TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-514a-5p
miRNA Sequence: UACUCUGGAGAGUGACAAUCAUG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000020chr12102297 2075 1635 1602 866 486 478 396 342 320 --42369 892 406 302 11905
NM_000084chrX126775 6567 6481 6233 4863 2641 2475 2399 1612 1560 1008 460 --11990 --
NM_000216chrX84080 3789 3313 3261 1131 656 101 81 ------
NM_000332chr6126646 6336 5526 4957 2883 2801 2411 1973 1433 487 376 137 --1764 --
NM_000346chr1731664 789 309 ----1587
NM_000390chrX33423 2303 54 12355 --1730
NM_000408chr252194 2176 1217 581 64 --12969 --
NM_000448chr1173133 2777 2412 1004 838 675 273 --12365 --
NM_000555chrX117714 7694 6448 6246 5972 5274 3153 2250 2035 249 21 ----130
NM_000599chr2113724 3687 3537 3438 3110 3006 2879 1776 1164 628 339 --34097 2945 1565 --
NM_000610chr11102932 2735 2249 2088 2053 1953 1933 942 805 639 --1362 --
NM_000618chr1265798 5780 5136 2355 1457 1122 --26571 1981 --
NM_000618chr1265798 5780 5136 2355 1457 1122 --26571 1981 --
NM_000663chr16132747 2674 2655 2437 2325 2304 1999 1096 1030 911 483 230 96 --32054 874 288 --
NM_000719chr12166622 6583 6541 6387 6257 5714 5186 4818 4340 4305 2444 1096 503 481 418 412 --14325 --
NM_000813chr534460 1001 288 74182 3917 3592 2094 1782 1118 749 ----
NM_000831chr1255969 5565 5457 5451 5424 5202 4819 4754 4716 4634 4460 4208 4038 2412 2025 1530 1440 1396 1328 1205 1175 781 594 416 103 11925 26021 303 13946
NM_000859chr561316 1179 1099 697 265 151 ------
NM_000875chr15125397 5252 5107 5074 4955 4442 2227 2189 2133 2034 1013 644 --36656 4753 1381 --
NM_001001389chr11102932 2735 2249 2088 2053 1953 1933 942 805 639 --1362 --
NM_001001390chr11102932 2735 2249 2088 2053 1953 1933 942 805 639 --1362 --
NM_001001391chr11102932 2735 2249 2088 2053 1953 1933 942 805 639 --1362 --
NM_001001392chr11102978 2781 2295 2134 2099 1999 1979 988 851 685 --1408 --
NM_001001419chr544524 4495 4261 4070 1221 --13283
NM_001001420chr544524 4495 4261 4070 1221 --13283
NM_001001928chr22198315 7887 6937 6913 6583 6335 5757 5045 3346 3218 2998 2758 2589 2470 2204 1692 1384 1013 794 18328 13253 --
NM_001002762chr10112764 2291 1848 1141 906 881 760 301 272 173 43 --22792 2629 --
NM_001003800chr971117 1003 964 667 585 470 243 ----12357
NM_001003940chr1593567 3183 3090 3038 2808 2358 1134 492 364 22432 1116 --23711 1480
NM_001003942chr1593567 3183 3090 3038 2808 2358 1134 492 364 22432 1116 --23711 1480
NM_001003943chr1593571 3187 3094 3042 2812 2362 1138 496 368 22436 1120 --23715 1484
NM_001004065chr983942 3411 3355 2793 2786 2759 1387 461 --11349 --
NM_001004317chr6104192 3938 3442 2940 1369 1338 1231 523 197 173 ------
NM_001005473chr556474 5815 5227 4124 702 12210 ----
NM_001005609chrX83305 3247 3161 2835 2690 480 349 336 --32482 219 153 --
NM_001008220chr5123519 3174 2811 2745 2498 2479 2425 1501 1203 913 579 133 13309 12546 23467 180
NM_001008408chr795380 4971 4263 2041 1748 734 728 163 133 --21674 553 --
NM_001009880chr22104366 3768 3600 1915 973 395 341 330 281 49 --24189 1414 --
