TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-515-3p
miRNA Sequence: GAGUGCCUUCUUUUGGAGCGUU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000068chr192563 235 --11423 --
NM_000109chrX----12503 --
NM_000125chr663759 3401 1313 1102 883 606 ------
NM_000176chr522550 701 13625 12919 --
NM_000217chr1244023 3365 1744 1250 --24172 2129 --
NM_000222chr421830 109 1755 21820 1336 --
NM_000259chr1584723 4186 4013 3892 1228 1192 392 233 14467 --26137 678
NM_000267chr1732959 2949 1287 --1581 --
NM_000314chr1032631 2172 276 12384 ----
NM_000321chr13----11273 11208
NM_000332chr652448 1424 317 245 218 16756 21389 404 --
NM_000337chr534900 4684 1669 --21066 492 --
NM_000389chr63935 472 229 21269 170 11291 --
NM_000408chr243004 1294 1084 1012 ------
NM_000430chr1723482 242 1295 13235 --
NM_000462chr1511641 ------
NM_000484chr2111034 ------
NM_000492chr7--11244 1226 --
NM_000522chr72907 129 ------
NM_000525chr1131290 1154 649 --2270 139 11388
NM_000555chrX55342 5198 1772 1564 62 --37541 7109 5675 15438
NM_000612chr1163510 3426 2615 2377 606 495 ------
NM_000635chr191475 ----11363
NM_000702chr142252 2014 95 25 --22094 1703 12221
NM_000719chr1296393 5597 5316 4729 4413 2438 2029 240 177 11453 11507 --
NM_000720chr32362 339 ----192
NM_000725chr124924 388 37 31 197 --1228
NM_000800chr5----21568 528 --
NM_000809chr455945 3712 2849 2679 2603 1385 ----
NM_000813chr553594 2242 1521 638 402 14529 ----
NM_000828chrX2515 23 1792 11830 --
NM_000875chr1596237 5346 4794 2731 1553 1530 747 648 626 --11815 --
NM_000891chr1743184 1137 963 85 23030 610 ----
NM_000899chr1243822 2839 1131 198 ----12975
NM_000901chr411679 21644 434 ----
NM_000945chr2----11334 --
NM_001001481chr822691 671 12639 23446 2482 --
NM_001001484chr1021929 448 ------
NM_001001521chr2----184 --
NM_001001701chr4----1862 1826
NM_001001890chr21--11611 14122 --
NM_001001995chrX----11183 --
NM_001002860chr1464700 4545 2868 1456 858 260 --23682 236 --
NM_001003688chr42812 351 ------
NM_001003694chr3--2525 420 ----
NM_001003800chr943260 2298 460 130 --22465 1264 --
NM_001004065chr942432 1450 1361 902 --13956 --
NM_001004317chr654547 3087 2880 1495 1212 1543 ----
NM_001004342chr175409 4902 3971 1669 1230 871 219 15678 ----
NM_001005242chr12------11639
NM_001005386chr22471 452 --1263 --
NM_001005781chr2----1117 --
NM_001005910chr3--1607 1168 --
NM_001007097chr921628 813 ----11598
NM_001007102chr61334 --1193 --
NM_001007156chr1511199 --178 --
NM_001007189chr5----156 --
NM_001007257chr12241 171 --1497 --
NM_001007466chr674779 4737 3523 632 350 327 244 ----15080
NM_001008391chr11------1475
NM_001008408chr765359 5096 4310 2478 1408 706 11364 24476 2093 14991
NM_001008493chr131466 553 543 ------
NM_001008540chr21397 ------
NM_001008707chr1421336 1253 --21739 407 --
NM_001008710chr821191 493 --11685 --
NM_001008895chr13----1218 --
NM_001009899chr372612 2252 1629 1604 1501 1470 1059 --25897 4423 --
NM_001010888chrX53573 2857 2829 1184 149 34166 1445 472 13920 --
NM_001011553chr71699 ------
NM_001011666chr745576 4838 1250 69 ------
NM_001011885chr151158 ------
NM_001012393chr1124596 1620 --21871 715 --
NM_001012979chrX----169 --
NM_001013399chr6----1720 --
NM_001013699chr12123 ------
