TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-514b-3p
miRNA Sequence: AUUGACACCUCUGUGAGUGGA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000176chr522783 2602 43791 3214 1252 754 23558 2432 13326
NM_000259chr15116353 5137 4772 3919 2267 2023 1847 698 545 461 196 21360 492 --12325
NM_000267chr1753337 3204 3194 2123 412 42602 2549 2178 1044 13013 --
NM_000314chr1063263 3240 2933 2926 1170 212 13079 --31315 235 100
NM_000814chr1553738 3186 1570 996 65 --12771 12808
NM_000826chr442061 149 79 46 22543 226 22453 800 12465
NM_000926chr1148634 8288 2960 596 59378 6984 6691 2381 257 38895 1949 407 --
NM_000959chr1--42695 2672 159 136 --22809 910
NM_001001419chr564705 3899 3428 2045 1364 1099 54628 3833 3453 3186 1804 11149 13199
NM_001001420chr564705 3899 3428 2045 1364 1099 54628 3833 3453 3186 1804 11149 13199
NM_001001481chr853487 3454 1043 889 624 1242 1231 --
NM_001002257chr223561 2882 52663 2639 798 125 95 12428 13102
NM_001003652chr1878077 7690 6169 5448 2934 2565 2482 18393 18657 18103
NM_001003674chr1876596 5783 5403 5052 4831 2319 2098 46453 6193 4817 2697 15492 15540
NM_001003675chr1876596 5783 5403 5052 4831 2319 2098 46453 6193 4817 2697 15492 15540
NM_001003712chr1253011 2886 2822 2620 353 53899 3116 2992 2518 504 1211 --
NM_001004317chr664483 3881 3247 219 190 177 13850 13606 --
NM_001005386chr262413 2151 1626 903 631 169 21805 159 ----
NM_001005473chr574948 4379 4294 2639 1806 1485 228 14639 --1812
NM_001008925chr473444 3196 2823 588 302 261 251 33266 2886 613 1423 --
NM_001009899chr385993 2206 1919 1836 1530 1016 647 439 56467 5468 4451 175 154 15975 --
NM_001009993chr233498 3345 3045 --24455 775 24371 453
NM_001011666chr746571 4138 459 383 25552 343 26435 6243 --
NM_001012393chr11115078 4998 4833 4787 4739 4018 3506 3314 1375 800 495 --23275 1690 14900
NM_001012755chrX83879 3858 3852 3783 2030 1760 711 277 13307 --13420
NM_001013620chr1286529 5944 5738 5480 3026 2235 2151 455 12349 1844 --
NM_001018067chr145063 4433 3423 1945 34453 493 478 22080 832 --
NM_001018068chr145063 4433 3423 1945 34453 493 478 22080 832 --
NM_001018069chr145063 4433 3423 1945 34453 493 478 22080 832 --
NM_001018074chr522783 2602 43791 3214 1252 754 23558 2432 13326
NM_001018075chr522783 2602 43791 3214 1252 754 23558 2432 13326
NM_001018076chr522783 2602 43791 3214 1252 754 23558 2432 13326
NM_001018077chr522783 2602 43791 3214 1252 754 23558 2432 13326
NM_001024094chr522783 2602 43791 3214 1252 754 23558 2432 13326
NM_001024647chr1267722 6984 5791 5474 2457 939 --11243 1730
NM_001025356chr1262973 2931 2279 2090 2003 1090 147 22520 1838 --
NM_001025580chrX63421 2976 2731 2659 1421 187 24329 3566 13516 --
NM_001025616chr43385 203 197 21212 306 ----
NM_001039585chr1--42952 2929 416 393 --23066 1167
NM_001039618chr1165269 4978 4677 4143 2139 2032 21917 61 ----
NM_001039840chrX56097 4869 2218 740 28 56042 5803 4613 3941 3711 14215 14846
NM_001039937chr1353866 1638 1520 653 336 23844 3271 1281 --
NM_001040152chr7105010 4940 4057 3840 3825 3740 3474 3323 1876 1761 13460 ----
