TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-512-3p
miRNA Sequence: AAGUGCUGUCAUAGCUGAGGUC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000037chr842112 1755 1593 970 11008 ----
NM_000044chrX------1340
NM_000052chrX23160 464 --152 --
NM_000081chr121766 32 ----11291
NM_000084chrX86970 6076 5887 5311 2663 2020 1755 1514 1556 --11066
NM_000089chr72603 164 --1674 --
NM_000111chr71257 ------
NM_000115chr1351085 678 250 230 109 --1640 --
NM_000125chr673759 3326 1579 1303 884 482 384 --11029 --
NM_000138chr1522253 821 2391 131 ----
NM_000188chr10--1474 137 --
NM_000189chr222312 562 --2583 399 --
NM_000217chr1274974 4699 4172 1872 1251 1037 448 --12091 11114
NM_000227chr182343 44 ------
NM_000237chr851643 1636 1351 455 221 1176 ----
NM_000248chr353074 3001 2126 800 503 ------
NM_000259chr15114724 4644 4364 4049 3983 2447 2337 1192 625 333 102 1678 21076 314 --
NM_000275chr15----1416 --
NM_000276chrX31977 759 733 1375 ----
NM_000329chr13832 731 149 1581 ----
NM_000332chr6127165 6777 5466 5107 2449 2329 2130 1389 1178 1120 1004 298 36756 5035 1373 15550 --
NM_000333chr331093 1022 193 --170 --
NM_000345chr4----1170 --
NM_000346chr1721768 796 ------
NM_000362chr2253528 3411 1204 631 116 ------
NM_000393chr2----1123 --
NM_000401chr11----21130 68 --
NM_000408chr243250 3004 695 460 --22253 825 --
NM_000428chr1422069 826 22200 1846 ----
NM_000430chr1713235 32940 1452 295 ----
NM_000461chr31272 --23522 510 137
NM_000486chr1253249 2986 2217 1083 107 --1708 --
NM_000489chrX42536 2454 903 645 ----11032
NM_000503chr86648 322 242 202 79 24 1584 1634 --
NM_000516chr20------1326
NM_000523chr2----1392 --
NM_000530chr13867 840 454 ------
NM_000533chrX3743 660 603 ------
NM_000555chrX85907 5588 2676 2619 1901 1772 1263 544 --57771 7158 1570 372 243 --
NM_000610chr1113021 --3868 733 190 --
NM_000615chr1142700 2445 850 63 22981 429 12879 --
NM_000618chr1232629 1726 1586 1832 12199 --
NM_000621chr1311208 --1201 --
NM_000684chr1011225 1392 ----
NM_000686chrX41414 1078 463 430 ----11214
NM_000726chr231284 237 90 ------
NM_000793chr1453819 3595 3307 1256 270 --14706 --
NM_000794chr51658 ----1979
NM_000807chr42576 191 ------
NM_000810chr151531 196 ----
NM_000813chr575579 5530 3669 3601 1590 905 824 34529 4157 1890 35221 4856 330 --
NM_000826chr431754 1665 60 1395 12209 --
NM_000829chr1152305 2298 2000 1990 1486 --12188 --
NM_000844chr32989 766 --1213 --
NM_000856chr42277 71 --1251 --
NM_000866chr3----21706 709 --
NM_000875chr1596199 6137 2683 2239 2215 2082 2040 1106 279 17053 24937 1602 --
NM_000880chr81719 ----1882
NM_000891chr1743279 3184 2675 1160 23030 181 11378 --
NM_000899chr1253906 3196 2819 1132 198 --24010 690 --
NM_000901chr422138 1679 21644 862 1228 --
NM_000919chr5166 --1402 --
NM_000944chr421808 1502 11897 --1430
NM_000945chr22563 196 ------
NM_000950chrX53419 3333 3071 2586 62 1373 ----
NM_000965chr3135 11153 ----
NM_001001132chr2121205 117 ------
NM_001001323chr12--12693 12170 --
NM_001001330chr101943 ------
NM_001001331chr352626 2186 1740 1667 493 ------
NM_001001395chr1232490 691 563 22508 37 ----
NM_001001396chr144118 4064 3785 1678 ------
NM_001001433chr2043114 2508 2379 316 ------
NM_001001481chr841337 910 548 55 12639 ----
NM_001001664chr21441 --13615 --
NM_001001890chr2164183 4122 4107 2908 2891 275 21611 851 ----
NM_001001924chr851284 538 263 98 36 ------
NM_001001928chr2268025 7058 6726 2724 1050 76 --55871 1973 624 420 175 21815 53
NM_001001933chr11111 ------
NM_001001971chr102537 105 ------
NM_001002009chr71568 ------
NM_001002033chr172246 111 ------
NM_001002233chr822041 1717 --32135 1609 821 --
NM_001002265chr10----1581 --
NM_001002296chr841134 340 261 187 ------
NM_001002762chr1061829 1090 780 651 385 368 --22461 2050 --
NM_001002860chr1474577 3143 1674 1646 1603 501 260 --24472 858 --
NM_001002909chr1751970 1394 621 438 403 --11931 --
NM_001003652chr1887737 7461 6254 6089 2025 775 431 60 18700 26789 117 12269
NM_001003674chr1877068 4534 4469 4427 1717 1647 1367 25764 403 36730 4518 867 --
NM_001003712chr1263890 3166 2662 861 748 521 13830 ----
NM_001003805chr14----158 --
NM_001004304chr1232728 2716 2210 --1221 --
NM_001004317chr654418 4008 3102 2881 643 21539 401 11170 13074
NM_001004419chr1214510 127 32810 927 532 --
NM_001005158chr3----1435 --
NM_001005386chr232408 1956 332 1929 1665 --
NM_001005404chr1743579 3396 3207 1560 ------
NM_001005463chr1052509 2118 777 34 27 --11981 --
NM_001005473chr575775 5694 4815 4199 2101 1868 1747 --14214 16103
NM_001005753chr242192 902 356 261 1703 ----
NM_001005781chr21465 ------
NM_001005845chr831897 1289 252 11542 ----
NM_001006600chr5----11715 11860
NM_001006665chr13670 598 52 ------
NM_001006681chrX------1128
NM_001007097chr923856 234 --43195 1746 1394 505 --
NM_001007102chr61663 --130 --
NM_001007226chr1731278 576 82 ----1155
NM_001007237chr142218 804 635 79 ------
NM_001007246chr2121818 64 ------
NM_001007257chr131354 1097 242 171 11421 --
NM_001007553chr11416 ------
NM_001007559chr182654 478 --160 --
NM_001007565chr31111 ----165
NM_001008222chrX1250 --31190 1094 521 --
NM_001008239chr1853096 1495 886 600 422 --11162 --
NM_001008392chr322852 1204 --13080 13494
NM_001008407chr74702 352 104 27 --21210 649 --
NM_001008491chr241844 361 183 127 12074 ----
NM_001008541chr1012205 1686 21705 888 --
NM_001008660chr1111262 ------
NM_001008738chr542137 2065 246 141 ------
NM_001009554chr4104276 4147 3702 3655 3358 1806 1480 1322 747 576 13305 13957 --
NM_001009569chr1031184 563 92 ------
NM_001009909chr1143131 1451 1413 313 13729 1374 --
NM_001009993chr293209 3007 2924 1793 1720 1691 1331 575 157 --14355 --
NM_001010934chr71376 --1732 --
NM_001010935chr1--1380 175 --
NM_001010942chr122969 517 --169 --
NM_001010984chr142236 1727 1699 972 --1484 --
NM_001011513chr443393 3020 2988 2921 13699 21172 558 13747
NM_001011538chr41720 1421 2864 795 --
NM_001011546chr20--1565 1334 --
NM_001011666chr7126602 6321 6224 5576 5229 4934 4863 2598 1412 1279 1251 689 --16412 --
NM_001011708chr232490 995 482 --1381 --
NM_001012393chr1194754 4220 4045 3442 1929 1778 1649 1621 1295 --14546 --
NM_001012398chr16----2420 226 1332
NM_001012426chr643318 2406 1065 343 ------
NM_001012761chr51269 ------
NM_001013640chr191923 ------
NM_001013699chr12----1175 --
NM_001013746chr711653 ------
NM_001014286chr13145 ------
NM_001015508chr8----190 --
NM_001015877chrX122907 2745 2541 2003 1233 1225 860 650 582 504 416 332 --12217 --
NM_001017395chr322351 773 --23647 1376 --
NM_001017396chr25784 578 484 413 146 21845 424 --1355
NM_001017424chr141779 1349 708 78 --1173 --
NM_001017440chr725696 2311 --47097 5604 709 671 --
NM_001017926chr821543 259 ------
NM_001017977chr1122 ------
NM_001018009chr321051 1019 ------
NM_001018025chrX2329 220 ------
NM_001018056chr91390 ------
NM_001018067chr124205 3907 --1634 11142
NM_001024218chr142583 73 --2750 589 --
NM_001024226chr111159 ------
NM_001024463chr15166 --1118 --
NM_001024668chr122945 144 --168 --
NM_001024847chr362428 2192 642 606 222 181 ----1467
NM_001024948chr152272 1208 788 567 180 --13051 --
NM_001025068chr32718 709 --11482 --
NM_001025077chr1097434 7014 6888 6322 5101 2344 855 528 420 15012 ----
NM_001025079chr383522 2607 1241 1224 849 811 770 371 13624 ----
NM_001025105chr521136 606 11216 2166 49 --
NM_001025108chr231577 742 439 --2125 93 --
NM_001025356chr1253013 2093 696 437 24 --1793 --
NM_001025366chr651894 1509 237 216 181 ------
NM_001025580chrX63960 3325 3303 2946 655 233 --13710 --
NM_001025780chr93428 254 188 ------
NM_001031677chr51536 --1160 --
NM_001031679chr1232623 1423 667 13043 21153 708 --
NM_001031681chr174920 413 279 28 --12174 --
NM_001031695chr2275442 5410 3521 1806 1798 1182 808 --11558 --
NM_001031710chr72823 240 ------
