TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-512-5p
miRNA Sequence: CACUCAGCCUUGAGGGCACUUUC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000084chrX56498 6471 5534 4437 4368 35056 1937 69 26242 6206 --
NM_000109chrX32507 1983 663 12520 1648 --
NM_000167chrX1376 --11716 --
NM_000176chr511069 --1186 1872
NM_000259chr1585119 4666 3989 1294 1224 1045 911 338 23912 448 --15315
NM_000368chr973357 1651 1362 895 395 351 97 23445 3243 ----
NM_000430chr1742981 2385 1187 846 --22321 2316 --
NM_000452chr1341999 1959 1896 1459 12077 ----
NM_000489chrX--22443 2090 1408 1221
NM_000495chrX--1347 ----
NM_000612chr1163244 2856 555 534 463 190 --12589 --
NM_000793chr1444244 3439 1471 1153 14984 15099 1186
NM_000794chr5----1363 --
NM_000813chr555148 5015 1243 394 250 12045 ----
NM_000814chr1564178 2864 2855 1583 617 43 33899 3167 2932 ----
NM_000826chr42641 188 ------
NM_000875chr1566752 6637 2288 2124 1705 381 16673 22005 1878 --
NM_000933chr2011247 1164 11214 --
NM_001001394chr2----1235 --
NM_001001481chr832491 2200 2143 ------
NM_001001664chr234121 3925 3730 ------
NM_001001870chr17----1756 --
NM_001002026chr332254 2234 2190 12458 22343 197 --
NM_001003398chr121265 ------
NM_001003652chr1868718 8439 2697 1836 1191 267 ------
NM_001003712chr1213788 23004 2479 --11068
NM_001003800chr963035 2999 2959 2528 981 378 23741 3485 23230 939 --
NM_001003810chr42828 173 ------
NM_001004065chr943044 2798 1156 673 --14006 --
NM_001004317chr644499 4443 1097 252 ------
NM_001004329chr12--2366 266 11159 --
NM_001004342chr1126066 5528 5313 5306 5225 5216 3912 2036 1900 1527 1263 491 11643 ----
NM_001004360chr221715 405 31985 1640 1632 ----
NM_001005366chr12----1789 --
NM_001005404chr1774018 3688 3411 3016 3003 1492 922 23726 1015 1653 --
NM_001005473chr565433 4689 2645 1349 717 96 15365 ----
NM_001005474chr311076 1284 --11481
NM_001007466chr654762 4397 4221 1036 848 ------
NM_001008493chr1--11280 ----
NM_001008541chr1032261 1607 285 1355 21994 1655 --
NM_001008738chr572693 2368 2329 2273 2154 1932 748 ------
NM_001009993chr2114168 3199 3108 2920 2755 1625 1562 1421 1325 1234 666 13800 11682 --
NM_001010888chrX64327 4052 3882 3456 678 543 ------
NM_001010891chr586188 4867 2766 2629 2590 2398 1162 432 --24971 1337 --
NM_001010924chr102415 374 ------
NM_001010984chr142454 963 603 301 ------
NM_001011666chr744870 2130 1460 924 21454 410 25926 443 --
NM_001012755chrX73924 3723 1680 1451 767 384 155 ------
NM_001013746chr732222 2186 196 ----21868 1848
NM_001013843chr152837 588 ------
NM_001015877chrX22602 701 12251 1181 12183
NM_001017395chr383596 2891 2863 2750 2662 2313 1262 1240 1984 23249 109 --
NM_001017923chr1421263 204 ------
NM_001024855chr31127 --11856 --
NM_001024948chr143494 2178 1081 919 1194 1132 --
NM_001024956chr1131799 1307 146 14058 15207 11137
NM_001030006chr1732511 2424 305 1822 ----
NM_001030007chr1641420 704 197 125 --1454 --
NM_001030288chr16215029 4848 4804 4540 4406 4367 4120 4004 3861 3841 3394 2213 2178 2000 1850 1767 1344 1213 1100 714 395 14030 41980 1032 878 641 --
NM_001031679chr1293082 2692 2393 1400 1081 989 855 596 382 ------
NM_001031695chr2274867 4696 4018 1312 1279 1101 492 --14206 --
NM_001031804chr1663957 1462 1184 1111 806 642 14096 ----