NM_001040284chr1645857 4554 3876 552 33987 3646 1559 25615 5376 14014
NM_001040665chr744783 4630 1860 684 3322 115 90 33813 3697 1396 13307
NM_001042492chr1753337 3204 3194 2123 412 42602 2549 2178 1044 13013 --
NM_001042604chr374757 3981 3723 3366 824 493 216 14861 14012 --
NM_001042669chr43385 203 197 21212 306 ----
NM_001083620chr442059 149 79 46 22541 225 22451 799 12463
NM_001100108chr188178 8160 7575 7345 6576 2718 2616 2607 27124 1697 --18277
NM_001106chr398992 8727 8648 8384 7544 7384 7013 3554 3308 18413 29618 2885 18626
NM_001167chrX55117 1430 1276 1252 645 2758 635 --12347
NM_001204chr267403 6046 5554 1317 1029 99 36827 6703 1537 15184 --
NM_001609chr1074244 4228 3786 3620 3568 2901 33 14310 --13929
NM_001690chr31131 22595 2575 --12360
NM_002025chrX128107 7865 7280 6745 5756 3105 2936 2617 2042 1839 1712 663 68965 8517 6570 2666 512 460 ----
NM_002069chr731662 1390 1328 11160 11877 1224
NM_002139chrX2125 103 1223 1231 1641
NM_002158chr243312 831 636 315 23425 324 13045 --
NM_002223chr1274026 2992 2648 2549 1547 1159 673 23449 712 ----
NM_002310chr566530 5593 4694 2578 2081 130 16003 14794 --
NM_002545chr11115078 4998 4833 4787 4739 4018 3506 3314 1375 800 495 --23275 1690 14900
NM_002581chr983896 3779 2128 1848 1189 1115 741 508 35625 4630 22 --11145
NM_002655chr855267 4270 2115 1596 689 23512 3230 24091 3423 --
NM_002745chr22114475 4351 4092 4053 3171 3121 1673 1058 766 714 218 23664 1188 ----
NM_002886chr354810 4520 4223 3463 704 34940 3831 3211 --13160
NM_002998chr83806 756 381 --1338 21606 570
NM_003099chr1586479 5701 5234 4821 4000 2402 2380 2349 12259 15160 26165 5832
NM_003112chr752918 2839 2558 2549 2388 12989 1298 --
NM_003161chr1762568 2484 2473 2467 1304 673 ------
NM_003199chr1855248 5061 4167 1688 1166 35045 4315 4069 15201 --
NM_003262chr375245 4375 3725 2117 1508 1494 1327 23914 1378 13413 --
NM_003574chr1895237 4582 3557 1538 1159 753 638 598 232 11519 ----
NM_003583chr1233011 1144 878 23896 2500 12808 23314 328
NM_003590chr233869 3172 2587 53999 3711 3105 1208 862 13012 12931
NM_003663chr353404 2973 2512 2397 177 ----1792
NM_003671chr963257 2207 1279 1235 533 524 ----22405 417
NM_004293chr943285 3241 1194 605 53735 3694 1055 1041 642 ----
NM_004338chr1876596 5783 5403 5052 4831 2319 2098 46453 6193 4817 2697 15492 15540
NM_004412chr1075738 5423 2177 1321 543 367 339 15294 11970 --
NM_004440chr621825 1306 31212 366 342 --1493
NM_004500chr1441684 550 438 210 1521 --11805
NM_004582chr13361 349 93 ----1114
NM_004726chrX45232 4920 4727 714 25771 635 15552 1103
NM_004744chr443925 3779 2894 1343 33963 3786 3294 23565 958 12878
NM_004745chr846857 2711 2586 1162 22280 2043 1581 15591
NM_004775chr1862193 2071 1877 1782 520 90 1808 1837 --
NM_004796chr141898 190 12031 21546 963
NM_004815chr184602 3626 3603 3083 1669 1227 946 40 33827 1762 1268 ----
NM_004866chr533382 3256 3183 13150 --14472
NM_004904chr746571 4138 459 383 25552 343 26435 6243 --
NM_004985chr1243632 1814 1678 715 33777 2923 1593 23870 3134 1860
