TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-513c-3p
miRNA Sequence: UAAAUUUCACCUUUCUGAGAAGA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000051chr11143515 3496 3088 3005 2876 2707 2496 2463 2456 2255 826 617 599 43 53556 3346 2639 2630 967 11197 --
NM_000052chrX163245 3071 2950 2797 2776 1362 1307 1105 982 920 798 706 365 357 279 202 1642 12662 --
NM_000081chr181889 1655 1514 712 642 279 238 51 2412 356 --11267
NM_000084chrX216976 6449 6270 5701 5682 5439 5288 4969 4889 4789 4776 2327 2229 1913 1384 792 653 342 283 189 167 35966 4800 645 36462 2680 1701 --
NM_000092chr284398 3768 3485 1609 1467 1453 1218 790 21445 1349 63524 3510 1529 1424 542 458 --
NM_000104chr2122707 2478 2198 2142 2045 1240 1160 1097 782 708 531 440 --32579 206 24 --
NM_000112chr5124742 4626 4305 4193 4151 3840 1941 1654 1623 1561 359 45 54672 4647 3595 3535 1120 74756 4370 4353 1082 670 100 84 25540 4695
NM_000115chr1382685 2299 2034 1969 1938 441 324 205 32545 2289 711 --1348
NM_000138chr1561988 1969 1656 431 360 115 21063 445 1728 12346
NM_000176chr563842 2436 2383 1320 490 252 22765 464 43247 2815 1438 379 1229
NM_000202chrX83835 3823 3167 3069 2988 1384 1373 640 1195 1699 23151 379
NM_000216chrX103347 3307 3280 2982 2659 2566 688 322 257 26 43646 3542 2828 550 33420 917 758 11174
NM_000217chr12104753 4363 3606 1713 1227 1176 911 853 405 399 14626 34460 3960 1990 --
NM_000232chr4113090 3009 2997 2963 2849 2097 854 803 771 622 446 21962 1127 ----
NM_000252chrX31470 1349 1038 2270 264 31480 1367 1103 1585
NM_000259chr15176316 6055 6030 5979 5759 5694 5395 5283 5168 5055 4526 2059 1606 1593 1551 1259 688 11736 --15863
NM_000267chr1753178 3069 2719 2494 1083 32347 446 176 21294 604 12504
NM_000314chr1073067 2619 2458 1214 1111 628 437 22837 1144 42857 1260 1098 338 12063
NM_000332chr6187125 7085 7037 6830 6090 5312 5098 4784 2714 2312 2032 1826 1768 1639 1304 1086 1080 574 37172 4801 4343 45289 5051 4966 2051 11914
NM_000337chr5165646 4968 4630 4080 2629 2611 2603 2380 2366 2335 2277 1757 900 667 657 583 12424 76106 5122 4555 4398 2569 1798 1731 14943
NM_000390chrX123417 3289 3116 2806 2783 2762 2617 1372 1053 932 405 38 ----13249
NM_000393chr291972 1817 1578 682 617 444 355 194 79 41880 726 703 664 ----
NM_000397chrX72505 2231 1702 1607 1597 720 249 2794 743 22436 511 --
NM_000408chr243306 2838 961 443 31248 865 617 22368 510 13296
NM_000411chr2163084 1324 1129 978 245 78 53347 894 729 723 212 --1683
NM_000439chr592400 2380 2341 1902 1777 1750 747 444 177 --42281 1866 1650 955 --
NM_000448chr1182935 2735 2701 2520 2417 2087 518 363 31110 849 720 12283 32685 1305 834
NM_000461chr3174544 4434 4222 3951 3749 2805 1844 1733 1650 1580 1013 933 892 709 477 409 151 24417 3556 13765 11521
NM_000462chr1561848 1506 641 204 90 65 21189 57 ----
NM_000489chrX83458 3397 2515 925 789 756 302 289 42842 1298 370 352 22778 1232 --
NM_000544chr6_cox_hap183192 2856 2703 2548 2228 1071 473 442 1316 1126 13315
NM_000555chrX137898 7510 6658 6399 6156 4755 3036 2265 1917 1524 1097 894 104 56768 6504 2494 1470 1052 17720 --
NM_000610chr1182675 2663 2164 1158 1030 232 203 126 --31937 505 392 12324
NM_000618chr12156448 5210 4444 4387 4353 2169 1958 1860 1707 1460 1425 1359 741 524 102 54776 4344 4146 4044 842 32023 1687 1162 --
NM_000618chr12156448 5210 4444 4387 4353 2169 1958 1860 1707 1460 1425 1359 741 524 102 54776 4344 4146 4044 842 32023 1687 1162 --
NM_000633chr18135025 4917 4839 4819 4397 4262 4061 4036 3828 3810 3313 3278 1472 1256 54183 4082 1907 1658 662 --
NM_000809chr4239245 9180 8844 8669 8086 7975 7663 7028 6822 6201 6138 5886 5714 3026 2763 2537 1986 1524 1465 1221 1119 1095 372 79298 9192 9096 8930 7392 3497 645 47549 7122 624 465 17207
NM_000813chr5154933 4885 4514 4478 3975 3691 2197 2100 1954 1708 1691 1273 1239 873 690 15554 14953 --
NM_000814chr1593799 3723 3306 2869 1614 1580 1131 1047 69 24222 4105 12970 --
NM_000868chrX62167 1608 916 764 574 54 22636 2428 21042 892 1172
NM_000875chr1556894 6773 6361 4867 1055 46929 4555 2513 2340 1495 1534
NM_000877chr283097 3019 2759 1962 959 896 833 813 22402 2055 11941 12561
NM_000885chr282186 1922 1864 1406 1339 651 481 89 --11502 42087 2006 1720 58
NM_000899chr12114414 3717 3685 3314 2933 1568 1249 1239 744 432 166 24366 3915 --14259
NM_000902chr3123176 3021 3011 2984 2417 2340 1997 1267 1120 874 651 61 22572 916 23191 815 1724
NM_000926chr11289310 8841 8779 7705 7489 7289 7199 7035 7027 6829 6489 6273 5886 5861 3594 3335 3072 2319 1747 1541 1425 1320 1051 637 500 481 450 32 59442 7890 6423 227 133 36065 5913 1039 18366
NM_000959chr1103692 3379 3155 2946 2814 1258 1220 1162 1033 717 11443 23864 153 --
NM_000963chr182213 1935 1923 851 346 267 198 179 2951 783 42414 670 550 411 --
NM_001001323chr1283060 3045 1974 1105 1026 884 205 41 53175 2498 2011 1141 426 12682 --
NM_001001389chr1182675 2663 2164 1158 1030 232 203 126 --31937 505 392 12324
NM_001001390chr1182675 2663 2164 1158 1030 232 203 126 --31937 505 392 12324
NM_001001391chr1182675 2663 2164 1158 1030 232 203 126 --31937 505 392 12324
NM_001001392chr1182721 2709 2210 1204 1076 278 249 172 --31983 551 438 12370
NM_001001419chr5145105 4922 4785 4656 4639 4224 3757 3582 3551 1839 991 684 514 382 2598 311 1247 13160
NM_001001420chr5145105 4922 4785 4656 4639 4224 3757 3582 3551 1839 991 684 514 382 2598 311 1247 13160
NM_001001481chr8103463 2938 2903 2131 1061 1047 1008 863 646 381 32442 2409 1179 13162 --
NM_001001484chr1092470 2289 2098 1600 1579 1511 667 483 477 1331 ----
NM_001001556chr1571513 1500 1340 578 544 274 47 21561 1551 1591 1259
NM_001001664chr2183984 3946 3884 3838 3823 3704 3324 3016 1589 1341 1268 903 695 594 454 389 347 31 53338 1501 808 663 422 1946 --
NM_001001668chr19113898 3744 3456 3252 2973 2784 1305 1258 1075 691 373 44003 3853 3732 441 ----
NM_001001928chr22128375 7664 6645 6287 5996 5926 2931 1748 1651 1506 1422 572 47414 3135 2064 1912 15432 --
NM_001001974chr1092177 1807 1667 1619 1543 931 848 762 518 2813 491 21853 732 --
NM_001002860chr1483668 3612 3107 3035 1343 1171 809 487 12849 34413 650 290 12888
NM_001003652chr18268141 7984 7562 7530 7106 7090 6551 6392 6304 6148 5922 5906 5636 5443 3277 2877 2649 2247 1717 1559 1325 1288 886 524 501 228 --48238 6275 6071 1419 27945 7758
NM_001003674chr18147030 6901 6537 6254 6150 5878 5677 5107 4760 2232 1008 632 530 158 35997 4562 4334 36083 5148 2007 --
NM_001003675chr18147030 6901 6537 6254 6150 5878 5677 5107 4760 2232 1008 632 530 158 35997 4562 4334 36083 5148 2007 --
NM_001003688chr451090 1006 904 759 334 1947 21204 786 2378 142
NM_001003712chr12124078 4021 3684 3531 3383 3295 3075 1337 1192 627 447 432 73628 3342 3285 3121 2471 647 618 13752 11098
NM_001003760chr6173569 3555 2876 2693 2521 2370 2318 2303 1451 1290 1062 832 639 472 450 430 269 53442 3255 765 500 398 33497 1054 338 1982
NM_001004317chr683970 3946 3758 3412 1753 1472 576 128 23403 419 --23821 3438
NM_001004330chr1271738 1503 1473 713 185 129 67 --61486 1174 201 136 121 104 11284
NM_001004419chr12124625 4454 4230 4098 4088 3859 3309 3256 3105 1830 1461 1369 1152 24578 1852 23446 323
NM_001005375chrY101732 1652 1553 1480 564 417 175 167 149 120 1342 167 1547
NM_001005473chr5256580 6466 6315 6204 6118 5901 5669 5349 4870 4631 4625 4365 4235 2533 2413 1898 1605 1596 1405 1393 1374 1243 1181 1162 1150 36622 5340 2504 26426 6278 25262 1297
NM_001006600chr5122485 2466 2458 2442 2386 2318 2190 2077 1874 1831 121 65 140 42136 1571 786 464 --
NM_001007024chr17104299 4261 3873 3469 3420 2916 2735 1428 753 79 13183 33834 3037 2895 --
NM_001007025chr17104299 4261 3873 3469 3420 2916 2735 1428 753 79 13183 33834 3037 2895 --
NM_001007097chr9125114 5029 4847 4557 4467 4440 4305 2025 1825 1539 1033 862 33918 1481 803 24777 4528 14118
NM_001007278chr13154536 4483 4455 4330 3414 3254 3219 2015 1835 1814 815 806 744 70 39 34980 1710 888 14044 1171
NM_001007466chr6115214 5180 4745 4626 4279 4055 3628 3529 3490 1685 1313 33398 3344 1743 23333 1871 --
NM_001008239chr18123794 3680 3404 3120 2811 2690 1145 1096 380 243 206 69 11468 32659 2449 1169 --
NM_001008539chr8125408 5335 5195 4385 4196 3999 3773 3529 3467 1976 1532 601 25272 3882 34413 3449 199 --
NM_001008564chr1332000 873 108 12264 42170 1891 1650 134 2185 100
NM_001008738chr5102826 2788 2735 2212 1082 751 221 205 80 24 --21991 276 --
NM_001008925chr4123269 3021 2959 2282 1250 740 728 676 639 410 164 122 33548 3454 3304 1796 --
NM_001009894chr1281633 1334 1312 1135 607 533 157 129 31725 1233 485 --11064
NM_001009899chr3156448 4971 4918 4355 4064 2244 2109 1817 1687 1270 1111 613 558 280 38 45517 5132 4092 236 36456 5665 5632 33992 1657 1005
NM_001010846chr173644 3169 1720 1238 1222 1078 1065 33181 1784 1705 11095 --
NM_001010853chr6103191 3036 2881 2867 2804 2438 2318 2255 1084 176 12371 1388 12746
NM_001010861chr172570 2541 1977 1950 1859 521 73 22806 2219 --21906 95
NM_001010862chrX113293 2920 2734 2347 2091 2075 1228 1007 1000 971 682 ----12129
NM_001010891chr5156428 5383 5351 4942 4825 4345 2102 2003 1912 1895 1888 1443 915 840 286 56886 1992 1944 1922 1779 56581 4419 4356 2184 457 35909 4607 4305
NM_001010984chr1132444 2390 2350 2312 2004 1845 1826 1674 798 703 689 554 518 32604 2476 500 ----
NM_001011513chr4123916 3131 2971 2710 2616 2600 1480 1352 976 876 481 399 33152 1078 299 132 --
NM_001011663chr1071056 995 783 772 250 242 69 11076 1226 1793
NM_001011666chr7106549 6515 5039 4598 4054 4027 4006 2572 2392 976 26220 1135 --15327
NM_001012393chr11145113 4558 4391 4213 4031 3823 3182 3168 1285 750 681 571 346 118 34968 4854 4688 45208 4773 650 643 --
NM_001012751chr1051930 1780 1637 1385 633 2470 386 21681 650 11189
NM_001012755chrX94742 4664 3555 3428 3311 1317 431 292 134 33816 3614 666 22003 1950 --
NM_001012968chrX142612 2456 2443 2182 1901 1862 1851 1804 1110 1016 1007 119 100 25 ------
NM_001013620chr12248455 7280 7236 7217 7057 6968 6863 6670 6430 5865 5746 5719 5670 5584 5256 3399 3361 2958 2572 2352 2163 1263 1141 162 68068 7398 5731 5396 3338 305 25643 89 --
NM_001013659chr19175367 5209 5159 5133 4825 4726 4182 3754 3397 3347 2078 1702 1565 1505 1242 964 386 14096 135 1352
NM_001014380chr13175290 5217 4771 4690 4647 4487 4027 3965 3767 3564 1380 1247 1166 754 537 80 55 75893 4882 4606 3904 500 478 311 65014 5000 4978 1794 1504 87 --
NM_001014797chr10128100 6827 5827 5713 5364 5283 3223 3206 2236 1388 1199 115 18249 66923 3272 2431 1640 1177 1087 --
NM_001017368chr17102843 2757 2704 2462 1987 1023 954 620 563 433 1978 22581 730 --
NM_001017424chr181932 1812 1360 1264 1258 437 160 154 31879 1738 1732 1465 --
NM_001017425chr181932 1812 1360 1264 1258 437 160 154 31879 1738 1732 1465 --
NM_001018065chr9115971 5376 5125 4484 4381 4129 4084 1879 1277 839 162 24077 383 26020 5097 --
NM_001018066chr9115971 5376 5125 4484 4381 4129 4084 1879 1277 839 162 24077 383 26020 5097 --
NM_001018067chr1185380 5324 5214 4615 4598 4298 3528 3244 2056 1754 1409 1345 1184 496 387 252 139 89 54668 4250 3637 2142 1585 33460 1398 1097 --
NM_001018068chr1185380 5324 5214 4615 4598 4298 3528 3244 2056 1754 1409 1345 1184 496 387 252 139 89 54668 4250 3637 2142 1585 33460 1398 1097 --
NM_001018069chr1185380 5324 5214 4615 4598 4298 3528 3244 2056 1754 1409 1345 1184 496 387 252 139 89 54668 4250 3637 2142 1585 33460 1398 1097 --
NM_001018074chr563842 2436 2383 1320 490 252 22765 464 43247 2815 1438 379 1229
NM_001018075chr563842 2436 2383 1320 490 252 22765 464 43247 2815 1438 379 1229
NM_001018076chr563842 2436 2383 1320 490 252 22765 464 43247 2815 1438 379 1229
NM_001018077chr563842 2436 2383 1320 490 252 22765 464 43247 2815 1438 379 1229
NM_001018090chr1592601 2313 2144 2030 1911 1774 1747 1045 222 22400 182 12331 12274
NM_001018091chr1592711 2423 2254 2140 2021 1884 1857 1155 332 22510 292 12441 12384
NM_001018102chr1592601 2313 2144 2030 1911 1774 1747 1045 222 22400 182 12331 12274
NM_001024094chr563842 2436 2383 1320 490 252 22765 464 43247 2815 1438 379 1229
NM_001024380chr8102365 2151 1951 1558 809 798 516 483 223 173 1500 22024 161 --
NM_001024381chr8102365 2151 1951 1558 809 798 516 483 223 173 1500 22024 161 --
NM_001024647chr12167583 5518 5455 4735 2846 2629 2428 1905 1724 1612 1508 1099 842 614 520 486 15736 26035 5961 --
NM_001024948chr1103377 2807 1152 997 883 645 443 368 307 288 53204 2998 2522 2348 589 32572 2411 437 --
NM_001024956chr11135673 5579 5453 5028 4871 4854 4669 3972 1594 1503 1303 1171 876 23687 1006 21880 801 35358 4978 667
NM_001025068chr341685 534 77 22 3426 420 34 21166 285 --
NM_001025069chr341685 534 77 22 3426 420 34 21166 285 --
NM_001025076chr10125058 4654 3816 1423 1267 1230 965 924 891 723 547 110 24170 852 1202 1281
NM_001025077chr10226416 6012 5174 5044 5018 4903 4837 2781 2625 2588 2323 2282 2249 2081 1905 1468 1310 1036 988 901 875 837 65528 5093 2210 776 696 354 34856 4746 1560 11639
NM_001025108chr244140 3987 3374 976 33199 1374 1295 23461 833 34148 750 595
NM_001025233chr1292083 1963 1933 1755 891 805 277 99 82 ----11835
NM_001025266chr3104814 4532 4296 4253 3388 3372 3040 1948 1533 947 24160 3349 33381 1435 278 --
NM_001029858chr6143205 3072 3049 2926 2879 2813 2519 2418 2407 2359 991 909 887 260 --22784 502 --
NM_001029863chr6122956 2889 2754 2557 1108 858 753 528 384 373 361 92 --22329 680 --
NM_001030055chr14204500 4363 4224 4136 4119 3795 3754 3585 3426 3384 3355 3347 3324 1664 1304 1278 1098 735 330 317 74483 4456 3806 3656 3280 2958 1851 1925 --
NM_001031695chr2295288 4528 3778 3639 2061 1373 946 681 197 11075 31211 1146 559 1904
NM_001031700chr472550 1875 901 831 771 748 295 22018 1759 1272 1646
NM_001031732chr463404 3296 2494 2374 1251 108 23489 83 32241 1290 866 13092
NM_001031804chr1663743 1582 1551 657 624 289 34129 2810 1362 34326 2782 1157 --
NM_001032288chr2041291 651 633 79 --11110 21555 141
NM_001032394chr6112560 2264 2093 2062 1896 987 785 286 278 177 130 22401 866 32522 2231 1017 12382
NM_001032395chr6102427 2131 1960 1929 1763 854 652 153 145 44 22268 733 32389 2098 884 12249
NM_001033057chr352120 484 269 234 68 31618 1606 393 2618 451 1380
NM_001033059chr691985 1906 1806 1672 1485 1283 542 440 243 12075 11686 1792
NM_001033087chr20113300 2480 2250 2153 2062 989 979 902 610 429 197 --12001 --
NM_001033557chr281426 1263 1034 959 928 328 233 158 11130 21020 247 --
NM_001033659chr1771590 1565 1487 1409 354 37 26 ----11613
NM_001033925chr1082004 1827 1809 1492 1481 269 184 138 --21680 577 1775
NM_001034954chr1093172 2872 2849 2787 2436 2383 2012 851 23 12910 32820 2483 2285 --
NM_001034955chr1093172 2872 2849 2787 2436 2383 2012 851 23 12910 32820 2483 2285 --