NM_001032280chr641465 1292 1044 442 ------
NM_001032380chr1011240 --11515 --
NM_001033045chr264070 3978 3238 1471 1238 530 23902 1686 167 --
NM_001033049chr2142231 2216 1736 305 2578 316 ----
NM_001034954chr1051261 970 721 554 201 21992 1081 175 --
NM_001037131chr221216 387 ----1825
NM_001039538chr253522 3354 2814 623 379 --12931 --
NM_001039577chr184149 4098 3953 1797 1614 1487 756 649 --13692 --
NM_001039585chr173060 3029 2900 1272 555 540 225 ------
NM_001040057chr711099 --11120 --
NM_001040100chr3----11264 --
NM_001040110chr751381 1333 1205 688 522 11438 ----
NM_001040284chr1644918 4419 1925 1404 --25492 1444 --
NM_001040429chr1333451 1307 857 --11066 --
NM_001040709chr152247 1675 767 681 658 ----11980
NM_001042355chr1664676 3708 1531 1520 1165 485 ----13359
NM_001042537chrX42422 2129 1948 775 ------
NM_001042555chr1224687 917 ------
NM_001044385chr273923 3456 2703 1018 975 797 700 22546 474 ----
NM_001046chr542738 2715 2255 1932 22986 1847 --1488
NM_001100108chr1217071 6506 6275 6230 6054 5667 5592 5548 5458 5094 2685 2468 2067 1974 1890 1663 821 446 313 138 106 16027 16582 11859
NM_001121chr1021537 1173 ------
NM_001146chr842123 526 269 172 1830 ----
NM_001167chrX166148 6059 5870 5735 5607 5432 5376 5313 4575 4475 4199 4155 2120 1944 1346 1077 11977 ----
NM_001241chr211554 --12008 11563
NM_001256chr1752932 1893 1178 1025 75 ------
NM_001259chr756296 6071 5994 5953 399 --1349 --
NM_001271chr1562621 2438 2231 723 418 169 1778 1839 --
NM_001364chr1184415 4382 4239 3584 3476 3206 1639 890 14119 --11744
NM_001390chr181606 --11224 --
NM_001396chr2121738 808 12231 22761 623 --
NM_001412chrX41237 1045 870 613 22672 2643 ----
NM_001451chr161337 ----1443
NM_001455chr674689 3797 1614 1076 745 414 188 13873 ----
NM_001483chr71863 ------
NM_001508chr2124 --1702 --
NM_001650chr1831132 967 409 --11003 --
NM_001668chr122204 302 12145 41650 1515 844 238 --
NM_001830chrX33891 2618 2475 --1387 --
NM_001855chr9----1353 --
NM_001901chr621021 934 ------
NM_001981chr112305 --1430 --
NM_002025chrX89237 8529 3008 2384 2252 1903 1775 1593 38127 6692 3602 48609 3508 3311 1571 --
NM_002128chr1332457 2015 641 ------
NM_002267chr1331874 1832 1562 1862 ----
NM_002268chr3--11325 ----
NM_002336chr1254246 3865 1807 603 61 21162 308 14361 --
NM_002373chr1541072 522 139 81 --167 --
NM_002397chr541565 644 210 191 --12119 --
NM_002398chr221503 1435 ------
NM_002430chr2242512 1779 1771 717 --22123 114 --
NM_002481chr197844 7119 6164 6082 5903 2303 2228 1852 1078 17906 27724 7524 --
NM_002499chr1572381 2293 1568 836 804 573 34 ------
NM_002515chr1431446 1324 1278 ----1377
NM_002522chr1762916 2850 2805 861 696 349 --13947 --
NM_002577chr353357 2617 2578 1479 450 12611 11327 --
NM_002581chr964853 4783 4032 2052 1673 1060 --11643 --
NM_002609chr52634 500 --11857 --
NM_002636chr6----1201 --
NM_002641chrX2178 148 1531 ----
NM_002731chr13120 70 52 2688 465 ----
NM_002807chr2----1178 --
NM_002829chr91425 ----11059
NM_002833chr1551555 1235 1132 458 62 --11275 --
NM_002857chr172478 1066 639 613 478 151 26 12394 ----
NM_002999chr2041669 1605 1300 607 11627 41844 1237 1213 1205 --
NM_003016chr172557 76 ----11622