NM_001010846chr194049 2975 2911 2849 1361 856 620 129 73 --13840 --
NM_001010888chrX94469 3570 1838 1648 1383 1189 357 327 110 --53552 716 504 374 218 --
NM_001012393chr1164841 4601 4465 4178 3227 202 --25009 1487 --
NM_001014797chr10177988 7717 7621 7185 7171 6899 6614 6191 6111 5402 5202 2761 2244 1715 1423 1069 110 --27701 7046 16473
NM_001017995chr5114122 4083 3647 3186 3010 1938 1692 1499 740 540 22 --11241 24037 1599
NM_001018065chr9106043 5928 5728 4481 2093 2013 1330 1274 1265 626 24739 2403 1849 --
NM_001018066chr9106043 5928 5728 4481 2093 2013 1330 1274 1265 626 24739 2403 1849 --
NM_001025108chr253186 2533 1213 285 271 --23942 23 --
NM_001031695chr22125173 5160 4507 4160 4064 3983 3342 1950 1821 1678 1224 914 25303 1114 15136 --
NM_001032296chr13122901 2537 2406 2204 2010 1981 1843 1134 1048 741 635 144 --11949 --
NM_001033117chr3164835 4662 4353 3799 3737 3676 3604 1851 1583 1497 1278 1246 821 800 754 219 --34542 1654 55 --
NM_001034841chr1694782 4394 4206 4200 4040 3830 3638 883 666 --1202 --
NM_001035511chr161417 1365 872 844 673 436 140 ----
NM_001037553chr21154854 4812 4564 4420 3924 3491 1887 1692 1039 981 729 633 243 198 71 ------
NM_001039547chr387853 7701 7639 6092 5242 2802 1802 1086 26796 6735 15232 11823
NM_001040424chr2152889 1946 924 715 311 1131 1205 12158
NM_001040665chr7124516 4037 3257 1954 1561 1442 1420 1230 1144 1115 1082 144 ------
NM_001042413chr963999 3594 3062 2855 950 120 --11637 --
NM_001042555chr1264445 3294 1713 1523 1503 1029 14554 ----
NM_001042599chr2106755 5088 5027 3126 3041 2849 2539 2489 1261 258 11848 12298 --
NM_001042603chr1264825 2022 1267 1065 119 69 14222 15303 --
NM_001044387chr1973449 3271 2645 1458 1170 971 795 ----12552
NM_001044388chr1973449 3271 2645 1458 1170 971 795 ----12552
NM_001100108chr1157457 7424 7025 6609 6559 6310 5372 5064 3135 2385 1943 1007 857 545 233 16851 ----
NM_001106chr379338 8168 6042 3333 2315 2223 423 18515 37540 6728 1122 --
NM_001167chrX106275 6184 5969 5668 5351 4677 4483 2512 805 391 26628 182 11647 --
NM_001256chr1751984 1869 996 791 781 1417 1357 12766
NM_001259chr776389 6368 2039 1746 1692 1284 1034 14452 36159 6115 2315 --
NM_001364chr11114739 4027 3965 3520 1771 1559 1389 1266 1254 1045 315 11229 ----
NM_001399chrX83305 3247 3161 2835 2690 480 349 336 --32482 219 153 --
NM_001609chr1043458 3085 1253 138 1587 1314 13025
NM_001650chr1853235 3133 3045 2631 1657 ------
NM_001918chr189170 8696 8063 7688 7431 3325 2056 221 15796 16945 --
NM_002025chrX43453 2266 2113 619 12807 --19003
NM_002111chr4103779 3716 3582 3329 3019 1479 1348 1289 993 44 ----23307 2748
NM_002137chr752135 1949 467 157 59 ------
NM_002203chr563666 2927 2787 2721 1638 799 1673 2271 48 --
NM_002285chr253186 2533 1213 285 271 --23942 23 --
NM_002309chr22152907 2637 1946 1928 1257 1188 1182 1008 978 556 451 374 355 186 90 1891 32331 2149 749 12824
NM_002359chr17114007 3968 3106 1724 1343 993 574 445 308 260 150 23555 800 23728 284 --
NM_002387chr593984 3175 1853 1451 1412 1327 1076 882 195 13709 121 --