NM_001034956chr1093172 2872 2849 2787 2436 2383 2012 851 23 12910 32820 2483 2285 --
NM_001034957chr1093172 2872 2849 2787 2436 2383 2012 851 23 12910 32820 2483 2285 --
NM_001037165chr7128845 8564 8099 7744 7676 7402 6920 6213 2008 599 573 231 18839 48917 6586 5630 2730 17775
NM_001037317chr172570 2541 1977 1950 1859 521 73 22806 2219 --21906 95
NM_001039199chr20114894 4640 3967 3286 3181 2000 1728 1561 1236 936 677 34964 3084 69 43904 3145 1923 658 --
NM_001039538chr2123655 2832 2403 2299 2256 2235 1217 974 962 715 474 176 --13302 --
NM_001039547chr3238040 7980 7891 7846 7137 7029 6764 6594 6209 6162 5997 5711 5167 5054 2971 2929 2402 2268 1983 1512 1450 1394 105 17169 1479 35299 2962 1384
NM_001039585chr1113949 3636 3412 3203 3071 2571 1515 1477 1419 1290 974 11700 24121 410 --
NM_001039590chrX103920 3779 3479 2841 2597 2555 1455 1428 930 584 54021 3910 3846 3258 910 33941 899 152 33826 2762 2455
NM_001039591chrX103920 3779 3479 2841 2597 2555 1455 1428 930 584 54021 3910 3846 3258 910 33941 899 152 33826 2762 2455
NM_001039618chr11245666 5343 5328 5034 4995 4806 4800 4747 4658 4566 4232 3602 2365 2328 2314 2259 1284 1013 970 873 866 680 651 640 55201 4601 3985 2081 1026 14763 11956
NM_001039840chrX216050 5676 5325 5042 4989 4821 4736 4686 4651 4428 4370 4189 4090 3861 2031 1326 797 746 653 158 63 36073 1897 1564 33751 1006 670 --
NM_001040057chr781327 1276 1183 947 380 320 114 98 11227 155 --
NM_001040142chr282371 2276 2038 1606 643 510 307 301 2700 413 ----
NM_001040143chr282371 2276 2038 1606 643 510 307 301 2700 413 ----
NM_001040152chr7154968 4957 4781 4326 4314 3936 3857 3793 3578 3247 1999 1510 1230 801 185 115146 4605 4160 4128 4048 3834 3761 3464 1432 1189 872 33920 3783 703 --
NM_001040159chr451003 576 388 272 249 21451 1189 --1374
NM_001040284chr16185823 5045 4982 4080 4067 4024 3919 2380 1909 1879 1844 1750 1583 1383 1325 739 597 526 43908 3667 2294 274 35876 2329 2126 15710
NM_001040402chr472951 2663 2089 934 312 272 227 1855 12121 12833
NM_001040441chr184834 4381 4006 3683 2087 1385 1202 993 54174 3900 1613 1502 95 44356 4276 1427 599 --
NM_001040446chr592751 2592 2533 2455 2388 557 399 222 41 12712 22443 1797 --
NM_001040450chr1571893 1798 979 904 726 633 281 22655 2066 32195 736 417 12515
NM_001040453chr1571893 1798 979 904 726 633 281 22655 2066 32195 736 417 12515
NM_001040665chr7194256 4118 4040 3968 3750 3603 3433 3360 1905 1737 1593 1473 826 667 605 539 401 347 192 13819 24314 123 23582 3169
NM_001040876chr461727 1542 1189 287 266 56 11413 --1770
NM_001042355chr16105345 4214 4098 4092 2156 2008 1936 938 852 243 14194 15065 1323
NM_001042412chr16105345 4214 4098 4092 2156 2008 1936 938 852 243 14194 15065 1323
NM_001042413chr942746 2586 2499 1046 24123 2620 34107 3324 1268 23416 252
NM_001042492chr1753178 3069 2719 2494 1083 32347 446 176 21294 604 12504
NM_001042494chr15103870 3662 3007 2863 2640 1312 1057 1050 713 319 33089 612 444 23379 1163 --
NM_001042495chr15103870 3662 3007 2863 2640 1312 1057 1050 713 319 33089 612 444 23379 1163 --
NM_001042496chr15103870 3662 3007 2863 2640 1312 1057 1050 713 319 33089 612 444 23379 1163 --
NM_001042497chr15103870 3662 3007 2863 2640 1312 1057 1050 713 319 33089 612 444 23379 1163 --
NM_001042510chr8101752 1702 1638 1612 1581 1527 854 839 342 238 11417 ----
NM_001042511chr8101752 1702 1638 1612 1581 1527 854 839 342 238 11417 ----
NM_001042533chr3103298 3187 3173 2521 1188 577 479 388 362 91 2718 236 22687 1049 12486
NM_001042537chrX61586 999 763 229 188 35 1866 31576 941 59 1879
NM_001042543chr491199 1067 992 617 548 481 392 346 184 31363 634 596 11186 1421
NM_001042555chr12174339 4047 3927 3853 3418 3394 2939 1834 1641 1589 1394 1102 937 774 639 152 111 24505 1431 21583 40 --
NM_001042599chr2147875 7373 6414 5969 5886 5658 5013 3073 3027 2454 2439 1774 518 465 21877 753 65777 5177 3149 1900 1385 1321 12057
NM_001042601chr3143263 3097 2995 2902 2891 2862 2714 2343 2319 919 570 541 194 84 32684 2672 2359 32797 2375 2233 11199
NM_001042603chr12104646 4014 3905 3778 3562 2136 2092 2074 1955 1100 24342 3822 25316 5067 24721 1880
NM_001042604chr3154786 4773 4287 3908 3788 3644 3557 3117 3030 1777 1498 1123 929 688 614 11136 44592 1891 425 121 --
NM_001044385chr2154066 4058 4038 4031 3362 3213 3120 3079 2859 2840 1228 1135 820 577 101 1369 2671 442 --
NM_001046chr592623 2518 2314 2126 1216 887 846 354 344 22878 1123 2952 236 1903
NM_001071775chr13111695 1506 1451 1359 1352 1246 1213 778 498 113 86 --11604 --
NM_001099678chr3196190 6179 6156 5142 4615 4389 4325 4133 4108 3884 2502 2450 1730 1306 1297 949 359 257 75 36423 5394 4714 34517 4238 1755 --
NM_001100108chr1217237 7197 7186 7018 6805 6390 5981 5727 5485 5405 3265 3167 3153 3138 3003 2595 1893 1877 1645 660 419 47948 7299 3248 3092 37533 6525 465 15956
NM_001106chr3249771 9628 9622 9249 9027 8883 8793 8636 8534 8407 8355 8240 7918 7794 6374 6022 5982 5961 1592 1468 1402 1331 811 744 58704 7889 7096 3153 2590 26282 2709 11564
NM_001121chr1071640 732 561 518 343 321 202 21337 1290 1542 --
NM_001160chr12112829 2589 2396 2313 1894 1044 838 478 333 323 38 12821 12205 --
NM_001167chrX216532 6389 5700 5023 4657 4429 2662 2351 2322 2288 1986 1718 1528 1376 1349 897 862 732 467 386 165 54569 2587 2316 2166 1842 26481 6369 22556 1621
NM_001173chr14204500 4363 4224 4136 4119 3795 3754 3585 3426 3384 3355 3347 3324 1664 1304 1278 1098 735 330 317 74483 4456 3806 3656 3280 2958 1851 1925 --
NM_001186chr2162538 2373 2339 2156 1147 435 32239 688 600 32435 131 46 1392
NM_001201chr473927 3492 3229 3177 2497 962 212 52557 2535 1584 898 539 ----
NM_001204chr2227139 6900 6835 6478 6271 6172 5656 5235 5192 4736 4706 2926 2646 2510 1794 1710 1564 643 204 190 144 28 46564 5960 2709 164 37723 5579 990 15919
NM_001206chr993096 2670 2039 2014 1987 1038 1013 565 380 42932 2755 2512 699 ----
NM_001233chr7122408 2396 2304 2259 2153 1982 1766 1691 951 476 192 26 21659 246 22271 374 --
NM_001237chr42912 107 31014 893 283 11185 21001 317
NM_001237chr42912 107 31014 893 283 11185 21001 317
NM_001256chr1792919 2742 2622 2474 2304 2281 1062 657 382 --11126 22291 1974
NM_001259chr7116332 5514 5322 4933 4263 3995 2418 911 869 638 455 55792 4088 2260 1721 748 65760 5100 2398 1055 982 661 15879
NM_001304chr1783748 3532 3230 3084 1297 148 131 117 12835 33724 3408 2412 --
NM_001351chr3111856 1705 1544 1527 1454 1386 466 347 87 79 32 1246 --1449
NM_001356chrX82299 2063 1928 1760 1655 1594 902 573 41856 1705 824 397 1130 --
NM_001390chr18113460 2992 2962 2951 2725 2402 1460 1393 1350 595 238 22687 785 2503 480 --
NM_001412chrX113483 2856 2444 2359 1505 1169 904 658 634 586 85 12687 1424 --
NM_001415chrX91881 1831 1652 670 422 240 95 48 42 11742 --11897
NM_001419chr19124870 4672 4545 4482 3931 3446 3086 1658 1213 1192 481 206 --1983 --
NM_001432chr4133892 3662 3593 3442 3253 3096 2905 2866 1267 923 841 496 347 22586 271 11022 --
NM_001438chr173007 2685 2570 1241 1013 731 397 23372 3233 23038 1050 22545 1100
NM_001460chr1123603 3358 3327 3218 2538 2451 2328 1034 1021 374 330 298 32524 1116 713 22962 387 11273
NM_001527chr6104783 4413 3746 3732 1327 1101 671 524 193 159 --13802 --
NM_001609chr1064143 3934 3127 1662 1154 47 33490 3163 785 33896 1690 598 --
NM_001616chr292441 2221 2171 1254 951 873 641 409 327 1933 12757 22949 2924
NM_001634chr691985 1906 1806 1672 1485 1283 542 440 243 12075 11686 1792
NM_001650chr18123562 3426 3328 3112 3080 2836 1650 708 581 297 80 53 44040 3746 2939 907 1656 --
NM_001656chr581924 1907 1377 269 187 169 145 71 2802 730 128 --
NM_001663chr14132780 2723 2638 2584 2563 2456 2436 2293 2037 1956 904 697 107 12621 12406 --
NM_001695chr8124245 3323 3048 2707 2694 2648 1627 1547 759 707 689 478 11055 23294 1596 24284 1232
NM_001742chr781498 1285 1272 1227 553 450 292 128 11141 --1622
NM_001762chr76826 780 678 322 163 155 --4672 148 104 70 --
NM_001806chr19102702 2637 2590 2448 2335 2000 978 796 705 566 32647 2275 2175 12923 12020
NM_001821chr1164760 4673 4603 4374 4184 3970 3858 3314 1733 949 909 899 885 775 336 53 54813 4319 3961 3476 749 21761 734 34229 3765 604
NM_001854chr1101464 1436 1376 1289 1036 1011 995 975 270 79 --11450 --
NM_001858chr6164715 4579 4279 4067 4009 3874 3221 3134 1988 1939 1898 1433 514 391 383 301 84782 4776 4378 3798 3340 3183 1712 423 ----
NM_001859chr9133414 3373 3366 3177 2822 2814 2738 2483 453 379 357 221 44 --23242 1379 12954
NM_001918chr1199214 9175 9071 8814 8398 7868 7416 7035 6571 6497 6145 5947 5781 3385 3334 2127 1126 1067 951 76317 6311 6228 5725 5698 3548 2284 31394 1222 370 29258 698
NM_001931chr1161329 1212 800 363 214 157 2851 473 1490 1373
NM_001938chr181647 1595 1463 605 479 393 226 142 31664 307 197 2326 247 --
NM_001941chr18143701 3357 3138 3006 2886 2713 2456 1342 1226 1162 1021 877 407 226 12742 32482 1447 1421 12815
NM_001942chr1861903 1745 1734 1675 1361 496 41716 1574 1467 467 11596 --
NM_001969chr14133945 3600 3452 3236 2929 2484 2471 1537 1284 1026 737 507 44 22791 2506 13261 --
NM_001981chr1132213 2200 2146 1930 1826 1692 753 686 655 501 398 135 114 3798 668 554 ----
NM_002006chr4185671 5580 5414 5346 5064 4564 4530 4346 3938 3873 3821 3650 1549 1348 954 897 520 314 45138 2264 676 434 44867 2206 1859 59 --
NM_002009chr15102680 2421 2335 2320 1056 800 638 322 190 77 32308 959 217 22428 42 12092
NM_002015chr1351318 856 706 329 303 1410 43340 2965 1130 251 --
NM_002024chrX122246 2210 1920 1837 1777 1577 1411 1371 248 205 181 139 --21904 768 --
NM_002025chrX229317 8969 8896 8630 8544 7386 6872 6543 6159 5999 5748 5720 3462 3442 3365 3329 2930 1809 1242 899 707 501 25648 3067 18090 18150
NM_002035chr18103555 3497 3085 2904 1119 997 877 346 311 163 1844 13488 --
NM_002040chr2172550 2435 2083 1991 584 155 80 52516 2448 2401 698 514 22568 444 1785
NM_002044chr1571513 1500 1340 578 544 274 47 21561 1551 1591 1259
NM_002069chr7111909 1780 1758 1632 1209 1191 755 748 728 590 457 11895 ----
NM_002128chr1382431 2134 1964 1837 1766 1625 952 110 --42566 1883 693 494 1254
NM_002137chr792321 1968 1837 1717 518 387 375 344 336 22209 451 ----
NM_002158chr2163837 3590 2515 2491 1536 1185 1110 1091 764 566 406 352 335 251 243 148 43785 3298 2932 1056 22748 470 --
NM_002203chr5134086 3860 3768 3149 1385 1370 1277 1209 893 736 582 357 164 --23326 819 23268 3047
NM_002210chr2123504 3002 2964 2782 2690 2329 1281 808 683 532 397 234 163 12724 --
NM_002214chr7175725 5210 5131 4436 4209 4190 4079 3995 3732 3636 3460 2259 2052 1801 989 945 37 45374 4848 3620 689 25089 3570 24247 1908
NM_002223chr1293901 3665 3602 1593 1154 869 836 745 454 22886 2524 42657 2505 695 391 --
NM_002242chr262029 1894 1618 1282 729 196 2585 264 11305 1316
NM_002264chr3114934 4291 3675 3511 3446 1637 1494 788 551 530 410 24780 3328 ----
NM_002270chr5175561 4949 4818 4564 3776 3543 3528 2218 2197 2078 1346 1038 951 599 488 474 337 44107 2061 1275 823 34033 2039 1809 --
NM_002285chr244140 3987 3374 976 33199 1374 1295 23461 833 34148 750 595
NM_002296chr191753 1725 1508 1460 1223 651 434 343 229 --21766 248 --
NM_002310chr5176364 6015 5944 5866 5158 4422 4340 4325 4246 2527 2516 2061 1662 1496 1422 480 380 56431 5728 4733 2010 782 36396 4205 1688 1433
NM_002336chr12174690 4655 4097 3641 3108 1904 1851 1762 1655 1513 1210 712 251 238 223 201 54 54169 4085 1459 1328 1011 25069 818 13931
NM_002356chr682878 2726 2653 2509 2326 919 438 154 1618 22629 853 22532 2010
NM_002374chr2123655 2832 2403 2299 2256 2235 1217 974 962 715 474 176 --13302 --
NM_002387chr5114930 4565 4149 3956 3907 3883 3801 1979 1796 1157 357 24819 4051 34838 4408 3755 --
NM_002481chr1137924 6774 6566 5477 5243 5079 2851 2539 1263 1212 1072 948 205 36593 5158 1236 25912 2870 21341 1249
NM_002508chr171960 1895 1536 1389 505 468 344 11884 21294 752 11443
NM_002526chr651685 1662 343 253 54 2684 240 2363 264 --
NM_002545chr11145113 4558 4391 4213 4031 3823 3182 3168 1285 750 681 571 346 118 34968 4854 4688 45208 4773 650 643 --
NM_002547chrX103816 3752 3573 3425 3371 2798 2633 1536 1282 1074 --23440 385 --
NM_002577chr393955 3914 3855 3341 1154 1039 927 492 214 22935 1305 2667 285 11050
NM_002581chr9185340 4568 4217 4210 4188 3680 3636 3565 3445 2093 1677 1611 1184 1148 1120 1023 1017 179 14934 24351 473 --
NM_002594chr2062453 2440 2209 2026 1727 757 1513 --21688 523
NM_002595chr1291928 1889 1638 1456 1284 1232 625 583 373 2533 483 --11661
NM_002610chr2113155 3067 3001 2960 2502 2355 779 729 577 177 49 22301 1012 23162 676 --
NM_002655chr8154952 4906 4842 4065 2051 1784 1305 1264 1258 1135 440 415 326 121 98 45206 4774 385 194 ----
NM_002656chr65998 838 809 401 83 1204 --2790 299
NM_002703chr4101414 1254 1206 779 688 666 382 318 128 52 --1136 21331 1215
NM_002709chr2153570 3468 3070 2855 2808 2782 2619 1448 1382 1351 1168 698 587 148 33 22204 1267 23496 579 12219
NM_002716chr1193594 2759 2511 2428 942 845 789 681 48 --1479 11027
NM_002719chr1462117 2057 800 758 707 154 ----2720 693
NM_002731chr192531 2146 2110 1087 902 895 821 586 565 --23097 623 1536
NM_002736chr7102227 1970 1889 1664 1543 863 803 775 483 460 12145 --12192
NM_002737chr17125588 5385 5122 4844 2210 1579 1486 1400 1247 810 244 79 --24667 4309 --
NM_002740chr3122561 2289 2104 2075 1826 1749 1732 880 673 585 492 267 22456 216 12617 11116
NM_002837chr12114619 3420 3177 2814 1417 1404 1382 1303 1098 441 141 21196 1055 11600 24019 1622
NM_002874chr992433 2408 2394 2155 1644 831 783 625 451 1396 12313 1443
NM_002886chr3225028 4699 4692 4623 4530 4207 3913 3875 3745 3220 1936 1856 1653 1369 1320 1281 1246 1194 566 471 328 88 45052 4740 2024 924 11594 13808
NM_002906chr1172227 2185 1584 1467 822 813 571 31656 628 141 ----
NM_002940chr461727 1542 1189 287 266 56 11413 --1770
NM_002959chr1114358 4231 3551 3543 3322 2792 1393 1162 1094 313 87 11072 31248 1061 801 12775
NM_003034chr12168126 7796 7748 7647 5549 5425 5178 5150 5032 3218 3180 3040 2041 1221 611 222 62473 2460 1909 734 678 505 22828 2428 --
NM_003046chr8125408 5335 5195 4385 4196 3999 3773 3529 3467 1976 1532 601 25272 3882 34413 3449 199 --
NM_003048chr2182514 2411 2284 2165 2125 2071 1922 1897 1832 1793 1074 1026 981 957 814 792 356 328 --22586 301 --
NM_003099chr15136555 5310 5251 5043 5001 4518 2438 2099 1764 513 492 473 244 32451 1840 1784 36510 4980 1442 12052
NM_003108chr2177020 6422 5845 5801 5285 5275 5237 5117 4423 2119 2113 1416 1121 377 208 188 63 56274 6145 5625 4861 1228 46321 5433 4884 1202 14836
NM_003112chr7173255 3229 2658 2585 2470 2318 2067 2060 2039 2021 1148 1106 847 697 529 164 98 22506 2108 ----
