TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-513c-5p
miRNA Sequence: UUCUCAAGGAGGUGUCGUUUAU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr51146 ------
NM_000046chr522548 1138 --22418 255 --
NM_000052chrX42173 1020 368 128 ------
NM_000109chrX42518 2358 662 502 1635 ----
NM_000126chr151118 ------
NM_000217chr1265182 5158 4986 4586 3733 3701 35277 1987 158 24638 1609 24690 3903
NM_000253chr41774 ------
NM_000288chr61147 ------
NM_000337chr576432 6260 5496 5183 4904 1770 140 35325 4750 2500 11022 --
NM_000408chr243061 2474 2130 1268 ------
NM_000462chr1521594 373 --1359 1604
NM_000489chrX33159 2765 2088 ------
NM_000767chr1921350 236 ------
NM_000809chr488303 6861 5751 5663 5614 1283 256 143 16697 18813 21999 1462
NM_000813chr565147 5014 2033 600 539 395 24411 4216 ----
NM_000814chr1563770 3165 2930 2898 2842 2651 22866 2751 13110 1366
NM_000826chr41187 ------
NM_000834chr1221141 351 --11113 --
NM_000912chr812798 ------
NM_000944chr4147 ------
NM_000945chr22547 498 ----1695
NM_000990chr1173677 3351 3144 2655 1563 1058 99 ----13710
NM_001001132chr211205 ------
NM_001001395chr1231897 1080 1026 12224 ----
NM_001001419chr553878 3365 1373 1336 64 ------
NM_001001420chr553878 3365 1373 1336 64 ------
NM_001001484chr1052102 951 487 364 29 ----1325
NM_001001522chr111116 ------
NM_001001664chr263978 2983 2624 1145 897 686 1676 22504 1647 --
NM_001001665chr292603 2370 2330 2246 2235 2204 773 639 614 13110 22738 2222 --
NM_001001852chr221141 ------
NM_001001928chr2298282 8200 6503 6296 5819 2398 2004 1979 630 11648 ----
NM_001002838chrX4599 296 110 84 1336 ----
NM_001002860chr14104603 3284 2987 2928 1698 1599 1571 1048 1033 1007 ------
NM_001002926chr721781 354 1855 ----
NM_001003652chr1898717 7711 7505 7377 3417 3280 3036 2653 575 --1122 12467
NM_001004051chrX1310 ------
NM_001004127chr1331018 297 252 ------
NM_001004346chr431104 243 182 ------
NM_001005366chr122952 371 ------
NM_001005386chr232115 621 145 32492 2296 1791 22434 1549 11730
NM_001005611chrX1498 ------
NM_001006605chr1159 ------
NM_001006605chr1159 ------
NM_001006618chr9169 ------
NM_001007246chr2131728 1207 245 ------
NM_001007278chr13105298 5233 4559 3756 3461 3299 1663 1092 547 379 25264 3926 ----
NM_001007553chr121247 1128 ------
NM_001007559chr1821633 670 ------
NM_001008223chr12193 ------
NM_001008408chr786228 6147 5970 2569 1975 1897 1231 572 1892 11562 15688
NM_001008712chr8159 ------
NM_001008895chr1321059 256 ------
NM_001009185chr51633 ------
NM_001009899chr365594 2523 2083 1893 1274 971 34596 4361 2599 ----
NM_001009959chr262357 2231 1844 348 210 88 11033 ----
NM_001009993chr2113798 3280 3156 3107 2852 2756 1624 1420 665 636 608 13490 13636 14014
NM_001010888chrX73978 3913 3457 3247 3178 998 428 ------
NM_001010891chr596584 6187 6162 6025 5567 2513 1331 1163 712 14947 15097 --
NM_001010908chr101581 ------
NM_001010927chr61233 ------
NM_001010980chr183378 3306 3070 2935 2911 2807 2605 1268 1264 13045 --
NM_001010984chr13968 962 267 1919 --1551
NM_001011666chr756291 6117 2129 1590 1347 16057 --1214
NM_001011708chr272348 2208 2194 2169 2126 1852 959 ----22871 2450
NM_001012393chr1154659 4224 4216 1625 85 --11415 23941 1263
NM_001012756chr1943056 2459 2351 744 32280 2101 1184 12899 12211
NM_001013620chr1277113 5934 5639 2434 2181 1523 786 45589 2841 2754 2090 --1284
NM_001014380chr1363995 2262 1689 1024 1005 591 21186 161 14118 --
NM_001014797chr1036430 3276 2960 38011 7813 524 16869 37515 7424 3032
NM_001015048chr1453205 3163 3028 2003 668 12916 ----
NM_001015049chr1453205 3163 3028 2003 668 12916 ----
NM_001017369chr431095 864 433 1989 ----
NM_001017395chr3113597 3224 3128 2687 2661 2312 1263 1235 1030 982 879 --1243 --
NM_001017926chr81404 ------
NM_001018054chr131374 1046 1014 ------
NM_001018057chr1121296 322 --1202 --
NM_001018065chr9105605 5465 5379 4968 4745 1789 1460 1187 662 538 15450 ----
NM_001018066chr9105605 5465 5379 4968 4745 1789 1460 1187 662 538 15450 ----
NM_001018067chr165337 4846 4786 4640 1795 748 11102 14894 --
NM_001018068chr165337 4846 4786 4640 1795 748 11102 14894 --
NM_001018069chr165337 4846 4786 4640 1795 748 11102 14894 --
NM_001018090chr156844 674 609 483 92 30 21989 1771 ----
NM_001018091chr156954 784 719 593 202 140 22099 1881 ----
NM_001018102chr156844 674 609 483 92 30 21989 1771 ----
NM_001024660chr331245 554 117 ------
NM_001024948chr162767 2177 1200 671 653 192 23496 761 ----
NM_001025072chr362687 2527 2197 906 877 274 11170 1363 1255
NM_001025073chr362687 2527 2197 906 877 274 11170 1363 1255
NM_001025076chr1066185 5937 5580 5323 1794 1493 21680 477 25645 1879 --
NM_001025077chr1097543 7295 6938 6681 4749 4697 2851 1229 193 34961 3038 1835 17003 1350
NM_001025079chr374134 3284 2764 1630 609 548 229 13648 12811 --
NM_001025580chrX43586 2940 1031 500 1878 ----
NM_001025595chr451503 1358 1176 1089 1063 31131 1124 230 ----
NM_001030006chr1742239 820 330 304 1684 22560 1988 11823
NM_001030055chr1454306 3971 3462 2894 840 14333 24617 510 --
NM_001031623chr62475 62 ----11308
NM_001031665chr191394 ------
NM_001031684chr221176 289 ----11314
NM_001031804chr1633956 1183 1110 ------
NM_001031812chr511831 ----1479
NM_001033112chr53711 362 307 1599 ----
NM_001033503chr51181 ------
NM_001033507chr131295 634 57 ------
NM_001034841chr16155073 4480 4284 4033 3744 3603 3497 2157 1862 1826 1815 1773 1647 1532 1253 ------
NM_001035chr121190 185 ------
NM_001037165chr7108779 8383 8253 7866 7832 7417 6995 6004 5689 1610 33201 654 460 --1326
NM_001037582chr42524 219 1133 --11378
NM_001039538chr253383 3353 2629 612 536 32735 1407 625 11431 --
NM_001039585chr1101436 1364 1273 1150 630 556 539 513 178 84 ----12870