NM_005065chr1475292 3972 3295 1418 1202 663 359 44740 4646 3635 1340 ----
NM_005156chr964659 4440 3813 1451 797 721 33299 1663 733 ----
NM_005160chr2255957 5055 4822 4622 4129 15463 --1997
NM_005359chr1865788 4338 2626 2535 2451 199 2976 753 15839 --
NM_005497chr1796154 5889 5032 3807 3748 2284 1883 1017 988 --15046 --
NM_005504chr1285597 5516 5377 5347 1379 1105 647 132 36361 4784 2408 21386 527 --
NM_005614chr72153 102 ----3868 796 376
NM_005665chr134363 3868 1653 11787 --13486
NM_005722chr262413 2151 1626 903 631 169 21805 159 ----
NM_005901chr1878077 7690 6169 5448 2934 2565 2482 18393 18657 18103
NM_005903chr564705 3899 3428 2045 1364 1099 54628 3833 3453 3186 1804 11149 13199
NM_005927chr541217 1019 902 115 ----1858
NM_005941chr894145 4111 4094 4060 3469 2877 2821 905 593 --13459 --
NM_006154chr1552020 1818 659 585 407 42446 2315 1975 1930 12063 --
NM_006283chr844905 4401 3832 909 ----1334
NM_006330chr821465 550 11213 11356 1105
NM_006420chr2092267 1388 1190 1068 951 564 489 465 398 1267 12111 23006 791
NM_006482chr1233011 1144 878 23896 2500 12808 23314 328
NM_006534chr2073179 2836 1307 849 809 313 290 ------
NM_006544chr1485144 5117 4804 4218 3881 2233 1482 467 1307 44102 1987 1739 30 --
NM_006599chr16105627 5390 3174 2847 2309 2250 1564 1458 1292 190 28205 3145 --15532
NM_006948chr2142246 574 568 454 11577 1789 --
NM_006954chr1043358 3277 3032 224 23223 2614 --12809
NM_006974chr1043358 3277 3032 224 23223 2614 --12809
NM_007007chr1231795 1500 1424 21442 351 11302 11480
NM_007172chr2242911 2303 693 164 23264 2082 21135 171 --
NM_012081chr573765 3660 3427 2710 958 859 225 ----13616
NM_012141chr1353866 1638 1520 653 336 23844 3271 1281 --
NM_012249chr242199 1439 1316 970 33490 3301 3284 --1941
NM_012252chr745215 4349 4275 4128 1886 1176 1349
NM_012262chr155104 4070 1092 1039 172 --24570 435 1593
NM_012297chr462206 2070 362 345 194 63 --12530 --
NM_013255chr7107005 6446 6267 5942 5722 1783 1331 584 547 481 48252 7729 7678 1806 28771 5883 --
NM_014181chr232417 2182 501 12707 --12734
NM_014313chr121543 304 2405 241 --1398
NM_014372chr152067 1862 1524 1280 796 32102 1906 1706 2722 287 --
NM_014423chr575585 5377 4514 3766 2077 165 48 23701 3566 1707 15479
NM_014840chr1282824 2723 2325 2152 716 684 202 195 13288 --1904
NM_014877chr1756541 6356 6337 2150 739 45263 1902 1879 1085 36973 4741 1805 1200
NM_014906chr1793185 3179 2625 1629 1362 1281 849 766 574 13589 13229 --
NM_015026chr1243424 2971 1092 475 34504 1859 571 33484 2960 319 11770
NM_015068chr793862 3792 2909 2692 2677 2592 1579 728 613 ------
NM_015092chr1674417 4384 4339 4190 3343 766 292 ----11794
NM_015144chr1663911 3812 3021 3008 1083 435 33956 2655 1375 --1204
NM_015185chrX1362 12954 --22978 2965
NM_015365chrX63421 2976 2731 2659 1421 187 24329 3566 13516 --
NM_015375chr124589 3768 14475 --34760 4069 368
NM_015436chr473263 3015 2642 407 121 80 70 33085 2705 432 1242 --
NM_015458chr845184 1794 1054 575 35220 3293 1724 --15303
NM_015460chr352119 1739 1565 1558 367 --11977 11749
NM_015640chr145063 4433 3423 1945 34453 493 478 22080 832 --