NM_003144chr692043 1886 1695 1443 874 835 442 192 68 21916 1742 32132 645 606 --
NM_003161chr1793625 3613 3193 2855 2634 1327 1101 593 544 33179 2412 25 --22744 2389
NM_003199chr18105609 5589 5303 4121 4096 2070 1928 1890 1225 758 33991 3571 669 25599 4263 23881 1515
NM_003203chr272191 1998 1833 1544 585 206 29 12057 42262 2228 1797 759 --
NM_003205chr15112287 2280 2220 2006 1992 1975 1943 1752 1562 365 318 --1827 12085
NM_003234chr372200 1804 1646 1634 820 244 74 12079 --11654
NM_003262chr3115301 5022 5001 4297 4041 4030 3899 3869 3354 1885 1381 45228 3192 1088 287 54190 1955 1774 850 483 --
NM_003274chr2182744 2604 2580 2425 2368 1915 877 290 22011 1027 12288 11962
NM_003298chr3186117 6079 5892 5879 5357 4942 4913 4850 4554 4222 3879 2092 1953 1623 1464 383 261 224 15552 24427 1233 --
NM_003338chr10101973 1815 1420 1400 1322 1310 1246 746 578 389 11839 --11261
NM_003342chr1783100 2825 2249 1073 1037 1012 822 470 22795 2595 33140 3006 378 --
NM_003349chr2041291 651 633 79 --11110 21555 141
NM_003392chr3114028 3995 3635 3584 3519 2876 2686 1577 1246 813 709 43444 2945 1497 719 1679 --
NM_003410chrX62839 2718 2273 1993 539 282 1971 2456 267 11987
NM_003411chrY91554 1471 1456 1355 1259 733 551 491 255 21767 1689 ----
NM_003412chr3103004 2887 2600 2544 2524 2505 2218 1911 1219 184 11207 22581 1030 12497
NM_003423chr1951633 898 742 508 171 4749 732 583 473 --1602
NM_003463chr683071 3054 2906 2434 2189 1290 902 151 --12282 22812 335
NM_003468chr294348 4220 3985 2918 1457 1042 818 467 347 23855 1678 24266 3818 --
NM_003471chr372088 1868 1716 1686 631 598 428 1944 21640 437 12042
NM_003478chr11143009 2988 2961 2655 2281 2255 2190 2082 2073 2061 528 271 68 37 53164 2877 2472 910 770 11275 --
NM_003489chr2193455 3406 3310 3200 3142 1201 817 703 269 12426 1674 23358 2235
NM_003505chr761885 1771 1445 1242 344 284 21728 1697 --11834
NM_003566chr12113017 2680 2628 1376 1256 1193 1148 640 464 124 45 73141 3076 2911 2262 549 369 246 ----
NM_003574chr18245801 5631 5563 5116 5102 4613 4236 3808 3519 1855 1822 1513 1387 1322 1265 856 802 774 675 505 468 354 258 59 65750 5339 5263 4466 1872 952 32140 1121 1093 14727
NM_003583chr12103936 3899 3761 2792 1538 1468 1436 1371 678 195 33139 994 748 22418 540 --
NM_003590chr2114010 4002 3993 3857 3777 3614 3389 2936 1318 442 59 54058 3756 1438 1356 828 23470 652 1298
NM_003615chr3154013 3962 3757 3712 3626 3436 3215 3017 2949 1504 1495 1226 1177 601 242 53411 3385 3288 2995 709 21595 381 13557
NM_003620chr17101081 1032 1022 939 376 333 222 212 128 59 --1800 --
NM_003663chr3183466 3442 3416 3334 3269 3179 2958 2860 2796 2554 2470 1287 1103 1042 798 762 425 347 21232 975 22374 682 --
NM_003677chr1251883 1736 852 846 396 31787 1543 380 --12017
NM_003722chr3102590 2414 2207 2003 1965 1941 1764 947 747 364 22747 872 21052 284 --
NM_003743chr272253 2186 2159 1902 1388 912 174 2846 270 21934 78 126
NM_003759chr474250 3099 2824 2772 1142 911 823 12745 33727 3558 2637 13782
NM_003772chr1191306 1183 1173 1018 1003 903 527 492 459 1446 1887 1895
NM_003774chr12103276 3066 2412 2322 2118 887 479 472 441 262 42814 2239 2110 995 22634 2093 1987
NM_003783chr171073 457 326 225 148 116 88 1495 11220 1996
NM_003816chr891491 1391 1298 1214 1163 1147 1112 1012 367 11190 --1204
NM_003884chr391810 1629 1518 1290 609 334 315 242 212 11261 ----
NM_003887chr252237 1897 709 295 228 32296 2007 1640 1785 1528
NM_003913chr694020 3570 3253 2753 1512 1388 1314 1237 105 23846 3172 43457 933 194 53 --
NM_003921chr191785 1711 1554 1482 1407 1369 1216 1191 402 11514 21349 359 --
NM_003930chr792565 2516 1993 1743 1686 1677 1670 593 171 52586 2349 1648 730 429 21887 1618 --
NM_003941chr7102429 1965 1957 1895 1860 906 751 741 540 377 2779 220 12472 --
NM_003966chr5127438 6734 6619 6396 5123 5088 3039 2265 2136 1617 596 570 47004 6535 5790 1748 57241 6919 5417 233 95 15035
NM_003980chr661252 929 378 298 60 43 31214 902 133 --133
NM_003994chr12114414 3717 3685 3314 2933 1568 1249 1239 744 432 166 24366 3915 --14259
NM_004028chr18123562 3426 3328 3112 3080 2836 1650 708 581 297 80 53 44040 3746 2939 907 1656 --
NM_004081chrY101732 1652 1553 1480 564 417 175 167 149 120 1342 167 1547
NM_004094chr1482911 1868 1017 992 787 681 407 76 41852 1082 707 584 22515 334 --
NM_004109chr113597 473 148 12310 2651 33 22360 1845
NM_004113chr371943 1870 1294 1264 610 525 475 21549 1501 11822 --
NM_004124chr14123444 3286 2835 2802 2669 2481 2205 863 655 598 424 146 22614 1350 53221 2346 1431 920 286 13078
NM_004133chr8102667 2640 2610 2510 2373 2252 1908 788 449 421 31842 1752 571 --22416 2026
NM_004161chr261611 1245 1152 360 134 36 31464 1146 419 11130 --
NM_004171chr11207711 7640 7546 7480 7260 7018 6545 6398 6153 3651 3488 2674 2599 1749 1427 870 717 539 447 266 89233 8947 8285 7630 7204 2939 822 798 47144 6655 1333 686 --
NM_004232chr18143912 3856 3683 3621 3599 2619 2370 1444 1161 1007 747 649 396 49 63873 2949 2427 1273 521 473 13657 --
NM_004272chr592043 1909 1644 1339 799 788 169 149 143 21974 1684 21854 774 11929
NM_004293chr9133628 3564 3305 3114 2826 2592 1530 1148 985 702 646 205 165 23527 718 2586 570 2861 532
NM_004331chr8142585 2576 2552 2319 2260 2142 1826 851 788 697 486 476 362 219 12188 2802 250 --
NM_004337chr8112314 2274 2143 1945 629 613 528 366 152 82 47 12180 --1796
NM_004338chr18147030 6901 6537 6254 6150 5878 5677 5107 4760 2232 1008 632 530 158 35997 4562 4334 36083 5148 2007 --
NM_004360chr1692018 1841 1740 1635 420 326 268 191 176 --1339 --
NM_004392chr1372512 2481 1981 882 566 165 111 1138 32572 2288 2139 --
NM_004397chr11144133 3684 3575 3520 3128 2793 2680 1480 1431 1369 1185 1004 758 635 ------
NM_004412chr10195733 5535 5437 4973 4774 2290 2278 2057 1804 1629 1512 1403 1352 1053 1041 925 777 737 66 45453 5129 4373 170 54599 4200 1099 379 131 25367 95
NM_004432chr952310 1940 1739 1564 680 3813 803 773 31690 784 150 31616 506 485
NM_004457chr281223 571 499 459 449 352 296 251 31192 1164 1118 1642 --
NM_004458chrX112654 2606 2123 1661 1650 1639 880 673 247 203 64 22210 932 1353 2919 394
NM_004464chr4143871 3859 3630 3619 3541 3285 3171 3159 3119 2946 973 848 798 182 43562 1350 1341 1326 22983 1258 --
NM_004482chr28856 819 719 605 593 387 172 162 ------
NM_004501chr1144006 3696 3498 3019 2890 2731 2648 2562 1601 1317 1023 915 823 578 53917 3045 2882 1652 342 --11131
NM_004504chr272884 2638 2041 922 898 493 304 53059 2547 1190 834 761 22214 881 --
NM_004586chrX145475 4826 4556 4303 4203 4097 3579 3479 1870 1801 1091 906 808 190 35462 2042 986 15337 14582
NM_004598chr593342 2811 1221 1141 786 756 599 309 27 --32906 802 279 --
NM_004612chr984868 4209 4135 3735 3712 3174 2936 1811 --14456 11876
NM_004660chrY82227 2078 1693 1637 1599 1536 873 191 31964 1786 395 --1841
NM_004685chr13112823 2750 2570 2207 2100 1188 1136 1073 540 520 351 21882 884 185 --
NM_004719chr12102853 2832 2686 2669 2629 2382 2217 1941 1087 747 1575 21967 99 12473
NM_004726chrX75212 4626 3958 3791 1817 1766 745 44365 1728 521 338 25068 229 11209
NM_004734chr1393201 2742 2504 2146 1211 744 681 450 174 --53000 2777 1007 476 159 --
NM_004744chr4153724 3102 2731 2676 2552 1437 1424 1038 948 770 692 604 446 346 297 33045 394 205 33369 2795 1020 13343
NM_004745chr8106808 6469 6359 6319 5741 5688 5609 4455 987 867 77004 5881 5869 4850 4335 1309 1024 11746 --
NM_004748chr15154196 4093 4075 3762 3645 3548 3486 3360 1232 1091 796 754 356 292 244 23322 3041 33806 3683 941 --
NM_004755chr1451096 961 854 462 286 1271 31083 1017 395 --
NM_004760chr7142484 2349 1878 1763 1688 1572 672 509 478 454 281 164 139 30 12230 --1189
NM_004788chr1171082 982 577 541 305 211 156 2762 238 --1596
NM_004804chr2102796 2654 2550 2452 1989 1689 969 335 260 231 --21769 495 1951
NM_004815chr163732 3295 1849 1765 1399 206 34721 4707 988 33986 1039 836 14781
NM_004857chr14134686 4243 4200 3896 3834 3762 3574 3321 3230 2974 2966 409 270 34127 3960 159 13694 196
NM_004859chr1772955 2644 2264 2227 2140 879 831 3890 364 199 32461 933 873 --
NM_004866chr5144698 4398 3813 3763 3447 3202 1531 1505 1390 1128 829 723 705 530 11672 13567 1746
NM_004871chr17104299 4261 3873 3469 3420 2916 2735 1428 753 79 13183 33834 3037 2895 --
NM_004904chr7106549 6515 5039 4598 4054 4027 4006 2572 2392 976 26220 1135 --15327
NM_004949chr1871721 1593 1512 449 388 278 151 1176 1724 1846
NM_004956chr7174512 4377 4327 4204 4164 3853 3662 3506 3141 3036 2963 1635 1492 1484 1387 638 299 54607 3996 2938 1478 1150 ----
NM_004972chr981044 1006 839 832 795 334 165 50 3929 157 37 1232 11070
NM_004985chr12124482 4433 4151 3765 3306 3229 1700 1311 837 807 786 252 44054 3848 1440 454 43397 3322 1252 166 23542 1764
NM_004999chr6144524 4100 3803 3218 1279 935 762 750 724 649 572 174 146 120 44126 3824 1697 72 33742 3439 501 11137
NM_005000chr761038 784 729 704 277 245 1400 1759 1888
NM_005036chr22128375 7664 6645 6287 5996 5926 2931 1748 1651 1506 1422 572 47414 3135 2064 1912 15432 --
NM_005054chr251276 376 365 358 189 1614 21384 642 1400
NM_005056chr1284890 4258 4149 4022 3806 2199 1344 89 24586 4066 25560 5311 24965 2124
NM_005065chr14165381 5020 4983 4524 4358 4247 4209 4202 4135 3447 2012 1589 1523 1319 837 43 54177 3600 1548 1486 431 34387 3841 1808 --
NM_005121chr17163407 3267 3149 3055 2852 2790 2658 2465 2377 1482 1034 759 643 505 456 359 13445 13499 21119 1088
NM_005124chr64773 727 393 373 2980 860 3741 721 127 --
NM_005135chr15103870 3662 3007 2863 2640 1312 1057 1050 713 319 33089 612 444 23379 1163 --
NM_005156chr9164644 3969 3888 1657 1642 1392 1227 1174 928 819 775 704 694 478 296 258 44064 881 566 380 12017 --
NM_005160chr22116145 5603 5087 4743 4717 4372 4173 2659 2025 1244 277 44864 4788 4758 699 34884 4237 1141 25375 324
NM_005171chr1281325 1179 1111 902 888 324 260 214 --1310 1375
NM_005188chr11168352 7948 7941 7829 6127 6090 5861 5484 5403 3333 3227 2532 2508 2267 449 148 38099 3219 2668 28056 7917 --
NM_005197chr14116176 5456 4349 4301 3782 2082 942 721 578 209 192 12113 32173 1236 61 15526
NM_005233chr362389 2081 1893 780 151 99 32204 1734 248 21853 543 1459
NM_005235chr2147875 7373 6414 5969 5886 5658 5013 3073 3027 2454 2439 1774 518 465 21877 753 65777 5177 3149 1900 1385 1321 12057
NM_005238chr11123587 3572 3088 2602 2332 1335 818 660 585 226 213 72 43338 2462 1409 572 13120 --
NM_005277chr451256 580 471 299 167 21447 768 31221 503 237 --
NM_005339chr4124322 4302 3187 3179 1602 1332 1223 990 891 770 660 85 53212 3067 1198 441 195 23376 918 1528
NM_005359chr18136329 5996 5822 5303 5200 4261 2406 2022 1959 1920 1906 1344 393 42560 1215 692 293 24046 820 --
NM_005385chr382740 2707 2532 2296 2042 825 232 104 21866 162 12378 2718 264
NM_005399chr1144385 4225 4122 3190 3184 2899 2696 1222 1043 970 863 655 381 329 13662 33372 3055 1077 1190
NM_005402chr781626 1202 1136 359 286 173 107 87 2464 158 1585 --
NM_005433chr1892552 2529 2479 2009 1815 1039 482 456 60 32798 2744 195 22220 614 --
NM_005497chr17126148 5699 4664 4453 3778 2172 2142 1987 1790 1467 1340 1074 35809 4550 1925 45318 2064 1618 1104 --
NM_005502chr9123210 3165 3153 2550 2526 2482 2022 1166 869 521 509 93 22125 237 22450 1057 --
NM_005504chr12196273 6163 5912 5895 5864 5752 4971 4689 4548 4079 4071 2385 2119 1762 1744 954 814 401 87 55662 5256 2416 2189 843 25013 1492 --
NM_005542chr791909 1874 1858 1770 1642 1603 1478 448 38 11258 21513 720 1742
NM_005570chr1831008 217 207 11187 --2814 63
NM_005578chr3125153 5050 4904 3809 3789 1997 1810 1742 1649 1159 802 721 31755 595 557 21433 148 --
NM_005591chr11112767 2754 2607 2263 2253 2154 1722 1067 794 565 81 21016 328 1123 12738
NM_005596chr9136307 6091 5584 5284 4791 4535 4414 4377 4006 1858 1422 1357 655 71917 1834 1119 987 966 893 647 1147 --
NM_005604chr642106 1764 1729 522 21666 509 --1546
NM_005665chr1164945 4753 4677 3996 3931 3726 3476 3179 3062 1976 1874 1297 950 520 347 324 --24878 3414 14708
NM_005668chr5154502 4157 4079 3845 3837 3435 2911 1650 1626 1524 1442 970 501 387 57 21585 1555 23578 3491 13127
NM_005725chr172465 2373 2337 2120 1996 948 269 21986 650 21627 433 --
NM_005746chr7102378 2177 2088 2052 1010 822 793 762 726 320 22776 911 22123 405 --
NM_005748chr12122787 2616 2387 2358 2272 2262 1203 1152 947 535 156 147 1340 23072 137 --
NM_005795chr292485 2379 2193 1959 910 808 787 269 134 22892 2265 22495 896 --
NM_005798chr13154536 4483 4455 4330 3414 3254 3219 2015 1835 1814 815 806 744 70 39 34980 1710 888 14044 1171
NM_005840chrX127636 7000 6696 5995 5964 5189 5174 4753 2727 1870 1657 875 --25840 4822 --
NM_005868chr7102497 2316 2109 1924 1719 1544 958 754 431 129 12338 31959 1670 26 1930
NM_005895chr12104194 4163 4153 4034 3536 3326 3258 3126 2850 922 --22857 446 1100
NM_005900chr451090 1006 904 759 334 1947 21204 786 2378 142
NM_005901chr18268141 7984 7562 7530 7106 7090 6551 6392 6304 6148 5922 5906 5636 5443 3277 2877 2649 2247 1717 1559 1325 1288 886 524 501 228 --48238 6275 6071 1419 27945 7758
NM_005903chr5145105 4922 4785 4656 4639 4224 3757 3582 3551 1839 991 684 514 382 2598 311 1247 13160
NM_005909chr5113848 3576 3542 3369 1512 1434 1365 1318 562 158 49 33678 3487 1008 --13110
NM_005935chr4135328 4917 4873 4527 4256 3847 1481 1379 1247 1149 945 878 373 15096 43579 1175 967 419 --
NM_005941chr8113758 3683 3432 2622 1436 1339 1227 1119 336 282 55 23809 3152 21279 604 --
NM_005955chr1155511 5398 5152 5141 4877 4757 4481 4400 3664 3534 2223 2146 1375 962 808 25498 954 184 --
NM_005977chr131357 3874 761 174 --1163
NM_005999chr151494 440 400 233 197 31205 1161 538 31405 1252 330 --
NM_006037chr2144252 3877 3713 3652 3463 1585 1544 1521 1421 1376 1343 1299 1116 973 23945 425 34068 3847 3803 --
NM_006047chr20153332 3050 2837 2672 2525 2304 1400 1189 1014 1008 568 490 427 406 389 12731 1941 12404
NM_006095chr4144484 4306 3995 3618 3410 3065 2820 1444 1419 908 852 485 423 240 54179 3896 3366 1630 596 23885 835 13813
NM_006154chr1582781 2694 2652 1979 557 421 313 68 32894 2740 1087 1451 --
NM_006166chr1292402 2363 2336 1847 914 707 490 446 200 1753 32326 2025 303 --
NM_006197chr892108 2100 1718 836 681 604 573 328 295 3618 272 183 1753 --
NM_006203chr5134931 4318 4131 4123 4091 3974 3874 1870 742 694 579 477 234 35405 3427 320 24552 4343 --
NM_006251chr5123287 3246 3165 2829 2810 2594 2315 2303 2162 2046 1175 856 2892 363 13212 --
NM_006252chr1337372 7285 7267 6488 6447 6343 6065 5966 5883 5836 5765 5718 5233 5077 2958 2782 2615 2397 2292 2198 2001 1940 1536 1161 1071 725 698 529 515 391 257 143 59 --1660 --
NM_006275chr2071990 1655 1578 932 845 653 480 31814 781 469 1124 --
NM_006282chr2064673 3591 1689 1371 1052 294 13760 24511 2943 13638