NM_001039590chrX53737 2896 2805 2524 1238 23776 2655 ----
NM_001039591chrX53737 2896 2805 2524 1238 23776 2655 ----
NM_001039618chr11105756 5651 5249 4662 3936 3906 3894 2302 1703 1633 1941 13879 --
NM_001039840chrX45929 5818 4954 1002 65197 4656 3747 2141 1106 1085 --15149
NM_001040101chr4156 ------
NM_001040142chr21648 ------
NM_001040143chr21648 ------
NM_001040157chr41174 ----22553 339
NM_001040214chr621886 405 ------
NM_001040409chr23964 859 386 ------
NM_001040429chr1322222 1306 23453 2858 --12265
NM_001040709chr151674 941 261 125 118 11737 1850 --
NM_001040712chr912194 ----184
NM_001042355chr1675150 4675 4096 3633 3523 1563 625 1347 --1424
NM_001042412chr1675150 4675 4096 3633 3523 1563 625 1347 --1424
NM_001042453chrX2583 243 ----11399
NM_001042510chr851916 1654 872 598 151 ------
NM_001042511chr851916 1654 872 598 151 ------
NM_001042555chr1241586 916 869 493 ------
NM_001042599chr296821 6746 6545 5780 3107 2955 2177 1807 1491 27644 523 --17724
NM_001042603chr12105139 4270 2003 1865 1443 761 427 241 49 22 11464 12055 25029 4716
NM_001042604chr344443 1941 1584 691 21774 401 1918 14893
NM_001042632chr2052204 1604 476 185 62 --22454 1881 12172
NM_001042633chr2052204 1604 476 185 62 --22454 1881 12172
NM_001042683chr621161 492 ------
NM_001043351chr142071 1968 1410 756 ------
NM_001044722chr511831 ----1479
NM_001044723chr511831 ----1479
NM_001048183chr183252 2688 2606 2319 1205 1062 884 765 12296 23399 575 1241
NM_001083620chr41187 ------
NM_001100108chr1107525 6130 6091 6025 5489 5093 2686 1891 969 105 11271 37540 6117 2432 27549 5951
NM_001113490chrX52969 2900 1457 151 79 11212 --11109
NM_001116chr1632580 2067 429 --12755 --
NM_001121chr1011172 ------
NM_001122679chr51146 ------
NM_001167chrX86620 5375 4432 4418 2134 1869 1721 1347 --14192 --
NM_001173chr1454306 3971 3462 2894 840 14333 24617 510 --
NM_001186chr2122473 1301 1594 --12889
NM_001238chr191532 ------
NM_001241chr242263 1798 1571 1553 ------
NM_001241chr242263 1798 1571 1553 ------
NM_001259chr745952 5159 4414 398 11960 12131 12017
NM_001268chr132261 25 ------
NM_001278chr101180 ------
NM_001281chr191130 ------
NM_001282chr1742239 820 330 304 1684 22560 1988 11823
NM_001283chr71543 ------
NM_001310chr1252970 2844 2184 2091 500 ------
NM_001365chr171788 ------
NM_001392chr182222 50 ------
NM_001412chrX43273 2670 869 438 11167 1421 --
NM_001415chrX41840 1261 698 319 31938 1754 1733 ----
NM_001416chr171135 ------
NM_001530chr141868 ------
NM_001560chrX62650 2032 1004 553 462 406 --12385 21801 40
NM_001614chr172531 244 147 ----
NM_001614chr172531 244 147 ----
NM_001660chr32304 293 ----1207
NM_001744chr51108 ------
NM_001753chr71304 ------
NM_001768chr24883 837 506 51 ------
NM_001777chr374134 3284 2764 1630 609 548 229 13648 12811 --
NM_001827chr91228 ----181
NM_001851chr63724 637 297 ------
NM_001860chr931053 459 130 11175 ----
NM_001894chr2211230 ------
NM_001918chr1157168 6913 6142 3471 3294 3115 2398 1821 1653 1559 978 775 373 334 31 23151 1072 31796 1546 469 --
NM_001920chr121671 ------
NM_001938chr11686 ------
NM_001939chrX83655 3608 3127 2617 2597 2344 895 767 23785 3098 13267 11275
NM_001980chr122882 377 --32149 1811 33 --
NM_001999chr531386 485 191 ------
NM_002025chrX88887 6790 3472 2637 2253 1774 1752 1494 33663 3128 1353 22531 1324 --
NM_002040chr212710 173 ------
NM_002076chr1233120 2614 2565 21220 1194 1791 --
NM_002089chr41123 ------
NM_002106chr41125 ------
NM_002137chr742069 1593 1461 249 ------
NM_002140chr91157 ------
NM_002161chr91352 --1173 --
NM_002166chr21475 ------
NM_002190chr62840 413 ----1375
NM_002211chr1031054 1008 792 --1201 --
NM_002214chr784319 4212 3747 3680 2072 1429 1177 215 --11862 --
NM_002268chr361904 1629 1529 1438 1323 354 ------
NM_002294chrX1136 ------
NM_002336chr1274312 4054 3235 3209 1596 471 62 13113 ----
NM_002356chr632723 2067 571 11021 ----
NM_002374chr253383 3353 2629 612 536 32735 1407 625 11431 --
NM_002387chr583970 3752 3716 3629 1712 674 157 86 11396 ----
NM_002398chr211502 ------
NM_002412chr10127 ------
NM_002431chr141277 ------
NM_002481chr1137904 7843 7120 6599 6488 6165 6151 5167 5029 1851 1622 1079 537 37929 5149 4818 22472 1582 --
NM_002508chr161986 1326 687 453 391 347 1778 11705 11523
NM_002545chr1154659 4224 4216 1625 85 --11415 23941 1263
NM_002577chr373356 1478 1318 1279 1092 744 449 ------
NM_002581chr954865 4355 3470 1061 570 14044 4825 775 768 462 11960
NM_002589chr42336 139 ------
NM_002715chr511247 --1992 --
NM_002719chr1421766 912 ------
NM_002731chr152209 1231 686 463 53 ------
NM_002822chr121186 ------
NM_002839chr912194 ----184
NM_002841chr3159 ------
NM_002843chr1133274 1259 134 ----32447 833 264
NM_002844chr621126 127 ------
NM_002857chr162477 2392 1015 940 780 68 1454 ----
NM_002912chr61286 ------
NM_002977chr243394 1043 1027 540 172 13439 13280
NM_003016chr1741257 219 140 75 ------
NM_003017chr621270 83 ------
NM_003030chr32785 90 ------
NM_003034chr1287650 7332 6370 5878 5824 2092 2062 1039 ------
NM_003074chr351645 838 822 570 84 --11764 11597
NM_003105chr11188 ------
NM_003106chr311090 ------
NM_003112chr712018 ------
NM_003155chr83605 580 70 ------
NM_003186chr111116 ------
NM_003202chr521473 1306 ----11813
NM_003222chr201934 ------
NM_003223chr161754 ------
NM_003255chr1752646 2139 2067 391 250 --1442 --
NM_003262chr334423 3219 853 ------
NM_003345chr161454 ------
NM_003350chr82955 694 ------
NM_003373chr1021771 465 ------
NM_003392chr361661 1625 1596 1590 1583 1562 21200 997 --1484
NM_003400chr21799 ------
NM_003410chrX1548 11245 --12991
NM_003453chr131103 ------
NM_003463chr652445 2175 2133 1288 1062 12989 139 12055
NM_003471chr33954 432 138 ------