NM_015879chr1888563 8169 6553 5783 3236 3002 2361 1815 38289 2801 1460 28141 3049 --
NM_015886chr865666 4822 4204 4085 3990 1811 34132 1759 1351 ----
NM_015906chr174420 3560 931 892 503 369 187 23713 3423 13236 --
NM_016009chr144602 1432 1058 91 --34831 1505 99 --
NM_016132chr1542618 2396 318 169 32385 905 147 12219 --
NM_016206chr388736 7992 7088 6520 5971 3414 325 124 12368 28870 6307 39016 6994 2204
NM_016248chr1332903 960 149 32612 797 190 22794 235 13704
NM_016255chr643141 2708 741 699 1190 --12341
NM_016260chr277148 6174 6147 4773 2288 2071 155 36825 6355 1460 1970 16034
NM_016289chr252264 2184 684 219 109 124 --12008
NM_016376chr1732765 1379 179 --1662 21274 192
NM_016531chr493758 3379 2914 2806 2681 1132 773 543 321 23683 352 --11389
NM_017440chr122260 151 --1473 168
NM_017447chr2174221 3820 3340 2909 2793 762 274 2305 146 14248 11519
NM_017637chr912095 76759 3461 3057 2848 2375 1896 1589 26478 980 12484
NM_017643chr171278 23146 367 --1708
NM_017644chr354642 3478 1605 1157 479 44791 3424 1621 205 ----
NM_017658chr1484572 4239 4230 3911 3247 1655 1108 1077 12961 ----
NM_017752chrX62038 1788 450 427 414 55 11713 --12086
NM_017919chr995720 5456 4923 4682 4671 2016 695 225 184 15708 14080 24571 1743
NM_017952chr253953 1269 1092 598 306 24068 485 --13853
NM_018036chr1474428 3924 3900 2924 1567 1170 270 --11665 1220
NM_018299chr853487 3454 1043 889 624 1242 1231 --
NM_018375chr1431848 747 222 21937 1494 11221 11333
NM_018452chr6_random53536 3365 1241 1019 418 31288 1225 759 12702 --
NM_018489chr122285 1511 1714 --11864
NM_018557chr21402 21417 266 --11709
NM_018638chr1275606 5427 5341 4004 1666 247 173 ----1222
NM_018841chr173255 3108 2858 2651 2499 1146 324 23305 352 ----
NM_019001chr374757 3981 3723 3366 824 493 216 14861 14012 --
NM_019050chr42210 26 21494 508 --11450
NM_019117chrX32240 1080 839 1609 2931 791 13511
NM_019593chr2041956 1224 971 839 42554 1168 646 271 21142 768 --
NM_020403chr1361419 1356 1153 690 483 128 ----1521
NM_020718chr16116447 6332 6052 5864 4296 2404 1395 1130 1102 951 651 25444 4075 25773 1249 --
NM_020772chr17118516 8216 7216 6813 6035 5905 3412 2992 2740 2700 783 48351 7846 6928 1457 15497 --
NM_020796chr532641 1957 591 11017 12707 22657 28
NM_020841chr1253011 2886 2822 2620 353 53899 3116 2992 2518 504 1211 --
NM_021033chr1383436 3177 3078 3069 2578 2330 684 147 13444 199 12305
NM_021083chrX63166 2797 2478 1372 820 110 23482 476 12552 21442 744
NM_021229chr1221235 443 1423 --1472
NM_021629chr344962 4928 3346 940 14856 11465 14628
NM_021912chr1553738 3186 1570 996 65 --12771 12808
NM_021960chr1--12755 1392 21948 1835
NM_021964chr356282 6271 4935 1000 452 --1731 15463
NM_022133chr851807 1434 1225 674 539 11495 --1341
NM_022456chr1267722 6984 5791 5474 2457 939 --11243 1730
NM_022459chr1361577 1535 979 519 194 188 14297 12517 15287
NM_022781chr932908 1109 569 ----12029
NM_024345chr955445 4406 2392 2086 577 45606 4478 4397 618 2937 370 --
NM_024524chr32865 854 33144 2405 757 22932 449 182
NM_024700chr11156 1188 1394 11094