NM_006306chrX155871 5711 4719 4413 4102 3783 3730 3625 2295 2134 1905 1476 1130 708 427 25236 1877 ----
NM_006313chr12101721 1659 1328 1139 664 335 267 189 138 66 21485 519 ----
NM_006330chr871503 1217 668 343 298 180 84 11680 11138 1165
NM_006359chrX61586 999 763 229 188 35 1866 31576 941 59 1879
NM_006364chr144840 343 171 51 31038 508 198 1237 11095
NM_006379chr7102219 2207 2173 2061 2022 863 754 236 97 62 12301 ----
NM_006380chr17104241 3359 3288 2688 1599 1592 1506 1307 1081 48 33844 3079 1300 63609 3438 2882 879 442 93 --
NM_006393chr1064104 3727 3297 1637 1344 312 13632 41419 1303 920 569 --
NM_006420chr2063485 3411 3363 3192 800 611 12179 42542 2290 474 79 --
NM_006434chr1093172 2872 2849 2787 2436 2383 2012 851 23 12910 32820 2483 2285 --
NM_006457chr4123916 3131 2971 2710 2616 2600 1480 1352 976 876 481 399 33152 1078 299 132 --
NM_006460chr1791694 1511 1462 1307 1299 1275 715 517 478 4723 584 365 146 1233 --
NM_006482chr12103936 3899 3761 2792 1538 1468 1436 1371 678 195 33139 994 748 22418 540 --
NM_006520chrX81669 1355 1065 640 595 442 360 42 31208 238 216 ----
NM_006526chr2082205 1884 1633 1446 1383 876 66 60 --21867 313 11797
NM_006534chr20113339 3269 3003 2826 2508 2467 2373 1241 962 489 392 13311 --22457 1363
NM_006538chr2174164 4108 3274 3205 2948 2727 2534 1564 1517 1117 810 778 706 497 488 390 190 23290 2566 23905 203 --
NM_006544chr14306116 6063 5940 5886 5875 5729 5634 5218 5183 5049 4902 4651 3885 3838 2376 2304 2114 2098 2071 1664 1454 1146 1107 1078 998 738 715 224 178 21 55952 4909 4290 1167 689 75161 4353 3872 2105 910 372 251 12187
NM_006546chr17136158 6115 5808 5727 5643 4832 4030 2560 2312 1703 1651 329 231 --34075 1213 744 --
NM_006561chr10125058 4654 3816 1423 1267 1230 965 924 891 723 547 110 24170 852 1202 1281
NM_006572chr1763152 1087 735 578 484 196 43532 2705 2512 619 --12435
NM_006599chr16187334 6086 5352 5311 5257 3060 2792 2769 2094 1916 1671 1639 1134 1104 1075 1004 802 128 26355 2984 38162 4989 2701 12038
NM_006614chr3113665 3190 3109 2821 2337 1461 1289 1235 640 528 109 1516 --11340
NM_006620chr6144828 4791 4713 4146 4114 3533 3079 1412 1325 1030 945 686 568 480 84684 4600 4594 4378 1688 1356 558 264 13833 14782
NM_006624chr10131987 1940 1917 1810 1701 836 815 724 716 261 241 228 88 1520 3290 178 135 --
NM_006626chr9112472 2322 2290 1787 1690 874 860 746 567 456 30 12526 22343 833 --
NM_006628chr15124633 4341 4139 3829 3159 3057 1540 1519 548 488 300 292 11718 23770 3398 1424
NM_006646chr1382828 2776 2408 2402 1182 1012 618 46 12979 --12348
NM_006654chr12174339 4047 3927 3853 3418 3394 2939 1834 1641 1589 1394 1102 937 774 639 152 111 24505 1431 21583 40 --
NM_006699chr1112431 2263 1887 1779 1761 1745 999 901 566 168 61 1646 22707 632 --
NM_006718chr65998 838 809 401 83 1204 --2790 299
NM_006729chrX145509 5257 5135 4332 3944 3662 2204 2164 1946 862 607 562 520 292 43878 1793 689 334 55182 3475 1685 1403 1091 14723
NM_006731chr9225840 5802 5668 4982 4817 4679 4597 4371 4314 4105 4099 3951 3762 1475 1169 951 874 710 644 558 118 26 1902 25394 173 13657
NM_006750chr16157516 7508 7432 6919 6549 5951 5409 5253 2535 2316 2254 1955 1868 739 656 46476 6041 5721 796 22910 2473 37875 5141 497
NM_006766chr852350 2176 1677 884 328 1113 1122 12278
NM_006775chr682831 2471 2261 882 595 564 520 166 22774 2550 ----
NM_006777chrX142464 2452 2278 1883 1097 1066 866 858 810 455 283 171 159 25 1601 --12569
NM_006873chr241296 1159 1020 790 43233 2854 1168 800 12953 1143
NM_006885chr16114152 3887 3687 3615 1615 1532 1466 1197 805 595 430 33552 902 35 13568 13340
NM_006918chr11135673 5579 5453 5028 4871 4854 4669 3972 1594 1503 1303 1171 876 23687 1006 21880 801 35358 4978 667
NM_006922chr282134 1996 1940 1851 729 717 523 370 32464 2125 1878 ----
NM_006924chr17184448 4334 4252 4051 3962 3545 3447 3267 3238 3145 3090 2990 2787 1663 1613 1235 518 327 73987 3224 3169 2997 1245 1073 219 33752 3278 1281 --
NM_006948chr2181969 1869 1765 1587 1568 929 352 137 3628 542 104 22019 968 11977
NM_006963chr104476 444 277 174 --1462 21053 148
NM_007006chr16143513 3481 3032 2578 2549 1304 1010 856 834 807 717 637 427 88 1370 32461 970 770 13371
NM_007007chr12144563 4526 3863 3781 3700 3655 3599 3170 1926 1873 1768 1211 1121 1060 23934 3512 53563 1530 1356 914 756 13133
NM_007011chr15176772 6715 6310 6275 5356 5097 4774 4723 2759 2227 1972 1754 1337 802 738 551 528 --22369 1822 16906
NM_007038chr21145702 5137 5041 3966 3907 2417 1833 1781 1607 1412 1391 972 605 544 35751 3951 2104 21867 649 1849
NM_007107chr392394 2295 2148 2130 2105 1797 475 354 180 --11856 1885
NM_007114chr393339 3162 2232 973 962 608 520 439 125 3741 623 221 32986 2950 1020 2576 267
NM_007125chrY71425 1236 1191 978 969 342 28 1398 31036 451 50 --
NM_007145chr1971414 1368 1254 948 935 461 147 21435 229 2430 47 --
NM_007146chr1772551 2530 2074 1125 1093 215 92 22891 732 2416 101 --
NM_007157chrX82991 2666 2546 2433 2412 941 853 134 13002 12819 1143
NM_007172chr2293231 2891 2854 2583 2473 2361 2056 1205 243 12237 23014 2394 12648
NM_007175chr8103477 3116 2958 2433 1290 1259 1238 910 598 228 23506 2875 --13580
NM_007212chr162118 1878 1705 568 368 168 1489 51771 1574 642 302 236 --
NM_007249chr13179476 9170 7977 7805 7763 7266 7229 6017 3604 3132 3015 2378 2176 1784 1705 1261 382 39030 8939 2528 67647 7025 3344 1971 1674 431 19211
NM_007287chr3123176 3021 3011 2984 2417 2340 1997 1267 1120 874 651 61 22572 916 23191 815 1724
NM_007288chr3123176 3021 3011 2984 2417 2340 1997 1267 1120 874 651 61 22572 916 23191 815 1724
NM_007289chr3123176 3021 3011 2984 2417 2340 1997 1267 1120 874 651 61 22572 916 23191 815 1724
NM_007350chr1264551 3953 3696 1204 536 261 24152 470 23302 1162 1611
NM_007373chr10101809 1294 664 575 431 351 280 208 194 159 2290 104 41827 1651 1572 454 1462
NM_007375chr1112823 2800 2749 2711 2610 2445 1906 191 98 48 41 --1182 12720
NM_012096chr3163734 3385 3324 3224 2844 2582 1395 1304 1186 973 899 776 465 279 261 98 1434 33349 529 36 23444 765
NM_012129chr782387 1896 1889 1749 1597 351 196 187 22427 122 1220 2896 423
NM_012164chr9147540 6539 5616 5298 5192 5062 2634 1971 1959 1949 1491 1440 1233 408 25101 4756 47191 6550 2889 2738 --
NM_012193chr11185454 5388 5318 5024 4918 4725 4508 3652 3296 1978 1830 1295 1140 980 771 694 77 64 11474 --1856
NM_012214chr2186305 6178 5966 5879 5270 4437 3899 2064 2027 1999 1983 795 714 494 446 306 195 37 36015 5562 1963 25038 1939 16408
NM_012234chr383407 2884 2714 2676 2535 1108 990 45 43779 3164 741 426 23480 166 23608 618
NM_012252chr7215231 5023 5006 4974 4875 4719 4537 4483 4426 4229 4182 4022 3859 3853 3567 1990 1845 1510 1231 1198 571 13318 34521 4306 3920 13979
NM_012262chr1155027 4790 4713 3949 3776 3364 3311 1989 1689 1628 1513 731 708 184 38 33977 3515 761 23941 719 1489
NM_012287chr394073 3843 3226 3174 2936 1751 1678 1592 246 54033 3245 3089 670 259 22988 904 --
NM_012347chr692560 2386 2201 1122 499 346 261 250 151 32353 2194 335 22118 708 --
NM_012388chr1582963 2055 568 502 315 207 198 72 32532 2474 226 ----
NM_012399chr2292018 1328 778 745 664 576 565 525 379 --11916 12002
NM_012431chr7153628 3310 2996 2979 2731 2702 2234 1127 1031 1024 990 839 755 723 396 136 21318 102 --
NM_012464chr462669 2377 2343 1862 1128 1073 22218 362 1157 22496 2445
NM_013229chr12112829 2589 2396 2313 1894 1044 838 478 333 323 38 12821 12205 --
NM_013255chr7248375 7760 7464 7414 7239 5690 5436 3340 3308 3209 2985 2816 2648 2438 2141 1945 1420 1175 681 658 619 326 218 141 46824 6762 5371 1884 38121 8097 2164 --
NM_013261chr483588 3523 3091 2745 2612 1192 927 842 12592 41513 1481 860 96 12688
NM_013269chr12124552 4381 4157 4025 4015 3786 3236 3183 3032 1757 1388 1296 179 24505 1779 23373 250
NM_013281chr2061551 1364 517 339 174 167 21054 473 ----
NM_013309chr15102428 1869 1738 1067 854 740 475 459 436 393 22076 1979 12439 --
NM_013381chr1292323 2078 1758 1724 1682 928 867 849 101 1764 1127 2813 41
NM_013386chr181302 1239 1100 580 428 418 383 302 11668 21621 559 --
NM_013943chr1153156 2989 2718 2570 2538 2413 2295 2275 1318 1230 1011 965 611 585 88 23033 684 42791 2581 2399 449 --
NM_014011chr2112645 2585 2464 2361 1860 1000 905 655 627 603 378 31627 1050 945 12634 --
NM_014021chr1133425 3296 2817 2501 2406 1046 858 752 580 540 445 397 44 32911 2515 533 1736 2480 368
NM_014028chr6123354 3261 3170 2831 2401 1322 1305 1118 1031 351 184 144 22877 607 ----
NM_014048chr16104872 4854 4694 2039 1777 1603 1526 1281 188 156 34483 645 639 11386 --
NM_014089chr1332000 873 108 12264 42170 1891 1650 134 2185 100
NM_014112chr8135511 4538 4250 4187 3600 2156 1944 1453 551 477 350 126 52 35233 1126 440 25376 3533 --
NM_014141chr7195274 5226 5117 5093 5083 5049 4833 4553 4546 4446 3587 3254 2046 1614 1511 876 815 342 39 14929 1271 12138
NM_014155chr11197323 6513 6485 6470 6132 6053 5538 5316 5152 5104 4830 2828 2801 2023 1930 1693 455 400 388 36353 1952 340 32423 1820 845 --
NM_014217chr181932 1812 1360 1264 1258 437 160 154 31879 1738 1732 1465 --
NM_014309chr2295278 4518 3768 3629 2051 1363 936 671 187 11065 31201 1136 549 1894
NM_014331chr4237728 7685 7127 6804 6336 6166 6156 5851 5826 5711 5106 5027 4819 2739 2638 2572 2500 2420 2269 2205 2124 1184 1021 107306 6764 5699 5089 2855 2256 2083 1161 994 673 41789 984 711 349 37834 475 169
NM_014372chr1131794 1775 1732 1685 1665 1625 1588 827 522 408 273 111 91 --11988 --
NM_014382chr381355 1094 631 543 447 174 86 36 1412 11279 11266
NM_014423chr5185653 5410 5260 5052 4958 4496 4207 4160 4013 3794 3555 1965 1827 1765 1219 1130 997 266 65634 5512 5469 1943 400 373 44995 4668 1472 300 1573
NM_014584chr1471346 1196 569 489 483 422 229 2577 238 157 11446
NM_014612chr951129 977 506 332 128 21233 274 --1156
NM_014616chr3133494 3380 3328 3000 2920 2733 2139 1080 945 862 422 211 91 53487 2721 1398 1334 613 1502 --
NM_014635chr251239 340 329 322 153 --21352 606 1364
NM_014674chr3104030 3336 2940 2568 2556 1612 1277 1220 380 235 23994 1562 2550 121 --
NM_014701chr15113180 2970 2906 2881 2640 2581 2417 2366 2115 2089 280 33408 3330 1308 22795 1100 --
NM_014702chr6143407 3362 3347 2436 1367 1270 1255 1090 898 581 431 387 189 33 32501 830 681 ----
NM_014711chr1661798 1416 685 535 407 391 41677 1527 361 240 ----
NM_014721chr6187259 6590 6382 6075 6038 5807 5760 5668 4855 2754 2704 2340 2142 2065 1843 1825 715 330 46563 4826 2361 2288 11278 1517
NM_014729chr882257 2104 1517 1511 1491 408 243 34 21780 1686 21603 228 --
NM_014733chr542052 1938 1730 571 1186 21838 1745 21541 260
NM_014739chr6174200 4068 4032 3890 3633 3564 3504 3325 3284 3179 2805 1245 1054 626 562 400 101 --33010 2759 130 13551
NM_014746chr274302 4183 3771 3381 1029 762 577 31716 1346 1298 --21562 605
NM_014755chr2103999 3532 3349 3310 3028 1157 1054 854 364 116 23598 545 24041 1139 --
NM_014783chr1591714 1657 1224 720 670 572 549 162 112 11278 11505 --
NM_014803chr10112841 2648 2389 2024 773 742 632 597 280 263 197 32758 1945 718 22663 2001 --
NM_014810chr153654 3095 2953 2444 629 22739 2708 22971 2837 13250
NM_014819chr572406 2017 1723 587 564 401 61 21832 157 21635 500 --
NM_014824chr1182045 2000 1769 1670 1662 1638 1347 772 31627 1357 567 11481 --
NM_014829chr5112323 2257 2194 2051 2043 1530 1499 906 866 372 91 1584 --1940
NM_014830chr12103816 3395 3288 3181 3085 2952 2849 451 111 88 --33939 2561 2397 11140
NM_014838chr22112843 2809 2252 1834 957 879 868 285 275 254 181 --22090 1982 --
NM_014839chr182563 2472 2213 2000 984 909 847 805 --12028 11711
NM_014864chr1154410 4358 4314 3307 3084 3072 3002 2737 1640 1539 1508 1485 1152 967 179 ----13497
NM_014867chr8103473 3096 3074 3035 2713 2669 1109 1020 754 502 11074 --1455
NM_014873chr154310 1835 1530 309 112 --24125 1560 14820
NM_014877chr17197723 7672 7639 5339 5188 4864 2901 2827 2664 1946 1905 1244 969 790 510 472 327 242 234 46645 2754 1194 846 55050 4905 4824 3029 2972 --
NM_014893chrY62076 1974 1617 1490 818 503 --21567 863 21527 390
NM_014897chr17173244 2628 2596 2331 2178 2122 2075 2013 1281 1251 1109 1023 688 569 435 393 259 12781 2519 283 --
NM_014899chr5113191 2945 2875 2841 2277 2155 2146 1174 1161 1149 720 13130 2473 458 1348
NM_014904chr1074030 2840 1285 910 797 742 339 33040 1407 834 --11298
NM_014912chr1063178 3154 2346 1134 991 900 43369 3031 2242 673 12471 11187
NM_014920chr673813 3573 2861 2501 679 367 162 --3935 803 478 23839 3292
NM_014934chr13103746 3655 3430 3119 1447 1407 1164 1058 328 266 33696 653 512 12490 --
NM_014936chr632475 1771 434 62660 2177 1151 1024 386 360 21138 1077 --
NM_014946chr292826 2556 2455 2382 2305 2145 2109 1972 1051 3559 482 96 12566 1831
NM_014950chr1451772 1713 1604 1574 1198 21581 537 --11169
NM_014959chr1993334 2348 2321 2291 2226 1344 1330 994 228 23577 1246 23506 3130 --
NM_014962chr20112322 1974 1901 1054 934 732 724 693 662 337 263 12772 22349 454 --
NM_014982chr14145434 4966 4885 4482 4436 4110 3461 1370 1219 1161 1059 1025 403 284 93815 3568 2068 2023 1871 1613 1329 513 475 1593 1976
NM_015000chr12112731 2391 2385 2336 2049 1251 1134 1034 558 165 128 83052 2919 2578 2079 855 652 631 585 11888 1548
NM_015008chr363666 3050 2578 2341 470 179 13611 2193 85 13605
NM_015020chr16113851 3689 2839 2508 1553 1236 1022 630 540 517 271 ----11201
NM_015026chr12124507 4107 3990 3762 3563 3173 1644 1475 1353 1012 549 422 34402 1468 370 13871 --
NM_015032chr13162948 2836 2795 2649 2623 2418 2349 2283 2206 2147 1013 719 692 649 451 374 1735 --12829
NM_015040chr2133221 2762 2243 992 899 859 712 628 466 418 310 232 172 12495 1548 --
NM_015051chr982761 2295 2267 1366 832 609 466 261 23246 2796 22475 121 --
NM_015068chr7143820 3809 3633 3178 3166 2788 2709 2645 2430 1207 997 851 362 82 93998 3457 3012 2980 2900 2686 2613 284 41 32772 2635 973 --
NM_015076chr654121 3779 3514 3342 925 34547 3736 1132 21450 197 13161
NM_015092chr16134357 4312 4207 3871 2933 2920 2914 1855 1746 986 551 451 258 11383 33154 3044 1147 13396
NM_015110chr992376 2348 1884 1794 857 845 561 319 81 --3892 538 30 --
NM_015115chr472951 2663 2089 934 312 272 227 1855 12121 12833
NM_015156chr14184033 3980 3959 3754 3730 3721 3201 3150 2782 2736 2620 1549 1278 997 952 846 840 453 23969 1530 13812 13646
NM_015199chr393020 2973 1969 855 691 399 245 168 86 42360 1131 383 352 32701 1995 553 --
NM_015200chr482507 2499 2423 2116 2100 878 584 429 --42302 2254 1584 824 --
NM_015206chr15153833 3518 3422 3407 3386 3061 3009 2932 2921 2408 1503 1492 1452 1286 1012 --13662 --
NM_015208chr18143757 3429 3328 3313 3234 2911 2795 1492 1288 1051 982 491 444 304 12970 12883 --
NM_015216chr561475 1412 1403 1168 1009 570 --2452 399 11221