NM_002545chr1164841 4601 4465 4178 3227 202 --25009 1487 --
NM_002581chr985626 5031 4499 3698 1573 1172 255 105 --2701 318 11249
NM_002613chr16155418 4543 4503 4327 4218 1854 1798 1266 1186 1118 1108 1050 893 469 214 --21848 1021 --
NM_002959chr174087 3238 3186 1057 584 372 164 1852 33584 3382 901 13261
NM_003012chr882735 2553 2262 2079 1952 1071 890 594 ----32721 461 188
NM_003034chr12107873 7443 6376 6201 6152 4971 4941 3109 2637 1593 --26804 1662 134
NM_003045chr13134419 3914 3874 3650 3247 1779 1757 1493 1389 744 502 53 22 14396 ----
NM_003281chr1225167 5055 4810 4563 4426 4158 4144 4031 4002 3969 3652 3518 3475 3438 2131 1741 1627 1386 1002 621 493 213 --42152 1849 1150 542 --
NM_003298chr3114991 4551 4532 4340 3934 3908 2485 1339 1229 1050 305 16143 21429 1392 1405
NM_003478chr1122628 2513 ----22609 1265
NM_003559chr17133627 3385 3299 3213 1173 780 706 697 677 321 105 29 23 ----1883
NM_003576chr13122901 2537 2406 2204 2010 1981 1843 1134 1048 741 635 144 --11949 --
NM_003583chr1273916 3243 3179 2754 1225 1006 728 --1374 --
NM_003590chr22863 703 12994 12645 11228
NM_003607chr1123718 3573 3051 2919 2758 1133 842 727 530 359 249 106 --23878 1338 --
NM_003644chr17106090 5887 5433 4595 2353 2045 1214 887 566 379 1397 24439 2020 12070
NM_003759chr473777 3121 2906 2867 2631 659 574 23320 1603 ----
NM_004028chr1853235 3133 3045 2631 1657 ------
NM_004171chr11148763 8528 8361 7527 6810 6162 6145 2747 1959 1889 1883 1247 367 334 18675 1806 12876
NM_004513chr1583592 3534 3515 3355 2855 2682 195 73 12843 23688 1476 11332
NM_004586chrX64591 4520 3415 3322 1747 742 24640 838 13887 --
NM_004726chrX54870 4164 3595 1379 1132 1430 15571 --
NM_004745chr8126428 5913 5105 5085 4745 4611 2463 1652 1410 1256 293 163 1951 24392 1950 --
NM_004863chr14114994 4320 4224 4063 3649 3388 1312 844 772 464 23 ------
NM_004947chr372292 2174 1749 824 633 100 92 --21684 645 1387
NM_004976chr11225006 4975 4876 4786 4570 4564 4515 4427 4277 3836 3517 3431 3209 1901 1884 1546 1166 774 348 274 162 119 15040 24908 651 --
NM_004992chrX208100 8051 7801 7756 7215 6455 6340 6232 6094 5941 3023 2805 2415 1823 1576 873 778 227 157 141 --36851 1710 726 --
NM_004992chrX208100 8051 7801 7756 7215 6455 6340 6232 6094 5941 3023 2805 2415 1823 1576 873 778 227 157 141 --36851 1710 726 --
NM_005036chr22198315 7887 6937 6913 6583 6335 5757 5045 3346 3218 2998 2758 2589 2470 2204 1692 1384 1013 794 18328 13253 --
NM_005056chr1265069 3423 1511 1309 363 313 14466 15547 --
NM_005065chr1455242 4741 1499 1046 815 1284 --11006
NM_005109chr362410 2248 1823 962 778 459 --21604 209 --
NM_005116chr20113882 3849 3678 3392 2815 1181 803 524 366 331 116 --1360 --
NM_005188chr11137756 6755 6678 6567 6043 5889 5816 5524 5279 5227 5038 1979 1848 --37251 6106 1605 11868
NM_005235chr2106755 5088 5027 3126 3041 2849 2539 2489 1261 258 11848 12298 --
NM_005338chr7133919 3780 3707 3409 2824 2785 1588 1475 1116 1109 715 481 97 --1823 --
NM_005359chr18116397 6371 5953 5663 5585 5115 4716 4546 4137 1495 212 ------