NM_001014797chr1056987 6887 6307 3126 888 18059 77569 7331 6736 5145 2631 1846 931 --
NM_001015508chr8----140 --
NM_001017371chr2----1208 --
NM_001017395chr333228 2948 2350 ------
NM_001017415chr1----1267 --
NM_001017424chr151652 1310 1198 763 26 --1708 --
NM_001018003chr82645 55 --1197 --
NM_001018050chr2272883 2807 2344 2206 887 845 704 --1665 --
NM_001018054chr11398 --11158 --
NM_001024808chr1282713 2598 816 717 678 646 628 42 --1924 --
NM_001024855chr31710 ----1253
NM_001024948chr12953 180 --11208 --
NM_001024956chr1121922 139 --11075 1828
NM_001025068chr351482 1472 1153 494 62 ------
NM_001025076chr1045328 2150 1963 388 --11103 --
NM_001025079chr332745 1298 675 1478 13911 --
NM_001029858chr621334 1131 --1921 --
NM_001029989chr151602 --182 --
NM_001030007chr1641495 1151 1096 487 --22602 471 1566
NM_001030055chr1411064 --34667 3672 2899 --
NM_001031679chr1252614 1382 1281 826 261 ------
NM_001031695chr2225017 4391 25038 1630 11182 11576
NM_001031711chr52524 441 --1486 11275
NM_001031804chr1611074 --23998 1222 --
NM_001031812chr531624 1459 528 --22122 594 --
NM_001032380chr1021577 119 ------
NM_001033578chr821752 170 12222 ----
NM_001034841chr1665323 4972 4514 4294 3786 941 --31886 441 106 --
NM_001034915chr811418 --21078 271 --
NM_001034915chr811418 --21078 271 --
NM_001035254chr951929 1747 1585 310 209 ------
NM_001035260chr1021400 62 --1655 --
NM_001037132chr731792 747 715 ----1658
NM_001037164chr7--1226 11760 11623
NM_001037172chr311352 --21080 228 --
NM_001038702chr532421 2048 1686 11765 22403 676 --
NM_001039348chr21158 --128 --
NM_001039479chr14102155 1993 1943 1789 828 776 638 559 546 435 12025 12258 --
NM_001039538chr232997 2388 40 12410 13609 --
NM_001039840chrX35755 4415 487 ----11398
NM_001040272chr92631 328 --12336 --
NM_001040429chr13129 --123 --
NM_001042404chr121776 776 ------
NM_001042555chr1244330 3814 1368 1205 13364 44665 3407 818 169 --
NM_001042599chr257554 6646 5501 5074 4920 --16619 --
NM_001042601chr3----12439 174
NM_001042604chr323146 975 --1147 --
NM_001042749chrX----1326 --
NM_001044305chr621363 1066 --1400 --
NM_001078chr1------1562
NM_001100108chr178090 7203 6910 6057 2626 2071 1951 --33339 2713 1147 1385
NM_001119chr431238 1098 442 --1284 1258
NM_001148chr431757 304 134 ------
NM_001149chr1011282 --1548 --
NM_001174chrX1331 --173 --
NM_001189chr451062 703 211 104 56 ------
NM_001204chr275540 4962 4775 2938 805 567 431 ------
NM_001222chr1021512 525 --11880 --
NM_001241chr221803 712 --1821 --
NM_001284chr5----1127 --
NM_001290chr421016 240 ------
NM_001310chr12----1798 --
NM_001315chr6----11659 --
NM_001332chr5----1311 --
NM_001356chrX11896 ------
NM_001358chr4----1422 --
NM_001364chr11--11263 11839 1689
NM_001396chr2132807 607 510 --1359 --
NM_001400chr11926 ------
NM_001412chrX1675 --13086 --
NM_001423chr12----11420 --
NM_001447chr531107 519 233 --1889 --
NM_001451chr16----1927 --
NM_001498chr611175 --11016 --
NM_001655chr112835 629 --21703 796 1820
NM_001664chr31976 --1378 1251
NM_001701chr911612 ------
NM_001743chr2----1440 --
NM_001755chr16--32083 1472 304 --1152
NM_001759chr1244570 3892 1329 881 --11435 --
NM_001769chr12------1292
NM_001792chr181299 11031 ----
NM_001794chr201214 --1234 --
NM_001830chrX63331 1504 1204 1019 811 638 --1186 --