NM_001031740chr121283 312 1121 21445 71 --
NM_001031804chr1664291 3856 3271 3187 1678 737 --23301 2728 --
NM_001032221chr941838 1810 1763 123 --145 --
NM_001032279chr11----1395 --
NM_001032282chr82374 286 ------
NM_001032293chr171441 ------
NM_001032380chr1031354 1330 120 2468 69 --1762
NM_001032730chr12165 132 --1238 --
NM_001033057chr331818 1396 608 ------
NM_001033507chr111517 1221 1158 --
NM_001033551chr1773545 3514 2999 1529 1401 1382 65 12764 1537 11015
NM_001033561chr171851 ----1699
NM_001033925chr101132 --1602 --
NM_001035260chr1041400 655 357 227 --1233 --
NM_001035chr12422 415 ------
NM_001037132chr73854 667 54 ------
NM_001037339chr1----21699 700 --
NM_001037533chr12561 541 --1806 --
NM_001039348chr2--165 ----
NM_001039547chr367710 6669 6034 2988 646 134 --57409 6402 5512 3170 2090 --
NM_001039570chr2283917 3893 3106 2951 2837 1727 1131 1120 13728 21386 793 11279
NM_001039590chrX34025 3830 3152 12743 ----
NM_001039802chr1--1233 --1189
NM_001039840chrX95455 4308 2221 2196 2103 1942 1310 1245 487 ------
NM_001039841chr15--123 ----
NM_001039888chr12276 188 --1162 --
NM_001039937chr1352942 1447 927 618 493 23604 3373 ----
NM_001040101chr411293 --1197 --
NM_001040142chr241739 1679 1662 889 21970 737 ----
NM_001040157chr441979 1966 1960 743 12844 1273 --
NM_001040158chr52217 187 ------
NM_001040202chr42520 305 --22153 889 12183
NM_001040273chr1021998 73 1438 31745 766 37 --
NM_001040284chr1635601 5018 1823 11613 45410 5052 4881 697 13889
NM_001040402chr442492 1106 1054 410 --11091 --
NM_001040429chr1321281 773 23067 1275 ----
NM_001040445chr284268 3770 3740 3720 2268 2177 2088 606 --44103 4095 760 336 --
NM_001040619chr111423 11405 1328 --
NM_001040624chr812411 1814 ----
NM_001040712chr962811 2490 2198 2185 367 78 ------
NM_001042353chr20----1156 --
NM_001042404chr14776 498 467 62 --11746 --
NM_001042413chr973467 3382 3301 3289 2807 2653 1279 ------
NM_001042473chr1022044 1533 ------
NM_001042494chr1533391 1245 1013 12424 11391 23623 361
NM_001042555chr1284713 4480 3501 3186 3060 1359 1206 443 --34039 1219 219 --
NM_001042599chr266879 6526 5501 3003 2897 1282 --12573 27412 1607
NM_001042601chr333026 2767 2070 12407 ----
NM_001042603chr1255259 3893 1361 1257 387 --24133 3664 --
NM_001042604chr373865 3679 3301 1858 680 381 147 --11769 1729
NM_001042678chr1----1272 --
NM_001044305chr621480 454 --11066 --
NM_001044385chr253745 2536 1382 770 304 1196 ----
NM_001048183chr15579 533 149 91 81 --2759 135 --
NM_001070chr171184 ------
NM_001077628chr11475 --1179 --
NM_001092chr1731794 1686 715 --2356 104 --
NM_001100108chr1108091 5915 5806 3339 2713 2550 2122 1740 1659 852 1862 46916 6085 5445 3238 --
NM_001106chr3119174 8172 7454 7118 6757 3782 2774 2131 705 282 206 23761 776 18695 --
NM_001116chr1621187 234 --12554 --
NM_001148chr482118 1976 1848 1757 1534 720 109 40 188 ----
NM_001149chr1021154 548 --11343 --
NM_001167chrX35416 4669 100 26631 5149 22681 2643 --
NM_001172chr141700 --1252 1222
NM_001186chr2132262 2144 319 32394 2245 2184 --1836
NM_001194chr191496 --2677 515 --
NM_001204chr276585 5947 3002 2218 1631 1527 102 --25540 4857 --
NM_001206chr962936 2294 627 587 108 53 --22942 2499 --
NM_001233chr741919 967 775 670 --12238 --
NM_001241chr262367 821 712 409 34 21 --12357 --
NM_001259chr775920 5557 5146 5046 4573 4495 1376 --54775 2407 2151 1133 611 12118
NM_001271chr1573284 2978 2452 808 780 255 141 ------
NM_001284chr5----1371 --
NM_001304chr1743394 460 184 28 1828 ----
NM_001356chrX72434 2288 1896 1881 1568 716 100 ------
NM_001364chr1154501 1732 1179 964 38 1689 21578 372 13630
NM_001390chr1873152 2870 2838 2329 1035 872 405 --22580 837 --
NM_001396chr2122501 359 --1524 --
NM_001402chr61513 --1223 --
NM_001406chr1721144 528 ------
NM_001419chr1973963 1333 1016 942 912 850 796 --11278 --
NM_001420chr1941262 415 159 98 ------
NM_001421chrX41702 542 231 76 1209 150 --
NM_001427chr7------195
NM_001430chr241504 1481 98 25 ------
NM_001431chr6----1770 --
NM_001455chr6114429 3601 3427 1910 1596 1543 1441 775 288 278 196 34112 1503 1026 14867 --
NM_001463chr21700 ----1751
NM_001483chr7--1699 ----
NM_001494chr101119 --1188 --
NM_001609chr1064304 4021 3856 3453 1598 1497 --34173 734 107 --
NM_001614chr17125 --1154 --
NM_001625chr11126 ------
NM_001656chr511324 11394 3624 450 152 --
NM_001663chr14--12758 12716 --
NM_001677chr111026 ----1344
NM_001695chr853807 3054 2603 1533 493 ------
NM_001707chr77903 764 748 692 639 213 91 ------
NM_001721chrX----151 --
NM_001731chr122652 182 ------
NM_001759chr1294011 3940 3810 1739 972 943 373 213 189 ------
NM_001792chr185953 228 219 102 66 11031 ----
NM_001794chr204269 234 214 198 ------
NM_001806chr1922419 542 12880 1140 --
NM_001830chrX33100 1205 1164 --32599 867 725 11179
NM_001839chr13734 264 212 ------
NM_001933chr1421322 136 ------
NM_001935chr21724 ------
NM_001949chr642416 1989 838 410 22461 2435 ----
NM_001957chr411967 ----1237
NM_001968chr41232 ------
NM_001977chr461170 1089 350 194 123 57 --21638 410 --
NM_001991chr1721774 515 3853 831 359 240 25 --
NM_002006chr423786 658 22285 915 14164 --
NM_002009chr1522495 1090 --21098 486 1908
NM_002015chr1332151 1011 32 1924 1886 --
NM_002024chrX5660 362 333 270 234 ------
NM_002025chrX109157 7760 7397 5887 5635 3721 2411 330 223 54 --11879 --
NM_002026chr21816 ------
NM_002076chr1232103 446 432 --1355 --
NM_002107chr11388 --1327 --
NM_002126chr1763711 3697 2569 1651 923 62 2680 513 195 --
NM_002137chr732383 2018 313 ----11640
NM_002146chr17----11020 1269
NM_002148chr21246 --1446 --
NM_002184chr5135 1193 ----
NM_002193chr221251 1217 ------
NM_002199chr4----1155 1385
NM_002203chr583012 2627 2585 2535 1347 1291 438 36 --12899 --
NM_002211chr101907 1739 ----
NM_002214chr785158 4547 4106 2214 366 294 268 234 12083 42275 2068 1013 639 --
NM_002228chr11400 --11254 --
NM_002247chr1052214 1795 549 465 311 ------
NM_002264chr334487 1246 469 --23570 1349 --
NM_002265chr1721034 211 --1189 --
NM_002268chr31368 --21805 35 --
NM_002271chr1352102 1930 1906 1794 228 11783 2687 151 --
NM_002293chr151997 1808 1700 433 25 --1390 --
NM_002296chr111475 --11311 --
NM_002309chr2252871 2774 2709 2531 2073 ------
NM_002334chr1151931 1787 792 395 322 ------
NM_002349chr21477 --1452 --
NM_002359chr1734119 3177 469 --14235 --
NM_002397chr54735 539 204 143 1852 ----
NM_002419chr11153 --1352 --
NM_002430chr22----12341 --
NM_002487chr151125 ------
NM_002494chr4----1124 --
NM_002500chr2----1403 --
NM_002501chr1943760 3754 2999 416 13851 --13163
NM_002505chr661259 1233 1154 1105 299 289 --1414 --
NM_002515chr1442015 737 531 419 ----1283
NM_002522chr1772799 2645 1133 968 761 729 481 ------
NM_002537chr151973 1908 1361 --
NM_002544chr17133 ------
NM_002547chrX44276 1692 1249 626 13908 43340 1557 1116 548 --
NM_002576chr1131217 820 122 --21150 163 --
NM_002577chr323682 2913 11468 ----
NM_002581chr963937 1932 1861 1383 1327 116 --23943 1439 --
NM_002605chr15----1372 192
NM_002613chr1694606 4497 4462 3696 2076 1823 1328 1228 51 --1133 --
NM_002627chr10----177 --
NM_002628chr32363 196 11043 1354 --
NM_002636chr62191 57 ------
NM_002655chr865241 4880 3919 3630 1706 1590 --14220 --
NM_002657chr2053745 2740 2535 541 142 13622 ----
NM_002702chr12279 30 ------
NM_002715chr521028 363 31226 803 255 ----
NM_002718chr32479 291 --21958 250 --
NM_002721chr9193 ------
NM_002731chr131142 605 195 --1790 1218
NM_002742chr142172 129 ------
NM_002745chr22144569 4555 4549 3939 3548 3333 1780 1152 1134 1061 1053 698 589 449 11202 21791 786 --
NM_002752chr51364 --130 --
NM_002753chr4------1605
NM_002822chr1221188 124 1568 ----
NM_002827chr2061662 1590 1499 538 445 347 --21463 584 --
NM_002828chr18----1930 --
NM_002830chr2----1137 --
NM_002840chr141611 1179 1088 215 --11027 11391
NM_002844chr611350 --11076 --