NM_005399chr153717 3486 3368 1411 122 13648 12845 1500
NM_005475chr1273086 2937 2249 1239 536 316 95 ------
NM_005497chr1795771 5190 2295 1997 1634 1398 832 647 467 15391 14743 --
NM_005504chr1276491 5844 5275 1715 1326 972 160 14828 14542 --
NM_005578chr355025 4151 3984 1044 957 ----168
NM_005665chr123783 2989 11759 --24054 1009
NM_005730chr1283342 3327 2897 2432 2385 1090 806 190 179 22413 1362 --
NM_005795chr232296 2190 1069 --22280 504 12840
NM_005840chrX117642 6929 6531 6419 5961 2676 2647 1977 1867 446 24 --27315 1953 15681
NM_005903chr544524 4495 4261 4070 1221 --13283
NM_005935chr484745 4307 1833 1800 1126 1027 662 218 --11231 --
NM_005937chr17164001 3687 3493 3469 3260 2828 1241 1135 976 887 838 308 300 233 132 113 11029 --21441 1298
NM_005941chr863952 3852 3475 1650 1041 138 --12664 --
NM_005955chr1145067 4957 4909 3886 3524 3443 1868 1693 1434 911 787 580 529 483 11174 24108 841 --
NM_006007chr922929 650 --23856 105 24475 3752
NM_006259chr42268 238 186 --1797
NM_006371chr394915 4781 4499 3267 1430 1096 1017 900 92 --15134 --
NM_006482chr1273916 3243 3179 2754 1225 1006 728 --1374 --
NM_006544chr1475528 4621 3773 1813 1607 1525 1416 --15209 --
NM_006546chr17105327 5306 5224 4538 4289 2355 2021 1989 1974 1059 24614 848 16257 --
NM_006646chr132732 391 12314 --12903
NM_006650chr5123519 3174 2811 2745 2498 2479 2425 1501 1203 913 579 133 13309 12546 23467 180
NM_006654chr1264445 3294 1713 1523 1503 1029 14554 ----
NM_006981chr942897 2733 2482 1034 21024 190 1900 1416
NM_007038chr21105656 5544 4767 3988 3924 3724 2422 2290 2281 917 ----15158
NM_007050chr20157701 7404 6930 6740 6714 6012 5509 5276 5213 4991 2612 2511 1762 1327 34 26464 5158 32487 2212 28 --
NM_007146chr1741075 946 826 510 12627 1994 --
NM_007203chr983942 3411 3355 2793 2786 2759 1387 461 --11349 --
NM_007238chr20124804 4677 4646 4156 4037 4010 1806 1290 1123 1058 1052 295 --24254 116 13181
NM_007249chr13149319 9206 9179 9095 8825 8807 7666 7256 7142 7058 6039 881 365 128 16577 ----
NM_012072chr2094468 3067 1686 1600 1478 889 766 297 50 --129 --
NM_012137chr182879 1823 1799 738 727 678 638 428 ----11083
NM_012164chr9117412 6889 6612 6074 5892 2395 2228 966 615 156 149 --21879 1394 --
NM_012193chr11114365 3949 3787 3555 3400 3293 1767 886 842 341 317 --14426 --
NM_012382chr563734 2894 1583 1508 1416 1025 1445 14307 --
NM_012398chr19142766 2178 2007 1938 1924 1899 1878 1186 1175 1154 330 181 87 25 --12853 --
NM_013231chr1463881 3445 2972 1515 722 268 1411 --13064
NM_013286chr3153715 3181 2897 2719 1414 1401 1268 1143 1038 885 867 843 775 689 337 --12468 --
NM_013372chr1572867 2099 1292 1014 217 196 95 ------
NM_014048chr16124809 4413 4214 3897 3597 3399 3273 1915 1496 1175 472 462 ----1883
NM_014155chr1156384 589 248 228 191 26047 4753 ----
NM_014309chr22125163 5150 4497 4150 4054 3973 3332 1940 1811 1668 1214 904 25293 1104 15126 --
NM_014586chr21154388 3953 3933 3902 2930 1440 1311 1174 1069 987 530 454 208 175 71 --13862 --
NM_014721chr687462 6108 4565 4515 2564 1513 1496 928 24671 4533 11790 --