NM_015225chr982774 1087 984 435 219 176 148 125 --22817 2740 1696
NM_015247chr16105345 4214 4098 4092 2156 2008 1936 938 852 243 14194 15065 1323
NM_015251chr1662328 2112 1987 940 426 191 --2849 161 12241
NM_015275chr1272108 2051 1634 439 377 260 154 31856 680 673 32089 839 201 --
NM_015310chr8158434 7785 7351 6965 6235 5556 5409 5380 3148 2944 2661 1529 1337 896 818 68318 8094 7621 1871 1392 363 --13370
NM_015313chr11164688 4291 3928 3693 3422 3140 1858 1804 1727 1415 1124 867 846 497 303 245 21708 316 11890 --
NM_015314chr7112463 2392 2294 2189 2110 2096 1018 684 545 295 205 22130 81 31917 917 141 --
NM_015336chr1252675 1959 1065 246 128 3802 722 371 11914 12489
NM_015344chr882194 2116 1810 1636 805 654 451 358 2697 260 1844 11610
NM_015349chr6133103 3065 2902 2723 2664 2588 2377 2207 1949 919 766 724 358 22400 458 ----
NM_015355chr17101890 1262 646 483 464 416 323 300 53 38 ----11345
NM_015367chr2231197 547 477 11528 161 21642 1571
NM_015385chr1093172 2872 2849 2787 2436 2383 2012 851 23 12910 32820 2483 2285 --
NM_015397chr9101767 1690 1646 1534 765 647 500 402 212 120 --11898 127
NM_015436chr4113088 2840 2778 2101 1266 1069 559 547 495 458 229 33367 3273 3123 1615 11328
NM_015455chr573156 3128 3110 1042 952 744 540 33186 2736 442 32769 490 252 --
NM_015458chr865306 4387 3682 1131 1020 991 1665 23246 717 23644 1087
NM_015525chr68985 963 879 819 784 460 360 173 2412 352 184 --
NM_015532chr1592601 2313 2144 2030 1911 1774 1747 1045 222 22400 182 12331 12274
NM_015553chr6114987 4804 4499 3448 3211 3193 2033 1992 1039 343 203 33984 1271 834 13486 11438
NM_015569chr1114615 3755 3616 3545 3424 1268 1208 1191 704 311 296 31656 1218 962 24768 1328 --
NM_015571chr692602 2290 2128 1956 1850 1633 1046 741 54 11068 21942 107 2859 847
NM_015640chr1185380 5324 5214 4615 4598 4298 3528 3244 2056 1754 1409 1345 1184 496 387 252 139 89 54668 4250 3637 2142 1585 33460 1398 1097 --
NM_015713chr873476 3422 3153 2901 2382 760 77 41172 986 785 663 12719 --
NM_015878chr892250 2075 1528 753 679 562 551 463 32 21552 211 32020 1474 1395 1192
NM_015879chr18128293 7836 7627 6745 6468 6084 5711 5435 2231 1988 1463 1014 2894 169 12285 --
NM_015886chr8175447 5293 5000 4415 3967 3942 3841 3750 2301 2054 1933 1796 1480 1005 593 289 76 75034 4877 4634 4079 2254 2235 1091 35604 3950 454 1950
NM_015888chr172822 2799 2656 2491 2467 1104 848 11169 43168 2350 2181 621 22830 2216
NM_015906chr1184862 4781 4701 4398 4290 3748 3587 3105 3001 1725 1581 1548 1491 951 848 512 381 218 44219 4156 3922 3184 23113 3062 13792
NM_016009chr194040 3135 1752 1497 988 830 726 671 473 74069 1798 927 706 623 409 178 11729 --
NM_016018chr8102757 2505 2494 2337 1956 1759 1102 1041 603 290 32346 2062 1906 22297 1741 2494 421
NM_016021chr6122681 2616 2031 1872 1012 959 869 794 772 719 496 287 42539 1185 689 135 1319 --
NM_016023chr8112109 2094 2020 1870 1613 1607 1574 1343 682 310 200 21789 660 1191 21592 396
NM_016040chr152389 2039 1883 1713 276 42147 1902 1012 813 32663 561 405 --
NM_016045chr2081690 1419 1123 627 446 303 208 192 21752 1468 ----
NM_016096chr8101752 1702 1638 1612 1581 1527 854 839 342 238 11417 ----
NM_016097chr1891126 1051 982 687 371 364 350 276 50 ------
NM_016132chr15163402 3114 2898 2763 2609 2603 2450 2388 1220 1038 1024 479 470 448 344 179 ------
NM_016206chr3238429 6658 6534 6502 6099 5994 5596 5471 5439 3607 3444 3123 2603 2440 1965 1590 1368 1090 892 734 419 376 282 138317 7068 6445 2955 2379 2334 2295 2053 2044 1903 1412 1302 682 27003 1559 11267
NM_016217chr6103628 3533 3081 2996 2642 1351 1212 970 735 682 32392 2282 293 1305 --
NM_016248chr13123929 3921 3895 3609 3303 3270 2616 874 852 475 464 78 54026 3411 3187 3063 802 1944 --
NM_016255chr6102972 2200 1340 1181 759 657 438 295 207 95 22442 345 22185 572 --
NM_016257chr153546 2431 2225 756 325 --13289 42937 952 774 734
NM_016260chr2247666 6466 6455 5904 5685 5598 5516 5403 5378 5011 4624 2933 2897 2779 2650 2632 2346 2323 1845 1779 1722 1531 860 327 57578 7538 6714 2418 1358 56671 4945 3066 3037 2819 2576 252
NM_016271chr18112264 2238 2172 2114 2085 1991 1977 751 656 377 292 62193 2179 2164 1890 1842 1794 3566 479 319 1871
NM_016275chr3132759 2657 2380 1727 1704 1041 1010 970 817 763 580 454 193 42647 2122 1051 756 ----
NM_016308chr1132075 1733 1712 1526 1448 1431 1345 616 422 409 391 384 145 1809 ----
NM_016315chr271615 1235 721 695 244 142 128 31644 1323 1223 31559 1343 315 --
NM_016357chr1251273 1261 1009 497 368 ----21179 391
NM_016396chr1572990 2438 2361 2138 910 671 512 42867 2454 852 793 2244 89 --
NM_016422chr11143216 3004 2887 2664 2280 2176 2152 2105 2014 922 822 797 239 192 22905 414 32811 906 703 --
NM_016442chr561751 1724 1673 945 926 338 1912 12032 --
NM_016472chr1481504 1221 499 492 355 336 328 190 11105 ----
NM_016507chr17113200 3164 2901 2595 2449 2102 1026 948 482 427 387 21989 653 ----
NM_016513chr673813 3573 2861 2501 679 367 162 --3935 803 478 23839 3292
NM_016530chr15103682 3391 3354 3224 3166 2866 2569 1003 378 366 63785 3300 3119 2988 1059 539 23153 831 --
NM_016531chr493937 3699 3657 3207 3189 2750 1536 1453 495 21347 131 33489 3061 2962 22595 1281
NM_016613chr492673 2550 1875 1084 901 831 771 748 295 22018 1759 1272 1646
NM_016617chr1361974 1944 1568 585 554 508 22001 336 21824 1668 21904 676
NM_016620chr171432 1272 1212 1049 979 52 46 1453 1218 --
NM_016824chr1071640 732 561 518 343 321 202 21337 1290 1542 --
NM_016831chr1112341 2323 2093 1730 1672 854 697 640 248 112 92 32291 2213 2140 22307 1523 --
NM_016950chr451003 576 388 272 249 21451 1189 --1374
NM_017423chr4112174 2159 2140 2112 2097 1888 1598 1570 1507 749 527 2654 46 11532 --
NM_017444chr861625 1287 744 617 460 157 21237 430 --1628
NM_017447chr21144295 3588 3306 2677 1435 1406 1224 974 916 843 413 366 235 110 23906 1650 64010 3529 3225 2982 1596 70 14229
NM_017563chr3156383 6120 5991 5681 5558 4949 4658 4607 2304 2275 1716 1541 1242 869 253 1512 25376 1772 1825
NM_017610chr1591587 853 843 739 624 384 333 208 93 22047 834 --12129
NM_017628chr4165105 5029 4814 4772 4428 4049 3785 1156 1039 982 932 511 441 375 357 176 25046 4612 35122 3491 1792 --
NM_017633chr6123904 3548 2888 2612 2451 1542 1268 842 789 388 372 142 21581 735 13025 --
NM_017635chr1181397 1320 1292 1221 1133 1071 996 179 31263 1103 82 11056 --
NM_017637chr9139301 8437 7703 6528 6158 2998 2667 2574 2408 2206 2077 1008 198 29475 7251 39402 9007 3741 --
NM_017643chr1793116 3048 2213 437 292 258 239 129 116 63016 2914 1022 949 608 320 2420 183 12375
NM_017644chr3165220 4925 4650 4473 4438 4371 4090 3533 1966 1771 1613 1398 1347 755 636 423 34965 4160 3289 21782 1694 13608
NM_017645chr982932 2836 2819 2547 2540 801 521 207 33124 2911 2067 --11182
NM_017650chr7186041 5916 5703 5539 5175 5068 4955 4427 4289 2047 1653 1421 1171 1009 894 882 501 375 26019 3882 54965 2102 1321 1106 232 15520
NM_017654chr7101742 1719 1700 1581 1346 1216 1158 592 284 28 --31624 1096 614 --
NM_017658chr14114664 4314 4292 4111 3892 3100 3056 2892 1775 601 134 22938 710 44411 3673 3335 2903 --
NM_017666chrX72217 2180 1990 1826 898 452 51 21673 111 22243 1726 --
NM_017676chr5101780 1759 1674 1530 1233 384 364 340 331 324 --11252 --
NM_017705chr1573680 3069 2616 1201 920 834 373 43807 2465 898 268 1163 13101
NM_017709chr193639 2716 1647 1450 1329 892 663 336 326 34321 1719 1441 11131 --
NM_017719chr341711 1019 639 609 2679 625 2936 302 11806
NM_017736chr16103204 2728 2503 2284 2152 2144 2057 1189 1174 682 --32005 451 334 --
NM_017754chr693268 3223 1709 1669 1548 1449 1353 763 624 24614 4495 24992 1600 1747
NM_017779chr182446 2260 2140 1700 1014 559 285 270 22693 342 32557 2114 962 --
NM_017801chr382610 2482 2406 1909 1660 396 193 82 12372 1234 1468
NM_017813chr8135715 4884 4770 4685 4602 4009 3698 1939 1697 1654 1398 1109 574 35368 3785 552 35828 4550 1168 11875
NM_017831chr18104676 4338 3425 3292 1565 1395 883 506 199 77 34726 1424 1144 13891 --
NM_017847chr1102255 2164 2031 1904 1785 1629 1472 728 462 300 32207 1735 656 ----
NM_017919chr9135760 5422 5106 3998 3949 3547 1975 805 647 547 257 234 190 25848 3635 25620 892 --
NM_017925chr9121911 1785 1524 1339 1189 732 367 337 213 106 69 48 21748 1420 21905 1318 --
NM_017964chr271011 994 982 966 920 870 240 --1933 1767
NM_017987chr10142221 2170 1893 1812 1644 1606 1386 671 590 541 456 436 148 32 11417 11773 11532
NM_018003chr1592156 1980 1941 1607 969 960 895 760 358 21843 582 --1657
NM_018017chr1072873 2867 2796 2242 2030 671 662 --42559 2318 1122 200 12230
NM_018036chr1484341 4025 3596 3213 3124 1357 1162 711 34292 1406 491 34228 3868 2778 --
NM_018112chr99943 402 365 347 324 275 225 134 34 --1843 --
NM_018133chr392139 1998 1903 1738 1362 859 795 773 666 2748 328 11745 --
NM_018155chr393460 3103 2720 2565 2398 970 894 849 143 2490 381 33112 2424 130 22298 1110
NM_018211chr161937 1668 1482 826 819 433 11733 41521 1474 1382 320 1810
NM_018227chr4113064 2370 2294 2234 2088 2048 939 836 384 338 254 31026 472 371 12671 --
NM_018243chr4143660 3598 3329 3000 2964 2864 2558 2544 1558 1467 1006 972 946 492 13240 23704 1179 --
NM_018246chr882640 2519 2210 1827 1044 641 143 127 --1489 22102 2078
NM_018254chr152317 532 406 387 290 52243 1753 1720 1574 269 2586 159 12296
NM_018257chr20142618 2369 2283 2261 2057 1773 823 794 678 634 527 480 474 53 12269 32356 1973 1736 --
NM_018293chr352982 2492 2448 2422 2395 --22962 2848 11918
NM_018299chr8103463 2938 2903 2131 1061 1047 1008 863 646 381 32442 2409 1179 13162 --
NM_018313chr392261 2180 2091 1932 1644 926 895 878 213 11675 1458 11840
NM_018351chr12103198 1868 1624 980 935 659 432 407 200 133 34761 1249 1107 44493 4264 559 45 --
NM_018361chr8134066 3975 3372 3303 3046 2948 1247 1193 881 727 628 610 137 53508 2660 921 747 86 --1687
NM_018362chr11174063 3966 3818 3754 3511 3437 3146 1626 1048 801 654 588 457 352 283 260 117 21314 107 31163 435 49 --
NM_018364chr1153993 3781 3610 3012 2946 2691 2666 2602 1438 1326 1105 466 83 53 41 23382 390 21300 538 12616
NM_018373chr14156045 5125 4980 4947 4747 4739 4009 3919 2361 2247 1825 781 407 262 102 35995 1264 628 --15007
NM_018374chr7255275 5255 5243 4904 4809 4680 4470 4253 4201 4039 3844 3799 3364 3297 3277 2000 1867 1555 1367 1045 1027 902 840 806 630 54144 3808 3223 218 110 34274 4181 3313 11113
NM_018383chr272001 1928 1913 1847 1717 635 365 21589 303 21534 326 --
NM_018394chr34655 623 434 192 1260 41368 452 418 367 --
NM_018403chr3184140 4127 4092 3967 3955 3319 3204 3168 3117 2702 1645 1457 1174 799 522 445 376 103 1503 33258 2675 586 --
NM_018429chr5102870 2652 2628 2294 2268 2174 1836 1043 403 351 11115 12430 22124 486
NM_018439chr18102311 2193 2105 1957 1865 984 839 821 655 380 12447 11885 --
NM_018440chr8138430 8353 8020 7087 6717 3154 2986 2846 2768 2713 2449 2107 1770 47747 3078 1624 1070 35404 2996 485 12975
NM_018444chr8102154 1996 1559 720 700 635 546 399 202 55 22334 2166 1942 --
NM_018448chr12101259 1202 998 928 913 855 495 372 355 340 11105 ----
NM_018452chr6_random93648 3419 3192 2418 1321 1270 708 299 191 23255 316 32411 1164 1128 --
NM_018566chr1174726 4540 4244 3779 3213 1703 1693 1521 1382 1050 1004 910 900 544 392 285 145 43528 1970 947 178 21477 1181 1961
NM_018638chr12275441 5336 5154 5111 4988 4857 4793 4717 4685 4594 4352 4341 4182 4151 4061 3967 3561 3460 2227 2110 1676 1565 1290 823 791 387 378 45402 3446 1471 909 24366 1841 25660 3886
NM_018650chr182111 1938 1526 1412 727 661 309 113 52157 1921 1840 782 505 32166 2056 1720 --
NM_018662chr164227 3436 1751 319 241 216 22912 1736 33820 3477 3162 22943 698
NM_018695chr5122485 2466 2458 2442 2386 2318 2190 2077 1874 1831 121 65 140 42136 1571 786 464 --
NM_018710chr861296 1144 978 900 557 202 1511 --11095
NM_018847chr941787 1407 736 677 21475 778 31696 695 467 --
NM_018898chr591888 1844 1826 1802 1630 519 378 371 252 22020 903 21944 1667 --
NM_018899chr591888 1844 1826 1802 1630 519 378 371 252 22020 903 21944 1667 --
NM_018900chr591888 1844 1826 1802 1630 519 378 371 252 22020 903 21944 1667 --
NM_018901chr591888 1844 1826 1802 1630 519 378 371 252 22020 903 21944 1667 --
NM_018902chr591888 1844 1826 1802 1630 519 378 371 252 22020 903 21944 1667 --
NM_018903chr591888 1844 1826 1802 1630 519 378 371 252 22020 903 21944 1667 --
NM_018904chr591888 1844 1826 1802 1630 519 378 371 252 22020 903 21944 1667 --
NM_018905chr591888 1844 1826 1802 1630 519 378 371 252 22020 903 21944 1667 --
NM_018906chr591888 1844 1826 1802 1630 519 378 371 252 22020 903 21944 1667 --
NM_018907chr591888 1844 1826 1802 1630 519 378 371 252 22020 903 21944 1667 --
NM_018908chr591888 1844 1826 1802 1630 519 378 371 252 22020 903 21944 1667 --
NM_018909chr591888 1844 1826 1802 1630 519 378 371 252 22020 903 21944 1667 --
NM_018910chr591888 1844 1826 1802 1630 519 378 371 252 22020 903 21944 1667 --
NM_018911chr591888 1844 1826 1802 1630 519 378 371 252 22020 903 21944 1667 --
NM_018947chr794424 4033 3698 1525 916 817 376 316 189 54907 4893 4814 3207 335 11224 11494
NM_018999chr10164885 4611 4156 4069 4014 3983 3726 3672 3650 3487 3075 3009 1480 1284 1254 945 33932 3084 1806 13631 --
NM_019001chr3154786 4773 4287 3908 3788 3644 3557 3117 3030 1777 1498 1123 929 688 614 11136 44592 1891 425 121 --
NM_019022chr18112715 2543 2518 2490 2454 2413 2300 2258 2187 1158 609 61266 1259 447 418 225 65 22461 819 --
NM_019044chr254723 3998 3983 3781 1711 23840 1439 23938 1695 14435
NM_019050chr4122282 2120 1803 1754 1725 1554 727 689 639 449 383 287 12307 --1709
NM_019072chr5113441 3234 3163 2880 2873 2690 1327 1290 1260 1090 387 44070 4046 3654 2653 ----
NM_019080chr134620 530 399 133 11499 146 11243
NM_019094chr12113208 3117 2946 2597 2516 2374 595 505 497 420 104 --31207 762 210 12448
NM_019117chrX103335 3193 2337 1321 1225 1084 874 685 653 613 11378 13162 --
NM_019593chr2082637 2529 2404 1016 987 778 650 305 21186 218 21261 1211 12454
NM_019903chr1071640 732 561 518 343 321 202 21337 1290 1542 --
NM_020116chr431603 1499 1141 51634 1511 113 91 70 21544 312 --
NM_020122chr2135280 4927 4436 4409 4101 3806 2296 1849 1008 847 805 779 424 21342 1303 21891 1752 --
NM_020139chr472065 1894 1494 1438 1423 1355 1312 21457 1389 1673 --
NM_020141chr151724 1706 652 499 411 1815 --21591 518
NM_020148chr1882939 2794 2717 2652 1005 796 124 108 33098 2905 988 12830 --
NM_020159chr451292 1164 1120 440 381 2613 548 21565 187 11109
NM_020177chr5143392 2896 2890 2716 2556 2243 2144 1287 944 781 765 396 345 232 43040 2590 955 148 --1824
NM_020205chr193017 2580 2465 2324 2214 2152 707 501 463 23466 3240 53477 3311 3291 2946 2761 --