NM_024824chr1421320 1066 2253 82 --21139 1082
NM_024947chr379085 8873 7968 7850 7707 3530 277 28566 3772 15976 16112
NM_024989chr247743 6351 2905 1014 37139 867 735 16057 --
NM_025040chr192565 238 11765 --31652 1564 485
NM_025238chr1531006 626 89 ----153
NM_030621chr1473552 3251 3110 3031 1176 354 339 ------
NM_030627chr573859 3488 2702 1052 972 359 175 13341 ----
NM_030674chr1225869 4092 --24265 2240 24243 782
NM_031305chr43385 203 197 21212 306 ----
NM_031314chr1441684 550 438 210 1521 --11805
NM_031427chr1435996 4962 621 1861 25543 25 14681
NM_031438chr551432 574 566 484 96 31750 1487 205 1601 --
NM_031483chr2062649 2419 1438 1035 696 593 22890 424 --1301
NM_032047chr352338 2283 2218 779 592 42358 2291 1659 422 --11673
NM_032208chr293371 3283 3179 2782 2710 2634 2496 1161 842 33209 856 828 ----
NM_032228chr1193504 3052 3007 2929 2836 2210 2148 192 90 13533 --12923
NM_032373chr1055651 1486 1444 1224 147 35907 5550 5109 13684 --
NM_032446chr5103631 3371 3295 3090 2766 2524 1179 1054 547 470 ------
NM_032549chr71416 2532 171 --1203
NM_032682chr321388 714 13124 33434 1431 146 13645
NM_033020chr174420 3560 931 892 503 369 187 23713 3423 13236 --
NM_033083chr333129 271 185 1456 22970 566 12839
NM_033331chr963257 2207 1279 1235 533 524 ----22405 417
NM_033360chr1233753 1799 836 33898 3044 1714 23991 3255 1981
NM_033505chr242164 1776 1672 1084 11397 --16508
NM_033656chr2195800 5473 4789 4711 4394 3960 3759 987 336 74162 4063 3898 1893 362 278 68 11784 --
NM_052879chr1213966 24044 3993 11443 21138 1104
NM_052885chr1244353 3624 1768 946 14556 14946 1427
NM_057749chr82912 304 1198 --1957
NM_133334chr486340 6272 6194 5362 5204 4490 4224 1281 35450 4316 2191 ----
NM_138694chr652929 2758 2298 1221 247 33017 996 503 13487 --
NM_138713chr16105627 5390 3174 2847 2309 2250 1564 1458 1292 190 28205 3145 --15532
NM_138714chr16105627 5390 3174 2847 2309 2250 1564 1458 1292 190 28205 3145 --15532
NM_138970chr141898 190 12031 21546 963
NM_144571chr475722 5069 4648 2580 2221 1324 1161 56890 5507 2767 1926 917 ----
NM_144578chr1484318 3784 1901 1805 1741 1687 1579 531 45009 4160 1839 545 ----
NM_145259chr247149 5595 5094 945 46480 5266 2769 2650 26273 1153 --
NM_145307chr1013294 44673 3420 3266 2962 11187 1361
NM_145753chr341383 1348 1321 658 11124 --11653
NM_148955chr1586479 5701 5234 4821 4000 2402 2380 2349 12259 15160 26165 5832
NM_152263chr175247 5070 2014 655 529 216 179 32441 2113 1696 14498 --
NM_152409chr512927 43465 2969 2361 531 --12537
NM_152417chr82864 119 ----21247 183
NM_152622chr542219 1068 833 120 33272 2284 1332 22631 996 --
NM_152624chr597425 7235 6644 6558 5996 2738 1529 1069 317 56960 6028 2921 2193 1775 27107 4599 --
NM_152688chr63960 700 346 3889 678 609 ----
NM_152826chr1586479 5701 5234 4821 4000 2402 2380 2349 12259 15160 26165 5832
NM_152836chr851807 1434 1225 674 539 11495 --1341
NM_152837chr851807 1434 1225 674 539 11495 --1341
NM_152999chr744783 4630 1860 684 3322 115 90 33813 3697 1396 13307
NM_153235chr63301 280 174 197 --12276