NM_014729chr822223 1599 ----22242 442
NM_014730chr12134902 4788 4147 3964 3571 1892 1389 1230 1155 1117 1006 327 26 --13666 --
NM_014730chr12134902 4788 4147 3964 3571 1892 1389 1230 1155 1117 1006 327 26 --13666 --
NM_014732chr16155123 4830 4493 4113 4016 3644 3566 2346 1907 1824 1503 1485 1210 657 112 --1709 --
NM_014743chr462130 1043 920 779 387 159 ----12342
NM_014755chr293433 2905 1292 913 698 215 154 103 41 ------
NM_014767chr10133382 3267 2947 2312 1446 1344 1294 1229 834 773 766 692 270 ------
NM_014826chr1123718 3573 3051 2919 2758 1133 842 727 530 359 249 106 --23878 1338 --
NM_014850chr3164835 4662 4353 3799 3737 3676 3604 1851 1583 1497 1278 1246 821 800 754 219 --34542 1654 55 --
NM_014864chr184294 3476 3147 1365 804 467 184 121 13426 --11301
NM_014877chr1796938 5926 5432 5422 4753 3072 2894 1360 620 25143 4782 ----
NM_014924chr1443032 2591 2492 700 ----12513
NM_014935chr1143286 3244 3127 2689 2397 1455 1385 776 674 649 528 418 255 172 --11443 --
NM_014946chr242694 2421 1986 112 12500 ----
NM_014947chr152881 2569 2162 2117 1253 32859 2190 684 11172 --
NM_014982chr1475256 4677 4107 4087 904 872 810 14897 14529 --
NM_015020chr1683876 3071 2785 1194 547 129 62 41 22811 2633 ----
NM_015035chr20195902 5794 4779 4760 4730 4376 4342 4061 2461 2232 1939 1639 1570 1547 1079 990 965 277 153 --31490 1162 1139 15069
NM_015046chr941073 656 230 192 ----1672
NM_015071chr5106455 5484 5336 5245 4717 4451 4442 1698 1575 1462 --14746 15608
NM_015077chr17174426 4407 4393 4214 3632 3588 3440 2860 1878 1794 1788 1472 1421 1171 840 623 454 --11696 --
NM_015090chr1155830 5479 4958 4768 4757 4699 4580 4330 4249 4014 1776 1757 1600 1042 926 22215 2046 13974 11016
NM_015178chr8182610 2426 2368 2242 2131 2041 1981 1905 1779 1641 665 618 527 358 322 162 122 98 1509 1294 --
NM_015264chr22104366 3768 3600 1915 973 395 341 330 281 49 --24189 1414 --
NM_015299chr14153455 3213 3109 2976 2724 1329 1288 897 732 399 336 285 269 242 98 --23860 1215 11349
NM_015310chr8137530 7103 6074 5862 5673 5546 5528 3038 2311 1746 1410 1343 839 28230 2233 16453 --
NM_015315chr563075 2319 1288 1100 681 165 --22302 1345 13118
NM_015458chr885275 4575 3744 3650 1895 872 827 343 ------
NM_015568chr20163904 3797 3689 3461 2864 2728 1316 1218 1148 1011 891 726 614 549 474 121 --21425 1371 --
NM_015602chr151521 1467 408 77 64 --11637 --
NM_015995chr15125013 4770 4744 4326 4088 3876 3742 1693 1635 1540 992 463 11624 11847 --
NM_016089chr3132035 1991 1947 1741 1707 1410 800 464 418 380 272 141 44 ----1550
NM_016206chr3128919 5731 2820 2671 2132 1717 1523 1329 1085 909 859 510 --27191 6832 --
NM_016531chr473819 2850 2814 2781 1357 816 400 24169 355 ----
NM_016544chr273923 3820 3635 2402 1290 387 56 --11226 13204
NM_017563chr3125573 4819 4481 4422 2508 2453 1883 1807 1611 1274 1082 273 --15766 --
NM_017637chr9118976 8568 7529 7124 5884 3058 3011 2275 1590 1221 252 28175 264 39040 8365 3565 --
NM_017644chr374969 4300 4071 3958 1690 1384 1060 24571 1915 15043 13283
NM_017787chr10102885 2653 2610 2465 2279 2213 1907 1091 480 303 197 12290 146