NM_002869chr1152175 1815 693 575 228 11654 ----
NM_002874chr922174 836 --21602 865 --
NM_002892chr1441635 482 279 82 11542 ----
NM_002893chrX1136 ------
NM_002906chr1141926 938 516 103 ------
NM_002912chr62345 320 ------
NM_002923chr1----1483 --
NM_002941chr3------11532
NM_002956chr12----168 --
NM_002957chr943166 2693 1465 1187 23883 2573 ----
NM_002971chr31388 1340 ----
NM_003013chr41679 --1159 --
NM_003014chr7----21088 142 --
NM_003016chr1711946 --11405 --
NM_003022chrX----11307 --
NM_003048chr242693 2681 1096 859 1409 ----
NM_003060chr521029 259 ------
NM_003072chr19----1291 --
NM_003108chr2106911 6758 5991 4826 2068 2059 1652 1031 897 507 27110 6991 24434 2652 --
NM_003110chr171820 --21075 789 --
NM_003161chr1733374 2223 1422 22775 2323 23343 802 --
NM_003183chr2----2832 335 --
NM_003188chr61547 --2562 233 --
NM_003189chr143069 2590 1072 240 --23211 2236 --
NM_003200chr1952183 1549 698 323 118 --12385 --
NM_003205chr1562095 1521 811 632 511 452 ------
NM_003253chr2141481 1238 364 300 ------
NM_003269chr631205 445 149 --11227 --
NM_003275chr951366 1300 1102 370 95 ----11402
NM_003291chr133790 546 251 1336 1113 --
NM_003298chr3105784 5647 5151 4646 1343 1290 1257 674 430 418 --34008 1844 970 --
NM_003304chr321606 1104 --21212 448 --
NM_003337chr521484 365 --11365 --
NM_003338chr1051582 618 193 78 34 ------
NM_003339chr511086 --11111 --
NM_003340chr431376 1268 423 ----1411
NM_003385chr21372 ------
NM_003390chr111334 ------
NM_003392chr343756 3574 3256 1534 12785 1969 --
NM_003406chr82431 271 11359 11817 --
NM_003410chrX21972 1010 ----13061
NM_003425chr19--1239 1611 --
NM_003439chr783452 3222 2587 938 920 898 782 309 31429 1113 746 23576 2275 --
NM_003453chr13------140
NM_003466chr262406 2313 1916 679 433 127 --1120 --
NM_003468chr243264 3241 1584 713 1749 13125 --
NM_003477chr111135 ------
NM_003478chr1132943 454 209 ------
NM_003483chr1222160 849 --1753 --
NM_003488chr17157 --1969 --
NM_003506chr841218 1188 944 482 ------
NM_003566chr1232432 1345 431 --13405 --
NM_003583chr1283407 3360 3270 2983 2651 1571 1233 603 13525 32451 2377 128 --
NM_003590chr253456 2737 2660 390 112 --11384 --
NM_003592chr7----2342 324 --
NM_003597chr221742 1669 --31441 771 269 --
NM_003613chr15193 ------
NM_003615chr323565 1199 ------
NM_003625chr12----125 --
NM_003629chr143203 846 704 611 ------
NM_003633chr532260 1769 217 --21864 351 --
NM_003644chr1766030 4768 2330 1734 1115 669 --16333 --
NM_003658chr111167 ------
NM_003672chr121433 748 1134 ----
NM_003704chr4----1568 --
NM_003709chr2------1316
NM_003713chr141544 660 388 369 11089 ----
NM_003743chr231659 1496 119 --11921 --
NM_003745chr16------130
NM_003749chr131375 --170 --
NM_003758chr152341 60 1540 ----
NM_003760chr11688 1211 --1781
NM_003764chr62686 668 ------
NM_003772chr111331 ------
NM_003822chr162584 2533 2264 2032 511 88 12248 ----
NM_003829chr9----11203 --
NM_003831chr1811733 --1172 --
NM_003870chr1571972 1898 1659 1394 602 397 108 ----1311
NM_003872chr232095 676 610 --22102 960 --
NM_003873chr1031722 726 530 12040 1544 --
NM_003884chr331703 1326 123 ------
NM_003887chr232210 1879 540 21577 23 ----
NM_003899chr1342328 742 522 494 --1695 1612
NM_003901chr1031982 1799 626 ------
NM_003913chr664003 3638 1700 524 425 369 --1518 --
NM_003916chrX41208 1102 964 419 --1412 --
NM_003927chr182862 299 21095 134 ----
NM_003941chr71913 2890 405 --12277
NM_003954chr1741422 1186 1038 957 11253 11012 --
NM_003955chr1721220 1042 11625 ----
NM_003958chr653752 2872 2718 1407 215 ------
NM_003972chr1031356 344 125 1981 11296 --
NM_003981chr1511021 1904 --1941
NM_004050chr1412066 ------
NM_004064chr123282 171 132 1211 ----
NM_004079chr1143 --22414 175 --
NM_004093chr1382343 1168 907 875 823 530 177 108 --22111 829 --
NM_004094chr1462994 2924 2539 1907 459 207 12429 145 --
NM_004100chr612491 11999 22130 673 --
NM_004114chrX1216 ----1310
NM_004124chr14----12718 --
NM_004157chr32711 650 ----1161
NM_004187chrX----1238 --
NM_004225chr841227 961 365 343 ------
NM_004227chr772075 2043 1256 799 700 672 295 --12816 --
NM_004235chr91635 1105 ----
NM_004239chr14130 ------
NM_004274chr141522 12776 2614 417 --
NM_004277chr61686 --3362 242 139 --
NM_004279chr71203 32155 582 477 1328 --
NM_004296chr1473143 2861 2799 2459 725 548 540 --1437 --
NM_004321chr243186 2396 835 574 --23003 2194 --
NM_004326chr1183 ------
NM_004329chr101887 --1154 --
NM_004331chr832632 1705 1031 ------
NM_004349chr82862 475 --1127 --
NM_004397chr1163281 3142 2777 1504 1157 902 --1615 --
NM_004411chr7--1533 1200 --
NM_004417chr52458 188 --1503 --
NM_004418chr22593 81 ------
NM_004427chr11245 1844 ----
NM_004430chr832466 1714 806 --12653 --
NM_004432chr962428 2276 2045 1958 608 447 ------
NM_004433chr161756 1452 1421 1236 468 400 ------
NM_004439chr4----156 --
NM_004440chr61780 1240 151 --
NM_004469chrX2113 43 --1430 --
NM_004482chr22706 647 1151 ----
NM_004501chr164141 4103 3787 3378 3254 2555 24133 2857 1212 --
NM_004504chr232994 2254 812 12588 1282 --
NM_004514chr1752558 2450 687 314 305 --2116 73 --
NM_004525chr21473 --188 --
NM_004529chr931389 501 470 ------
NM_004567chr341395 648 397 35 --12034 --
NM_004583chr17------2571 560
NM_004586chrX114748 4448 3746 3639 3571 840 481 422 393 69 47 1318 21515 1191 --
NM_004596chr19----1138 --
NM_004637chr311280 --11039 --
NM_004661chr56408 315 307 210 72 22 ------
NM_004690chr61265 1702 ----
NM_004709chrX51720 1560 1483 1124 311 --11704 --
NM_004730chr561802 671 574 201 131 44 ------
NM_004731chr1231528 1340 748 --21421 1247 --
NM_004734chr1372489 2475 2431 2334 868 422 208 12180 ----
NM_004745chr8106444 6080 5940 5227 1870 1641 1545 1212 687 59 ------
NM_004755chr1441137 809 166 50 11181 ----
NM_004762chr1741619 1331 693 212 --11271 --
NM_004766chr3----1178 --
NM_004774chr1732914 2313 2248 --11065 --
NM_004775chr18--12157 1917 --
NM_004798chr2032974 970 179 --136 --
NM_004834chr233231 2608 842 ------
NM_004841chr121145 336 ------
NM_004852chr181112312 12232 11339 8963 4572 4479 3749 3263 2859 2851 1272 --213332 978 --
NM_004856chr15--1611 ----
NM_004857chr1484750 3687 3497 3378 1430 309 211 131 34713 3471 626 1667 13859
NM_004884chr153655 618 451 --1112 --
NM_004887chr531110 457 163 ----1912
NM_004899chr21136 --159 --
NM_004926chr1431549 418 137 ------
NM_004929chr831511 558 231 --11030 --
NM_004947chr331945 637 189 ----22319 990
NM_004956chr754235 1752 1411 1193 894 23427 716 ----
NM_004973chr631660 638 68 1152 ----
NM_004979chrX2263 226 --21131 755 --
NM_004982chr122697 58 --1145 --
NM_004992chrX138402 8031 7257 5855 5819 5750 3378 2703 2286 1779 1390 1142 175 26328 2671 28122 2932 --
NM_005028chr1032217 187 91 --1648 --
NM_005034chr81161 ------
NM_005068chr6--1162 21115 74 --
NM_005097chr10143 1136 ----
NM_005110chr5--1832 1718 --
NM_005116chr2074176 4154 4126 3827 3690 2932 715 1460 21739 1027 --
NM_005121chr1713598 13077 1802 --
NM_005156chr975369 5131 4899 4718 4271 3780 1134 --24874 4435 --
NM_005168chr241480 1264 464 450 --11231 21574 654
NM_005188chr1197400 7156 5185 2217 2044 1876 829 767 454 17717 47206 6987 3022 2429 --
NM_005206chr171244 --11218 --
NM_005211chr5------1769
NM_005238chr1152938 2202 1346 988 858 1926 --12998
NM_005256chr113791 627 379 1151 ----
NM_005257chr1821425 993 ------
NM_005277chr41159 ------
NM_005324chr1741995 1507 794 178 ------
NM_005329chr162632 294 11913 11983 11613
NM_005358chr1361797 1770 1320 242 151 24 ------
NM_005375chr61134 1437 11123 --
NM_005378chr21862 ----1238
NM_005386chr204320 167 122 63 ------
NM_005399chr133877 3571 717 --24164 3883 1777
NM_005406chr1811359 ------
NM_005407chr1421010 998 11217 ----
NM_005436chr1083254 3212 2827 2721 2519 1134 1049 1040 13923 --1460
NM_005440chr1712036 --2971 822 --
NM_005477chr1542205 974 594 506 --12142 1215