NM_003472chr63291 161 144 ------
NM_003477chr112760 315 ------
NM_003503chr131178 828 208 1983 1185 --
NM_003574chr1842294 2081 798 440 35158 4661 1943 --13738
NM_003589chr1321059 256 ------
NM_003590chr251513 648 536 153 131 ------
NM_003592chr71347 ------
NM_003597chr222193 1857 --1172 --
NM_003633chr532538 809 775 ------
NM_003766chr172569 407 ------
NM_003818chr201213 ------
NM_003884chr31551 ------
NM_003887chr212164 ------
NM_003901chr1052166 1978 1774 500 136 --154 --
NM_003966chr587103 5060 4897 4803 2044 1332 538 285 17516 26916 2967 22203 1300
NM_004006chrX42518 2358 662 502 1635 ----
NM_004007chrX42518 2358 662 502 1635 ----
NM_004009chrX42518 2358 662 502 1635 ----
NM_004010chrX42518 2358 662 502 1635 ----
NM_004011chrX42518 2358 662 502 1635 ----
NM_004012chrX42518 2358 662 502 1635 ----
NM_004013chrX42518 2358 662 502 1635 ----
NM_004014chrX42518 2358 662 502 1635 ----
NM_004015chrX42518 2358 662 502 1635 ----
NM_004016chrX42432 2272 576 416 1549 ----
NM_004017chrX42518 2358 662 502 1635 ----
NM_004018chrX42432 2272 576 416 1549 ----
NM_004020chrX42518 2358 662 502 1635 ----
NM_004021chrX42432 2272 576 416 1549 ----
NM_004022chrX42432 2272 576 416 1549 ----
NM_004023chrX42432 2272 576 416 1549 ----
NM_004036chr21667 ------
NM_004087chr351770 732 667 398 84 1781 ----
NM_004094chr1452929 1051 750 678 203 --21938 1102 --
NM_004124chr1443347 3089 1399 446 ----13217
NM_004169chr171121 ------
NM_004171chr1189505 8667 7499 6214 3313 2825 2416 1495 46683 3787 3198 1523 11507 38264 6725 376
NM_004267chr31158 ------
NM_004311chr1012142 ------
NM_004337chr82531 94 ------
NM_004384chr511831 ----1479
NM_004392chr1322597 1855 12104 ----
NM_004427chr111052 ------
NM_004498chr151314 ------
NM_004501chr1114045 3820 3773 3661 3536 3424 3410 3385 2711 1076 591 12567 ----
NM_004505chr1721256 591 ------
NM_004520chr51581 ------
NM_004523chr1071300 622 497 188 174 149 71 ------
NM_004596chr191206 ------
NM_004612chr964434 3478 3135 1309 519 63 11329 22955 1427 --
NM_004631chr131374 1046 1014 ------
NM_004654chrY1379 ------
NM_004660chrY62086 1908 1436 546 539 524 11667 --1643
NM_004663chr1521116 474 ------
NM_004687chr1761916 764 721 667 447 205 ----1123
NM_004690chr6162 ------
NM_004719chr1262633 2461 2087 810 673 593 22155 738 ----
NM_004726chrX63736 2246 1845 1719 1311 454 25597 4930 --25285 1106
NM_004742chr351824 1290 681 405 343 ------
NM_004748chr1552858 2702 1653 854 178 ----33662 1318 738
NM_004774chr1762978 2888 2826 935 483 466 12940 12658 --
NM_004788chr1111013 ------
NM_004789chr9189 ------
NM_004792chr2149 ------
NM_004815chr144339 4306 4007 1042 1353 --13481
NM_004849chr621568 1212 ------
NM_004863chr1464696 4345 4159 1974 1554 357 11474 55237 4722 4306 2029 1580 --
NM_004873chr1453205 3163 3028 2003 668 12916 ----
NM_004902chr20159 ----148
NM_004904chr756291 6117 2129 1590 1347 16057 --1214
NM_004926chr1411659 ------
NM_004939chr2128 ------
NM_004947chr322275 805 ------
NM_004964chr11529 ------
NM_004972chr941030 870 836 308 ------
NM_004985chr12114208 4088 4027 3480 1738 1249 1022 904 441 409 262 23900 1562 ----
NM_005036chr2298282 8200 6503 6296 5819 2398 2004 1979 630 11648 ----
NM_005056chr12115383 4514 3478 2247 2109 1687 1005 671 485 293 266 11708 --25273 4960
NM_005063chr10103518 3484 3265 2515 1333 1185 921 747 420 389 23691 1460 --11310
NM_005070chr21214 ------
NM_005077chr91139 ------
NM_005104chr62668 600 ------
NM_005116chr2034422 4319 219 --13167 --
NM_005168chr21126 ------
NM_005188chr11137906 7271 5670 2553 2398 2317 2064 1973 1535 1523 897 207 45 21345 332 17102 16473
NM_005197chr1465579 5565 4952 4396 4269 1775 25367 493 13960 11838
NM_005235chr296821 6746 6545 5780 3107 2955 2177 1807 1491 27644 523 --17724
NM_005249chr142798 362 ------
NM_005302chr71368 ------
NM_005308chr101402 ------
NM_005339chr443114 3091 3051 356 44320 2734 929 509 --24228 46
NM_005349chr42501 36 ----197
NM_005358chr1321183 288 --1249 11361
NM_005359chr1896041 6029 5703 5369 4886 4582 2093 1367 1120 22578 662 --26529 4780
NM_005376chr11129 --21171 1041 --
NM_005398chr1041295 975 122 114 1314 --1154
NM_005402chr751841 1736 1575 1321 269 ----1733
NM_005461chr2031704 1487 123 ------
NM_005504chr1256529 5494 5386 5125 5088 31867 1039 396 35641 1937 1770 --
NM_005517chr13904 409 240 ------
NM_005520chr51634 ------
NM_005542chr721824 1456 11775 ----
NM_005585chr151392 ------
NM_005596chr955282 4126 2437 1007 949 ----35750 1289 1052
NM_005613chr162042 883 856 819 232 179 ------
NM_005618chr62596 468 ------
NM_005637chr1821633 670 ------
NM_005652chr161101 ------
NM_005667chr2132 ------
NM_005668chr564165 3123 2909 1774 562 430 11789 --1384
NM_005688chr31940 ------
NM_005722chr232115 621 145 32492 2296 1791 22434 1549 11730
NM_005725chr142370 1655 469 172 21767 350 ----
NM_005731chr21368 ------
NM_005739chr1511551 ------
NM_005746chr711917 ------
NM_005748chr1263226 2838 2735 2576 618 116 1389 ----
NM_005749chr171683 ----173
NM_005754chr51472 ------
NM_005779chr573534 3491 2338 931 648 70 33 --12373 --
NM_005798chr13105298 5233 4559 3756 3461 3299 1663 1092 547 379 25264 3926 ----
NM_005828chr1784462 4402 3922 1485 1473 1458 1034 640 23892 307 23129 872 11623
NM_005839chr1178 ------
NM_005875chr31248 ------
NM_005895chr1274011 3872 3330 3191 2875 2659 564 1930 --24151 4076
NM_005901chr1898717 7711 7505 7377 3417 3280 3036 2653 575 --1122 12467
NM_005903chr553878 3365 1373 1336 64 ------
NM_006007chr964299 3759 3647 1702 1066 1043 33229 1727 342 1657 13215
NM_006080chr742714 2494 2393 1164 ----1484
NM_006139chr262424 2368 1146 865 813 168 --32612 2269 891 --
NM_006166chr1292329 2113 2099 2073 2028 1885 716 449 148 11632 --1168