NM_020228chr1192271 2100 1877 1752 832 569 530 255 238 192 21715 873 --
NM_020245chr6115120 5086 4651 4532 4185 3961 3534 3435 3396 1591 1219 33304 3250 1649 23239 1777 --
NM_020337chr4113151 2953 2937 2742 2488 2473 2073 1255 896 298 201 ------
NM_020342chr252421 2316 1858 127 118 1548 32048 1709 642 11024
NM_020390chr3103951 3501 3351 3041 1822 1568 1242 727 442 199 54376 3897 3886 3193 411 33307 1922 1302 --
NM_020420chrY101732 1652 1553 1480 564 417 175 167 149 120 1342 167 1547
NM_020455chr6112560 2264 2093 2062 1896 987 785 286 278 177 130 22401 866 32522 2231 1017 12382
NM_020456chr1352073 1897 1477 296 156 ----32252 459 368
NM_020474chr1891857 1632 1516 780 697 597 585 536 398 --31757 1729 389 1816
NM_020638chr1262095 2036 2026 2018 2010 821 11882 31800 257 116 --
NM_020640chr371887 1822 1724 1704 1696 1560 609 1907 1525 --
NM_020648chr18122763 2693 2360 2228 2095 1956 1047 995 739 718 648 128 22736 1106 22643 2295 --
NM_020673chr20197615 7130 6649 6312 5783 5540 4836 3026 2847 2712 1632 1530 1439 1428 1250 955 740 387 313 67402 6409 5749 4861 3050 1505 11710 11496
NM_020699chr185196 4919 3537 3286 1759 1443 1139 689 14483 34217 1665 569 21631 753
NM_020704chr7122556 2489 1995 1799 1691 1586 1537 473 466 453 447 384 --2426 312 11010
NM_020718chr16226580 6089 5758 5610 5554 5522 5438 5325 5030 4842 4585 4483 4453 4343 2598 2535 2109 1914 1664 1190 1047 830 76620 6515 6419 6184 5795 1788 1466 56242 6021 4749 1761 853 --
NM_020727chr21144045 3801 3737 3432 3272 2789 1525 1481 1143 617 250 128 113 42 --13233 23488 591
NM_020739chr15154196 4093 4075 3762 3645 3548 3486 3360 1232 1091 796 754 356 292 244 23322 3041 33806 3683 941 --
NM_020742chrX72491 2255 2144 2042 1693 1036 881 --1473 2523 408
NM_020748chr1772098 2019 1783 1500 629 533 500 1790 2702 289 11540
NM_020752chr1072411 2151 2041 1904 775 395 355 22889 2573 11152 12419
NM_020766chrX124079 3772 3735 3426 3363 1647 1610 998 977 943 920 481 44596 3853 1720 295 --14301
NM_020768chr5152842 2733 2303 2196 2079 2073 1301 1139 886 769 692 410 187 65 47 1469 1417 --
NM_020771chr641284 1174 1114 217 1557 --21382 1278
NM_020772chr17278699 8691 8380 7864 7639 7611 7135 7031 6949 6921 6871 6775 6389 6005 5489 3372 3321 3012 2149 1728 1436 1367 1349 1328 1225 691 555 58609 7735 7204 6143 217 58642 8447 2655 2331 1235 --
NM_020774chr18226033 5904 5821 5631 5563 4929 4672 4140 3970 3908 2095 1762 1693 1686 1676 1505 1256 541 319 203 177 78 36164 4425 2236 36225 4920 2172 14078
NM_020782chr12114311 4141 3939 3230 3218 1842 1807 1264 1088 862 41 23028 823 34329 4228 1237 --
NM_020794chr151355 985 977 275 77 41434 1285 996 60 ----
NM_020802chr11113364 3003 2836 2490 1125 1040 990 591 375 346 132 33170 3121 2684 1638 2186 150
NM_020810chr14132949 2931 2515 2225 2200 1191 699 618 593 544 400 74 55 11166 ----
NM_020830chr253089 2548 2021 1029 228 13009 1678 23073 2104
NM_020841chr12124078 4021 3684 3531 3383 3295 3075 1337 1192 627 447 432 73628 3342 3285 3121 2471 647 618 13752 11098
NM_020844chr8147706 7504 6843 6804 6496 5957 5581 1700 1472 1415 870 523 447 76 36307 4847 2845 1562 27175 1379
NM_020870chr4102246 2059 1936 1916 1379 855 849 641 442 380 11775 12135 --
NM_020872chr361612 1548 1439 1400 1131 326 21822 1754 --1212
NM_020909chr273040 1160 1097 476 433 171 121 43686 939 631 469 53933 3781 1569 1384 267 22917 555
NM_020917chr19112926 2845 2597 1333 1172 1125 1071 720 587 479 98 11102 33383 2384 1154 11350
NM_020918chr10113442 3275 2807 2694 2622 2516 1428 1367 1359 1152 693 21402 602 ----
NM_020921chr14153686 3604 3119 3066 2828 2749 2633 2289 1175 1127 1019 956 705 229 211 62241 1045 877 620 413 218 22866 363 --
NM_020935chr2104660 4419 3905 1796 1354 1076 660 651 89 83 23292 3263 23633 775 --
NM_020948chr1203333 2831 2820 2654 2602 2375 1291 1129 979 943 917 842 785 686 413 354 220 165 109 53 52674 2410 2394 1058 281 11245 1559
NM_021005chr1571170 474 332 296 270 152 110 1137 --1777
NM_021007chr282371 2276 2038 1606 643 510 307 301 2700 413 ----
NM_021032chr371943 1870 1294 1264 610 525 475 21549 1501 11822 --
NM_021033chr13112743 2702 2629 2429 2269 1356 1252 821 679 526 440 23539 3416 ----
NM_021045chr1091750 1676 935 665 407 256 172 157 31 --2675 86 1216
NM_021101chr392424 2398 2303 2261 2246 1836 906 218 86 32440 2311 720 22521 2088 --
NM_021116chr7128871 8338 7302 7071 6650 6475 6052 5759 5532 2756 1090 979 15545 27771 1033 --
NM_021148chr751958 690 493 446 221 22433 1703 --1412
NM_021163chr7143719 3658 3645 3555 3021 2592 2435 1060 832 787 759 562 556 141 13284 4968 450 350 236 1701
NM_021183chrX142517 2504 2489 2157 2004 1968 1874 1802 1790 1783 1696 1031 798 683 21611 807 22015 54 --
NM_021255chr14123998 3949 3209 3060 2614 1386 1197 1053 386 299 69 50 44054 3185 1083 876 23546 2795 2633 361
NM_021622chr1092177 1807 1667 1619 1543 931 848 762 518 2813 491 21853 732 --
NM_021629chr3144223 4198 4135 3785 3640 3587 1947 1906 1697 1519 1064 823 644 102 24323 4277 2851 652 --
NM_021813chr695821 5787 5696 4224 2017 1270 898 705 408 24642 1109 22133 353 13874
NM_021815chr283026 2599 2302 1946 1156 880 818 349 32536 1065 950 ----
NM_021911chr5154933 4885 4514 4478 3975 3691 2197 2100 1954 1708 1691 1273 1239 873 690 15554 14953 --
NM_021912chr1593799 3723 3306 2869 1614 1580 1131 1047 69 24222 4105 12970 --
NM_021914chr1472251 2104 1747 1725 1685 959 555 22469 526 21982 883 --
NM_021954chr13133183 2653 2562 2506 1361 1064 1054 1032 964 941 723 559 481 33724 2929 521 12615 --
NM_021961chr11227243 6795 6736 6310 6079 6034 5785 5699 5018 2647 1685 1658 1468 1450 1050 976 962 925 653 531 232 206 47191 6637 6200 2525 46456 5962 5914 4619 --
NM_021964chr3246094 6082 5998 5870 5397 5236 5085 4918 4874 4644 4208 2456 2138 1914 1862 1528 1475 1283 1049 977 815 458 374 335 76438 4852 4812 4348 1925 445 93 66327 5535 5476 5452 4666 801 1354
NM_021988chr2041291 651 633 79 --11110 21555 141
NM_022114chr174780 4209 3476 3113 2907 1667 837 14769 34435 652 568 11398
NM_022133chr851482 1185 521 370 239 51348 735 476 130 44 1143 --
NM_022351chr8173825 2778 2693 2650 2641 2557 1410 1368 1274 1254 1195 1049 962 858 753 383 173 23624 2900 --22628 455
NM_022442chr2041291 651 633 79 --11110 21555 141
NM_022456chr12167583 5518 5455 4735 2846 2629 2428 1905 1724 1612 1508 1099 842 614 520 486 15736 26035 5961 --
NM_022459chr13185831 5483 5364 5095 5031 4780 4583 4558 4332 3868 2180 2143 1752 1243 551 354 261 248 56333 4992 4568 1231 348 --15418
NM_022461chr361324 322 315 293 102 66 1540 190 31345 1108 1085
NM_022483chr551475 1434 1266 647 364 ----2533 332
NM_022716chr172847 2832 2646 2475 2362 2143 1015 1698 42575 1131 862 330 --
NM_022763chr3103132 3074 2795 2753 2364 2346 1093 1011 692 275 32400 284 120 22825 2427 --
NM_022771chr1291106 1036 937 898 780 351 300 267 73 3925 718 156 ----
NM_022781chr993278 3223 3211 2921 2879 2406 2346 1004 963 22161 23 1835 12584
NM_022841chr1562663 1995 1944 899 625 223 12204 21807 924 1913
NM_022898chr14124812 4726 4578 4129 3495 3262 3033 2933 1488 1429 1222 1154 --23922 311 1451
NM_022918chr1191922 1850 1836 1720 1511 1340 489 452 153 11608 11827 --
NM_022977chrX112654 2606 2123 1661 1650 1639 880 673 247 203 64 22210 932 1353 2919 394
NM_023016chr2102892 2874 2435 2361 2214 2050 856 850 753 186 --12866 --
NM_023929chr8172798 2694 2685 2527 2485 2415 2372 2204 2152 1925 1842 1125 740 726 690 480 159 ------
NM_024345chr9275946 5904 5892 5857 5840 5823 5597 5571 4964 4654 4084 3988 3917 3880 2368 2360 2171 1772 1408 887 663 633 609 483 448 98 50 25789 718 25970 2407 15533
NM_024408chr1103695 3340 2877 2502 1390 891 755 409 396 221 --13644 13205
NM_024423chr18153915 3571 3352 3220 3100 2927 2670 1556 1440 1376 1235 1091 621 440 21 22956 182 32696 1661 1635 13029
NM_024430chr1841711 1694 627 531 3717 436 146 --3649 202 139
NM_024511chr4102605 1415 1403 1371 942 864 582 323 89 80 12398 31253 936 308 --
NM_024524chr3173230 2981 2639 2485 2450 2353 2295 2258 2113 2107 1058 963 948 888 843 420 256 --21155 308 --
NM_024607chr8124067 3990 3787 3770 3724 3676 3341 3205 2833 1512 1250 942 23707 1712 24390 1504 --
NM_024624chr291634 1547 1432 1239 1210 1064 364 290 243 21681 1314 --11168
NM_024636chr782877 2685 1037 902 817 260 160 112 22305 617 11115 11145
NM_024646chr1153959 3915 3759 3518 3466 3172 3060 2673 1486 1273 975 598 404 295 273 --33869 3419 232 11355
NM_024665chr3124286 3880 3563 3338 1714 1637 1624 1275 1032 676 669 478 33401 1610 1374 34160 4016 258 --
NM_024744chr282564 1980 1746 792 692 533 465 411 82453 1928 1883 1795 1772 1019 262 24 --1665
NM_024749chr161528 1504 1478 631 553 105 1835 1267 21965 590
NM_024751chr472131 1900 1771 1587 1355 843 820 12077 --11619
NM_024761chr9125172 5068 4928 4038 3758 3317 2120 1744 466 440 339 262 1989 23491 2072 --
NM_024770chr2105208 5163 4458 4237 4147 1269 875 552 525 104 22213 229 12279 --
NM_024818chr371552 1517 1505 1061 459 67 55 21472 1420 ----
NM_024828chr951395 1247 558 490 23 21004 73 --1425
NM_024947chr3168867 8610 7434 6227 6199 5918 5884 3314 2921 2884 2821 2183 1837 1500 607 534 49344 7110 6028 2223 22891 2097 --
NM_024949chr4134930 3546 1635 1562 1556 1502 1459 1397 1226 1018 799 147 68 11186 --11810
NM_024989chr2188217 7584 6588 6113 5759 5693 5164 3210 3166 3022 2918 2584 1998 1616 1357 1325 411 139 57722 6889 5824 1818 1164 36170 5903 2957 2462 323
NM_024991chr1093172 2872 2849 2787 2436 2383 2012 851 23 12910 32820 2483 2285 --
NM_025054chr8194156 3978 3929 3780 3376 3333 2632 1623 1439 1217 1206 1121 991 926 615 443 371 263 199 33196 2564 818 33752 1650 539 --
NM_025073chr1154682 4525 4320 3659 1662 1483 1458 1449 1184 1155 1076 201 96 47 27 21148 386 1373 --
NM_025134chr1682479 2080 1867 962 935 809 553 183 12041 --22569 613
NM_025160chr1144227 4014 3664 2890 2727 1452 1359 1103 948 929 875 853 617 453 24245 1212 13715 21087 359
NM_025191chr1103295 2881 2817 2707 2275 1420 1338 1330 721 301 63539 3200 3062 2616 2524 2245 ----
NM_025235chr1072128 2061 1895 1770 1759 803 490 2684 609 --22173 140
NM_030621chr14164015 3941 3727 3698 3545 3105 2807 2797 2744 1322 1117 1046 822 578 180 126 21191 120 44176 3807 2998 1432 33679 3192 1570
NM_030627chr583884 3738 3566 3560 2810 2628 2591 547 63703 3265 1435 1313 1128 776 1229 --
NM_030647chr7146215 6107 5690 5627 5084 4606 3894 2324 1853 958 528 404 346 269 24865 1559 --12235
NM_030648chr4115421 5195 5012 4340 4169 4130 4057 3604 1818 1031 1002 65567 3850 3625 1873 787 180 45356 3914 2228 1567 --
NM_030664chr1092470 2289 2098 1600 1579 1511 667 483 477 1331 ----
NM_030674chr12165846 5731 5490 5090 5070 5004 4247 4235 4186 3838 2348 1640 1608 1109 229 189 55101 4898 4564 2270 89 1216 --
NM_030755chr14123014 2620 2416 2338 2166 990 873 840 820 644 503 172 43111 2953 301 250 33122 607 432 23038 775
NM_030777chr2042104 950 925 22 22399 1596 --22455 2299
NM_030791chr1471728 1443 1408 1391 1296 729 621 21618 1557 --1104
NM_030799chr561876 1741 1550 883 825 309 1106 32011 1492 855 --
NM_030816chr1103170 2621 2245 1458 1340 1176 868 303 165 105 ------
NM_030817chr1283425 3326 3076 2945 1456 1380 448 63 23141 2811 --12294
NM_030885chr392274 1952 1482 911 880 796 683 601 480 --32010 1928 1878 --
NM_030918chr1104759 4688 4524 3840 2000 1260 991 976 640 351 43882 3568 1423 435 1476 --
NM_030920chr1112087 1760 1529 1505 1495 1465 1292 638 365 224 201 11699 12002 --
NM_030934chr191728 1713 1571 1351 648 572 280 210 181 --2724 304 --
NM_031216chr1892095 2054 1899 1387 888 836 802 701 505 ----12177
NM_031243chr792321 1968 1837 1717 518 387 375 344 336 22209 451 ----
NM_031296chr472763 2254 2031 1822 1741 201 158 32540 2169 79 --12005
NM_031411chr591888 1844 1826 1802 1630 519 378 371 252 22020 903 21944 1667 --
NM_031427chr14145600 5307 4830 4810 3979 3840 2030 1755 1446 1423 975 228 104 60 55265 3860 2139 1154 866 14455 1631
NM_031435chr12113358 3165 2951 2636 2381 1236 490 328 221 122 97 2936 464 22911 168 --
NM_031469chr6124138 3865 3854 2912 2676 1603 1445 1358 1172 716 480 356 42739 2696 2573 1002 11562 11436
NM_031483chr20113407 3230 3224 3072 2517 1404 1394 1314 1112 727 388 32549 1355 145 33095 244 225 --
NM_031844chr1144006 3696 3498 3019 2890 2731 2648 2562 1601 1317 1023 915 823 578 53917 3045 2882 1652 342 --11131
NM_031845chr2123655 2832 2403 2299 2256 2235 1217 974 962 715 474 176 --13302 --
NM_031847chr2123655 2832 2403 2299 2256 2235 1217 974 962 715 474 176 --13302 --
NM_031849chr591888 1844 1826 1802 1630 519 378 371 252 22020 903 21944 1667 --
NM_031857chr591888 1844 1826 1802 1630 519 378 371 252 22020 903 21944 1667 --
NM_031860chr591888 1844 1826 1802 1630 519 378 371 252 22020 903 21944 1667 --
NM_031940chr8102365 2151 1951 1558 809 798 516 483 223 173 1500 22024 161 --
NM_032012chr9135078 4748 4524 3892 3434 1996 1874 1754 1251 878 257 42 35 54799 4771 4384 4272 1849 1290 --
NM_032047chr392378 2295 2081 1736 1644 1513 851 255 204 32032 635 411 31608 1584 314 --
NM_032105chr1138057 6907 6699 5610 5376 5212 2984 2672 1396 1345 1205 1081 338 46726 5291 1369 150 26045 3003 21474 1382
NM_032116chr13175290 5217 4771 4690 4647 4487 4027 3965 3767 3564 1380 1247 1166 754 537 80 55 75893 4882 4606 3904 500 478 311 65014 5000 4978 1794 1504 87 --
NM_032145chr691953 1645 1560 1541 1421 546 430 378 294 21735 103 2390 201 --
NM_032154chr1071056 995 783 772 250 242 69 11076 1226 1793
NM_032160chr18133002 2932 2829 2736 1564 939 489 306 299 267 242 225 143 63151 3139 3125 3061 3020 926 32924 644 23 --
NM_032186chr171432 1272 1212 1049 979 52 46 1453 1218 --
NM_032291chr171577 1559 1550 1532 1481 665 65 41504 748 405 337 11744 11849
NM_032352chr1461440 1309 1286 352 301 183 21455 27 --1457
NM_032373chr10155760 4289 3644 2345 2085 2061 1914 1849 1795 1681 1530 1347 696 443 105 65601 5220 4228 3705 1830 1783 45059 4457 3736 1961 --
NM_032440chr10122957 2934 2775 2606 2425 2167 2106 2041 1048 765 178 117 22646 621 2749 549 --
NM_032445chr1592625 2569 2461 1992 1633 1003 968 730 176 21714 1029 22077 1999 --
NM_032446chr5103451 3421 2896 2663 2650 2558 900 796 616 349 42914 2700 600 416 23506 3307 13131
NM_032521chr2093070 3057 2977 2943 2663 2605 2472 2408 227 33001 2684 193 ----
NM_032778chr3103298 3187 3173 2521 1188 577 479 388 362 91 2718 236 22687 1049 12486
NM_032801chr1171764 978 872 793 755 742 184 ----1949
NM_032828chr19114923 4847 4698 4644 3991 3249 1519 1140 1096 1052 401 ----14574
NM_032832chr651664 1488 1419 197 156 ----1187
NM_032859chr13164009 3944 3875 3861 3069 3040 2881 2733 2471 1189 1159 813 747 617 587 275 33362 2904 2704 --1741
NM_032968chrX104043 3220 2889 1709 1641 1591 1193 622 90 24 53630 3162 975 396 53 1867 24014 216