NM_005502chr933083 2653 2287 ------
NM_005506chr412489 12707 ----
NM_005509chr521821 1362 --11650 --
NM_005537chr13----1211 --
NM_005545chr151273 --2717 245 --
NM_005561chr133793 750 685 --1140 --
NM_005569chr2231522 1144 167 --21533 44 --
NM_005573chr51555 ------
NM_005596chr965361 5296 4425 4318 640 581 --21079 255 --
NM_005599chr111124 ------
NM_005600chr1----1272 --
NM_005604chr651825 1813 1682 895 324 ------
NM_005611chr1611339 ------
NM_005639chr1261887 1684 1582 1507 682 638 1482 11672 --
NM_005669chr541841 1611 1464 184 ------
NM_005688chr34948 473 377 39 ------
NM_005692chr7----172 --
NM_005737chr232288 2174 672 ------
NM_005739chr1522003 466 --2166 108 --
NM_005748chr1233400 2580 795 --32707 2633 1226 --
NM_005759chr234226 3651 266 11678 43945 1805 1693 567 --
NM_005766chr1361429 1243 1228 922 570 308 1894 1185 11390
NM_005768chr12----165 --
NM_005822chr682226 1819 1812 1600 1567 538 315 255 12289 32253 1579 491 --
NM_005843chr24749 565 551 479 ------
NM_005859chr531424 1101 474 ------
NM_005871chr101196 --1258 --
NM_005880chr1621561 222 ------
NM_005885chr5----1133 --
NM_005898chr1153026 2392 1249 685 498 --1577 --
NM_005905chr131179 ----1395
NM_005909chr554077 3866 3773 3148 2823 --24041 820 --
NM_005911chr23922 438 387 --11220 --
NM_005926chr152200 51 ------
NM_005933chr1162942 2874 2395 860 559 387 --22327 2191 --
NM_005934chr1932325 2234 2216 --197 --
NM_005935chr464320 4179 3915 2006 747 666 --14556 --
NM_005937chr1743242 2995 882 526 --34153 983 365 --
NM_005955chr133716 3584 616 --15351 --
NM_005964chr171347 ----11148
NM_005966chr241833 1600 609 287 1929 ----
NM_005977chr133372 279 55 ------
NM_005986chr132607 471 ------
NM_006011chr15114301 4166 4140 3539 3153 3066 3001 2924 1101 608 558 23712 208 --14284
NM_006037chr254284 3953 3173 3148 1572 12961 --13479
NM_006040chr1631289 930 217 --11062 --
NM_006076chr763092 3007 589 534 492 472 --22475 331 --
NM_006084chr141309 ------
NM_006106chr1122733 1028 12904 22557 387 --
NM_006141chr1632227 1979 567 ------
NM_006145chr191895 ----11151
NM_006154chr1532007 891 137 ------
NM_006166chr1231938 556 498 1832 22067 1771 --
NM_006186chr211068 ------
NM_006195chr91210 --11225 --
NM_006206chr432217 2042 541 --1348 --
NM_006218chr3------1112
NM_006226chr241254 1179 878 403 ------
NM_006237chr1322210 248 11876 ----
NM_006243chr1--1849 11063 --
NM_006256chr132476 2205 207 22092 1975 31990 1072 716 --
NM_006285chr9----1212 --
NM_006289chr91154 --1101 --
NM_006298chr653247 2955 2495 1085 708 41269 883 260 29 32723 627 619 139
NM_006306chrX43892 1139 456 127 25780 793 ----
NM_006313chr1211475 --2493 154 --
NM_006320chr41925 ----1801
NM_006335chr13862 738 135 ------
NM_006345chr411224 --1887 1913
NM_006361chr1731777 518 340 ----1288
NM_006379chr71737 2790 182 1487 --
NM_006380chr1731618 692 195 1491 44357 3657 2819 642 14074
NM_006401chr9----1331 --
NM_006424chr42787 179 --11556 --
NM_006458chr11----195 --
NM_006467chr562060 867 619 414 404 94 ------
NM_006472chr141224 1196 799 196 --11170 --
NM_006496chr141539 139 129 114 ------
NM_006504chr1021858 933 --32681 1007 438 --
NM_006516chr141625 1601 1500 584 ----11593
NM_006517chrX42226 1434 921 84 --2114 64 --
NM_006534chr2042704 2619 1300 842 --12425 --
NM_006537chr15------1592
NM_006538chr2104061 3999 2737 1620 1248 1093 1042 883 229 67 --13843 --
NM_006539chr162515 33 ------
NM_006546chr1786065 4483 4140 1253 1185 1078 936 246 --21298 1093 --
NM_006547chr731995 1750 1435 ----1839
NM_006565chr16----1792 --
NM_006572chr1722872 138 --11354 13226
NM_006578chr151370 --1200 --
NM_006595chr11----3536 81 71 --
NM_006599chr16108124 7453 7157 6771 6024 5763 5376 992 977 576 11344 16497 --
NM_006609chr262083 1895 1883 1872 1850 269 ------
NM_006614chr343296 2292 183 155 --22690 1440 --
NM_006618chr1------1319
NM_006621chr121705 1257 --11350 --
NM_006626chr962413 2334 2217 2131 1959 1071 1447 173 --
NM_006628chr1574502 4203 4055 3911 3253 2870 266 ------
NM_006667chrX2889 108 ------
NM_006682chr731142 921 579 11827 52251 791 360 140 62 --
NM_006690chr2052259 1763 1556 774 367 --12309 1389
NM_006699chr132341 1984 1841 --1416 --
NM_006711chr162767 133 ----1729
NM_006717chr93941 898 176 12096 12856 --
NM_006726chr4------1454
NM_006729chrX4656 641 634 532 24289 2071 --13748
NM_006742chr1641271 247 203 28 ----11329
NM_006749chr831057 1021 809 1942 --1302
NM_006750chr16148011 7278 6689 6260 6238 2612 1549 1424 1214 1130 469 353 197 99 12373 28027 5767 17575
NM_006761chr171858 ----1272
NM_006772chr63544 329 59 ------
NM_006775chr642015 1930 990 121 --22911 279 13058
NM_006777chrX22844 369 --22793 493 --
NM_006788chr1872076 2057 1750 1719 1480 1373 530 --21599 393 --
NM_006815chr122358 342 ----1936
NM_006823chr81442 1455 1522 --
NM_006826chr22836 513 --1200 --
NM_006827chr142916 90 12544 1294 --
NM_006838chr1211221 ----11352
NM_006885chr163724 447 371 ----23273 3173
NM_006902chr132929 2446 2221 1828 190 --
NM_006902chr132929 2446 2221 1828 190 --
NM_006908chr72517 363 11483 ----
NM_006912chr162357 1776 1696 1655 603 194 --170 --
NM_006915chrX22487 984 ------
NM_006920chr211539 --11290 11463
NM_006940chr1221480 277 ------
NM_006943chr2043264 2469 1116 709 1497 23219 1080 --
NM_006951chr10----1712 --
NM_006981chr932751 288 41 11176 12930 --
NM_006990chr142413 2295 1836 1674 11917 12462 --
NM_006991chr321004 833 --1174 --
NM_006997chr10154 ----1158
NM_007005chr9143 11579 11535 --
NM_007010chr1731769 1525 52 --11189 --
NM_007011chr15156393 6206 5907 5326 4988 2438 2341 1950 1939 1861 1429 1206 760 614 268 16147 26699 5415 --
NM_007038chr2126049 1295 15925 35208 5190 48 --
NM_007039chr144854 145 112 62 21688 762 1263 --
NM_007050chr2087588 7000 6032 5394 2180 1609 1342 1049 --27882 645 --
NM_007073chr643557 2851 1540 975 14042 167 --
NM_007085chr351945 1840 466 450 35 --153 --
NM_007106chr1332621 728 640 1966 --11125
NM_007124chr6----1306 --
NM_007146chr1771944 911 873 861 700 675 134 11977 22859 555 1324
NM_007159chr311586 11101 ----
NM_007174chr123263 197 140 --1880 --
NM_007175chr832311 769 576 --23175 2821 --
NM_007202chr17--1726 --196
NM_007246chr4281 22 ------
NM_007249chr13139386 8241 8058 6930 3472 2999 2532 2332 2165 1589 546 488 50 27323 2322 57616 2691 2659 1133 1104 --
NM_007275chr351097 474 416 266 233 1961 1370 --
NM_007276chr72449 172 ------
NM_007332chr811552 --1348 --
NM_007345chr18164 11903 ----
NM_007359chr1731595 1468 1295 11246 11729 --
NM_007375chr142728 2458 1875 573 ------
NM_012082chr84656 384 361 302 ------
NM_012089chr131367 1231 218 ------
NM_012092chr231841 1640 396 --21646 543 --
NM_012095chr1072596 2178 816 716 571 530 105 --23030 2188 --
NM_012098chr931285 497 69 --21472 1332 --
NM_012160chr61192 ------
NM_012164chr976380 6102 5817 5723 5216 2107 201 ------
NM_012197chr941625 1323 1200 515 ------
NM_012199chr164649 4463 3992 3451 1128 719 1712 23710 276 --
NM_012207chr10138 ------
NM_012214chr2145840 5609 5595 5535 4942 4658 2481 2239 2148 1827 1763 1687 1234 648 15488 35942 2324 1292 --
NM_012215chr1031704 1457 763 ----1308
NM_012224chr42431 41 ----11120
NM_012233chr24834 775 153 134 ------
NM_012234chr351368 1168 910 693 411 ------
NM_012238chr1031300 605 457 ----142
NM_012245chr14------1122
NM_012247chr101318 1939 1961 --
NM_012249chr223158 189 ------
NM_012255chr20----1104 --
NM_012261chr202572 67 ------
NM_012262chr185159 1930 1799 1371 1230 1185 931 344 11391 --14017
NM_012290chr2168 --1465 --
NM_012294chr7103295 2836 2762 2734 2715 1015 1009 469 314 237 --22804 36 --
NM_012296chr1163400 3231 1503 893 131 34 13484 12972 --
NM_012297chr431987 1595 775 12536 22646 2324 --
NM_012300chr522277 474 --1400 --
NM_012307chr181200 --1252 --
NM_012319chr181925 ------
NM_012342chr102415 70 ------