NM_003034chr12136621 6487 6369 5972 5879 5019 2761 2586 2357 2063 1426 568 324 1524 ----
NM_003071chr3------1278
NM_003108chr266869 6113 5181 2024 1985 1950 --147 --
NM_003155chr8171 ----12621
NM_003161chr1712585 --1332 --
NM_003204chr1721806 1410 ----11243
NM_003222chr2021046 188 --1863 --
NM_003262chr364675 4539 3545 3220 1646 500 34101 1572 855 ----
NM_003304chr3----11575 --
NM_003337chr541591 1548 1516 1334 1623 ----
NM_003342chr1772883 2859 2491 2289 2016 1174 926 12117 ----
NM_003392chr344302 1662 1584 1099 --13541 --
NM_003453chr132478 104 ----1131
NM_003458chr393561 3106 2940 2718 714 589 504 208 175 ------
NM_003474chr1062012 1827 1522 902 617 261 ------
NM_003574chr1831941 539 245 12313 ----
NM_003597chr212112 11859 --1570
NM_003603chr421560 745 ----11794
NM_003750chr10--1302 1693 --
NM_003800chr621504 726 1653 11563 --
NM_003884chr311414 11644 ----
NM_003888chr1531600 440 91 ----1172
NM_003921chr121796 1486 ------
NM_004035chr17114841 4570 4435 3759 3640 3330 1976 1969 1894 1847 1455 23634 315 ----
NM_004050chr1482150 1846 1837 1010 820 501 249 35 ----22363 150
NM_004100chr611066 1819 --12518
NM_004115chr13----149 --
NM_004272chr541804 1386 572 493 21891 1418 1761 --
NM_004293chr943497 3477 2926 190 --13831 --
NM_004397chr1141440 1074 1015 872 13294 24266 3938 23917 773
NM_004430chr852227 927 864 664 647 ----12464
NM_004432chr921902 103 ----12365
NM_004454chr321439 175 1113 1681 --
NM_004501chr154046 3660 2735 1327 1310 --23349 2508 1505
NM_004506chr6------1740
NM_004508chr101735 ------
NM_004588chr11114018 3989 3823 2570 2531 1377 1296 1252 880 787 779 --12875 --
NM_004612chr954435 3136 3088 520 51 21456 748 11950 --
NM_004620chr11----1475 --
NM_004635chr341166 953 341 226 11021 31205 1096 464 --
NM_004655chr171479 ----1192
NM_004687chr172765 712 --1252 --
NM_004734chr1342508 1163 1121 439 12562 12041 --
NM_004742chr341825 1755 342 331 1683 ----
NM_004745chr822158 769 11995 24543 718 11766
NM_004774chr1763007 2979 2889 2045 484 401 --22781 142 --
NM_004798chr2043229 2292 947 695 ------
NM_004818chr123636 507 25 ------
NM_004824chr631095 576 40 ------
NM_004852chr181113595 10521 8907 4303 3115 2990 1879 1420 808 435 95 14869 111898 --
NM_004898chr452325 1847 939 806 118 ------
NM_004956chr723404 698 1305 ----
NM_004985chr1284209 4128 4087 3523 3481 1248 905 408 13012 ----
NM_005006chr21765 ----1401
NM_005105chr141846 1743 1682 129 ------
NM_005116chr2024320 1239 ----162
NM_005121chr1743755 3556 3252 2753 ------
NM_005171chr12----11068 --
NM_005264chr102755 105 ------
NM_005342chrX82466 2444 2421 1898 1043 991 459 378 ------
NM_005400chr232483 2474 2388 --1559 22568 2151
NM_005544chr21744 --2841 750 --
NM_005562chr151422 1293 1266 223 200 21048 372 11364 --
NM_005596chr945281 4127 2210 374 --25711 547 --
NM_005614chr73996 748 161 ------
NM_005618chr62597 114 1470 ----
NM_005668chr574055 3889 3515 3122 922 788 487 14487 185 --
NM_005721chr2----1956 --
NM_005737chr22754 689 ----1552
NM_005759chr243826 3372 572 210 --1167 14646
NM_005828chr17114500 4089 3519 3136 1961 1077 1035 1007 840 641 305 --24528 219 --
NM_005859chr531229 454 331 ------
NM_005871chr101981 --1986 --
NM_005899chr17--1323 1126 11162
NM_005909chr544070 3098 847 583 12867 11112 --