NM_017944chr1163096 2834 2286 2216 1162 1040 1591 12687 --
NM_018036chr1484202 3887 3812 3637 3380 3278 73 53 --14000 --
NM_018071chr143735 678 209 ----2561 147
NM_018085chr1178070 8056 7982 7898 7442 7282 5960 5799 5775 5589 3198 2679 2019 1656 792 582 278 --17275 --
NM_018167chr142386 68 --1344 1332
NM_018689chr1572710 2614 2359 2160 1061 869 154 --22137 1893 --
NM_018979chr1242354 2204 1738 126 ----1530
NM_018999chr1074309 4213 3801 1926 1190 962 577 24865 3681 21554 1303 --
NM_019067chrX54159 3830 3662 3170 1290 --24723 3902 11356
NM_019116chr1693234 2727 2683 2650 2582 1116 862 150 85 1753 ----
NM_020132chr21154854 4812 4564 4420 3924 3491 1887 1692 1039 981 729 633 243 198 71 ------
NM_020182chr2093209 3008 2937 2322 1104 1093 805 709 589 --22741 2254 --
NM_020348chr10102315 2258 2069 1940 1876 1854 804 702 531 42 ----12203
NM_020443chr196898 6585 5923 5251 2166 1229 954 493 86 --14543 --
NM_020456chr1362117 1653 1509 873 604 337 1645 11678 --
NM_020673chr20126933 6155 5986 5941 5913 5889 5846 5640 5617 1867 1847 1553 17728 ----
NM_020686chr16132747 2674 2655 2437 2325 2304 1999 1096 1030 911 483 230 96 --32054 874 288 --
NM_020717chrX134946 3874 3650 3090 1775 1626 1366 1352 1151 1077 757 414 380 14176 ----
NM_020766chrX53710 3287 1675 1600 110 11194 24292 3318 --
NM_020772chr1776423 3469 3212 3064 2549 1191 563 23029 1684 ----
NM_020774chr1833837 1953 1939 24334 573 --1121
NM_020781chr772868 2480 1077 813 804 325 144 ----12209
NM_020853chr1222240 39 12796 --11918
NM_020956chr19304707 4537 4418 4006 3965 3759 3706 3328 3293 1903 1888 1879 1864 1840 1825 1810 1762 1747 1732 1708 1684 1669 1654 1630 1606 1591 1491 1144 934 135 13722 44474 4449 1362 598 --
NM_021148chr762034 1877 855 629 572 363 42093 1798 719 272 ----
NM_021238chr122707 99 ----21489 354
NM_021638chr4134049 4036 3904 1539 1276 1210 1022 937 719 552 478 113 29 --23268 89 --
NM_021911chr534460 1001 288 74182 3917 3592 2094 1782 1118 749 ----
NM_021961chr11104630 2847 2754 2385 2330 1892 1512 1495 1236 110 --13006 --
NM_022048chr15165476 5084 4499 4484 4137 2052 1533 1326 1314 1187 1136 1035 888 871 221 166 16066 ----
NM_022114chr1124090 3739 3292 3038 3030 2904 1747 867 466 190 77 32 --23461 3012 --
NM_022166chr16115423 5381 5190 2245 2210 1892 1536 1021 798 381 54 22256 1780 25673 2360 1474
NM_022465chr1262449 2230 2029 2012 948 389 12019 12421 --
NM_024341chr1973449 3271 2645 1458 1170 971 795 ----12552
NM_024423chr1864081 3195 2625 1629 1333 1172 13617 11320 --
NM_024639chr6102111 1932 1845 499 357 213 154 115 91 50 1937 11152 --
NM_024770chr2126706 6699 6310 5377 5284 5088 4948 4198 992 530 443 32 12410 16531 --
NM_024900chr452302 1923 391 282 44 --22158 289 --
NM_024900chr452302 1923 391 282 44 --22158 289 --
NM_024947chr389178 9130 8075 3241 3049 2677 788 694 15906 17192 --
NM_024963chr7155695 5492 4856 3835 3777 3755 2192 2163 2066 1991 1755 1447 1180 631 66 ------
NM_030648chr485278 4764 4415 1946 1714 1677 83 24 --14603 1715