NM_012395chr763131 2535 2452 1324 658 320 13278 12659 --
NM_012406chr122485 146 ------
NM_012464chr422437 2415 12488 --1181
NM_013230chrY----1506 --
NM_013247chr2----1127 --
NM_013296chr1185 ------
NM_013316chr73861 849 113 --1211 --
NM_013354chr83553 339 93 ----1142
NM_013372chr152223 24 ------
NM_013381chr1221560 381 --21733 579 --
NM_013396chr21--11401 1367 --
NM_013411chr142107 1911 1135 670 --22337 817 --
NM_013436chr21590 1664 ----
NM_013437chr811296 1914 ----
NM_013446chr731438 1010 1003 ------
NM_013448chr141146 --1228 --
NM_013995chrX32498 2223 816 --11035 1851
NM_014002chr11181 135 --1148
NM_014011chr242516 2256 1875 58 12068 ----
NM_014016chr3------11305
NM_014021chr143386 2989 2804 303 33269 3250 267 ----
NM_014023chr105967 730 487 258 38 ------
NM_014028chr623235 2386 1816 12111 --
NM_014034chr62964 281 11545 1586 --
NM_014048chr16134679 4597 4565 3587 3448 3352 3330 2061 1669 1637 885 320 207 25018 1688 ----
NM_014057chr931588 1304 392 ----1226
NM_014112chr884896 4881 4783 4374 3696 1832 1814 1228 11140 24395 386 --
NM_014117chr1642683 2170 2036 722 ------
NM_014154chr32502 241 ------
NM_014155chr1186782 6763 6604 4968 2669 2392 2299 137 ------
NM_014157chr1693966 3954 3810 3158 2898 1618 401 384 215 --33756 408 245 --
NM_014238chr17157 197 21559 1124 11383
NM_014240chr362864 1665 1493 1367 285 250 --23707 654 --
NM_014267chr11----1230 --
NM_014283chr111226 ------
NM_014289chrX31473 1361 1336 --21135 456 --
NM_014294chr811107 11391 --166
NM_014325chr1232130 617 99 --1513 --
NM_014326chr1541254 108 90 84 --2997 207 --
NM_014331chr487470 7256 6942 5606 4872 1980 561 316 25978 5330 11379 --
NM_014335chr15--1899 11036 --
NM_014351chr2221418 1348 11440 ----
NM_014368chr952170 2066 1525 1320 799 1726 11697 --
NM_014415chr32594 477 ------
NM_014423chr554830 3953 2264 792 224 --24840 4518 --
NM_014456chr10297 67 11781 11465 --
NM_014488chr112523 240 ----1170
NM_014491chr71165 --1421 --
NM_014494chr1611474 156 1885 --
NM_014515chr12159 1400 ----
NM_014554chr1232094 652 430 --21436 851 --
NM_014570chr221941 ----1923
NM_014572chr134653 366 267 187 --11711 --
NM_014585chr211170 ------
NM_014629chr82909 206 --11226 --
NM_014635chr2----1314 --
NM_014646chr1853183 2843 2784 974 852 12139 13189 --
NM_014647chr1611543 22058 319 2830 789 --
NM_014666chr52293 188 ----11007
NM_014682chr8----11896 --
NM_014689chr2------1436
NM_014702chr642668 2519 501 60 --1448 13423
NM_014707chr732052 641 366 ----2743 609
NM_014729chr81117 ----12054
NM_014730chr1265116 4999 4734 4577 3633 658 --21785 403 --
NM_014732chr1695058 4008 2200 1911 1035 1028 394 106 62 --24919 2172 15163
NM_014737chr2064239 3706 3241 1477 335 73 --12976 --
NM_014752chr1121540 333 --1301 --
NM_014755chr233361 864 424 13106 1894 --
NM_014764chr123200 186 147 --151 --
NM_014779chr31208 --21093 179 --
NM_014786chr112426 149 ------
NM_014798chr171347 ------
NM_014803chr1062726 2201 1909 1023 900 219 ----12319
NM_014810chr143435 3104 1373 562 12698 11279 13111
NM_014813chr11222 --192 --
NM_014827chr111623 ------
NM_014832chr131461 --21414 1368 1770
NM_014835chr2041576 1420 869 308 --11512 --
NM_014839chr152426 2311 2009 1904 723 --11948 --
NM_014847chr1171 --1441 --
NM_014848chr154917 526 304 103 11954 22496 763 --
NM_014869chr33520 415 282 ------
NM_014871chr12----1104 --
NM_014874chr141779 1578 420 244 --1327 1156
NM_014876chr2231970 1892 509 --11637 --
NM_014891chr721169 1117 11046 21270 231 --
NM_014903chr1222340 209 ------
NM_014917chr11170 --1625 --
NM_014920chr633617 3236 285 --1257 --
NM_014926chr321017 791 ------
NM_014935chr112733 --23836 473 12653
NM_014939chr1821553 243 --1369 11102
NM_014943chr8--1468 --2849 356
NM_014951chr1041768 883 803 796 ------
NM_014952chr1562057 1420 1310 541 484 60 --177 --
NM_014961chr441652 851 640 542 12238 ----
NM_014962chr2022050 1923 11012 1176 12788
NM_014974chr1021176 531 ------
NM_014982chr1464258 3610 1606 1564 1421 1348 1532 25241 3676 --
NM_014999chr1231644 1359 1139 --11385 --
NM_015000chr1262708 2275 2172 2104 1050 671 ------
NM_015020chr1673593 3469 2828 2775 1365 949 879 ------
NM_015025chr232741 2186 2041 12255 21928 760 --
NM_015039chr1114022 3954 2995 2812 2686 683 443 404 365 326 287 --1621 --
NM_015045chr1032123 1915 885 ------
NM_015049chr223025 38 --22979 1289 1550
NM_015050chr651276 1244 1190 858 112 ------
NM_015052chr731305 1208 388 1382 ----
NM_015071chr5156244 6230 6113 5876 5821 5181 5121 4759 4710 4574 4433 923 453 292 230 11421 34805 477 195 --
NM_015073chr1951526 1426 605 535 173 --11626 --
NM_015074chr123873 1107 --23244 136 --
NM_015075chrX51845 1719 1405 647 616 ------
NM_015076chr694195 3506 1697 1478 740 719 535 206 143 1465 2287 269 --
NM_015090chr194856 4616 4291 4159 4008 1118 910 835 320 --11346 --
NM_015092chr1611388 --53590 3509 1546 1401 498 --
NM_015094chr2274362 3549 1585 1419 1239 727 504 ------
NM_015132chr741997 1975 1849 1646 --2460 296 --
NM_015138chr1542637 1147 427 375 --1649 --
NM_015143chr42256 28 --1133 --
NM_015144chr16113448 3413 3195 3085 2874 2616 2552 891 671 605 295 1471 13049 --
NM_015149chr121747 1416 1146 ----
NM_015156chr1423887 1091 13916 1738 --
NM_015163chr141778 --11242 --
NM_015172chr11633 --11074 --
NM_015180chr143288 139 58 ----1322
NM_015185chrX62256 2121 2072 1870 628 80 --21126 858 --
NM_015192chr2032122 517 435 1402 ----
NM_015215chr132709 2657 599 11245 1798 --
NM_015236chr431407 1284 283 ------
NM_015238chr5------1230
NM_015252chr21895 ------
NM_015263chr152820 747 1445 1245 --
NM_015267chr1232019 1582 581 ------
NM_015268chr32522 187 ------
NM_015271chr473253 3224 2929 2833 1258 908 695 11054 23830 1220 --
NM_015285chr1822346 1923 --22282 364 --
NM_015288chr553291 2975 1511 1400 538 ------
NM_015299chr1483202 3169 2982 2902 2523 1353 1226 237 --22944 1384 13008
NM_015310chr8136808 6730 6715 6592 5569 5099 3258 2777 2273 2262 1677 557 478 15320 ----
NM_015317chr222152 408 --1962 --
NM_015318chr1941709 1486 280 79 ------
NM_015326chr152757 2739 2506 2084 1032 ------
NM_015336chr1252517 1834 996 682 435 --12427 --
NM_015338chr2031930 459 113 ------
NM_015346chr1431663 357 317 ------
NM_015349chr642701 2677 1040 623 ------
NM_015355chr1741920 1737 608 106 ----1178
NM_015375chr154639 3960 3924 3572 3152 14544 23130 725 --
NM_015397chr951920 1626 1249 1229 138 ------
NM_015409chr1232161 1964 298 --22709 104 --
NM_015435chr8--11094 1344 --
NM_015443chr1721317 210 ------
NM_015455chr5103805 3529 3467 3305 3270 3046 1159 1092 968 344 23689 1621 ----
NM_015470chr21355 --11033 --
NM_015497chr1521075 54 ------
NM_015508chr321356 110 2435 297 292 48 1536
NM_015534chr13829 407 116 ------
NM_015548chr62688 36 ----1322
NM_015554chr1552571 2193 2109 2072 343 --12064 --
NM_015557chr162262 1195 751 591 451 116 --3862 404 32 --
NM_015577chr531749 1152 400 2607 474 11611 --
NM_015578chr1921839 1823 1212 31528 275 117 --
NM_015652chr101434 ------
NM_015686chrX1504 --11847 --
NM_015714chr1----1238 --
NM_015853chr111180 ------
NM_015879chr18147620 7549 7400 7299 6367 5962 5860 5844 5718 2029 1258 1203 856 815 27930 3414 48609 8426 8011 1415 --
NM_015888chr143217 2999 2723 1094 12547 12636 --
NM_015891chr642078 1949 1415 574 11582 ----
NM_015898chr1962334 1881 1714 916 557 179 --1772 --
NM_015995chr15105344 4434 3704 3681 1781 1025 948 755 719 621 15077 13885 --
NM_015999chr11125 --1266 --
NM_016018chr822625 50 --1390 --
NM_016021chr682565 2439 2336 2125 1158 1132 622 388 --11149 --
NM_016041chr172275 126 ------
NM_016061chr221091 537 --11577 21650 468
NM_016073chr151780 ------
NM_016076chr153184 2728 2300 2011 614 --22685 2080 --
NM_016081chr4--22162 2120 2214 105 1612
NM_016083chr663834 3776 3054 1409 895 23 23168 410 --12507
NM_016087chr721750 532 ----185