NM_005922chr6176 --1384 --
NM_005941chr8----11572 --
NM_006038chr2022184 850 --11626 --
NM_006134chr2141280 506 329 135 --1555 --
NM_006136chr731160 965 495 1876 ----
NM_006141chr162660 484 ------
NM_006142chr14342 188 161 145 --1456 --
NM_006166chr1252537 2288 2216 717 450 12331 21828 367 --
NM_006212chr1125206 5195 4129 3996 3590 3321 2075 1734 1060 860 304 234 13777 12024 15435
NM_006224chr1772401 2310 2215 2103 2013 807 455 11665 ----
NM_006241chr322087 1850 --1560 --
NM_006246chr142944 523 11240 ----
NM_006252chr176305 5521 5117 5042 4754 3023 1030 --25568 4864 14591
NM_006256chr1196 --1237 --
NM_006265chr8----1299 --
NM_006321chr311889 --12231 --
NM_006328chr112492 485 ------
NM_006329chr14--1617 ----
NM_006352chr11723 --1770 --
NM_006420chr2041371 1227 573 459 --33092 2528 443 --
NM_006421chr83208 110 65 ------
NM_006451chr5----1109 --
NM_006502chr62949 658 --1143 --
NM_006534chr20----2713 526 --
NM_006559chr12954 819 ----1312
NM_006572chr17--12761 1178 --
NM_006591chr1121883 1737 ----11524
NM_006599chr1676383 6277 2009 1878 1500 675 244 37774 2176 115 ----
NM_006601chr122257 79 ------
NM_006621chr13763 750 659 --1816 --
NM_006750chr16127810 7340 6053 5964 5916 5872 2985 2645 2433 2213 2078 698 28007 2072 ----
NM_006775chr631906 702 116 --12044 --
NM_006802chr131018 311 164 ------
NM_006803chr81641 --22112 561 --
NM_006852chr1752310 2270 749 482 266 --12615 --
NM_006885chr1653810 3793 3665 3030 778 ----23372 859
NM_006888chr1432736 921 519 --32523 2401 2279 12682
NM_006981chr9------1971
NM_007050chr20107058 6559 6354 5712 5494 1936 1828 1470 355 316 26870 970 12052 15378
NM_007084chr1321208 994 ------
NM_007085chr332127 1021 309 --157 --
NM_007249chr1377776 7425 3039 2729 2508 1659 23 26942 448 48886 6542 6303 1634 23433 1175
NM_007375chr132380 2187 219 --12645 --
NM_012104chr1133153 2598 987 ----12772
NM_012137chr1----12957 --
NM_012199chr184298 3545 3369 3363 3344 1590 1278 1033 --14102 --
NM_012281chr7----21827 593 --
NM_012294chr753245 3182 2521 1191 873 --23856 99 --
NM_012300chr531768 895 873 --21855 94 1127
NM_012316chr1135549 5115 4972 4928 4792 4748 4568 4108 4091 1766 914 670 551 15493 15558 --
NM_012421chr12443 78 --2448 162 --
NM_012471chrX41433 1348 625 407 1568 1502 --
NM_013238chr1321542 650 --11915 --
NM_013261chr433653 2382 805 12618 11326 --
NM_013433chr1951992 800 515 455 95 --31669 1537 607 12044
NM_013438chr9------21265 594
NM_014021chr12275 111 --23092 693 --
NM_014034chr621315 1276 ------
NM_014117chr1612376 ----1387
NM_014141chr795165 4828 4098 3953 3624 3355 3348 3326 1841 --1203 --
NM_014216chr1461571 1447 650 605 252 54 --31389 1262 1028 --
NM_014223chr1----1241 --
NM_014240chr383854 3720 3150 2944 2701 1633 1627 1396 --43811 2937 2914 698 --
NM_014243chr4------1580
NM_014319chr12------21249 179
NM_014548chr1521384 410 --11374 --
NM_014572chr1311150 11423 ----
NM_014586chr2184639 4101 3175 3039 1951 1773 1094 1087 14454 24808 841 --
NM_014635chr22600 437 --11370 --
NM_014636chr963764 3364 1672 1437 103 52 13472 11076 --
NM_014663chr161141 850 360 234 226 53 ------
NM_014682chr8----2512 449 --
NM_014746chr223243 174 32829 1520 511 ----
NM_014755chr272956 2950 2846 2605 1456 972 203 --11713 --