NM_032969chrX104043 3220 2889 1709 1641 1591 1193 622 90 24 53630 3162 975 396 53 1867 24014 216
NM_032973chrY94035 3215 2884 1703 1590 1193 622 90 24 53622 3157 975 396 53 1867 24006 216
NM_032975chr18113460 2992 2962 2951 2725 2402 1460 1393 1350 595 238 22687 785 2503 480 --
NM_032980chr18113460 2992 2962 2951 2725 2402 1460 1393 1350 595 238 22687 785 2503 480 --
NM_033020chr1184862 4781 4701 4398 4290 3748 3587 3105 3001 1725 1581 1548 1491 951 848 512 381 218 44219 4156 3922 3184 23113 3062 13792
NM_033030chr231549 1111 165 11587 41675 1504 1495 175 --
NM_033143chr4154202 4190 3961 3950 3872 3616 3502 3490 3450 3277 1304 1179 1129 513 319 43893 1681 1672 1657 23314 1589 --
NM_033211chr572111 1579 1549 749 691 601 149 ----2445 366
NM_033224chr7207590 7489 7391 7091 6903 6863 6053 6034 5695 5641 5075 2825 2288 2045 2021 2009 1622 1237 791 602 12315 46496 5474 2693 1409 --
NM_033285chr894295 3841 3693 2775 1267 846 735 601 514 2390 157 54312 4023 3906 3677 2924 --
NM_033360chr12134603 4554 4272 3886 3427 3350 1821 1432 958 928 907 373 43 44175 3969 1561 575 43518 3443 1373 287 13663
NM_033426chr1482922 2654 1906 1179 1062 714 680 642 12165 12912 22873 2719
NM_033429chr15113247 3022 3001 2753 2737 2247 2019 1184 1068 477 197 12776 --12791
NM_033430chr471581 1551 1469 1335 1224 1021 967 13811 11387 32835 956 30
NM_033437chr471581 1551 1469 1335 1224 1021 967 13811 11387 32835 956 30
NM_033480chr692560 2386 2201 1122 499 346 261 250 151 32353 2194 335 22118 708 --
NM_033481chr692560 2386 2201 1122 499 346 261 250 151 32353 2194 335 22118 708 --
NM_033505chr2155692 5667 5536 5244 5228 4708 4663 4154 2182 1861 1810 1564 1428 997 654 54821 2684 2053 1483 1401 54359 1271 866 746 157 --
NM_033656chr21125914 5428 4409 4218 4049 3892 3783 3769 3696 2209 868 356 65958 4815 4346 1197 885 661 45244 4440 4115 3831 --
NM_052811chr13154536 4483 4455 4330 3414 3254 3219 2015 1835 1814 815 806 744 70 39 34980 1710 888 14044 1171
NM_052832chr8112903 2862 2591 2526 2335 1890 1855 1124 965 518 389 ----12019
NM_052879chr12184103 3978 3705 3658 3055 2979 2679 2543 1266 1160 1043 993 855 761 753 614 450 425 53734 3671 2537 1392 326 21298 292 22666 635
NM_052885chr12124901 4588 4422 4414 4155 3676 3591 3395 3090 1723 1305 1246 43804 3757 3462 1219 64274 4098 3261 1996 739 214 34858 4495 3253
NM_052917chr2133314 3258 2682 2144 2070 1232 1218 1019 940 903 515 175 94 --23405 1322 --
NM_052937chr862058 1674 1057 760 567 302 22259 324 32361 654 577 --
NM_053016chr9197464 7022 6991 6983 6656 5758 5625 5164 5127 2917 2834 2687 2236 1709 1625 1279 850 744 328 --27751 4864 --
NM_053064chr1462752 2548 2420 2309 2237 896 22780 1948 43099 2859 2826 807 --
NM_057178chr17102843 2757 2704 2462 1987 1023 954 620 563 433 1978 22581 730 --
NM_078473chr8102365 2151 1951 1558 809 798 516 483 223 173 1500 22024 161 --
NM_080546chr972334 2126 1981 1825 1641 829 498 22013 389 32269 579 335 --
NM_080629chr1101464 1436 1376 1289 1036 1011 995 975 270 79 --11450 --
NM_080630chr1101464 1436 1376 1289 1036 1011 995 975 270 79 --11450 --
NM_080664chr1471928 1714 1588 687 646 234 64 11425 11875 --
NM_080676chr20113300 2480 2250 2153 2062 989 979 902 610 429 197 --12001 --
NM_080759chr1372512 2481 1981 882 566 165 111 1138 32572 2288 2139 --
NM_080760chr1372512 2481 1981 882 566 165 111 1138 32572 2288 2139 --
NM_080764chr22103212 2961 2183 2152 2064 1266 1179 847 666 169 ----13253
NM_080867chr14145085 4295 4080 3991 3960 3293 3246 1996 1986 1029 975 948 637 128 34655 3208 1234 33499 1481 322 --
NM_080872chr8164035 3572 3237 2939 2614 2479 1622 1416 1092 1012 865 330 251 147 124 97 33561 2782 531 12870 22838 2690
NM_130809chr562786 2525 2160 1126 568 290 2663 277 21946 865 --
NM_130838chr1561848 1506 641 204 90 65 21189 57 ----
NM_130839chr1561848 1506 641 204 90 65 21189 57 ----
NM_133329chr261758 1263 1232 1225 1211 495 1507 11434 --
NM_133334chr4125226 4286 4231 2050 1967 1939 1480 1464 1069 571 250 154 15073 25936 5091 11348
NM_133370chr463404 3296 2494 2374 1251 108 23489 83 32241 1290 866 13092
NM_133372chr5102826 2788 2735 2212 1082 751 221 205 80 24 --21991 276 --
NM_133477chr4143269 3129 3116 3080 2897 2217 2084 1236 1104 870 724 394 255 135 52334 2057 1295 991 86 22595 458 --
NM_133493chr6164580 4474 4346 3819 3812 3555 2937 1806 1673 1480 1471 1368 550 520 252 170 24274 3661 11152 --
NM_133496chr1144454 4215 4040 3756 3601 3528 3035 2809 1277 1246 483 374 95 40 21172 183 23365 2925 --
NM_133646chr2125433 5257 4889 4656 4594 4239 4018 3593 2085 2022 1128 787 11205 35484 1551 249 11475
NM_133647chr15103870 3662 3007 2863 2640 1312 1057 1050 713 319 33089 612 444 23379 1163 --
NM_138270chrX83458 3397 2515 925 789 756 302 289 42842 1298 370 352 22778 1232 --
NM_138286chr19114399 3802 3591 3567 2751 1445 1080 898 740 479 163 32795 2789 1538 33767 3412 227 1445
NM_138288chr1492028 1956 1871 1787 1766 1670 460 438 54 2826 518 --12103
NM_138292chr11143515 3496 3088 3005 2876 2707 2496 2463 2456 2255 826 617 599 43 53556 3346 2639 2630 967 11197 --
NM_138333chr9101959 1800 1715 1621 969 851 713 591 518 124 --1657 12086
NM_138348chr5136554 6190 5313 5128 4720 4402 2334 2323 1975 1529 1100 459 171 --16253 --
NM_138400chr752696 2461 688 649 290 23459 2195 2382 137 13263
NM_138426chr782502 2380 2370 2320 2310 2268 1786 52 --22360 992 1928
NM_138444chr13154853 4825 4731 4582 4446 4325 4309 4242 4147 3985 3473 1471 615 572 408 13881 33694 1344 1081 13466
NM_138459chr6103627 3547 3443 3062 3056 2736 2365 1188 1000 893 53266 3151 2728 2446 788 53602 3123 3080 1420 1083 --
NM_138468chr2116383 4829 4777 4624 4312 4297 2417 1982 1188 533 378 16301 56281 6125 4649 2043 914 25894 283
NM_138473chr12105194 5040 4703 4514 4247 4140 1480 1175 1043 984 34830 3794 3520 13605 11579
NM_138576chr14124812 4726 4578 4129 3495 3262 3033 2933 1488 1429 1222 1154 --23922 311 1451
NM_138621chr2174164 4108 3274 3205 2948 2727 2534 1564 1517 1117 810 778 706 497 488 390 190 23290 2566 23905 203 --
NM_138638chr1472251 2104 1747 1725 1685 959 555 22469 526 21982 883 --
NM_138694chr6103600 3503 3375 3047 2829 1174 1162 900 707 615 12657 22485 721 --
NM_138713chr16187334 6086 5352 5311 5257 3060 2792 2769 2094 1916 1671 1639 1134 1104 1075 1004 802 128 26355 2984 38162 4989 2701 12038
NM_138714chr16187334 6086 5352 5311 5257 3060 2792 2769 2094 1916 1671 1639 1134 1104 1075 1004 802 128 26355 2984 38162 4989 2701 12038
NM_138715chr841353 1347 346 97 21839 785 22203 217 2718 262
NM_138731chr14103935 3857 3459 3109 3090 2646 2632 1188 1170 1025 43697 3276 3084 933 11044 11156
NM_138771chr761472 1422 1207 1033 233 168 21318 1302 21501 1026 --
NM_138782chr5112388 2350 2256 2174 1961 1897 1843 747 453 413 336 21767 727 31522 404 257 --
NM_138799chr271819 1793 1572 1560 1504 1486 357 --2498 133 11696
NM_138811chr761237 1015 905 881 443 63 41072 318 239 201 2917 280 1141
NM_138959chr1136277 6091 5829 5683 5406 5248 5200 5088 4414 2640 2561 2213 1864 35815 2390 2147 --15841
NM_139048chr361248 969 811 264 150 61 41231 1054 1040 417 --1309
NM_139076chr431397 560 348 41274 1250 582 464 125 1452
NM_139207chr1292237 2118 1773 1706 1588 1469 824 645 502 3746 675 657 32204 2138 1837 --
NM_139279chr2103390 3182 3155 2963 2881 2786 2405 904 842 537 13541 22433 566 --
NM_144567chr142765 2619 321 105 22294 2221 42654 1910 1137 1090 22723 1121
NM_144571chr4196921 6484 5768 5743 5668 4447 4440 4407 2660 2622 1975 1892 1370 1068 961 823 563 448 212 55292 2423 1566 737 511 21508 1487 22297 1416
NM_144578chr14145467 5000 4925 4607 4339 4276 4106 4085 3940 1491 1413 845 711 285 34639 4405 1304 35423 5341 749 --
NM_144632chr282362 2047 1943 1898 1785 717 336 142 3866 494 425 136 --
NM_144664chr1182228 880 836 665 601 539 458 41 31796 962 488 11893 --
NM_144721chr4112401 2324 1971 1928 1777 930 896 401 326 269 48 22624 1097 32606 2468 171 --
NM_144775chr17144972 4910 4818 4093 4034 3560 3458 3437 3397 3047 3007 1365 1231 101 14600 ----
NM_144949chr2112645 2585 2464 2361 1860 1000 905 655 627 603 378 31627 1050 945 12634 --
NM_144973chr12125244 4901 4325 3999 3769 3710 3464 1705 1280 807 597 246 35162 4706 3755 11969 34050 2031 183
NM_145055chr18123794 3680 3404 3120 2811 2690 1145 1096 380 243 206 69 11468 32659 2449 1169 --
NM_145174chr2251322 1019 449 201 63 31475 987 243 21126 415 --
NM_145207chr4175240 5104 4870 4322 4312 4304 3772 2094 1989 593 430 386 194 150 88 65 48 45126 4789 4054 127 44943 4186 3862 217 --
NM_145259chr2156752 6676 6096 5943 5642 5604 5479 5017 4798 4682 4337 2388 2295 2029 313 36876 5270 4659 26389 5541 22728 1352
NM_145284chrX102572 2227 2123 2086 809 489 386 375 108 99 12544 22502 404 --
NM_145307chr10144159 3236 3211 1728 1665 1157 902 891 832 560 476 458 390 320 23397 1251 24471 595 1764
NM_145808chr763124 2455 2413 1969 699 133 22924 1040 --11023
NM_147189chr892372 2215 1970 1515 933 741 543 346 215 11486 --12082
NM_147223chr262436 2369 2342 2085 1571 357 1453 22117 261 1209
NM_147233chr272253 2186 2159 1902 1388 912 174 2846 270 21934 78 126
NM_148174chr892250 2075 1528 753 679 562 551 463 32 21552 211 32020 1474 1395 1192
NM_148955chr15136555 5310 5251 5043 5001 4518 2438 2099 1764 513 492 473 244 32451 1840 1784 36510 4980 1442 12052
NM_148957chr1352605 2442 2135 928 314 --12484 22635 597
NM_152261chr1292567 2167 2001 1930 1817 1768 1557 687 508 1313 --1519
NM_152263chr1145050 4786 4716 4240 2041 2022 1829 1513 1375 1253 945 923 900 885 14686 21744 1281 --
NM_152271chr881145 1135 1086 952 475 460 372 240 1439 --2927 101
NM_152275chr262384 2208 2032 909 675 637 1129 42334 2265 803 588 11567
NM_152280chr1113536 3228 2999 945 790 758 725 685 670 639 113 12599 ----
NM_152388chr2154066 4058 4038 4031 3362 3213 3120 3079 2859 2840 1228 1135 820 577 101 1369 2671 442 --
NM_152400chr471560 1303 1295 411 328 91 58 1135 31778 1725 692 1847
NM_152409chr552571 2366 1272 871 109 43502 2874 2722 724 13233 --
NM_152422chr951852 1527 1339 682 215 --31396 1359 534 1604
NM_152475chr1992775 2696 2478 2425 1771 900 802 479 267 --12735 22353 621
NM_152522chr21813 2975 747 2926 820 1313
NM_152542chr4132181 2015 1960 1759 1493 1457 1437 1418 653 569 428 386 361 1419 ----
NM_152581chrX41450 940 311 191 1987 11401 21035 496
NM_152594chr1562362 2317 2040 1996 426 47 32174 2064 349 31949 1498 891 --
NM_152622chr5123407 3381 3179 3136 2950 2534 2468 2308 2208 2147 1139 1019 12909 32770 753 87 --
NM_152624chr5186954 6761 6602 6409 6376 5705 5336 2927 2874 2731 2615 2536 2173 1972 1622 1507 1452 50 67062 6341 5607 2212 227 201 66226 5592 2848 2379 1247 822 15792
NM_152629chr942746 2586 2499 1046 24123 2620 34107 3324 1268 23416 252
NM_152636chr11123063 2645 2105 1951 1015 975 968 912 843 500 379 245 2851 276 2748 176 --
NM_152641chr1292771 2538 2429 2209 1845 1053 783 713 457 1594 32163 1180 1089 12034
NM_152673chr384449 3992 3564 3233 2895 1699 1042 583 34201 1006 595 ----
NM_152695chrX122323 1979 1717 1600 799 712 593 580 573 468 253 202 --1555 --
NM_152705chr1341364 1300 313 304 4554 410 298 213 --1473
NM_152754chr7123411 3232 3169 3110 2842 2768 2662 2604 2422 1306 674 320 23767 581 22850 538 32988 373 281
NM_152756chr5164228 4008 3914 3569 3449 2874 2800 2761 2720 2665 1714 1240 1222 1147 1036 923 21539 731 --12770
NM_152758chr8102952 2946 2835 2427 2283 2208 765 729 579 326 32801 884 27 13007 12810
NM_152789chr781327 1276 1183 947 380 320 114 98 11227 155 --
NM_152793chr7114725 4328 4229 3413 1649 1372 1233 913 883 477 195 54885 1933 1012 293 257 11904 13581
NM_152826chr15136555 5310 5251 5043 5001 4518 2438 2099 1764 513 492 473 244 32451 1840 1784 36510 4980 1442 12052
NM_152835chr192616 2089 2071 1935 1866 986 685 214 118 12890 72852 2475 2141 2129 517 341 241 --
NM_152836chr851482 1185 521 370 239 51348 735 476 130 44 1143 --
NM_152837chr851482 1185 521 370 239 51348 735 476 130 44 1143 --
NM_152838chr20153332 3050 2837 2672 2525 2304 1400 1189 1014 1008 568 490 427 406 389 12731 1941 12404
NM_152890chr161081 1013 964 955 940 273 21061 260 ----
NM_152902chr1122058 1929 1863 1638 1430 1335 791 611 519 483 226 107 2578 206 --1563
NM_152924chr15176772 6715 6310 6275 5356 5097 4774 4723 2759 2227 1972 1754 1337 802 738 551 528 --22369 1822 16906
NM_152999chr7194256 4118 4040 3968 3750 3603 3433 3360 1905 1737 1593 1473 826 667 605 539 401 347 192 13819 24314 123 23582 3169
NM_153035chr142859 2361 346 111 11241 22803 700 21035 914
NM_153042chr671760 1553 672 643 321 309 268 41792 1258 495 200 147 1606
NM_153182chr3103298 3187 3173 2521 1188 577 479 388 362 91 2718 236 22687 1049 12486
NM_153188chr5175561 4949 4818 4564 3776 3543 3528 2218 2197 2078 1346 1038 951 599 488 474 337 44107 2061 1275 823 34033 2039 1809 --
NM_153207chr12154064 4052 3953 3646 3530 3491 3475 3407 3320 3153 3073 3042 1543 1231 1105 33401 2528 1647 ----
NM_153223chr5121303 1214 1124 1048 1020 613 605 584 491 294 122 42 --11345 --
NM_153235chr632231 316 296 22281 263 12201 11915
NM_153262chr1123076 2988 2919 2780 2012 2000 1214 1157 1113 834 354 280 --21126 627 1256
NM_153332chr8153295 3123 2017 1313 1296 1274 1200 1077 919 618 510 489 251 159 36 21178 478 33274 3050 2524 --
NM_153346chrX81935 1906 1524 1444 1397 1313 322 57 21629 1596 11286 --
NM_153371chr1362020 1989 1964 1550 453 46 11586 32145 960 895 --
NM_153456chr13126298 5936 4222 3958 2533 2521 2222 1335 1086 938 898 164 14423 35644 1424 974 --
NM_153645chr2293231 2891 2854 2583 2473 2361 2056 1205 243 12237 23014 2394 12648
NM_153686chr482321 2057 1985 1773 1539 346 299 240 42449 2338 872 257 21719 193 --
NM_153688chr1681333 1260 1208 660 447 411 166 92 31429 386 321 2633 405 --
NM_170710chr4102863 2500 2469 2258 2022 1215 749 527 287 142 43177 3003 2536 542 13210 1622
NM_170740chr6143483 3473 3372 3203 2960 2806 2646 2639 2236 2192 1214 1166 854 107 32779 643 27 --13364
NM_172071chr1256857 6731 6325 6117 5713 5492 5219 5210 5204 4902 4800 4765 4742 4723 2985 2965 2925 2459 2432 2389 2130 1664 583 246 119 46682 2516 1756 795 56950 6867 6636 5057 883 --
NM_172159chr372088 1868 1716 1686 631 598 428 1944 21640 437 12042
NM_172160chr372088 1868 1716 1686 631 598 428 1944 21640 437 12042
NM_172193chr1441219 312 256 198 199 11013 11134
NM_172344chr261758 1263 1232 1225 1211 495 1507 11434 --
NM_172373chr1341305 1219 313 284 11324 21238 246 1364
NM_173083chr151062 1051 881 412 49 --21181 1009 1112
NM_173214chr16187334 6086 5352 5311 5257 3060 2792 2769 2094 1916 1671 1639 1134 1104 1075 1004 802 128 26355 2984 38162 4989 2701 12038