NM_016098chr62344 335 --140 --
NM_016107chr51474 ----11286
NM_016120chrX11196 ------
NM_016123chr122927 473 --11097 --
NM_016125chr17----1419 --
NM_016131chr221691 871 --11866 --
NM_016132chr15------1275
NM_016133chr221265 1163 11611 ----
NM_016151chr16243 36 ------
NM_016206chr366415 3533 517 430 192 33 16889 28459 6908 16932
NM_016224chr641743 1687 1407 245 ------
NM_016230chr61149 ------
NM_016237chr12----1116 --
NM_016255chr663168 2781 1130 953 895 307 11054 23311 2679 --
NM_016257chr152849 2836 2486 724 203 13246 ----
NM_016269chr441166 1070 450 438 --1980 --
NM_016275chr332781 949 570 --12232 --
NM_016277chr621221 371 --11438 --
NM_016287chr131867 1811 425 11764 11626 --
NM_016289chr252282 1512 317 67 59 --139 --
NM_016308chr131653 835 499 21492 631 11284 --
NM_016322chr963068 2644 2480 2332 842 292 12617 22189 60 --
NM_016356chr622012 594 ------
NM_016358chr51395 --1416 --
NM_016374chr151393 1205 1128 141 22 198 11221 --
NM_016396chr1553013 2221 2115 1111 978 ------
NM_016436chr2012089 --22181 751 --
NM_016441chr252324 1674 767 730 174 ----1124
NM_016488chr121452 --11674 11705
NM_016520chr9--1559 1106 --
NM_016525chr91717 ----1763
NM_016529chr131256 ----1323
NM_016530chr1583543 3362 1141 875 486 406 325 27 ------
NM_016531chr433351 2921 1436 --34123 3459 809 --
NM_016544chr263575 2817 1489 800 757 576 12489 12910 --
NM_016592chr2031079 1061 924 --2956 438 11417
NM_016598chr331181 1148 145 ----151
NM_016626chr1811708 21162 218 ----
NM_016644chr52153 68 ------
NM_017420chr1422493 1043 --1508 --
NM_017423chr431466 759 462 ------
NM_017426chr41500 ------
NM_017519chr621373 1130 ------
NM_017542chr131829 1785 1687 ------
NM_017544chrX2777 312 1637 ----
NM_017551chr1032385 2095 1901 --12696 --
NM_017580chr1051970 1721 368 361 329 --22034 1919 --
NM_017629chr141787 1505 1243 749 1524 1153 --
NM_017635chr1151282 1156 402 143 119 --193 --
NM_017637chr967934 7337 7115 2345 1902 766 1674 36098 2061 1459 --
NM_017650chr755484 4601 4404 3928 1506 --2824 455 11237
NM_017658chr1414035 24429 1232 23962 3086 --
NM_017694chr22514 168 --1106 --
NM_017709chr183324 2898 2869 2710 1259 1032 345 293 ------
NM_017734chr12603 51 --1241 --
NM_017741chr411067 --21724 204 --
NM_017754chr664633 3579 3523 125 75 55 14272 11846 --
NM_017758chr1711038 --11505 --
NM_017778chr83520 462 424 11449 21326 526 --
NM_017780chr8--1331 --1788
NM_017784chr31947 ------
NM_017799chr1411912 11769 1143 --
NM_017811chr922183 762 ------
NM_017813chr855568 5537 5040 4056 343 35611 878 828 1707 --
NM_017824chr1031016 934 137 --12290 --
NM_017849chr21291 --11052 --
NM_017902chr10105753 5736 4840 3576 1653 1055 1032 769 220 170 186 23593 2012 --
NM_017915chr123412 399 142 ------
NM_017944chr1172991 2907 2898 2789 2539 1205 737 --1117 --
NM_017987chr10--21433 862 --12138
NM_018011chr13----1617 --
NM_018027chr1043317 2713 1247 539 --1218 --
NM_018046chr531873 1777 86 --1615 --
NM_018061chr121468 659 --1496 --
NM_018078chr421072 177 --1321 --
NM_018084chr242608 2118 709 339 22691 207 ----
NM_018086chr221864 652 1678 11546 --
NM_018087chr1----170 --
NM_018098chr3188 ------
NM_018113chr122422 211 ------
NM_018121chr1012167 --12596 --
NM_018137chr12434 272 ------
NM_018154chr192937 27 ------
NM_018181chr1831758 1664 508 --194 --
NM_018184chr341429 832 429 204 --11395 --
NM_018208chr1----138 --
NM_018243chr433228 1000 270 1522 12605 13737
NM_018254chr161947 1941 1904 1827 958 946 --1489 --
NM_018275chr71495 ------
NM_018293chr332307 1184 264 154 2772 625 --
NM_018362chr1173635 3590 3558 3536 3082 707 577 22787 736 11516 --
NM_018364chr163726 3580 3561 3476 1242 402 --23004 581 11049
NM_018367chr1112035 --32232 625 450 --
NM_018370chr1241965 467 377 113 --11593 --
NM_018388chrX21342 457 1171 ----
NM_018403chr364146 3132 2734 1052 669 598 11298 --1651
NM_018416chr1242342 1834 1758 842 ------
NM_018462chr31831 --1887 --
NM_018471chr22434 40 ------
NM_018475chr41108 ------
NM_018482chr822510 244 --22554 2090 --
NM_018489chr151785 1649 755 584 302 12156 ----
NM_018527chr131169 --1107 --
NM_018557chr231288 519 219 11453 --196
NM_018566chr1134918 4411 4072 3993 1825 1776 1604 1560 1543 1141 989 411 304 34453 3718 1294 24993 3499 --
NM_018584chr121209 83 ------
NM_018590chr101373 ----144
NM_018602chr15137 --1122 --
NM_018638chr1223631 308 --15251 --
NM_018650chr141749 903 674 631 ------
NM_018682chr72703 595 ------
NM_018700chr541506 1240 1065 677 21416 439 ----
NM_018712chr1121531 1139 --1521 1306
NM_018717chr432857 2459 298 --12110 --
NM_018718chr741762 555 250 59 ------
NM_018898chr5--12014 12263 --
NM_018945chr642807 1416 872 411 --1197 --
NM_018970chr782644 1999 1131 857 664 560 482 348 ------
NM_018977chrX21098 673 --1782 --
NM_018979chr1212228 ----1607
NM_018999chr1084637 4401 4341 4206 4128 4099 3941 1489 14151 --11627
NM_019003chrX------1128
NM_019024chr21359 --1472 --
NM_019050chr431990 648 531 --1435 --
NM_019058chr10----1212 --
NM_019084chr102277 126 ------
NM_019091chr231099 991 320 ------
NM_019102chr7122 ----159
NM_019114chr932530 2220 83 1188 ----
NM_019555chr32156 87 ----11290
NM_019558chr21315 ------
NM_019593chr2043165 372 296 73 --12801 --
NM_019610chr111690 1251 1857 --
NM_019885chr252810 2517 646 457 295 22659 2411 ----
NM_020066chr11266 --1400 --
NM_020134chr23828 393 189 --21161 1047 --
NM_020144chr742098 1412 603 119 ------
NM_020177chr563306 2641 2290 649 66 22 1133 2903 86 13132
NM_020193chr1141302 1271 1228 88 ------
NM_020198chr1751583 1274 1127 1075 321 ------
NM_020211chr1521430 1138 ------
NM_020228chr1122426 28 ------
NM_020310chr1752780 2051 1825 1029 954 ------
NM_020337chr441962 1129 242 125 --1531 --
NM_020341chr2041512 481 398 279 22023 1721 ----
NM_020342chr261818 1740 964 903 553 160 --11733 11930
NM_020353chr3----174 --
NM_020403chr1321313 132 1465 ----
NM_020440chr12675 181 --22540 204 --
NM_020463chr23980 973 583 ------
NM_020466chr684244 3382 1956 1678 1536 1356 782 392 1817 34286 1728 330 --
NM_020525chr12----1365 --
NM_020526chr151728 1452 623 537 405 --11478 --
NM_020640chr331538 1485 459 ------
NM_020651chr211331 1721 ----
NM_020673chr2097143 5561 5514 1702 1417 1269 1066 548 344 27382 6938 67015 6699 5796 5485 4919 2440 --
NM_020689chr2021474 436 ----11597
NM_020699chr195331 5001 4050 3734 2165 1914 1712 630 503 11385 13855 13914
NM_020704chr712529 12129 ----
NM_020713chr2082937 2604 2519 2303 2076 840 492 302 ------
NM_020742chrX42096 1043 977 483 --12744 --
NM_020752chr1092910 2862 2771 2348 2198 1942 551 447 248 --11035 11136
NM_020760chr231604 1261 736 --1377 --
NM_020768chr542517 2476 2140 2003 --11060 --
NM_020769chrX----1816 --
NM_020772chr17107939 7673 6824 6733 5781 3037 2975 2887 2069 1415 38289 3310 1259 --139
NM_020783chr1811685 ------
NM_020791chr172472 182 11432 21323 1002 --
NM_020794chr12436 138 ------
NM_020801chr542259 2185 1689 441 --1804 --
NM_020825chr1623459 924 --43481 3153 3091 2960 --
NM_020845chr121542 --2899 863 --
NM_020853chr1231065 618 170 12770 ----
NM_020854chr1831269 964 72 ----1488
NM_020856chr1941487 405 395 311 ----11582
NM_020858chr1522328 516 11921 1301 11475
NM_020871chrX32112 1997 621 1940 11005 11770
NM_020872chr32505 270 21422 389 ----
NM_020888chr141607 783 398 23 ------
NM_020935chr264095 2855 1083 383 234 26 --14554 1872
NM_020940chr1032462 1136 273 --12229 --
NM_020956chr1931196 491 427 14670 ----
NM_020962chr1542017 1819 1626 699 22172 1976 22365 1826 --
NM_020967chr201252 --11203 --
NM_020975chr1041388 670 269 243 --21326 574 --
NM_021033chr1363181 2845 2733 937 847 434 ----1516
NM_021035chr2041086 1030 488 416 --1138 --
NM_021038chr363135 3106 2986 2597 846 282 1752 11161 --
NM_021045chr1032573 1818 997 --1757 1343
NM_021072chr552050 1704 583 408 217 12212 ----
NM_021079chr1732213 981 621 --12906 --