NM_014774chr132906 2327 319 --22950 847 --
NM_014810chr152788 2748 556 332 305 --128 --
NM_014819chr531890 494 199 ------
NM_014827chr131051 540 398 ------
NM_014876chr2241594 835 593 392 --1332 11690
NM_014877chr1767347 6983 6832 5603 5393 1412 22724 2693 1405 --
NM_014906chr1734036 3193 2632 ------
NM_014947chr142342 1178 1043 80 12352 ----
NM_014982chr1455306 4852 4218 1630 918 --15365 --
NM_014989chr631639 470 407 ----11906
NM_015045chr101367 11597 ----
NM_015055chr1162812 2707 2332 322 274 230 21086 676 ----
NM_015076chr654460 3002 2867 988 710 13730 11353 --
NM_015077chr17113769 3740 3566 3558 3292 1466 1348 1236 724 634 91 11869 13194 14403
NM_015092chr1653778 3150 3069 1695 1515 11831 14453 --
NM_015093chr611807 ----11833
NM_015111chr5113485 2618 1598 1334 1067 743 423 358 332 267 116 --11190 23450 161
NM_015172chr12554 285 --11509 --
NM_015199chr342223 2144 733 549 --1570 --
NM_015236chr4159 11375 ----
NM_015277chr1851345 1295 1211 714 179 --11819 --
NM_015310chr8177725 7398 7345 7297 7267 7206 7089 6804 6796 6609 5608 5598 2478 2116 717 568 511 --15620 --
NM_015313chr1164425 4022 3018 1181 1068 720 1411 ----
NM_015317chr252699 2143 872 861 212 --12057 --
NM_015338chr2011611 1197 1532 --
NM_015355chr17------11798
NM_015375chr184937 4297 1915 1128 872 738 255 122 ------
NM_015455chr5----12918 --
NM_015626chr172390 146 --11231 --
NM_015678chr1331551 398 37 ------
NM_015902chr83621 286 221 --1149 --
NM_015980chr541559 1496 1385 1292 ----11409
NM_015999chr14574 283 194 86 ------
NM_016018chr822435 943 2887 297 ----
NM_016120chrX2117 82 21126 474 ----
NM_016131chr21408 --21641 689 --
NM_016206chr347517 2697 2480 2085 --22665 484 --
NM_016235chr162461 305 ----11499
NM_016396chr1522426 536 1755 ----
NM_016422chr1153082 2914 2596 1125 1081 --23220 2312 1741
NM_016441chr232426 2232 1707 ------
NM_016531chr422588 1222 --11061 --
NM_016605chr552438 890 525 248 79 1850 1385 --
NM_016940chr212591 186 ------
NM_017423chr422204 1406 ----11823
NM_017637chr988879 7841 7737 5889 3306 3294 2403 1354 18554 28080 2792 --
NM_017658chr14--11321 11338 --
NM_017747chr5------1343
NM_017752chrX31986 1935 1481 1732 --11881
NM_017798chr2041137 1006 982 812 --1103 --
NM_017799chr1411333 ----11766
NM_017813chr855582 5120 3572 2300 2071 --1285 --
NM_017919chr9105616 5350 4667 4001 3863 1793 1524 1058 206 165 --15815 --
NM_018027chr102637 469 --12613 --
NM_018032chr164267 120 96 68 ----1944
NM_018064chr6----144 --
NM_018121chr1072906 2345 2219 1226 1209 620 491 ------
NM_018128chr1741365 1317 1200 462 --1535 --
NM_018176chr421261 488 --11103 --
NM_018244chr2041273 1247 195 182 --2449 146 --
NM_018448chr1211161 --11071 --
NM_018482chr812150 --22220 1798 --
NM_018566chr143873 514 282 57 31725 397 290 ----
NM_018638chr1255010 4924 1348 1095 32 --25701 348 --
NM_018657chr33801 662 94 1623 ----
NM_018704chr141504 1328 611 71 1168 ----
NM_018976chr1242768 1910 963 133 ----150
NM_019006chr151188 --1244 --
NM_019022chr1823091 1289 1683 ----
NM_019080chr13----1327 --
NM_019116chr1653312 3263 2430 743 572 13049 13526 --
NM_019556chrX21116 206 ------
NM_020133chr694720 3993 2395 1634 1320 581 464 320 105 35350 5112 5027 54593 4065 1884 363 91 --
NM_020199chr5--1453 1186 --