NM_001843chr12----1164 --
NM_001845chr131227 ------
NM_001858chr633593 1116 875 15072 21633 1298 1132
NM_001918chr167178 7043 3662 2509 2497 131 --22936 1023 17227
NM_001944chr181104 ------
NM_001981chr112357 12134 1952 --
NM_001993chr11873 2923 207 1993 --
NM_001999chr51942 1288 ----
NM_002025chrX58794 7920 7112 5919 714 16376 --19269
NM_002040chr2111133 --1719 1966
NM_002137chr7----1766 --
NM_002156chr2----1303 --
NM_002158chr2--11195 --12975
NM_002192chr7----2553 446 --
NM_002210chr21585 1124 23143 431 --
NM_002214chr744106 1439 1304 313 --15675 --
NM_002356chr612801 --172 --
NM_002384chr181923 --2742 49 --
NM_002390chr1771775 1760 1725 1604 1456 200 87 ------
NM_002397chr531469 539 520 --1125 --
NM_002480chr1211230 ------
NM_002522chr1752645 1535 1176 1142 232 ------
NM_002546chr8--1132 2590 74 --
NM_002572chr11--162 189 --
NM_002576chr11------11202
NM_002628chr3--11043 1477 --
NM_002655chr844231 3790 791 681 ----12099
NM_002670chr311600 ------
NM_002693chr15----1287 --
NM_002711chr71245 ----1860
NM_002715chr5--1803 ----
NM_002734chr17----11413 --
NM_002745chr2222960 448 14295 21823 1780 --
NM_002748chr1511026 1768 ----
NM_002813chr12----2281 178 --
NM_002840chr111323 --1215 --
NM_002841chr3121 --1448 --
NM_002843chr1143279 2164 1017 58 ------
NM_002855chr1112891 12481 ----
NM_002868chr1251619 1611 654 283 149 ------
NM_002893chrX----177 --
NM_002973chr12----1189 --
NM_002998chr841697 1685 827 115 ------
NM_003030chr331283 199 41 --11315 11461
NM_003048chr21455 22845 409 ----
NM_003068chr8----179 --
NM_003070chr9----189 --
NM_003074chr31715 --1844 1512
NM_003081chr201280 ------
NM_003108chr262914 2635 2515 2405 2067 1400 --21031 445 --
NM_003137chr642219 2091 1675 821 ------
NM_003150chr1751736 1487 447 161 42 ------
NM_003164chr11191 --122 --
NM_003173chrX11358 --1914 --
NM_003189chr143293 3064 453 369 --1223 --
NM_003234chr31868 1128 ----
NM_003246chr151371 1530 1615 --
NM_003250chr17----1461 --
NM_003257chr15----1122 --
NM_003262chr344686 4550 3364 85 1173 21754 1048 --
NM_003269chr6------11201
NM_003286chr20----11064 --
NM_003295chr13----1152 --
NM_003339chr511071 --11229 1251
NM_003342chr1732817 2454 62 ------
NM_003350chr81421 --1220 --
NM_003358chr91144 ------
NM_003360chr41224 ------
NM_003367chr19----1338 --
NM_003400chr2----1232 --
NM_003458chr383988 3599 3232 1330 1254 433 303 289 ------
NM_003474chr1022366 1937 --3866 245 186 --
NM_003488chr17157 ------
NM_003489chr2133265 353 289 12582 ----
NM_003583chr1243350 3183 2965 1423 --23270 2983 --
NM_003633chr5----12189 --
NM_003670chr321367 121 --2568 420 --
NM_003672chr1----11380 --
NM_003749chr1362043 1855 1817 604 209 159 --1859 --
NM_003760chr1----1172 --
NM_003796chr19----1441 --
NM_003872chr222102 2095 ------
NM_003895chr212884 28 166 1438 --
NM_003913chr643331 1617 1042 665 --11293 --
NM_003966chr556261 5708 761 689 615 15500 1384 --
NM_003972chr1011218 1981 ----
NM_004064chr12----1171 --
NM_004077chr12--11028 21012 113 --
NM_004133chr812103 127 ----
NM_004200chr1142520 2314 2162 878 --1220 --
NM_004331chr81537 --1174 --
NM_004370chr62855 711 --12195 --
NM_004375chr171280 ------
NM_004393chr352125 1875 1811 1606 926 ------
NM_004397chr1123382 902 ------
NM_004426chr1231973 1237 624 --11644 1784