NM_153365chr462615 2396 945 911 888 312 --1789 12634
NM_153645chr2242911 2303 693 164 23264 2082 21135 171 --
NM_172071chr147476 5815 1512 481 37296 5167 2419 15294 14797
NM_173214chr16105627 5390 3174 2847 2309 2250 1564 1458 1292 190 28205 3145 --15532
NM_173552chr372429 825 678 398 283 141 97 --1871 --
NM_173582chr11126309 6191 5903 4327 4235 2050 1982 1304 1053 924 476 80 ------
NM_173602chr1253641 2440 879 433 195 11449 23801 3078 23660 953
NM_173642chr179166 9027 7844 7110 5934 5758 3424 57100 6843 6384 5882 1524 17526 --
NM_173829chr545622 2040 1250 290 ----11085
NM_173851chr833998 1107 1018 43886 3499 3001 1519 --13540
NM_175623chr1267722 6984 5791 5474 2457 939 --11243 1730
NM_175624chr1267817 7079 5886 5569 2552 1034 --11338 1825
NM_175625chr1267817 7079 5886 5569 2552 1034 --11338 1825
NM_175861chr1255784 4461 1672 1656 1213 24790 4741 11915 --
NM_176081chr1075738 5423 2177 1321 543 367 339 15294 11970 --
NM_176083chr1075738 5423 2177 1321 543 367 339 15294 11970 --
NM_177438chr1473552 3251 3110 3031 1176 354 339 ------
NM_181481chr1876596 5783 5403 5052 4831 2319 2098 46453 6193 4817 2697 15492 15540
NM_181482chr1876596 5783 5403 5052 4831 2319 2098 46453 6193 4817 2697 15492 15540
NM_181483chr1876596 5783 5403 5052 4831 2319 2098 46453 6193 4817 2697 15492 15540
NM_181659chr2073179 2836 1307 849 809 313 290 ------
NM_181659chr2073179 2836 1307 849 809 313 290 ------
NM_181787chr843321 1177 610 132 73534 3444 2652 1420 1259 935 758 ----
NM_182551chr223561 2882 52663 2639 798 125 95 12428 13102
NM_182756chr21634 2534 48 --171
NM_182762chr766092 5838 5590 5236 2480 358 25859 4313 35954 4561 717 --
NM_182898chr746571 4138 459 383 25552 343 26435 6243 --
NM_182899chr746571 4138 459 383 25552 343 26435 6243 --
NM_194247chr284162 3527 3247 1769 1130 795 492 55 14062 1247 --
NM_194314chr165637 4529 4090 4008 1708 744 13843 --13670
NM_194328chr932908 1109 569 ----12029
NM_194329chr932908 1109 569 ----12029
NM_194330chr932908 1109 569 ----12029
NM_194332chr932908 1109 569 ----12029
NM_194434chr1895237 4582 3557 1538 1159 753 638 598 232 11519 ----
NM_198400chr1552020 1818 659 585 407 42446 2315 1975 1930 12063 --
NM_198581chr277352 6333 1808 1726 760 736 421 --11892 --
NM_198584chr832664 1009 137 --12523 12564
NM_199072chr722493 113 23067 270 --125
NM_199188chr1213966 24044 3993 11443 21138 1104
NM_199190chr1213966 24044 3993 11443 21138 1104
NM_199324chr453433 3267 2607 1261 1020 3913 573 267 --13576
NM_199462chr124589 3768 14475 --34760 4069 368
NM_203406chr562826 2741 1830 1141 881 764 42698 2577 859 742 ----
NM_203487chr1361419 1356 1153 690 483 128 ----1521
NM_203504chr462206 2070 362 345 194 63 --12530 --
NM_203505chr462206 2070 362 345 194 63 --12530 --
NM_207325chr1971907 761 686 617 547 523 233 ------
NM_207361chr1376247 5316 5150 4900 4233 2126 688 24363 2533 --15143
NM_207406chr486569 6378 6289 5489 4630 4280 1424 952 24435 1589 1394 --
NM_207660chr1421320 1066 2253 82 --21139 1082
NM_207661chr1421320 1066 2253 82 --21139 1082
NM_207662chr1421320 1066 2253 82 --21139 1082