360 1224
NM_001018067chr195088 4296 3543 1963 1392 1068 972 838 510 13601 35073 888 791 --
NM_001018068chr195088 4296 3543 1963 1392 1068 972 838 510 13601 35073 888 791 --
NM_001018069chr195088 4296 3543 1963 1392 1068 972 838 510 13601 35073 888 791 --
NM_001025077chr1076973 6461 6352 5992 4819 2723 2340 87352 5811 4680 4583 2496 2434 1607 747 --12776
NM_001025580chrX43227 1714 967 896 34263 3651 1326 23989 129 1624
NM_001039199chr2084928 4826 4778 4704 3732 1672 614 447 31829 1725 396 34320 3566 1359 25001 1998
NM_001039840chrX55905 5774 4898 2114 1508 15429 14035 35188 4519 4157
NM_001040284chr1665510 5481 5094 4969 1839 1027 24819 4578 45548 5043 4980 1520 15439
NM_001167chrX96611 6279 5955 4740 4487 4242 2552 1690 1025 26686 428 --24831 457
NM_001918chr1108700 8622 7527 7376 3617 2060 1834 1583 1391 507 28227 3344 47604 2459 1716 397 --
NM_002270chr564430 3789 1556 949 670 323 65227 4424 4030 1702 1172 270 --1233
NM_002481chr155709 2099 1209 1098 416 11199 46128 5799 2148 106 27602 5241
NM_002886chr354442 4016 1591 1551 361 33901 844 760 --2387 213
NM_003099chr15106146 5901 4956 4545 4145 3975 2306 891 883 259 16401 21439 242 --
NM_003108chr2116930 6141 4461 2837 2484 1780 1662 533 227 215 133 26242 987 22705 2216 --
NM_003421chr1064062 3457 3391 1060 506 221 44041 741 490 206 34249 289 39 --
NM_004171chr11139182 8516 8445 8432 8400 8106 7750 7283 6218 5933 3210 2300 1330 58280 7478 3268 2642 671 18726 11576
NM_004857chr1461927 1340 846 689 465 456 33446 1354 1078 1736 --
NM_004863chr1485250 5202 4228 1953 1741 867 284 105 23826 1398 24000 1617 23643 797
NM_004904chr755792 4004 2141 1781 903 15362 14899 24218 1191
NM_004985chr1274469 3448 3096 1486 1474 326 162 21306 230 21760 1492 --
NM_005197chr1485437 5257 4415 4164 1961 1936 660 473 44155 3763 1018 922 13864 15661
NM_005901chr1898683 8136 6866 6691 6424 6068 1805 1411 149 36962 6505 6453 28235 7799 --
NM_005955chr185419 5296 4508 4132 3810 1752 583 39 45494 5333 3706 3363 1539 --
NM_006544chr1465562 5199 5158 4948 776 122 35643 4150 1163 24715 405 15237
NM_012164chr997502 7188 5912 5613 5167 2697 1968 1947 1504 36266 5034 1588 --11836
NM_012464chr432387 484 477 32724 2539 1000 22355 230 --
NM_013255chr7117053 5910 3385 3205 2512 2230 1943 1636 1223 1186 216 17616 ----
NM_013269chr1293078 2955 2842 2793 1786 1650 910 868 610 53771 1453 1292 1268 1052 23931 1776 13360
NM_013372chr1543158 2711 673 666 32677 654 594 --1957
NM_013411chr162146 1950 718 121 107 98 11837 22170 193 1317
NM_014333chr114884 707 603 121 32551 1807 660 --22122 112
NM_014832chr133386 364 143 11481 --2489 481
NM_015313chr1153177 1765 1203 530 417 11210 34774 4272 1224 --
NM_015365chrX43227 1714 967 896 34263 3651 1326 23989 129 1624
NM_015640chr195088 4296 3543 1963 1392 1068 972 838 510 13601 35073 888 791 --
NM_015852chr722931 2547 142759 1235 1154 1070 902 818 734 566 482 398 323 314 230 62 --11382
NM_015879chr1858470 7924 7382 5702 754 18518 --26481 5277
NM_016133chr241312 1048 398 53 11459 --21516 590
NM_016220chr732059 1747 564 72191 1677 887 481 401 233 64 --2869 132
NM_016929chr663859 3704 3634 3592 3298 1543 ----31475 1314 921
NM_017563chr376172 6024 4739 4319 2290 1710 123 76133 6054 5362 4918 4428 1172 409 36336 5795 631 --
NM_018361chr883818 3214 2913 2575 2540 1214 1000 469 13100 --13249
NM_018440chr877124 6694 6192 6095 6026 2971 62 37452 6661 5380 25901 626 18033
NM_018566chr154197 3928 1474 462 355 35168 4770 1460 11619 24485 4371