NM_004432chr921974 217 --12223 --
NM_004437chr121442 531 --23514 837 --
NM_004438chr233221 3068 2405 ------
NM_004440chr6----1780 --
NM_004501chr134112 3983 3216 --11303 --
NM_004529chr9----1920 --
NM_004578chr1131 1343 ----
NM_004586chrX35249 5165 4595 --14448 13765
NM_004600chr1----1506 --
NM_004612chr933997 3885 974 1872 ----
NM_004637chr31330 --11110 --
NM_004660chrY32306 1931 1827 --1637 --
NM_004663chr1531416 1078 597 --21428 1141 --
NM_004687chr1721285 347 --1510 --
NM_004705chr111246 ------
NM_004717chr731498 1489 338 ------
NM_004730chr521436 470 --1574 --
NM_004736chr11356 22271 1490 32243 479 329 --
NM_004745chr825048 2070 --11962 1430
NM_004747chr1031413 648 614 --21555 1178 --
NM_004798chr2062966 2473 2221 970 548 179 ------
NM_004845chrX43839 1425 1132 1042 --13898 --
NM_004850chr211514 --11273 --
NM_004898chr432072 1981 738 --11073 1329
NM_004905chr1--1149 ----
NM_004921chr12363 146 --1968 --
NM_004956chr731411 670 436 ----11007
NM_004961chrX31075 1025 956 1596 ----
NM_004985chr1233247 485 29 --13502 13434
NM_004993chr141292 --1202 --
NM_004995chr1451441 1138 1051 428 185 ------
NM_004998chr15144 --1870 --
NM_004999chr623542 45 --13577 31776 629 442
NM_005009chr16------1287
NM_005032chrX1216 --11101 --
NM_005095chr1----11518 --
NM_005120chrX----1155 --
NM_005121chr1733197 1066 786 --11136 --
NM_005126chr3--11738 --1618
NM_005160chr2266736 6072 5800 4902 4415 76 --25575 673 --
NM_005168chr231352 1170 450 ------
NM_005180chr10--2674 616 11131 --
NM_005233chr3------22276 2031
NM_005238chr1122420 2201 11097 ----
NM_005244chr20------1686
NM_005254chr15176 --1907 --
NM_005277chr4--11529 --11848
NM_005284chr61175 ------
NM_005308chr10----1452 --
NM_005324chr17------1292
NM_005342chrX32156 1049 323 --32105 304 254 --
NM_005375chr6----1371 --
NM_005389chr61218 --1589 --
NM_005402chr711757 --11465 --
NM_005414chr3----1111 --
NM_005433chr1811111 12096 ----
NM_005435chr71566 ------
NM_005458chr95727 602 567 140 105 --42340 1823 988 273 21894 344
NM_005499chr19--1486 ----
NM_005504chr1234913 2562 1437 --21774 719 --
NM_005587chr152271 255 --1189 --
NM_005596chr966269 6109 6043 5802 5578 1979 11014 --11025
NM_005618chr61200 --1526 --
NM_005639chr121125 ----1482
NM_005647chrX23312 901 --11371 --
NM_005678chr152832 709 --1635 2870 753
NM_005715chr652322 2072 1933 715 244 --32464 2346 1053 --
NM_005746chr712355 --1672 --
NM_005749chr17--1281 ----
NM_005776chr14------1797
NM_005786chr181267 --1467 --
NM_005789chr1722023 477 --11648 --
NM_005813chr21161 --22244 532 --
NM_005842chr132673 94 ------
NM_005859chr51626 ------
NM_005898chr1121039 685 1818 1901 --
NM_005906chr621520 125 21509 648 --11713
NM_005909chr51808 11074 2538 308 --
NM_005924chr7----1124 --
NM_005937chr1773567 3242 2618 1010 861 534 79 ------
NM_006003chr191231 ------
NM_006011chr1544166 2662 2611 1304 ------
NM_006060chr733475 3434 1411 --11455 --
NM_006106chr111618 --13398 --
NM_006186chr22841 217 ------
NM_006206chr432746 1923 1013 1534 1527 --
NM_006212chr144955 3956 3821 534 --15271 --
NM_006224chr172598 579 --11720 --
NM_006237chr1311553 --150 11808
NM_006268chr1121050 881 ------
NM_006298chr622821 2656 1883 --11269
NM_006306chrX64090 4010 3683 3677 2176 1138 --2478 127 25247 793