NM_021083chrX43308 3272 3256 2936 --33549 3491 2556 12952
NM_021090chr2274191 3468 1867 1144 927 791 512 --14646 --
NM_021136chr143641 467 109 --1582 --
NM_021137chr1762360 872 590 501 190 106 ----11623
NM_021151chr73984 393 23 ------
NM_021183chrX62223 1671 717 697 209 132 --1762 --
NM_021190chr111363 --1529 --
NM_021202chr2042205 1947 1920 220 --12510 12502
NM_021224chr91145 ------
NM_021229chr123306 274 29 ------
NM_021244chr61174 ------
NM_021629chr364861 4441 3936 1130 980 523 --13222 14592
NM_021643chr221448 380 --11230 --
NM_021813chr665721 4556 4468 982 757 69 12101 ----
NM_021914chr144510 482 433 404 1278 1974 --
NM_021935chr3----11024 --
NM_021945chr653472 2769 1112 402 263 --22363 2282 1855
NM_021946chrX11033 --11257 1143
NM_021947chr172347 286 --1446 --
NM_021960chr112230 1403 1466 --
NM_021964chr3126357 6285 4628 4037 2404 2242 2211 1567 1375 925 382 33 15392 1175 --
NM_021998chrX21522 1134 1203 --1558
NM_022051chr11566 ------
NM_022062chr1121852 21 --11952 --
NM_022114chr164063 3581 2959 1276 1017 111 ------
NM_022123chr14183 ------
NM_022166chr1685763 5372 5200 4181 1131 1005 997 533 15555 ----
NM_022373chr71896 --2963 359 --
NM_022459chr1365854 5842 4547 4531 1988 1405 --11395 --
NM_022474chr1441854 916 795 259 21830 1080 ----
NM_022484chr721094 33 --11391 --
NM_022491chr1253296 2170 1005 153 131 ------
NM_022497chr343106 2802 2522 430 12511 43775 3751 3254 996 --
NM_022659chr83464 141 24 166 ----
NM_022719chr22103841 3722 3691 3344 2489 1488 947 716 660 171 --43375 2940 2423 431 --
NM_022728chr71211 --1678 --
NM_022753chr132223 2081 1050 --159 1297
NM_022763chr342561 2385 2199 684 12044 12487 --
NM_022771chr122385 57 ------
NM_022781chr952266 2227 907 659 512 ----1583
NM_022817chr211995 ----11946
NM_022831chr151657 1651 1220 522 170 --11632 --
NM_022832chr461793 1021 972 916 618 407 --32128 827 49 1169
NM_022841chr1562727 2513 857 708 539 24 ----22276 1709
NM_022843chr1311407 1205 1184 --
NM_022893chr262995 2676 2165 582 367 181 12281 22602 796 --
NM_022898chr1494770 4630 4095 1818 1436 803 693 661 191 11532 2856 132 11280
NM_022912chr222253 81 --1458 --
NM_023012chr123773 535 80 ------
NM_023016chr242510 2473 2060 973 ------
NM_023076chr1652964 1852 720 564 384 --42467 2415 991 48 --
NM_024052chr1752039 1975 1044 729 452 --1991 --
NM_024081chr11----2784 80 --
NM_024090chr431903 758 222 ------
NM_024297chr17--1459 ----
NM_024312chr122124 46 --135 --
NM_024345chr954594 4057 202 166 152 --21575 218 1770
NM_024503chr12426 23 ------
NM_024524chr322540 2096 191 13177 --
NM_024525chr1----1558 --
NM_024546chr1331288 975 802 ------
NM_024548chr311616 ------
NM_024554chr141611 1244 507 239 --21203 491 --
NM_024594chr511883 11698 1289 --
NM_024595chr1----31006 913 765 --
NM_024612chr175812 800 776 268 244 1372 2978 105 183
NM_024615chr5----1228 --
NM_024656chr1921562 1036 21055 383 1259 1168
NM_024665chr344380 3362 1851 249 23415 1708 21810 1779 13603
NM_024721chr842357 1052 513 108 --12079 --
NM_024749chr161987 1699 1623 700 625 62 --1458 --
NM_024792chr174952 403 393 181 --155 --
NM_024811chr1111520 --11246 1456
NM_024830chr52380 109 --1559 --
NM_024893chr204804 789 205 87 --1178 --
NM_024915chr812545 ------
NM_024939chr1661679 1457 1426 1312 1061 75 ------
NM_024942chr10----21327 172 --
NM_024947chr379392 9314 9163 8841 8586 1330 824 49174 5826 2124 1104 ----
NM_024963chr735669 4479 3720 --45044 4626 3989 951 --
NM_024993chr241490 1462 549 23 1237 ----
NM_025010chr332165 1952 205 --12037 --
NM_025040chr191973 11980 ----
NM_025074chr462226 1925 1169 778 276 122 11087 12508 --
NM_025083chr1531995 1843 713 --12029 --
NM_025133chr22421 308 1211 ----
NM_025146chr321037 504 ------
NM_025160chr153881 1342 912 663 590 ------
NM_025179chr133855 3460 3183 --21678 1315 --
NM_025182chr92985 818 ------
NM_025187chr161446 ------
NM_025195chr83685 331 181 ------
NM_025235chr10--12195 32031 370 208 --
NM_025248chr1742785 1191 1028 885 ------
NM_030576chr1762524 2228 1662 640 616 334 ------
NM_030625chr101625 --12581 --
NM_030627chr563935 3645 3270 1596 1058 881 --11636 1612
NM_030629chr1631443 1421 660 --11746 --
NM_030637chr141140 ------
NM_030647chr766251 6015 5501 3852 1514 1325 12298 --15202
NM_030648chr484702 3592 2152 1197 1125 696 401 231 --15294 11046
NM_030665chr171235 --3559 475 109 1898
NM_030755chr1412285 1159 ----
NM_030762chr1211267 --11724 --
NM_030786chr121232 1192 ------
NM_030806chr1148930 8787 7932 7730 7270 6887 6832 6661 6586 6515 6506 2936 1448 1082 22730 907 --29262 101
NM_030816chr123115 673 --1848 --
NM_030820chr6--1732 --1210
NM_030885chr321430 802 --2469 84 --
NM_030912chr102855 765 ------
NM_030939chr61471 ------
NM_030953chr511121 --1109 --
NM_030957chr192462 204 --1396 --
NM_030964chr553380 3304 1446 1104 196 --32952 2722 2583 --
NM_031216chr1841707 644 528 91 --1872 --
NM_031442chrX62425 2167 2142 2052 1108 497 1924 ----
NM_031483chr2022625 771 --23416 2772 --
NM_031492chr11------1509
NM_031942chr24928 454 358 235 ------
NM_032021chr111215 ----1984
NM_032144chr251671 1139 545 424 78 ------
NM_032172chr721008 984 ------
NM_032199chr1053545 3463 3219 1176 989 ------
NM_032208chr242794 2414 2364 2265 ----12968
NM_032221chr201818 11924 21323 269 --
NM_032242chr3103324 3247 2802 2741 2618 2454 2067 914 568 24 --2420 242 --
NM_032352chr1451427 1070 1040 580 133 --11401 --
NM_032373chr1065719 5699 5298 4939 4747 112 --24205 3924 --
NM_032410chr811210 ------
NM_032439chr102426 51 --1460 --
NM_032440chr1032613 2175 2003 22868 45 ----
NM_032457chr413677 ------
NM_032458chrX103237 3075 2871 2333 1190 980 912 834 746 662 --12547 --
NM_032491chr121440 1259 ----
NM_032499chr15----2462 234 --
NM_032505chr342707 2465 818 321 1447 1215 --
NM_032547chr42283 83 ------
NM_032557chr42353 300 --1775 --
NM_032603chr22264 220 --1731 --
NM_032632chr1412059 1190 1149 --
NM_032682chr343378 2691 2659 1090 --32346 1110 451 --
NM_032701chr192633 115 ------
NM_032777chr851460 1140 499 315 288 --11177 --
NM_032780chr114930 797 370 320 --1361 --
NM_032786chr121547 ------
NM_032801chr1151926 425 416 385 350 --1566 --
NM_032804chr1051962 1588 688 669 270 ------
NM_032812chr10----129 --
NM_032833chr112096 --2982 674 --
NM_032840chr121960 ------
NM_032859chr1363731 2799 2774 1571 971 503 1881 ----
NM_032876chr1411466 --11511 --
NM_032932chr1764930 4245 1863 1352 1093 197 --24518 749 --
NM_032961chr42887 31 ----1265
NM_032983chr731169 276 62 --2769 139 --
NM_033030chr2--11565 ----
NM_033055chr12220 33 ------
NM_033132chr131425 21447 404 ----
NM_033211chr531907 1306 387 --1379 --
NM_033224chr787759 4881 2980 2460 1389 1265 1217 236 12264 35628 5121 477 --
NM_033272chr21123 --1332 --
NM_033285chr874394 3950 1638 1315 867 855 697 1481 54371 3112 3063 427 299 --
NM_033394chr21644 --11124 --
NM_033495chrX11000 --1275 --
NM_033505chr275565 5448 4944 4891 4689 2447 29 15009 25043 4720 25347 1533
NM_033546chr181159 ------
NM_033631chr153896 2434 1259 870 308 13250 12617 --
NM_033656chr2174981 4820 3921 1347 1086 738 193 1315 1187 --
NM_052867chr13----2480 221 --
NM_052904chr61272 --1299 1478
NM_052905chr2--1719 1663 1746
NM_052910chr1331767 594 271 --11622 --
NM_052927chr52335 145 --11780 --
NM_052932chr1111999 32322 2032 639 1376 --
NM_052937chr8159 ------
NM_053023chr1182940 2889 637 546 508 448 137 82 ----11057
NM_053024chr32995 518 11365 1228 --
NM_053056chr1153113 2408 1048 1018 92 ------
NM_054027chr542156 1820 704 22 ------
NM_057175chr432105 405 388 --1746 --
NM_058170chr12425 116 1235 ----
NM_058237chr143933 420 366 --1797 --
NM_058238chr221225 --1833 --
NM_078469chr1051173 1135 997 979 411 --1919 --
NM_080391chr11592 --1116 --
NM_080422chr18------1325
NM_080546chr921447 903 ------
NM_080621chr203442 277 83 --134 --