NM_173468chr4205328 5291 5205 5181 5136 5088 4776 4298 3951 3869 3840 3806 1899 1628 1341 1136 1070 1005 968 563 65911 4730 4717 4633 4522 219 14272 24477 1117
NM_173470chrX142511 2398 2101 1975 1943 1133 1046 1009 935 723 643 609 329 218 ------
NM_173511chr2123773 3652 3552 3522 3016 2636 2567 1383 1202 714 662 35 33478 3176 3037 33614 2704 1187 --
NM_173531chr19163822 3816 3797 3476 3281 3152 3118 2708 2382 1368 1123 1007 799 788 263 156 63858 3108 2846 2693 2509 832 23509 955 1669
NM_173536chr4165043 4481 4198 4139 4053 3484 3384 3356 3183 3164 1606 1369 1076 539 282 244 33504 1299 86 14210 180
NM_173552chr352159 1980 1648 516 479 21710 935 41878 1843 746 87 22220 2171
NM_173582chr11206254 5949 5804 5680 5626 5170 4901 4778 4367 3923 3855 2196 1930 1451 1164 1081 697 419 209 173 66107 4588 1902 1026 982 614 ----
NM_173602chr1283715 3697 3153 3036 2308 654 319 167 43741 2701 991 970 1592 1333
NM_173607chr14122138 2038 1984 1517 1478 857 510 410 361 217 181 36 32110 802 682 11435 --
NM_173632chr1952947 2326 2304 669 264 11058 63183 3042 2588 340 256 196 --
NM_173642chr1138981 7051 6810 6756 5671 3556 3461 2779 1804 1722 1095 589 341 21577 673 26766 6164 17253
NM_173654chr362162 2154 2085 795 771 444 1874 12251 11605
NM_173698chrX51544 1467 1357 599 227 1426 1830 1681
NM_173808chr1104283 3960 3146 3132 1610 1586 996 796 515 241 13372 11679 --
NM_173829chr5295696 5678 5364 5182 5085 4868 4815 4799 4309 3960 3876 3797 2341 2295 2235 2206 2051 2028 1800 1226 1102 995 934 898 706 648 623 488 37 56175 2381 2248 1125 30 55340 1384 1174 836 71 25929 441
NM_173851chr873502 3473 3044 396 340 101 29 12673 13071 12716
NM_174916chr1582319 2126 1886 1875 1578 1556 775 495 32369 901 376 --22005 240
NM_175061chr751916 1802 1652 1455 128 --2392 361 1884
NM_175623chr12167583 5518 5455 4735 2846 2629 2428 1905 1724 1612 1508 1099 842 614 520 486 15736 26035 5961 --
NM_175624chr12167678 5613 5550 4830 2941 2724 2523 2000 1819 1707 1603 1194 937 709 615 581 15831 26130 6056 --
NM_175625chr12167678 5613 5550 4830 2941 2724 2523 2000 1819 1707 1603 1194 937 709 615 581 15831 26130 6056 --
NM_175736chr12117827 7705 7548 7498 6885 6699 4910 2661 2290 2051 68 26838 5880 17512 --
NM_175854chr1372462 2095 1051 808 782 490 426 42141 2033 233 222 31954 920 570 --
NM_175861chr12165697 5236 4819 4615 4322 2158 2065 1753 1453 1348 1139 757 628 608 280 257 45968 5895 4556 2040 34334 3695 102 1912
NM_175876chr192412 2093 1961 1951 1836 970 755 255 193 11829 22696 618 --
NM_175910chr19112507 2333 2103 1992 1933 1784 1772 1693 1679 198 144 11807 --11645
NM_175921chr5124279 3695 3461 3445 3397 3228 3154 2838 985 580 404 290 32608 611 337 2748 387 --
NM_176081chr10195733 5535 5437 4973 4774 2290 2278 2057 1804 1629 1512 1403 1352 1053 1041 925 777 737 66 45453 5129 4373 170 54599 4200 1099 379 131 25367 95
NM_176083chr10195733 5535 5437 4973 4774 2290 2278 2057 1804 1629 1512 1403 1352 1053 1041 925 777 737 66 45453 5129 4373 170 54599 4200 1099 379 131 25367 95
NM_177438chr14164015 3941 3727 3698 3545 3105 2807 2797 2744 1322 1117 1046 822 578 180 126 21191 120 44176 3807 2998 1432 33679 3192 1570
NM_177538chr2178922 8181 8151 7733 6923 5776 3503 3375 2654 2375 2186 1031 866 730 337 323 135 12618 58788 7602 7028 5422 1923 13006
NM_177966chr341818 1747 671 648 159 21902 1251 11447
NM_177995chr951852 1527 1339 682 215 --31396 1359 534 1604
NM_178011chr10133109 3013 2934 2865 2209 2195 2158 1192 1147 687 567 414 327 33302 3074 2107 22520 2083 --
NM_178151chrX137898 7510 6658 6399 6156 4755 3036 2265 1917 1524 1097 894 104 56768 6504 2494 1470 1052 17720 --
NM_178152chrX137898 7510 6658 6399 6156 4755 3036 2265 1917 1524 1097 894 104 56768 6504 2494 1470 1052 17720 --
NM_178153chrX137898 7510 6658 6399 6156 4755 3036 2265 1917 1524 1097 894 104 56768 6504 2494 1470 1052 17720 --
NM_178509chr17103882 3825 3395 3301 3139 3025 2730 1466 1232 815 11256 33713 3373 1594 1463
NM_178539chr1291940 1912 1904 1813 1442 249 213 203 90 --22050 1934 --
NM_178566chr961547 678 452 367 347 196 21370 399 ----
NM_178586chr1462117 2057 800 758 707 154 ----2720 693
NM_178815chr10112721 2715 2292 2242 2135 1879 1839 978 803 622 161 11054 1889 --
NM_180989chr1372506 2044 1724 1686 949 497 491 21987 1871 1791 11813
NM_180991chr552806 2782 2098 1754 504 82690 2677 2063 563 527 469 368 40 --11925
NM_181265chr4102863 2500 2469 2258 2022 1215 749 527 287 142 43177 3003 2536 542 13210 1622
NM_181332chrX72491 2255 2144 2042 1693 1036 881 --1473 2523 408
NM_181358chr1134283 3909 3679 2911 2874 1545 1171 971 845 658 310 299 204 44123 3253 1206 1194 33094 1224 100 --
NM_181443chr20112322 1974 1901 1054 934 732 724 693 662 337 263 12772 22349 454 --
NM_181453chr251239 340 329 322 153 --21352 606 1364
NM_181481chr18147030 6901 6537 6254 6150 5878 5677 5107 4760 2232 1008 632 530 158 35997 4562 4334 36083 5148 2007 --
NM_181482chr18147030 6901 6537 6254 6150 5878 5677 5107 4760 2232 1008 632 530 158 35997 4562 4334 36083 5148 2007 --
NM_181483chr18147030 6901 6537 6254 6150 5878 5677 5107 4760 2232 1008 632 530 158 35997 4562 4334 36083 5148 2007 --
NM_181521chr16135868 5678 4991 4835 4521 2018 1976 1381 1012 752 101 80 56 12796 25704 5135 --
NM_181659chr20113339 3269 3003 2826 2508 2467 2373 1241 962 489 392 13311 --22457 1363
NM_181659chr20113339 3269 3003 2826 2508 2467 2373 1241 962 489 392 13311 --22457 1363
NM_181705chr5195810 5783 5181 5030 5022 5015 4939 4742 4667 4309 2257 1667 1374 1339 1094 1060 240 201 141 24197 1227 21415 1101 15285
NM_181712chr151997 1311 751 695 689 --21366 383 1709
NM_181714chr671893 1742 1544 1531 1392 782 247 51973 1857 1286 1242 278 ----
NM_181723chr862064 1999 717 630 542 131 --1344 2704 463
NM_181787chr883929 3450 1238 1148 573 521 422 320 43751 3361 3035 1040 23916 458 --
NM_181836chr592492 2323 2200 1962 1720 1681 1645 830 753 52477 2312 1655 1053 362 12648 11639
NM_181861chr12112829 2589 2396 2313 1894 1044 838 478 333 323 38 12821 12205 --
NM_181868chr12112829 2589 2396 2313 1894 1044 838 478 333 323 38 12821 12205 --
NM_181869chr12112914 2674 2481 2398 1979 1129 923 563 418 408 123 12906 12290 --
NM_182485chr473591 3028 1482 1339 1247 989 858 33322 3000 903 11496 --
NM_182493chr16115183 4694 4485 3796 3675 2102 1574 1545 669 405 35 1306 24343 4040 24393 4359
NM_182515chr19196489 5612 4978 4972 4776 4444 4323 4231 2696 2500 2278 2262 2016 1621 1582 1278 1025 481 246 85438 5431 5331 5006 2528 2209 1405 1370 15484 25525 1244
NM_182646chr473591 3028 1482 1339 1247 989 858 33322 3000 903 11496 --
NM_182758chr15123732 3394 3296 2539 1500 1325 1236 1145 805 440 328 29 32528 409 312 --11519
NM_182762chr7166188 6051 5850 5546 5483 5454 5346 5078 4633 4518 4439 4391 4244 3792 3777 2495 32355 1784 369 45523 3844 1562 955 16239
NM_182830chr1472265 2217 2133 1895 1527 1499 142 --11971 12072
NM_182898chr7106549 6515 5039 4598 4054 4027 4006 2572 2392 976 26220 1135 --15327
NM_182899chr7106549 6515 5039 4598 4054 4027 4006 2572 2392 976 26220 1135 --15327
NM_182948chr192531 2146 2110 1087 902 895 821 586 565 --23097 623 1536
NM_183004chr14133945 3600 3452 3236 2929 2484 2471 1537 1284 1026 737 507 44 22791 2506 13261 --
NM_183043chr131357 3874 761 174 --1163
NM_183044chr131357 3874 761 174 --1163
NM_183376chr1572417 2141 1836 1798 1603 696 134 22039 185 32410 2390 1642 --
NM_194071chr7115442 4848 4687 4339 4288 3544 1436 1375 935 809 248 22147 2102 14239 --
NM_194247chr293994 3851 3472 1696 1300 1100 857 738 512 34114 4047 694 23211 374 --
NM_194282chr482475 2041 847 587 235 216 163 125 32284 896 44 31977 905 149 --
NM_194283chr5133290 3156 2939 2925 2575 2557 1555 1467 1416 882 350 84 39 34124 3222 760 32893 2851 824 --
NM_194285chr11143433 3409 3334 3100 3039 3012 2171 957 816 693 645 632 231 25 4998 707 519 94 23272 1073 --
NM_194291chr8122938 2900 2544 2439 2143 2045 1077 921 844 806 432 78 --22599 2573 12919
NM_194292chr1111587 1554 666 592 568 315 277 254 172 101 94 1507 ----
NM_194314chr1175581 5224 5105 5000 4975 3976 3846 2204 1399 488 474 410 381 260 181 70 25 74944 4474 3486 2002 1533 1067 503 41517 1007 496 320 1893
NM_194328chr993278 3223 3211 2921 2879 2406 2346 1004 963 22161 23 1835 12584
NM_194329chr993278 3223 3211 2921 2879 2406 2346 1004 963 22161 23 1835 12584
NM_194330chr993278 3223 3211 2921 2879 2406 2346 1004 963 22161 23 1835 12584
NM_194332chr993278 3223 3211 2921 2879 2406 2346 1004 963 22161 23 1835 12584
NM_194434chr18245801 5631 5563 5116 5102 4613 4236 3808 3519 1855 1822 1513 1387 1322 1265 856 802 774 675 505 468 354 258 59 65750 5339 5263 4466 1872 952 32140 1121 1093 14727
NM_194442chr191753 1725 1508 1460 1223 651 434 343 229 --21766 248 --
NM_197970chr231549 1111 165 11587 41675 1504 1495 175 --
NM_198128chr18112264 2238 2172 2114 2085 1991 1977 751 656 377 292 62193 2179 2164 1890 1842 1794 3566 479 319 1871
NM_198181chr1582896 2745 2585 2223 2217 2189 491 479 5245 215 185 157 127 ----
NM_198212chr7112370 2358 2266 2221 2115 1944 1728 1653 913 438 154 21621 208 22233 336 --
NM_198268chr1134283 3909 3679 2911 2874 1545 1171 971 845 658 310 299 204 44123 3253 1206 1194 33094 1224 100 --
NM_198269chr1134283 3909 3679 2911 2874 1545 1171 971 845 658 310 299 204 44123 3253 1206 1194 33094 1224 100 --
NM_198270chrX103477 2781 2312 2298 1182 1064 918 659 376 130 53177 2841 2699 489 428 12997 --
NM_198273chr5153175 3123 2564 2538 2477 2369 2213 1947 983 917 426 295 222 148 101 52278 386 340 325 93 ----
NM_198329chr371552 1517 1505 1061 459 67 55 21472 1420 ----
NM_198336chr781821 1786 1770 1682 1554 1515 1390 360 11170 21425 632 1654
NM_198391chr2061551 1364 517 339 174 167 21054 473 ----
NM_198399chr341685 534 77 22 3426 420 34 21166 285 --
NM_198400chr1582781 2694 2652 1979 557 421 313 68 32894 2740 1087 1451 --
NM_198465chrX143001 2739 2602 2331 2072 1922 1832 1102 1035 1012 381 303 73 65 ------
NM_198503chr1122358 2132 2118 2001 1902 1496 912 596 473 323 216 59 42173 1732 803 245 12037 --
NM_198513chr891957 1931 1896 1457 1319 1262 562 221 75 11326 1371 1535
NM_198549chr182920 2706 2233 2180 2100 768 560 165 21315 484 --11300
NM_198569chr6102427 2131 1960 1929 1763 854 652 153 145 44 22268 733 32389 2098 884 12249
NM_198581chr2197510 7481 7261 6937 6542 6258 4737 2616 2530 2150 2132 1717 1594 1547 1104 858 666 625 141 37551 6930 2016 36808 6216 1849 12977
NM_198900chr12117827 7705 7548 7498 6885 6699 4910 2661 2290 2051 68 26838 5880 17512 --
NM_198968chr13103746 3655 3430 3119 1447 1407 1164 1058 328 266 33696 653 512 12490 --
NM_198990chr783282 3013 2883 2511 2379 948 423 171 33199 1149 1018 22957 2522 13118
NM_199040chr12113208 3117 2946 2597 2516 2374 595 505 497 420 104 --31207 762 210 12448
NM_199072chr7163268 3239 3217 3179 3077 2938 2802 2508 2389 2356 2136 1148 652 636 213 47 43231 2708 1273 1162 2185 103 1943
NM_199144chr2041291 651 633 79 --11110 21555 141
NM_199188chr12184103 3978 3705 3658 3055 2979 2679 2543 1266 1160 1043 993 855 761 753 614 450 425 53734 3671 2537 1392 326 21298 292 22666 635
NM_199190chr12184103 3978 3705 3658 3055 2979 2679 2543 1266 1160 1043 993 855 761 753 614 450 425 53734 3671 2537 1392 326 21298 292 22666 635
NM_199203chr2041291 651 633 79 --11110 21555 141
NM_199324chr4133770 3449 3333 2532 2352 1494 1341 1223 918 698 681 344 261 2337 309 21361 847 --
NM_199421chr14145085 4295 4080 3991 3960 3293 3246 1996 1986 1029 975 948 637 128 34655 3208 1234 33499 1481 322 --
NM_199436chr292826 2556 2455 2382 2305 2145 2109 1972 1051 3559 482 96 12566 1831
NM_199437chr1192271 2100 1877 1752 832 569 530 255 238 192 21715 873 --
NM_199438chr1192271 2100 1877 1752 832 569 530 255 238 192 21715 873 --
NM_199439chr1192271 2100 1877 1752 832 569 530 255 238 192 21715 873 --
NM_199454chr174780 4209 3476 3113 2907 1667 837 14769 34435 652 568 11398
NM_201269chr171432 1272 1212 1049 979 52 46 1453 1218 --
NM_201591chr451256 580 471 299 167 21447 768 31221 503 237 --
NM_201592chr451256 580 471 299 167 21447 768 31221 503 237 --
NM_203372chr281223 571 499 459 449 352 296 251 31192 1164 1118 1642 --
NM_203390chr841894 1841 1675 1532 21707 203 1688 1540
NM_203406chr592760 2162 1124 848 772 745 629 598 512 --1283 --
NM_203459chr1112310 2148 2095 2003 1890 1865 1700 972 733 290 41 12382 1235 --
NM_203463chr2144805 4557 4082 3418 3319 3022 1977 1960 1365 1297 941 672 645 496 --21207 839 --
NM_206594chr173007 2685 2570 1241 1013 731 397 23372 3233 23038 1050 22545 1100
NM_206595chr173007 2685 2570 1241 1013 731 397 23372 3233 23038 1050 22545 1100
NM_206853chr6134114 3925 3824 3792 3690 3576 3255 3243 2849 1522 1106 951 882 41274 1152 974 46 23881 1174 12693
NM_206854chr6205375 5186 5085 5053 4951 4837 4516 4504 4110 3673 2143 1175 1061 1043 902 844 707 515 222 103 21307 258 35142 3587 3426 13954
NM_206855chr6276340 6151 6050 6018 5916 5802 5481 5469 5075 4638 4002 3944 2140 2026 2008 1867 1809 1672 1480 1187 1068 837 707 373 107 79 39 44111 2272 1223 165 36107 4552 4391 24919 336
NM_206866chr2162538 2373 2339 2156 1147 435 32239 688 600 32435 131 46 1392
NM_206876chr2153570 3468 3070 2855 2808 2782 2619 1448 1382 1351 1168 698 587 148 33 22204 1267 23496 579 12219
NM_206907chr5123287 3246 3165 2829 2810 2594 2315 2303 2162 2046 1175 856 2892 363 13212 --
NM_206909chr8158434 7785 7351 6965 6235 5556 5409 5380 3148 2944 2661 1529 1337 896 818 68318 8094 7621 1871 1392 363 --13370
NM_207015chr3102028 1677 1475 735 664 573 307 297 69 27 --1527 --
NM_207036chr15112287 2280 2220 2006 1992 1975 1943 1752 1562 365 318 --1827 12085
NM_207037chr15112287 2280 2220 2006 1992 1975 1943 1752 1562 365 318 --1827 12085
NM_207038chr15112287 2280 2220 2006 1992 1975 1943 1752 1562 365 318 --1827 12085
NM_207040chr15112287 2280 2220 2006 1992 1975 1943 1752 1562 365 318 --1827 12085
NM_207303chr10164042 4033 3944 3717 3058 2804 2763 2732 2618 2573 2527 1656 1587 1298 936 487 ----13760
NM_207361chr13166115 6071 5884 5749 5618 5519 5358 5256 4527 2524 2205 1574 798 609 594 486 46085 6027 5467 1781 65164 4328 4087 1398 816 703 --
NM_207406chr496418 6331 5879 4331 1721 1653 1374 1150 1005 54771 4247 1561 1454 815 22057 969 --
NM_207445chr15101997 1897 1841 1345 843 788 665 630 420 256 1430 ----
NM_207647chr992442 2300 2174 1933 1887 752 643 543 533 22557 892 41858 1761 611 75 11819
NM_212558chr993660 2977 2964 1612 1421 1407 1097 849 102 33103 2883 1081 24175 824 --
NM_213589chr2125614 5264 5042 4217 4162 3705 3446 2018 1898 1431 541 329 24800 3759 23998 1966 14303
NM_213590chr13154536 4483 4455 4330 3414 3254 3219 2015 1835 1814 815 806 744 70 39 34980 1710 888 14044 1171
NM_213651chr171302 1239 580 428 418 383 302 11668 21621 559 --