NM_020390chr353254 1543 1186 1049 941 --1136 --
NM_020432chr731750 1644 801 ----11957
NM_020463chr2----1592 --
NM_020673chr2096589 6230 5588 5167 5128 1975 625 103 66 25161 1476 --1295
NM_020715chr1441767 1437 583 448 ----12214
NM_020728chr752791 2385 2225 2049 1935 1674 ----
NM_020772chr1746625 6083 2373 1588 12401 28300 1987 --
NM_020774chr1813881 36173 3784 1320 14895 11648
NM_020783chr1832026 1893 608 --1633 12041
NM_020791chr1711346 --1110 --
NM_020796chr552289 2222 2167 829 437 22279 860 1131 --
NM_020809chr1142147 1959 1681 41 ------
NM_020824chr102544 511 ------
NM_020843chr15--128 ----
NM_020850chr1672564 2305 1239 1122 626 553 358 11047 22862 2427 --
NM_020866chr13----1775 --
NM_020871chrX22250 409 ------
NM_020888chr192024 1978 1659 1579 1417 1337 720 600 342 --21804 1555 --
NM_020899chr1742267 2069 1743 713 ------
NM_020935chr231628 1601 1241 23735 486 ----
NM_020975chr1031860 226 50 11946 ----
NM_021033chr1322485 2274 23187 163 1295 --
NM_021038chr31235 22270 2132 ----
NM_021090chr22104718 4079 3779 1566 1137 1104 878 677 548 482 14423 ----
NM_021116chr7129057 8698 6472 6380 2831 2802 2581 2317 2305 2142 1759 1694 38853 6952 1312 26116 2995 --
NM_021148chr721937 964 ----1638
NM_021163chr733486 3447 933 31241 776 599 ----
NM_021188chr14--1505 1427 --
NM_021190chr1----11315 --
NM_021191chr1222042 64 11943 12181 --
NM_021202chr2073009 2936 2599 2210 2004 937 738 11183 22908 2617 --
NM_021238chr1211834 --21773 209 1452
NM_021255chr1433910 1331 1177 22776 836 --13504
NM_021956chr61246 --11498 --
NM_021964chr376422 5688 5175 2238 2113 1443 1178 1413 ----
NM_022048chr1575448 4235 2540 1754 1385 958 433 15467 ----
NM_022085chr63346 309 80 1630 1351 --
NM_022719chr22123848 3005 2910 2895 1185 1134 1094 1063 1042 810 450 150 --11458 --
NM_022728chr7------178
NM_022756chr131254 1060 86 1138 ----
NM_022781chr923314 638 --13110 --
NM_022898chr1494657 3918 3335 1627 1492 1485 955 779 767 --34763 3310 3046 --
NM_022912chr241869 393 250 164 11971 1153 --
NM_024328chr143624 446 37 ------
NM_024574chr4187 ------
NM_024646chr173845 3268 3064 2988 2913 2714 1521 13764 12870 --
NM_024665chr311650 13481 ----
NM_024671chr163489 483 111 --1369 --
NM_024770chr2156651 5889 5396 5364 2677 2335 2170 2095 1688 1546 1033 899 872 707 689 26690 1540 ----
NM_025054chr833338 227 62 ----23482 1020
NM_025134chr1622495 711 --2597 81 --
NM_025146chr362307 2252 2083 1835 876 641 --1416 --
NM_025160chr123970 183 ------
NM_025208chr113924 713 343 --1134 --
NM_025222chr3102664 2657 2481 2433 2255 2196 907 804 460 331 12805 ----
NM_030648chr465494 5205 4952 4593 4188 1456 1925 ----
NM_030809chr1242253 1770 817 746 1152 --1299
NM_030918chr195225 4706 3714 2094 1954 1540 1039 673 485 21948 1463 ----
NM_030964chr583098 2977 2381 1341 1302 1130 796 763 1451 22762 1141 --
NM_031306chr14922 870 264 163 --1202 --
NM_031445chr273406 3175 3116 1139 922 749 707 --12778 --
NM_032102chr1132196 2153 650 --33078 2575 602 --
NM_032199chr1063751 2874 2743 2693 1286 319 13711 ----
NM_032208chr253568 3080 2322 1052 506 --1366 --
NM_032242chr3123035 2961 2409 2090 2074 2040 874 712 408 332 246 47 ------
NM_032283chr171689 1543 1504 1305 1285 558 367 ------