NM_006203chr575592 4746 4411 3632 2027 616 331 --35255 5238 5123 15132
NM_006223chrX169 ------
NM_006252chr187289 5382 4900 4762 3022 2876 2122 1729 42787 1895 1707 103 26817 657 --
NM_006275chr2062434 1581 867 455 386 234 --1814 --
NM_006282chr20114676 4609 4149 3050 2946 2913 2895 1413 684 663 580 11781 13581 --
NM_006283chr843968 1789 956 694 11768 ----
NM_006298chr652635 1284 801 328 24 12555 ----
NM_006367chr11293 ------
NM_006379chr7166 ------
NM_006393chr1074451 4097 3731 2841 1603 433 22 --1917 --
NM_006413chr1021162 322 ------
NM_006464chr274261 4235 3304 3180 1482 1413 763 --32893 1304 711 189
NM_006467chr531937 665 150 ------
NM_006476chr11144 ------
NM_006509chr191400 ------
NM_006526chr2052021 1528 771 687 326 184 ----
NM_006534chr2032532 151 116 167 2764 756 13287
NM_006546chr1785336 5038 5010 4301 2204 1963 991 432 26365 142 16389 15677
NM_006559chr12917 413 ------
NM_006561chr1066185 5937 5580 5323 1794 1493 21680 477 25645 1879 --
NM_006599chr16128112 8022 7772 7368 6384 5715 5204 2330 1799 1501 243 113 26084 2595 ----
NM_006620chr673536 3262 1767 1640 1601 995 643 24825 3838 ----
NM_006625chr121067 748 11119 ----
NM_006625chr121067 748 11119 ----
NM_006625chr121067 748 11119 ----
NM_006626chr932591 2339 1083 --11705 1556
NM_006628chr1544177 3452 556 99 12846 11791 --
NM_006636chr23964 859 386 ------
NM_006654chr1241586 916 869 493 ------
NM_006698chr201991 ------
NM_006731chr985825 4085 3560 2311 2194 1975 502 282 15049 15074 --
NM_006745chr431095 864 433 1989 ----
NM_006750chr1698005 5812 5773 5436 5100 2644 2434 1976 963 46492 5706 2987 950 --11044
NM_006754chr72935 912 ----167
NM_006800chrX3578 134 119 ------
NM_006807chr1721216 997 ----198
NM_006813chr63857 810 802 --1210 161
NM_006814chr2032278 1683 458 ------
NM_006884chr32785 90 ------
NM_006887chr21244 ------
NM_006915chrX42124 1893 1725 375 --1161 --
NM_006981chr912268 ------
NM_006991chr32219 179 ------
NM_007006chr1643346 3157 2861 400 23434 3317 12848 11260
NM_007010chr1711452 ------
NM_007011chr1576635 6313 5753 4798 1186 1074 536 --1470 --
NM_007013chr81743 ------
NM_007033chr13636 594 45 ------
NM_007034chr11111 ------
NM_007038chr2165997 4953 4908 1640 1519 1319 46024 5142 1896 1150 1216 --
NM_007052chrX2163 78 ------
NM_007064chr331245 554 117 ------
NM_007073chr641627 582 429 240 --11133 --
NM_007084chr1321021 993 ------
NM_007125chrY21007 482 ------
NM_007126chr91468 ------
NM_007129chr1311041 ------
NM_007158chr121247 1128 ------
NM_007202chr172721 481 ------
NM_007222chr81404 ------
NM_007238chr20114291 4208 3729 3064 1524 1241 1101 1072 713 595 570 --1610 --
NM_007249chr1348792 7659 3183 2846 37778 3059 1782 22778 2444 1998
NM_007285chr161190 ------
NM_007350chr1254665 3157 1682 1429 1391 54415 1285 1167 564 36 --144
NM_007373chr1031622 457 450 11392 ----
NM_012069chrX62232 1836 1724 1038 1004 517 ----12464
NM_012096chr362984 2933 2802 2391 2368 712 12588 --12742
NM_012118chr4163 ------
NM_012120chr642806 2317 2208 384 ------
NM_012129chr772264 1982 1893 1008 917 686 282 ------
NM_012193chr11135197 5084 4968 4357 3942 3650 3514 3427 1969 1902 1838 1593 351 13734 ----
NM_012199chr154551 4526 3368 2857 1277 14025 21837 1705 1428
NM_012215chr1071610 1499 1441 1365 233 158 64 --11619 --
NM_012249chr222790 563 ------
NM_012250chr1111294 ------
NM_012262chr174943 4137 4083 3724 1617 1251 706 14852 11160 15070
NM_012286chrX1536 ------
NM_012290chr23223 72 62 ------
NM_012297chr442587 1864 304 150 ------
NM_012316chr1125366 4965 4866 4689 4652 4057 3724 1650 1054 915 447 439 14093 44991 4785 4228 954 12180
NM_012333chr111553 ------
NM_012338chr72277 59 ------
NM_012342chr102105 50 ------
NM_012405chr173362 2789 1148 1130 1023 890 26 1866 13008 --
NM_012416chr92990 499 ------
NM_012421chr11442 ------
NM_012446chr51559 ------
NM_012454chr61233 ------
NM_013230chrY11116 21275 149 --2571 299
NM_013231chr1442837 1598 734 624 ----148
NM_013253chr1121296 322 --1202 --
NM_013283chr52270 239 ------
NM_013302chr1674014 3575 3126 3048 1609 1044 305 21583 1390 11368 13604
NM_013316chr71215 ------
NM_013341chr272348 2208 2194 2169 2126 1852 959 ----22871 2450
NM_013381chr1232081 2056 627 ------
NM_013386chr111520 ------
NM_013417chr91352 --1173 --
NM_014000chr1021771 465 ------
NM_014011chr252588 2379 2129 903 273 12040 --12164
NM_014071chr20163 ------
NM_014141chr743919 3834 1691 88 14830 21491 156 1391
NM_014155chr1187503 5588 5150 4902 1841 1370 1228 148 1393 1621 --
NM_014243chr411688 ------
NM_014365chr121810 ------
NM_014382chr321467 1247 191 ----
NM_014390chr71506 ------
NM_014392chr4156 ------
NM_014393chr81560 ------
NM_014423chr555455 3940 3750 1921 1801 --21266 431 --
NM_014426chr201569 ------
NM_014432chr61546 ------
NM_014447chr451502 1357 1175 1088 1062 31130 1123 230 ----
NM_014504chr74649 193 72 30 ------
NM_014515chr124277 224 158 41 ----1121
NM_014517chr321444 1292 --183 --
NM_014572chr1311421 ------
NM_014616chr312755 22707 216 12942 1432
NM_014637chr81513 ------
NM_014670chr221428 523 ------
NM_014682chr822245 2076 ------
NM_014689chr21187 ------
NM_014707chr742036 322 308 71 ------
NM_014711chr1642035 1892 1597 1388 ----1726
NM_014729chr831895 1515 131 ----11629
NM_014730chr12114615 4512 3794 3306 3214 1830 1737 1658 1595 1124 606 11799 24436 3390 23563 250
NM_014730chr12114615 4512 3794 3306 3214 1830 1737 1658 1595 1124 606 11799 24436 3390 23563 250
NM_014732chr1645860 5155 951 219 15774 14853 34056 2128 573
NM_014733chr51462 ------
NM_014747chr194852 4654 4560 4470 4322 2232 1700 1684 1524 24602 1038 --35763 4739 3527
NM_014755chr242845 1010 202 148 14089 12924 11580
NM_014764chr1221041 205 ------