NM_080737chrX1228 ------
NM_080743chr642139 2121 1817 364 21665 321 1962 --
NM_130386chr181105 ------
NM_130387chr3----1302 --
NM_133264chr1723182 457 23633 2847 12558 --
NM_133329chr231882 565 86 ------
NM_133433chr51872 ------
NM_133493chr643800 1719 792 652 21026 350 ----
NM_133507chr121796 --1107 --
NM_133625chr31445 ------
NM_138335chr44633 259 229 41 ------
NM_138346chr1----152 --
NM_138375chr18----2473 56 1142
NM_138423chr1511507 ------
NM_138426chr72267 115 12067 2886 220 --
NM_138453chr5----155 --
NM_138459chr633688 1052 473 --11221 --
NM_138473chr1283885 3383 3162 1622 1571 785 245 166 23415 104 ----
NM_138731chr1453922 3823 3757 2777 1008 ------
NM_138773chr51244 ------
NM_138779chr131176 --168 --
NM_138782chr531786 877 175 ------
NM_138797chr223246 196 60 ------
NM_138799chr261861 797 684 309 234 60 --1249 --
NM_138927chr211771 ----1683
NM_138967chr152493 201 --1487 --
NM_139058chrX3419 92 58 --1109 --
NM_139062chr17----129 --
NM_144571chr455107 2445 2059 608 503 15259 45787 5498 2756 268 --
NM_144582chr242636 2254 1646 484 --11608 --
NM_144633chr321237 396 --11195 --
NM_144664chr1142384 1801 580 21 --1153 --
NM_144726chr53823 373 140 ------
NM_144778chr1332776 2103 606 1413 12588 --
NM_144963chr822131 573 1876 1210 --
NM_144973chr1255270 4206 3298 1184 1037 --11665 --
NM_144979chr41611 1131 --1508
NM_145005chr92901 399 ------
NM_145011chr1021970 1471 ------
NM_145018chr112211 75 ------
NM_145166chr362974 2358 2033 1131 832 550 --2789 293 --
NM_145175chr211294 --2986 558 --
NM_145176chr623071 687 13463 ----
NM_145203chr13----148 --
NM_145233chr19----2321 122 --
NM_145307chr1043334 3189 1850 468 21572 314 34332 4259 1771 11198
NM_145735chr1331942 830 541 ------
NM_145800chrX1413 --1997 --
NM_145891chr1621070 613 ------
NM_147156chr101294 --1145 --
NM_152261chr12--12582 21014 32 --
NM_152264chr112769 426 --2895 316 --
NM_152265chr121216 1060 --21337 146 --
NM_152277chr531453 668 344 --22116 1853 11739
NM_152284chr8--1745 1221 --
NM_152291chr4179 1121 ----
NM_152335chr151496 ------
NM_152344chr1721355 30 --1128 --
NM_152400chr432005 1843 1751 --11906 --
NM_152409chr543180 2505 1290 815 --1929 --
NM_152424chrX44518 3950 3846 3110 ------
NM_152446chr144760 661 643 236 --1394 --
NM_152457chr16197 ------
NM_152493chr12233 57 ------
NM_152556chr752085 1745 1698 604 237 21800 245 21946 84 --
NM_152570chr9----1302 --
NM_152588chr121247 11158 ----
NM_152594chr1521693 261 12197 ----
NM_152622chr571326 978 648 605 493 375 35 13461 ----
NM_152624chr586396 6254 4678 2799 1466 1038 729 220 --21751 602 1458
NM_152653chr31721 ------
NM_152665chr1----1490 --
NM_152694chrX----1155 --
NM_152704chr132836 248 ------
NM_152735chr63847 766 623 ------
NM_152738chr62354 342 ------
NM_152753chr64784 526 279 142 --1244 --
NM_152756chr563870 3758 3625 1577 853 273 1886 ----
NM_152758chr852629 2015 1090 219 162 --12145 --
NM_152780chrX2924 267 ------
NM_152787chrX93931 3484 3111 2898 1378 1288 1012 870 347 146 ----
NM_152835chr152791 2680 1923 1073 816 --22824 1109 12250
NM_152890chr121072 107 1342 ----
NM_152991chr111620 --2640 476 --
NM_153020chr631578 1301 460 ------
NM_153026chr122528 22 1363 ----
NM_153029chr1634131 4010 577 11018 23989 3633 --
NM_153042chr661595 1518 706 522 192 167 ------
NM_153184chr321880 1627 --11933 --
NM_153207chr1263667 3144 2994 2543 1383 416 ------
NM_153208chr16----1790 --
NM_153262chr143138 992 774 39 1586 --12756
NM_153332chr812119 22398 643 1196 13021
NM_153365chr45953 759 584 261 86 1466 --11956
NM_153607chr522654 366 23204 93 1464 --
NM_153689chr252350 1934 1668 529 48 21825 795 ----
NM_153707chr91136 --136 --
NM_153810chr10134946 4869 3835 3779 3619 3516 1944 1574 1099 911 820 454 361 1516 1881 --
NM_170606chr71167 --21472 240 --
NM_172037chr82183 164 --173 --
NM_172070chr242165 1969 1449 684 ------
NM_172071chr144920 1884 1370 831 17229 17480 1523
NM_172212chr1----189 --
NM_172375chr14----167 --
NM_173075chr41444 --21294 413 --
NM_173083chr12857 216 --1164 1178
NM_173354chr2121910 1794 ------
NM_173355chr21384 ----1282
NM_173469chr1521108 96 ------
NM_173473chr1062618 2611 2470 1789 411 389 12725 32451 2088 601 --
NM_173495chrX31757 1614 423 --22564 757 --
NM_173511chr21217 --23876 3740 --
NM_173552chr311827 11601 142 --
NM_173595chr1251593 1350 550 486 81 ------
NM_173602chr1253131 3063 2783 1421 235 --13676 --
NM_173631chr192478 73 ------
NM_173642chr1139041 8840 8547 7192 7162 7113 6457 6293 3002 572 558 277 121 12315 49020 2739 128 22 --
NM_173648chr23824 215 143 2189 46 ----
NM_173683chr821412 498 --158 --
NM_173808chr1113843 3086 1600 1131 1061 964 930 605 391 301 203 ------
NM_173828chr52326 301 --187 --
NM_173833chr831675 1653 1418 --1115 --
NM_174909chr5----2888 219 --
NM_174911chr873363 2473 1542 1352 847 455 290 13250 ----
NM_175061chr73354 260 83 ------
NM_175069chr93976 355 175 ------
NM_175607chr3----1157 176
NM_175607chr3----1157 176
NM_175733chr1142120 1432 814 291 22067 1505 --1134
NM_175736chr12106722 6713 6584 6227 2921 2468 1263 1130 979 24 37367 6318 164 57454 6903 5445 4895 194 --
NM_175767chr561719 1393 1195 1150 710 225 11877 11370 --
NM_175852chr142862 2683 344 128 --22619 1071 --
NM_175854chr1311110 ------
NM_175866chr151495 1231 541 441 173 --1533 --
NM_175907chr1852464 882 848 610 45 11096 --12883
NM_176814chr71189 --2577 204 --
NM_178011chr1022875 358 --12745 --
NM_178126chr1711461 ------
NM_178313chr272131 2046 1932 1787 795 291 188 --1357 --
NM_178314chr122186 133 ----1829
NM_178439chr2162 ------
NM_178568chr1741515 1267 331 278 --127 --
NM_178815chr1072630 2422 1958 1910 1001 550 85 --22790 360 32074 823 441
NM_181077chr1541764 892 528 374 --1217 --
NM_181354chr841403 1335 637 57 ------
NM_181358chr133844 3758 3137 ----23625 2721
NM_181504chr543060 2926 2809 1037 13724 11538 1806
NM_181670chr1211241 --1301 1441
NM_181704chr21123 ----1249
NM_181782chr632007 682 367 11773 1450 --
NM_181787chr823209 1315 2848 173 22702 1287 --
NM_182488chr132119 71 ------
NM_182501chr293317 2911 2901 2768 2761 2715 2414 2253 453 ------
NM_182503chr665442 4016 1788 554 458 161 ------
NM_182509chr1471681 1500 1442 1248 465 319 232 1490 1249 11309
NM_182509chr1471681 1500 1442 1248 465 319 232 1490 1249 11309
NM_182511chr1811270 --1154 --
NM_182765chr104381 372 257 39 12202 ----
NM_182767chr1252012 826 488 438 160 3836 585 74 41847 1788 1515 699 --
NM_182830chr1441682 573 153 40 ------
NM_194250chr21293 1384 ----
NM_194298chr1031594 1544 614 ------
NM_194314chr134507 1570 1441 24788 4083 ----
NM_194317chr252302 1901 1845 217 134 11834 12695 --
NM_194318chr1321580 949 ------
NM_198270chrX22230 761 --1898 --
NM_198273chr542223 759 496 249 22262 938 ----
NM_198279chrX31145 1118 974 21080 94 --1813
NM_198467chr71169 --1402 --
NM_198494chr11176 ----1220
NM_198935chr2073170 2857 2844 2400 1149 992 320 --22838 188 --
NM_198990chr733336 2698 2147 --11261 --
NM_199355chr1641446 1409 203 21 ------
NM_199420chr31317 ------
NM_199464chr13------193
NM_201521chr6----159 --
NM_201633chr5----1336 --
NM_203349chr1542016 1862 715 677 --22068 521 --
NM_203394chr122346 328 ------
NM_203406chr542933 2401 2071 80 12157 ----
NM_203434chr921134 813 --11012 --
NM_203459chr132531 1849 284 --1580 --
NM_206854chr684745 3968 3814 1695 787 677 594 474 14038 1669 1202
NM_206914chr121271 11367 1287 1585
NM_207306chr133487 3093 272 24615 3745 2355 319 --
NM_207322chr1562161 615 526 400 385 108 ------
NM_207325chr1982085 1920 1802 1655 1645 1290 601 466 --11392 11595
NM_207517chr151343 31594 1264 785 ----
NM_207645chr112162 40 --11093 --
NM_212464chr1541913 1907 1320 673 --21981 755 134
NM_212551chr11942 --1734 --
NM_212554chr101479 --175 --
NM_213589chr265523 1788 1459 1091 833 586 24909 1997 21551 728 25421 4751