NM_006315chr434277 3238 638 ------
NM_006345chr411049 1913 ----
NM_006364chr141337 ------
NM_006369chr11325 --1182 --
NM_006371chr323947 353 --44558 3311 1345 1080 --
NM_006374chr2----1490 --
NM_006380chr1723937 913 ------
NM_006391chr111213 ------
NM_006393chr1044332 1522 623 140 --24023 3093 --
NM_006449chr231932 849 37 1309 1242 --
NM_006469chr131424 266 61 --11116 --
NM_006517chrX----11561 1900
NM_006519chr61107 ------
NM_006534chr2033171 250 87 --21262 919 --
NM_006540chr811219 --11335 --
NM_006546chr1756065 4765 1093 1077 612 --1246 --
NM_006599chr1667059 6577 5763 5180 478 285 --11805 --
NM_006609chr222719 2542 --21158 486 --
NM_006614chr31975 --13140 --
NM_006618chr12387 94 --1289 --
NM_006621chr131704 328 302 ------
NM_006624chr1032087 1646 828 ----1483
NM_006660chr15----187 --
NM_006698chr201167 --152 --
NM_006751chr2----181 --
NM_006765chr8126 ------
NM_006775chr61754 --1121 --
NM_006791chr15----1490 --
NM_006813chr61313 --1345 --
NM_006852chr1712641 ----1535
NM_006885chr1633807 3676 1270 ----1268
NM_006888chr1413514 ------
NM_006912chr121985 1625 12300 12357 --
NM_006981chr91470 --1223 --
NM_006990chr152462 2294 2027 1002 584 11917 ----
NM_007008chr2----1261 --
NM_007011chr15126217 4949 4943 4322 2505 2438 1950 1861 1692 1453 224 125 --34871 2579 614 --
NM_007034chr1----138 --
NM_007137chrX45250 4844 1858 1253 --24306 3564 --
NM_007146chr1722596 2051 --1911 --
NM_007236chr1521751 981 31968 1944 181 12344 --
NM_007249chr1389367 8598 8057 6780 1250 839 545 145 12322 1246 --
NM_007278chr172406 118 ------
NM_007345chr181437 ----1232
NM_012074chr14----11050 --
NM_012081chr522610 2269 13519 ----
NM_012158chr131741 11294 1750 --
NM_012199chr143991 3578 3233 719 ----1712
NM_012214chr255823 5535 4121 2459 347 15488 36266 4285 1265 --
NM_012215chr102763 591 1494 ----
NM_012238chr101517 ----1227
NM_012242chr101222 ------
NM_012247chr10------1326
NM_012282chrX1334 ------
NM_012286chrX----1478 --
NM_012329chr1721513 48 ------
NM_012333chr131432 364 292 11031 ----
NM_012430chr3--1480 ----
NM_012464chr412686 --12873 --
NM_012465chr1062366 1239 1227 1139 691 543 11251 1861 --
NM_013255chr743188 2451 1920 1197 16488 25562 1080 --
NM_013272chr152264 111 --1307 --
NM_013283chr5156 ------
NM_013313chr2253141 2813 2780 1043 707 ------
NM_013374chr322087 1265 12161 1443 --
NM_013437chr8----11430 --
NM_013446chr7----21043 1010 --
NM_014011chr21293 --2617 585 --
NM_014038chr7----1318 --
NM_014048chr1621669 454 --24679 4652 11688
NM_014112chr865196 4920 4355 4316 4168 972 --14237 --
NM_014117chr161760 ------
NM_014141chr744893 3964 3358 3263 --11851 2684 281
NM_014157chr1683572 3153 2898 2640 894 758 401 214 --13966 --
NM_014181chr222796 1960 12807 ----
NM_014238chr171685 197 ----
NM_014278chr4----1434 --
NM_014283chr1----1111 --
NM_014368chr942170 1660 1581 1525 --11737 1726
NM_014382chr3----1429 --
NM_014411chr731807 1470 197 ------
NM_014423chr535238 4909 637 --25315 5154 --
NM_014445chr322063 953 --1425 --
NM_014454chr61668 ----168
NM_014456chr1031571 1437 1171 --1117 --
NM_014470chr122730 58 ----1219
NM_014488chr11----2523 240 --
NM_014575chr3----1196 --
NM_014602chr3----165 --
NM_014621chr2----1100 --
NM_014630chr1553889 1205 772 688 380 --1716 11570