NM_014781chr831144 939 505 ------
NM_014797chr642870 2610 2433 1220 --13109 12923
NM_014829chr532191 662 504 ------
NM_014840chr12113318 2989 1222 1064 1039 484 478 389 375 149 60 22272 737 1874 --
NM_014868chr126824 713 632 621 323 97 ------
NM_014897chr1752478 2218 2011 1161 173 --23110 2818 --
NM_014899chr522636 2076 ------
NM_014904chr1023813 856 ------
NM_014918chr1531195 595 277 ------
NM_014923chr1332199 1946 108 ----1706
NM_014934chr1353149 3068 857 724 581 13797 23075 556 --
NM_014945chr561368 1353 519 464 273 214 ------
NM_014947chr162648 2350 2288 1138 928 671 182 ----
NM_015008chr3113597 3224 3128 2687 2661 2312 1263 1235 1030 982 879 --1243 --
NM_015017chr131037 898 238 11224 ----
NM_015025chr222095 1072 ------
NM_015026chr1254352 1610 1548 1536 1249 23383 1777 --11906
NM_015042chr15113329 3196 3066 2972 1522 1469 1318 1211 1089 971 689 --23934 1707 --
NM_015057chr131604 ------
NM_015071chr546188 5297 4585 1958 15916 41289 962 870 482 --
NM_015074chr194848 4652 4364 4071 3919 3880 1111 900 487 --54015 3516 1996 1884 1245 14582
NM_015076chr654459 3728 3108 2752 1505 13036 ----
NM_015110chr942421 1915 1798 218 ----127
NM_015192chr2022686 431 1389 ----
NM_015245chr642640 2452 2386 438 ------
NM_015247chr1675150 4675 4096 3633 3523 1563 625 1347 --1424
NM_015256chr51633 ------
NM_015265chr221703 695 ------
NM_015272chr1611908 ------
NM_015293chr61229 ------
NM_015294chr1721171 953 ------
NM_015313chr1164188 3486 3017 1894 820 813 34024 1434 1041 14548 --
NM_015365chrX43586 2940 1031 500 1878 ----
NM_015375chr175006 4607 3800 3134 1127 731 434 13968 34502 3096 1908 11607
NM_015396chr321308 176 ----1164
NM_015412chr362687 2527 2197 906 877 274 11170 1363 1255
NM_015442chr31215 ------
NM_015455chr532846 913 356 23817 671 13036 --
NM_015532chr156844 674 609 483 92 30 21989 1771 ----
NM_015542chr102403 385 ----1257
NM_015549chr141555 ------
NM_015555chr62475 62 ----11308
NM_015565chr2141437 817 756 231 ------
NM_015578chr191391 ------
NM_015640chr165337 4846 4786 4640 1795 748 11102 14894 --
NM_015652chr103654 227 131 ------
NM_015670chr171159 ------
NM_015711chr191129 ------
NM_015713chr811240 53578 2813 1357 908 683 --23049 2599
NM_015834chr211974 ------
NM_015874chr42501 36 ----197
NM_015879chr1853403 2078 1975 1523 235 11192 26080 2422 17278
NM_015881chr1121296 322 --1202 --
NM_015902chr81620 ------
NM_015906chr133883 3689 1122 2853 252 1360 --
NM_015975chrX31858 260 49 31374 1290 1269 ----
NM_016009chr184143 1423 1289 1266 1101 767 263 233 ----14171
NM_016018chr831756 535 295 ------
NM_016037chr13788 337 235 ------
NM_016073chr1511112 ------
NM_016083chr633446 3059 839 --13030 --
NM_016096chr851916 1654 872 598 151 ------
NM_016103chr51181 ------
NM_016129chr41273 ------
NM_016205chr41192 ------
NM_016206chr397651 3477 3039 2745 2696 2682 2544 1791 447 68119 6252 3556 3311 2410 1373 --36655 6441 157
NM_016216chr3145 ------
NM_016231chr1741402 1187 414 296 ------
NM_016257chr133457 1316 163 ----12865
NM_016260chr276073 5333 3063 2518 2197 2150 867 55016 2843 2614 2486 2006 ----
NM_016269chr411149 ------
NM_016287chr131863 1658 735 1549 --11964
NM_016396chr1532998 2425 537 1902 12388 12376
NM_016472chr1411532 ------
NM_016480chr53711 362 307 1599 ----
NM_016507chr1783020 2424 2105 893 866 723 485 353 ------
NM_016542chrX2583 243 ----11399
NM_016557chr311049 ------
NM_016592chr201533 ------
NM_016620chr11495 ------
NM_016622chr231687 606 475 ------
NM_016640chr51104 ------
NM_016824chr1011172 ------
NM_016946chr183586 2719 2502 1430 1216 980 381 251 ------
NM_017415chr583833 3773 3681 3575 2897 1437 1322 697 24022 1596 23544 96 11424
NM_017440chr122565 78 ------
NM_017447chr2143851 2674 1427 472 13524 22979 2745 14382
NM_017522chr131374 1046 1014 ------
NM_017554chr31857 --2469 186 11520
NM_017569chr13138 ------
NM_017577chr341653 1312 1156 117 ------
NM_017634chr861600 1406 1229 641 346 145 1359 ----
NM_017637chr9108605 8292 8059 7817 7738 7356 7342 3293 1626 88 1226 58612 8098 6494 542 165 --
NM_017644chr344934 4272 4011 928 --23604 401 --
NM_017645chr942476 1222 934 268 13137 1498 1921
NM_017650chr775335 4551 4385 3719 1561 789 704 22073 1317 21904 1438 --
NM_017693chr1311255 ------
NM_017709chr194291 3469 3431 3181 2920 1532 613 381 330 44299 3722 3343 1286 1413 13379
NM_017753chr91421 ------
NM_017762chr1522430 27 ------
NM_017778chr81203 ------
NM_017780chr81224 ------
NM_017813chr854744 2301 1259 1106 216 --15491 --
NM_017919chr965661 5617 3845 986 393 194 25569 4003 1308 13685
NM_017994chr721986 24 12010 --1250
NM_018036chr1433893 3871 3539 34224 1097 559 --1510
NM_018084chr222939 2182 --1868 12300
NM_018085chr1117922 7851 6956 6667 6497 6139 4967 3116 2507 1247 1208 22044 1109 31345 1234 74 22332 1378
NM_018112chr92378 145 ------
NM_018179chr121245 ------
NM_018323chr441746 1461 1205 672 31625 380 334 21180 679 1586
NM_018327chr201682 ------
NM_018330chr101561 ------
NM_018361chr844063 2946 326 168 ----1278
NM_018362chr1143900 3179 711 703 33013 2868 1168 ----
NM_018369chr5149 ------
NM_018373chr14105548 5432 5315 4743 4308 4012 2537 1318 984 788 12163 --1404
NM_018374chr744051 3309 1562 1365 1357 ----
NM_018383chr212048 ------
NM_018440chr8117708 7322 7207 6215 6176 2855 2811 2193 1982 1855 891 37200 3277 2526 16202 17437
NM_018482chr812149 ------
NM_018566chr153872 3580 1723 390 283 13366 --1695
NM_018584chr12818 407 ------
NM_018638chr1265009 4118 4076 4013 2269 1096 15151 --12183
NM_018640chr1231897 1080 1026 12224 ----
NM_018657chr33800 661 93 ------
NM_018834chr51700 ------
NM_018945chr632814 2657 366 11101 22406 1137 13177
NM_018981chr21942 ------