NM_030806chr1158228 7726 7720 7654 7615 7334 6873 6783 3366 3083 3038 2869 1689 1211 459 --27150 5716 --
NM_030816chr153516 3224 3000 2965 2392 13443 ----
NM_030918chr1115391 5268 4935 4313 4157 3689 2017 1847 1707 1493 107 23472 889 12163 --
NM_031243chr752135 1949 467 157 59 ------
NM_031268chr16155418 4543 4503 4327 4218 1854 1798 1266 1186 1118 1108 1050 893 469 214 --21848 1021 --
NM_031469chr6103769 3691 3594 3519 3369 2839 1364 1314 1139 312 11088 13756 --
NM_032160chr1863075 3052 1647 1093 351 254 14082 11409 --
NM_032711chr17114007 3968 3106 1724 1343 993 574 445 308 260 150 23555 800 23728 284 --
NM_032932chr17156323 5874 5253 5090 4377 4068 2394 2138 2092 1945 1240 1086 678 615 521 --56362 6054 5319 3967 1889 --
NM_033133chr1792502 2386 2329 891 531 402 378 351 267 ----1673
NM_033224chr7107803 7377 6611 6419 5868 2687 2557 1278 341 54 24879 2640 --16143
NM_033389chr17124735 4276 3341 3269 1884 1591 1413 1263 517 480 258 134 --44144 1892 1542 575 --
NM_033429chr1563129 1073 1065 646 639 562 --22154 660 1952
NM_033503chr1593567 3183 3090 3038 2808 2358 1134 492 364 22432 1116 --23711 1480
NM_033505chr296392 5441 4564 4111 2542 2524 1693 950 297 24598 4346 26345 5268 --
NM_033551chr563075 2319 1288 1100 681 165 --22302 1345 13118
NM_033656chr2165742 5358 3725 907 734 723 ------
NM_052906chr22114590 4461 4206 3922 1981 1714 1213 534 277 76 36 --54569 1567 1407 760 557 --
NM_052934chr1122202 1828 1541 901 893 757 691 541 419 175 113 33 ------
NM_053016chr997630 7110 6998 6939 6517 5615 5366 4872 630 12873 ----
NM_053043chr795380 4971 4263 2041 1748 734 728 163 133 --21674 553 --
NM_078476chr6101392 1287 1266 1236 1191 325 267 259 119 77 --1166 --
NM_080669chr17134667 4140 4103 4092 4083 3852 3613 3412 3287 1323 767 344 306 --13939 --
NM_130830chr3143972 3951 3941 3742 3578 2926 2735 2626 2511 1461 1175 1075 1038 535 --23597 906 --
NM_133170chr20157701 7404 6930 6740 6714 6012 5509 5276 5213 4991 2612 2511 1762 1327 34 26464 5158 32487 2212 28 --
NM_133474chr461394 1127 1044 648 605 65 21544 1186 ----
NM_138286chr1983949 2748 1663 1130 749 523 396 223 ------
NM_138468chr255115 3982 1532 1145 257 --15825 11781
NM_138635chr742821 553 204 177 23220 929 ----
NM_138959chr1156685 6383 6353 6240 6133 5754 4510 4370 2120 1941 1209 926 538 380 70 --14938 --
NM_144973chr1264873 4852 4331 2017 1161 955 1198 --14927
NM_145912chr22154546 4163 4146 4012 3343 3333 1859 1719 1404 586 526 504 314 100 40 ----14266
NM_147150chr983942 3411 3355 2793 2786 2759 1387 461 --11349 --
NM_152253chr22113867 3735 2737 1519 1047 1026 986 625 615 425 304 --1893 --
NM_152629chr963999 3594 3062 2855 950 120 --11637 --
NM_152744chr793118 2952 2924 2857 2565 2267 1281 431 387 --150 1867
NM_152999chr7124516 4037 3257 1954 1561 1442 1420 1230 1144 1115 1082 144 ------
NM_153035chr163257 2140 640 583 525 483 12428 --12715
NM_153487chr6174352 4293 4062 4052 3411 3334 3135 3122 3081 3018 1074 835 723 520 330 117 97 --44000 3634 3471 614 14483
NM_153810chr1074877 4362 1367 1338 816 778 69 --23280 1584 --