NM_020466chr684015 3292 1593 1583 1577 878 566 352 14336 23377 399 1663
NM_020673chr2065916 5854 2523 2196 1426 790 1797 36807 4834 3044 26982 1436
NM_020766chrX23840 479 43323 375 268 47 13291 24297 2803
NM_020802chr1152817 2076 940 182 146 63289 2721 2674 2110 1086 72 22362 545 --
NM_021045chr1052535 2304 1777 307 29 1359 --22227 199
NM_021116chr7158324 8032 7672 7128 6648 6293 6154 5504 3204 3092 2520 2230 1791 203 124 48806 8307 6919 1253 47766 7188 6340 2754 13395
NM_021629chr394308 3405 3393 3244 1983 1045 961 247 165 24188 71 23289 1817 199
NM_022459chr1355436 5237 3846 1037 151 45785 5311 3929 1342 15802 1443
NM_023016chr242863 1886 1013 76 22904 453 --32130 2082 1777
NM_024345chr935881 1597 661 44601 4173 3760 1376 31642 953 644 11939
NM_024639chr631794 770 304 1464 --42400 790 685 517
NM_024761chr994350 3928 3514 1391 799 437 225 119 70 24193 955 13561 13999
NM_030621chr14104042 4001 3180 3090 2642 1635 1186 674 608 100 13844 ----
NM_030647chr745659 2335 2322 445 25598 1924 13880 45609 4472 3957 2457
NM_031427chr1435724 4998 1364 14446 24234 1625 25342 543
NM_032012chr975269 4691 3477 3256 1697 1475 703 34891 3646 790 25144 1689 --
NM_032105chr155842 2232 1342 1231 549 11332 46261 5932 2281 239 27735 5374
NM_032373chr1075630 5096 4102 3946 3611 2011 1868 34661 2247 519 13992 24412 1710
NM_032859chr1363692 3318 3080 1099 629 585 2872 329 12740 12577
NM_033285chr863928 3710 1781 1760 1652 733 53074 1022 935 626 76 --12861
NM_033360chr1274590 3569 3217 1607 1595 447 283 21427 351 11613 --
NM_033656chr2145152 1192 978 858 --35296 1445 55 13910
NM_080666chr1431556 1173 649 31634 1360 541 --21256 138
NM_133334chr4106025 5964 5816 5497 5433 4673 2047 1965 1761 458 26365 375 --32182 1881 1442
NM_144775chr1764390 4189 1864 777 747 327 34964 4576 4168 11579 3557 445 234
NM_145259chr287111 6738 4671 2226 2199 1507 534 515 26812 6536 24777 1617 16746
NM_148955chr15106146 5901 4956 4545 4145 3975 2306 891 883 259 16401 21439 242 --
NM_152263chr166032 4888 2322 1574 1014 921 14508 25276 1061 24934 3877
NM_152470chr1853978 3388 839 761 478 24174 130 43264 2847 867 609 23556 643
NM_152624chr596804 6407 5589 5524 4717 2845 2106 701 545 21785 819 15153 16622
NM_152826chr15106146 5901 4956 4545 4145 3975 2306 891 883 259 16401 21439 242 --
NM_153188chr564430 3789 1556 949 670 323 65227 4424 4030 1702 1172 270 --1233
NM_153607chr553137 2775 1989 300 149 ----33044 2353 2141
NM_172071chr176993 6864 6656 6457 5883 2642 1897 16910 --27135 6933
NM_175624chr1286684 6676 6409 5498 5453 1998 1601 477 12799 13007 22701 1567
NM_175625chr1286684 6676 6409 5498 5453 1998 1601 477 12799 13007 22701 1567
NM_175736chr12107509 6928 6512 5164 2913 2808 1767 1566 1230 1215 15692 17005 17381
NM_177438chr14104042 4001 3180 3090 2642 1635 1186 674 608 100 13844 ----
NM_177538chr2197814 7294 7238 6903 6565 3181 3164 3002 2957 2912 2509 2253 1782 1557 1257 847 711 574 438 --46612 1950 1604 894 --
NM_182493chr1664506 4256 2153 1327 1217 221 44669 4601 3695 60 154 14247
NM_182515chr1966687 4497 4223 2276 1660 850 31103 261 180 56512 6285 4647 4100 895 2494 344
NM_182898chr755792 4004 2141 1781 903 15362 14899 24218 1191
NM_182899chr755792 4004 2141 1781 903 15362 14899 24218 1191
NM_198900chr12107509 6928 6512 5164 2913 2808 1767 1566 1230 1215 15692 17005 17381
NM_207406chr475705 5017 2522 2492 1148 376 276 35876 5864 4693 --1266
NM_213606chr1062534 2263 1983 1872 1827 495 1473 11005 1466