NM_018999chr1044629 4532 1919 915 24719 1792 11494 11825
NM_019001chr344443 1941 1584 691 21774 401 1918 14893
NM_019045chrX1131 ------
NM_019072chr534237 2899 1344 2437 395 11510 --
NM_019590chr1021249 106 ------
NM_019903chr1011172 ------
NM_020116chr41343 --11238 --
NM_020141chr142067 1833 1769 1622 1657 1617 --
NM_020198chr1731517 1012 108 ----1505
NM_020226chr42566 286 ------
NM_020337chr432904 2315 301 ------
NM_020405chr1793838 3744 3587 2909 1799 1370 1039 1000 32 --23562 1761 --
NM_020432chr742009 1992 1751 800 21944 1852 1264 1372
NM_020443chr146176 5472 1127 940 34885 209 173 12393 12548
NM_020456chr1322198 1646 12034 --12327
NM_020640chr331891 314 126 --11469 --
NM_020711chr262357 2231 1844 348 210 88 11033 ----
NM_020718chr1675211 4845 4821 4179 2297 1748 103 15083 22615 757 11658
NM_020738chr231491 392 276 ------
NM_020739chr1552858 2702 1653 854 178 ----33662 1318 738
NM_020742chrX52650 2045 2034 1958 1697 ------
NM_020752chr10--12029 --22217 710
NM_020772chr1798658 5824 2799 2597 2057 1632 1587 1365 368 28042 6010 27637 5358 18638
NM_020774chr1846171 6040 3880 3831 45099 4421 4145 3896 ----
NM_020796chr512221 ------
NM_020801chr512111 ------
NM_020805chr181421 ------
NM_020824chr101543 ------
NM_020843chr15126 ------
NM_020844chr877703 6552 6188 2584 2020 1714 709 15280 ----
NM_020856chr19139 ------
NM_020859chr463931 3670 3210 1215 957 569 ----12907
NM_020871chrX42249 1700 998 408 1926 ----
NM_020917chr1983919 3768 3729 3612 2842 2827 1139 585 161 13863 --
NM_020922chrX4599 296 110 84 1336 ----
NM_020924chr91202 ------
NM_020951chr1911650 ------
NM_020964chr18124502 4418 4186 4039 3977 3873 3575 3388 1722 1493 268 136 44258 1682 1608 1382 13266 --
NM_021007chr21648 ------
NM_021033chr1333342 2486 2273 ------
NM_021047chr192250 80 ------
NM_021090chr2274080 3425 1805 1381 742 660 134 33836 637 467 11087 11223
NM_021116chr7118954 7403 7291 6950 6303 6277 6184 5942 3383 2073 2040 37891 2583 619 ----
NM_021136chr141178 ------
NM_021140chrX21041 858 ------
NM_021148chr71848 ----1130
NM_021176chr221605 588 ------
NM_021191chr1212041 ------
NM_021205chr132506 658 178 --12434 --
NM_021222chr131432 1351 63 ------
NM_021252chr1032055 1623 482 --11567 --
NM_021255chr1443326 1155 936 284 13241 1920 13250
NM_021629chr393546 3228 3080 1754 865 769 616 382 220 --11780 --
NM_021814chr621244 679 ------
NM_021911chr565147 5014 2033 600 539 395 24411 4216 ----
NM_021912chr1563770 3165 2930 2898 2842 2651 22866 2751 13110 1366
NM_021914chr1452434 2248 1819 794 429 1956 ----
NM_021961chr1186997 6354 5080 5015 1539 1446 352 158 25704 1884 22479 2280 --
NM_021964chr375598 5174 4212 2112 1442 1177 1053 15316 --25270 2259
NM_021973chr41173 ------
NM_021977chr663822 3096 1475 1377 953 741 21371 385 --13296
NM_022048chr15125730 4697 4557 4296 2442 2306 2237 1933 1753 1228 842 568 ------
NM_022114chr123976 571 14319 11311 21231 220
NM_022459chr1365543 5414 1699 1661 1073 70 ----2828 432
NM_022782chr12124 ------
NM_022824chr541919 1483 616 317 ------
NM_022893chr21307 ------
NM_022898chr1454658 3336 1870 1626 766 --11636 13259
NM_023923chr183252 2688 2606 2319 1205 1062 884 765 12296 23399 575 1241
NM_024090chr411780 ------
NM_024295chr821957 1385 ------
NM_024415chr5163 ------
NM_024491chr32168 77 --1638 --
NM_024524chr332276 969 343 32909 2147 1177 1687 --
NM_024646chr183846 3521 3267 3080 3063 2773 2617 123 11587 31232 661 271 --
NM_024751chr451917 1614 695 628 602 12009 ----
NM_024761chr955341 4126 3939 1723 350 34829 3822 3670 ----
NM_024770chr296592 6287 5934 4367 4112 1953 1431 1368 842 1309 ----
NM_024831chr82238 162 ------
NM_024837chr1531647 84 77 ------
NM_024847chr163313 118 89 ------
NM_024884chr1464284 1520 969 743 718 514 34392 408 371 ----
NM_024927chr17166 ------
NM_024930chr562787 2495 1108 360 146 131 --12616 --
NM_024947chr3138097 8068 7318 7143 6652 3224 3024 2868 1556 1508 737 714 121 21387 880 ----
NM_024953chr1262101 2025 1047 488 418 397 2966 790 ----
NM_024969chr21928 ------
NM_024989chr288087 7654 7186 6762 2194 1749 1650 157 1260 --12808
NM_024997chr1661223 1210 1029 997 501 118 11004 ----
NM_025054chr843702 3337 976 917 13051 --21067 561
NM_025073chr174477 4347 3879 2899 1074 570 311 13422 ----
NM_025076chr21543 ------
NM_025147chr21451 ------
NM_025195chr861606 373 327 255 175 153 21715 1439 ----
NM_025208chr1131727 342 231 1926 ----
NM_030664chr1052102 951 487 364 29 ----1325
NM_030774chr1121545 401 ------
NM_030784chr61366 ------
NM_030806chr168871 8534 7952 7312 6180 2220 ----26172 2207
NM_030915chr232321 1480 292 ------
NM_031243chr742069 1593 1461 249 ------
NM_031263chr91157 ------
NM_031438chr52436 21 1389 190 11826
NM_031453chr1052572 2461 2311 1746 436 1484 1317 --
NM_031844chr1114045 3820 3773 3661 3536 3424 3410 3385 2711 1076 591 12567 ----
NM_031845chr253383 3353 2629 612 536 32735 1407 625 11431 --
NM_031847chr253383 3353 2629 612 536 32735 1407 625 11431 --
NM_031953chr41472 ------
NM_032027chr1127 ------
NM_032105chr1138037 7976 7253 6732 6621 6298 6284 5300 5162 1984 1755 1212 670 38062 5282 4951 22605 1715 --
NM_032116chr1363995 2262 1689 1024 1005 591 21186 161 14118 --
NM_032186chr11495 ------
NM_032199chr1053459 2742 1285 760 703 11212 ----
NM_032217chr411173 ------
NM_032228chr1133563 2410 243 53262 2642 2197 864 678 22600 840 --
NM_032299chr111219 ------
NM_032315chr1185 ------
NM_032373chr1064072 3930 3654 1661 535 482 11418 13956 14322
NM_032408chr72878 87 ------
NM_032431chr11138 ------
NM_032440chr1052846 2609 2219 1883 745 22261 545 12745 --
NM_032446chr533304 3003 325 22548 1026 21547 794 --
NM_032491chr121979 ------
NM_032558chr911120 ------
NM_032560chr1441055 722 356 210 11087 --1955