NM_032325chr1161750 1661 1526 1351 387 188 ----11738
NM_032440chr1042847 2585 245 37 12611 12414 --
NM_032457chr423261 1075 ------
NM_032458chrX32932 1031 137 12581 1511 12513
NM_032466chr821567 518 --11712 --
NM_032560chr14------1709
NM_032578chr103571 362 171 ----195
NM_032682chr312594 --21409 1312 --
NM_032875chr172535 262 133 ----
NM_032905chr1031312 248 58 ------
NM_033133chr1792796 2789 2770 2322 807 657 617 423 256 --32410 1308 357 11479
NM_033224chr7147625 7273 7016 6724 6328 6039 5255 5134 4961 2252 2195 1852 879 829 25331 404 ----
NM_033285chr863836 3391 3283 3069 1469 1017 ------
NM_033505chr286430 5542 5357 5193 5149 1576 649 218 35708 5576 1064 ----
NM_033549chr51967 1307 ----
NM_052877chr1----1484 --
NM_057175chr422263 229 12322 12635 --
NM_080671chr271785 1650 1611 903 867 387 265 21644 332 12195 --
NM_080738chr151768 1572 716 578 456 ------
NM_133264chr1742933 2624 1276 782 --13535 --
NM_133265chrX43518 754 736 417 1153 1936 12431
NM_133646chr275295 4789 4553 4015 3967 1661 782 14923 13924 --
NM_139072chr22731 344 1360 ----
NM_144578chr1434171 3798 1156 12046 11227 --
NM_144642chr321256 153 --1350 --
NM_144963chr811020 12620 ----
NM_144976chr194277 242 225 68 ------
NM_145117chr1152403 2084 1081 471 156 13131 32699 998 895 --
NM_145254chr16------1496
NM_152422chr931531 247 132 ------
NM_152493chr11554 --1252 --
NM_152545chr41613 ------
NM_152581chrX21466 414 --11375 --
NM_152594chr1541466 772 715 180 1861 ----
NM_152745chr71309 1431 11187 --
NM_152756chr524205 198 --13043 --
NM_152787chrX22655 1255 --1322 --
NM_152835chr111869 --11046 --
NM_152996chr111694 --1772 --
NM_153035chr193174 2989 2642 2400 886 831 596 423 77 --12229 --
NM_153040chr152517 88 --168 --
NM_153184chr32303 22 --21976 1753 --
NM_153260chr1541526 1098 1054 222 --167 --
NM_153687chr1231086 1011 67 ------
NM_153689chr252304 396 252 202 55 1345 11902 --
NM_172071chr177182 6640 4964 2325 1467 1045 531 34630 2319 1604 --11408
NM_173353chr122608 499 ----1535
NM_173354chr2171355 880 695 597 325 311 168 1185 ----
NM_173475chr16----1721 --
NM_174890chr10----1799 --
NM_174916chr1532026 1637 85 --1721 --
NM_175624chr12127171 7030 6763 6655 6547 5183 3033 3001 2957 733 497 46 --36416 5411 74 --
NM_177401chr1931667 700 694 ------
NM_178554chr333569 1075 96 --1430 13594
NM_181358chr133649 3272 2705 ------
NM_181504chr533669 3528 2646 --23098 1183 --
NM_181713chr24765 626 578 377 ------
NM_182691chr721118 556 ----1365
NM_182830chr1411866 1224 ----
NM_194247chr253375 3184 1405 1313 1069 11507 1807 12744
NM_194314chr143796 3547 1691 1159 ------
NM_198270chrX32752 1322 637 ----1153
NM_198467chr7----1510 --
NM_198581chr286785 5732 5596 5557 5404 4970 2461 2084 25590 5261 --12895
NM_198686chr1411762 1259 1145 11770
NM_198859chr353559 3521 1357 1349 853 1531 25018 275 --
NM_198935chr2012579 11087 --1151
NM_203341chr12747 52 ------
NM_203364chr11----1961 --
NM_203394chr1222349 2274 1376 ----
NM_206855chr646142 4410 1603 269 25263 4148 ----
NM_207015chr321533 475 ------
NM_207321chr1021054 279 ----1223
NM_207356chr12590 517 128 ----
NM_207372chr1012215 --12280 --
NM_207406chr4105186 4849 4449 4178 2518 2488 2377 2125 989 346 --32561 2462 1135 --
NM_212551chr1----1233 --