NM_170686chr772868 2480 1077 813 804 325 144 ----12209
NM_172071chr1105790 5525 5462 2827 2120 568 490 303 127 105 ------
NM_172217chr1583592 3534 3515 3355 2855 2682 195 73 12843 23688 1476 11332
NM_173065chr1142931 2754 2650 2287 2225 1154 992 943 928 651 505 248 208 35 --13243 --
NM_173198chr942897 2733 2482 1034 21024 190 1900 1416
NM_173200chr942897 2733 2482 1034 21024 190 1900 1416
NM_173468chr464610 2407 1822 1770 800 466 12164 15495 --
NM_173531chr1983332 3016 2362 883 826 746 460 149 11266 ----
NM_173582chr1165602 4730 4508 1714 716 192 1513 26226 4763 --
NM_173642chr1129088 8208 7805 7182 6363 5859 3632 3069 3050 2489 2229 2040 --28730 6549 --
NM_175736chr12227037 6768 5634 5205 5179 3123 3007 2988 2894 2684 2590 2553 2509 2130 1970 1932 1439 1273 1245 323 316 37 --16292 --
NM_178151chrX117714 7694 6448 6246 5972 5274 3153 2250 2035 249 21 ----130
NM_178152chrX117714 7694 6448 6246 5972 5274 3153 2250 2035 249 21 ----130
NM_178153chrX117714 7694 6448 6246 5972 5274 3153 2250 2035 249 21 ----130
NM_178498chr1173940 3363 2709 1181 789 776 757 --23338 2602 --
NM_178509chr1773996 2813 1510 1483 1143 1018 640 --12519 --
NM_181489chr3186703 6632 6521 5054 4994 4556 4241 2450 2279 2268 2177 1146 1084 956 843 724 544 51 24869 1784 35070 2460 2053 --
NM_181491chr9152977 2731 2537 2201 2012 1014 933 825 719 619 433 425 178 140 122 --22769 1005 --
NM_182487chr9154158 4134 4111 4030 3660 1347 1324 1202 1161 926 473 457 294 108 23 13966 24193 834 --
NM_182503chr685251 4998 4842 4178 1799 1307 454 345 1826 --25345 1639
NM_182935chr392334 1618 1028 619 599 529 346 340 253 --21831 323 --
NM_182970chr20204067 3952 3872 3685 3664 3210 2860 2854 2616 1395 1341 972 818 507 499 486 456 359 263 74 ------
NM_183397chr20125028 4901 4870 4380 4261 4234 2030 1514 1347 1282 1276 519 --24478 340 13405
NM_198081chr682780 2541 2466 2194 1942 1190 775 601 --22599 893 --
NM_198147chr1771194 1178 1019 989 964 827 353 ------
NM_198595chr4134049 4036 3904 1539 1276 1210 1022 937 719 552 478 113 29 --23268 89 --
NM_198859chr355075 4718 4340 1976 1282 --15000 11325
NM_198900chr12227037 6768 5634 5205 5179 3123 3007 2988 2894 2684 2590 2553 2509 2130 1970 1932 1439 1273 1245 323 316 37 --16292 --
NM_199169chr2093209 3008 2937 2322 1104 1093 805 709 589 --22741 2254 --
NM_199170chr2093209 3008 2937 2322 1104 1093 805 709 589 --22741 2254 --
NM_199171chr2093209 3008 2937 2322 1104 1093 805 709 589 --22741 2254 --
NM_199436chr242694 2421 1986 112 12500 ----
NM_199454chr1124090 3739 3292 3038 3030 2904 1747 867 466 190 77 32 --23461 3012 --
NM_201432chr17106090 5887 5433 4595 2353 2045 1214 887 566 379 1397 24439 2020 12070
NM_201433chr17106090 5887 5433 4595 2353 2045 1214 887 566 379 1397 24439 2020 12070
NM_203327chr20113882 3849 3678 3392 2815 1181 803 524 366 331 116 --1360 --
NM_206855chr645250 2517 924 555 36036 5000 4777 ----
NM_206909chr8137530 7103 6074 5862 5673 5546 5528 3038 2311 1746 1410 1343 839 28230 2233 16453 --
NM_207303chr1074059 4001 3755 3502 1319 701 108 --13686 --