NM_032590chr1211124 ------
NM_032632chr141729 ------
NM_032689chr192658 102 ------
NM_032842chr71311 ------
NM_032900chr1053625 2749 2426 638 537 1546 13289 12971
NM_033020chr133883 3689 1122 2853 252 1360 --
NM_033071chr61229 ------
NM_033081chr2011209 11195 --1479
NM_033132chr132613 494 ------
NM_033135chr1131727 342 231 1926 ----
NM_033181chr633446 3059 839 --13030 --
NM_033222chr921326 121 ----135
NM_033224chr7107864 6604 6500 6038 5858 5072 3167 2194 1724 878 27614 1810 25248 573 2509 183
NM_033285chr854280 3680 3390 3096 3068 13838 ----
NM_033300chr131374 1046 1014 ------
NM_033340chr1021292 26 ------
NM_033360chr12114329 4209 4148 3601 1859 1370 1143 1025 562 530 383 24021 1683 ----
NM_033430chr451227 1024 753 322 143 ------
NM_033437chr451227 1024 753 322 143 ------
NM_033656chr2155845 5593 3849 695 535 13876 15719 --
NM_052811chr13105298 5233 4559 3756 3461 3299 1663 1092 547 379 25264 3926 ----
NM_052900chr811521 ------
NM_052937chr812677 ------
NM_052950chr1342226 2200 2054 267 11998 --21713 1514
NM_053016chr996789 6684 6458 6192 6105 5695 5644 5177 2940 26492 6369 26764 1619 1923
NM_053043chr786228 6147 5970 2569 1975 1897 1231 572 1892 11562 15688
NM_053064chr142894 761 12832 --12417
NM_057089chr71341 ------
NM_057182chr191532 ------
NM_058172chr411132 ------
NM_058241chr242163 1698 1471 1453 ------
NM_058241chr242163 1698 1471 1453 ------
NM_078469chr101177 ------
NM_078470chr104618 148 70 42 12208 --11683
NM_078485chr63724 637 297 ------
NM_078629chrX3578 134 119 ------
NM_078630chrX3578 134 119 ------
NM_080599chr102403 385 ----1257
NM_080743chr682117 1863 1849 1824 1008 968 687 460 1663 1994 --
NM_080748chr20172 ------
NM_080759chr1322597 1855 12104 ----
NM_080760chr1322597 1855 12104 ----
NM_080862chr32949 534 --11039 --
NM_080867chr1413576 --24827 3560 --
NM_080927chr343198 1195 1056 713 --23378 668 --
NM_130391chr912194 ----184
NM_130392chr912194 ----184
NM_130393chr912194 ----184
NM_130438chr2183366 2806 2420 2406 2316 1084 594 159 ------
NM_130838chr1521594 373 --1359 1604
NM_130839chr1521594 373 --1359 1604
NM_130847chr11105695 4709 4025 3625 2265 1736 1696 1322 1152 301 45459 4841 2047 923 1431 14759
NM_133265chrX52969 2900 1457 151 79 11212 --11109
NM_133477chr442912 2754 2570 547 1959 ----
NM_133503chr121671 ------
NM_133504chr121671 ------
NM_133505chr121671 ------
NM_133506chr121671 ------
NM_133507chr121849 ------
NM_133646chr265294 4921 4554 4409 3825 3653 --31583 594 568 11762
NM_133650chr61229 ------
NM_138270chrX33159 2765 2088 ------
NM_138288chr1431529 321 33 21876 499 22085 711 12051
NM_138370chr21629 ------
NM_138437chrX1310 ------
NM_138444chr1354376 3116 3051 1210 1097 14822 --24065 3877
NM_138459chr653631 2517 993 267 29 --3689 618 151 --
NM_138468chr285922 5859 5088 4275 2249 2224 2156 1397 25416 538 33893 2508 34 --
NM_138576chr1454658 3336 1870 1626 766 --11636 13259
NM_138638chr1452434 2248 1819 794 429 1956 ----
NM_138713chr16128112 8022 7772 7368 6384 5715 5204 2330 1799 1501 243 113 26084 2595 ----
NM_138714chr16128112 8022 7772 7368 6384 5715 5204 2330 1799 1501 243 113 26084 2595 ----
NM_138782chr51117 ------
NM_138959chr176269 5789 4805 4798 4780 4552 2345 35593 4499 1899 1295 14656
NM_138966chr181240 ----1445
NM_139072chr22730 343 ------
NM_139283chr1221569 150 32262 903 163 1140 --
NM_144567chr142768 761 468 370 1617 ----
NM_144571chr496229 6158 4924 4362 2714 2604 2274 1054 294 25899 663 24663 1032 --
NM_144578chr14104739 4693 3656 2151 2103 2044 1990 1652 588 461 22072 779 34243 746 498 --
NM_144590chr103837 553 341 --1302 --
NM_144710chr22990 257 ------
NM_144775chr1784830 4546 4116 3166 3136 3017 789 393 14981 44259 3386 1042 687 --
NM_144778chr1332358 1000 845 142 ----
NM_144949chr252588 2379 2129 903 273 12040 --12164
NM_144963chr831856 1019 484 --1228 --
NM_144973chr1295317 4935 4545 4537 3467 3363 1709 1671 784 1796 --23325 1591
NM_144997chr173871 439 80 ------
NM_145203chr131363 ------
NM_145259chr254802 2526 2450 2066 1692 31993 1122 1111 --15212
NM_145284chrX3941 544 300 --1399 --
NM_145309chr1151057 503 346 173 70 ----11114
NM_145313chr1041615 1436 576 75 11267 --11461
NM_145802chrX2645 388 --1809 --
NM_145808chr723022 2347 1934 --12213
NM_147147chr641627 582 429 240 --11133 --
NM_147189chr851891 1751 936 728 370 ------
NM_148918chr171121 ------
NM_152221chr2211230 ------
NM_152227chr201569 ------
NM_152261chr1222407 2286 --11815 22078 1606
NM_152263chr1165833 5575 5376 5253 5054 4492 4479 4048 3679 2415 2150 1826 1458 998 741 255 44873 3926 811 536 24182 1433 --
NM_152277chr551975 734 625 514 202 11969 ----
NM_152300chr1711452 ------
NM_152305chr321389 500 ----1159
NM_152352chr1862668 2223 1101 1060 915 868 12499 12566 --
NM_152542chr431933 1817 617 ------
NM_152624chr5147466 6659 6594 5673 5557 5458 2515 2176 1715 1270 668 639 243 53 22395 2375 11254 35493 4819 2338
NM_152638chr1221279 43 122 ----
NM_152754chr743666 2846 1203 269 33684 3429 425 ----
NM_152756chr563888 3402 1568 1474 1303 207 23294 1003 13028 --
NM_152758chr833055 2069 769 ----1199
NM_152787chrX53872 3707 3643 924 41 ------
NM_152857chr62697 106 ----1297
NM_152858chr62697 106 ----1297
NM_152862chr21368 ------
NM_152896chr92782 763 ------
NM_152910chr131196 ------
NM_152924chr1576635 6313 5753 4798 1186 1074 536 --1470 --
NM_153050chr2274080 3425 1805 1381 742 660 134 33836 637 467 11087 11223
NM_153051chr2274080 3425 1805 1381 742 660 134 33836 637 467 11087 11223
NM_153181chr181240 ----1445
NM_153207chr1233965 1349 862 11491 ----
NM_153605chr311250 ------
NM_153649chr142071 1968 1410 756 ------
NM_153687chr1221153 66 ------
NM_153689chr241751 677 395 54 12306 ----
NM_153809chr91618 ------
NM_153810chr1094444 3935 3788 3702 1478 1077 937 605 202 --11347 --
NM_170679chr51157 --11122 --
NM_171827chr24883 837 506 51 ------
NM_172071chr197222 6639 6322 5695 5081 2087 1869 1602 661 --36526 6082 1722 1510
NM_172159chr33954 432 138 ------
NM_172160chr33954 432 138 ------
NM_172230chr11138 ------
NM_172373chr1351095 1016 1009 967 242 ------
NM_173039chr111214 ------
NM_173198chr912268 ------
NM_173200chr912268 ------
NM_173214chr16128112 8022 7772 7368 6384 5715 5204 2330 1799 1501 243 113 26084 2595 ----
NM_173510chr2212617 ------
NM_173642chr168202 7031 3544 2783 1369 58 --58676 6692 6161 2858 1196 37315 6909 3308
NM_173808chr133135 3118 1702 1793 ----
NM_173825chr322458 2444 12793 21905 419 12308
NM_175069chr91922 ------
NM_175624chr12187718 7356 6405 5269 5182 3076 3034 2906 2881 2856 2405 2380 2270 2256 2247 2222 1158 31 148 25403 2355 12995
NM_175625chr12187718 7356 6405 5269 5182 3076 3034 2906 2881 2856 2405 2380 2270 2256 2247 2222 1158 31 148 25403 2355 12995
NM_175736chr1247420 5946 2544 2275 27277 5090 36559 1476 130 --
NM_177398chr131295 634 57 ------
NM_177399chr131295 634 57 ------
NM_177538chr2328867 8314 8190 8184 7949 7828 7341 7207 7073 6996 6921 6588 6549 6113 5912 5547 5425 5409 5384 2728 2436 1926 1567 1541 1302 1280 1266 831 695 558 461 422 21889 40 57099 6864 6575 2023 1402 --
NM_178009chr131159 ------
NM_178011chr1022524 816 ------
NM_178313chr241894 596 587 148 ------
NM_178445chr311049 ------
NM_178539chr1242122 1930 1778 321 1466 ----
NM_178578chr2032278 1683 458 ------
NM_178584chr22990 257 ------
NM_178586chr1421766 912 ------
NM_180989chr131479 ------
NM_181054chr1411014 ------
NM_181332chrX52650 2045 2034 1958 1697 ------
NM_181489chr3115947 5922 5827 5444 5406 5045 2443 2129 1176 1135 870 24310 1183 15540 --
NM_181521chr1696671 5971 4994 4921 4681 1831 1642 736 179 24430 132 21105 244 --
NM_181659chr2032532 151 116 167 2764 756 13287
NM_181659chr2032532 151 116 167 2764 756 13287
NM_181672chrX41575 1337 1280 554 --1446 --
NM_181673chrX41575 1337 1280 554 --1446 --
NM_181783chr1241946 1470 722 316 ----2576 340
NM_181825chr221160 ------
NM_182493chr16115302 5164 5139 4683 4060 4043 3974 3369 1922 1736 1154 1521 23475 1180 --
NM_182515chr1976710 6696 4609 4583 1730 997 871 --1657 16185
NM_182691chr731412 555 130 11120 ----
NM_182692chr731412 555 130 11120 ----
NM_182715chr72935 912 ----167
NM_182762chr796048 5733 5155 4851 4711 3849 2018 1730 904 45437 4920 2501 1846 21370 878 --
NM_182796chr52270 239 ------
NM_182830chr1411442 ------
NM_182898chr756291 6117 2129 1590 1347 16057 --1214
NM_182899chr756291 6117 2129 1590 1347 16057 --1214
NM_182948chr152209 1231 686 463 53 ------
NM_182961chr61229 ------
NM_184234chr20159 ----148
NM_194071chr744649 3547 3348 943 25423 4040 13792 11430
NM_194259chr161454 ------
NM_194260chr161454 ------
NM_194261chr161454 ------
NM_194292chr141728 655 181 109 --1466 --
NM_194314chr164680 4352 4175 3850 3795 1823 31215 1161 386 --14920
NM_194317chr222770 182 ------
NM_194434chr1842294 2081 798 440 35158 4661 1943 --13738
NM_197941chr51901 ------
NM_197968chr131103 ------
NM_198040chr111052 ------
NM_198123chr811521 ------
NM_198124chr811521 ------
NM_198273chr542142 1035 176 154 31198 618 106 ----
NM_198334chr111733 ------
NM_198335chr111733 ------
NM_198336chr721736 1368 11687 ----
NM_198395chr51472 ------
NM_198396chr171398 ------
NM_198402chr3169 --1340 --
NM_198484chr396067 5223 5210 5184 5112 4323 2084 1589 366 2800 73 45963 5792 5319 4409 --
NM_198513chr821387 794 --11990 --
NM_198549chr1113130 3091 2837 2564 1167 830 673 658 633 286 26 11295 11142 --
NM_198581chr2106825 6784 6441 6325 5482 5156 4853 2614 2460 2083 21733 386 --11370
NM_198715chr186228 5846 4735 4315 2314 1706 1458 783 11109 11282 --
NM_198793chr374130 3280 2760 1626 605 544 225 13644 12807 --
NM_198889chr411173 ------
NM_198900chr1247420 5946 2544 2275 27277 5090 36559 1476 130 --
NM_198968chr1353149 3068 857 724 581 13797 23075 556 --
NM_198995chr181435 ------
NM_199135chr91863 ------
NM_199189chr51700 ------
NM_199229chr251723 1700 1524 237 108 11467 21448 1126 11583
NM_199328chr212892 879 1986 ----
NM_199355chr1621719 74 11289 ----
NM_199358chr91863 ------
NM_199421chr1413576 --24827 3560 --
NM_199454chr123976 571 14319 11311 21231 220
NM_199462chr175006 4607 3800 3134 1127 731 434 13968 34502 3096 1908 11607
NM_201269chr11495 ------
NM_201280chr651462 1335 1119 1076 570 ----1584
NM_201574chr21214 ------
NM_201624chr131037 898 238 11224 ----
NM_201632chr521473 1306 ----11813
NM_201634chr521572 1405 --11222 11912
NM_201998chr111652 ------
NM_203283chr42501 36 ----197
NM_203284chr42501 36 ----197
NM_203327chr2034422 4319 219 --13167 --
NM_203394chr1222348 2273 ----1724
NM_203459chr11872 ------
NM_203504chr442587 1864 304 150 ------
NM_203505chr442587 1864 304 150 ------
NM_206852chr141178 ------
NM_206853chr643915 2653 1307 507 13635 --13657
NM_206854chr655176 3914 3481 3444 1768 14896 13647 14918
NM_206855chr666141 4879 4446 4409 4146 331 25861 3901 14612 15883
NM_206857chr141178 ------
NM_206866chr2122473 1301 1594 --12889
NM_207299chr91421 ------
NM_207304chr1332245 887 732 ------
NM_207352chr42693 168 12568 --12488
NM_207377chr14196 ------
NM_207406chr454850 4448 2378 2060 972 35721 1638 165 --16002
NM_213569chr10122 ------
NM_213589chr274480 3995 2234 2130 2053 1980 1087 24659 474 12190 --
NM_213590chr13105298 5233 4559 3756 3461 3299 1663 1092 547 379 25264 3926 ----
NM_213594chr121979 ------
NM_213598chr1931435 1128 268 168 ----
NM_213609chr32401 379 157 ----
NM_213648chr521473 1306 ----11813
NM_213651chr111520 ------