NM_014649chr19----1212 --
NM_014671chr7----21050 487 --
NM_014702chr633077 2984 2454 --1493 --
NM_014720chr1011364 ------
NM_014729chr811594 --11873 --
NM_014755chr263854 3398 1700 1247 783 437 ----1486
NM_014764chr12----1147 --
NM_014810chr12833 825 --13354 --
NM_014838chr2232504 2065 575 --2385 112 --
NM_014839chr1----1772 11703
NM_014840chr1262829 2408 933 287 228 119 --23220 710 --
NM_014877chr1757445 6607 6179 6045 642 --27140 630 15817
NM_014912chr1053011 2162 1031 217 62 ------
NM_014924chr1442921 2004 1109 867 --12596 --
NM_014934chr1333411 3207 3056 13951 1284 --
NM_014935chr193474 3416 3378 3175 2986 2855 2563 2433 1255 --23855 1286 --
NM_014947chr133135 2741 755 ------
NM_014952chr1541420 511 230 59 ------
NM_014991chr4----23273 75 --
NM_014999chr122375 195 --11644 --
NM_015000chr1212172 1825 1237 --
NM_015017chr121024 364 1143 ----
NM_015025chr211928 ------
NM_015033chr932865 647 629 --13198 --
NM_015042chr1553900 2943 668 285 219 ------
NM_015071chr566244 5876 4710 1909 410 291 14390 34433 2066 453 --
NM_015094chr2294361 3652 1585 1363 1013 753 727 517 504 --21419 899 --
NM_015155chr1033185 2824 559 --13378 --
NM_015185chrX1252 --21917 724 --
NM_015196chr41106 ------
NM_015199chr3--1142 21111 66 1415
NM_015203chr1----122 --
NM_015236chr431239 1070 283 ----11202
NM_015238chr5----191 --
NM_015275chr122754 511 --11428 --
NM_015285chr1832346 1650 197 ------
NM_015291chr1----23492 2574 --
NM_015293chr6----1573 --
NM_015310chr857757 5352 2747 2060 798 27933 7906 47020 6715 5749 3067 11563
NM_015313chr1144580 4500 3261 919 --21099 768 --
NM_015326chr111032 ------
NM_015336chr121960 ------
NM_015346chr141672 --1357 --
NM_015355chr17----1106 --
NM_015396chr31345 ------
NM_015397chr9----2484 138 --
NM_015423chr11----11587 --
NM_015435chr8----1148 --
NM_015475chr2----1691 --
NM_015483chr711127 11021 ----
NM_015530chr22716 108 ------
NM_015549chr14----1549 --
NM_015567chr131208 --1851 --
NM_015569chr124722 3458 ------
NM_015577chr5--21332 474 ----
NM_015601chr10------194
NM_015608chr10------1588
NM_015627chr12612 261 ------
NM_015635chr921645 1373 1465 1122 --
NM_015642chr3--177 ----
NM_015678chr1321368 1274 --11107 --
NM_015886chr821894 1235 --34572 4333 734 --
NM_015898chr1951858 772 556 407 342 --11881 --
NM_015906chr154343 4234 3830 3029 116 --23902 2983 --
NM_015938chr31887 --1275 --
NM_015939chr201603 ----140
NM_015948chr6----199 --
NM_015987chr121282 --1423 --
NM_016018chr8------1668
NM_016072chr1222442 1579 --1373 --
NM_016221chr51302 --32321 607 155 --
NM_016248chr1321562 291 --12431 --
NM_016262chr61467 ------
NM_016272chr2242585 1974 1753 145 --12136 --
NM_016287chr121811 415 --1155 --
NM_016289chr231719 316 190 --167 --
NM_016333chr16----1478 --
NM_016338chr5--1937 ----
NM_016374chr131205 1128 141 ------
NM_016424chr1741375 1303 452 195 --2719 706 --
NM_016436chr2061054 587 444 395 42 29 --12651 --
NM_016441chr222324 630 --1831 --
NM_016472chr14----11089 --
NM_016485chr6----1778 --
NM_016511chr12----1817 --
NM_016531chr411067 12880 ----
NM_016544chr253407 3049 1489 675 146 12489 22786 946 --
NM_016577chr364243 4124 3649 3088 2849 2756 --13761 --
NM_016617chr1311769 --181 --
NM_016628chr102800 663 --1649 --
NM_017420chr1442951 1022 911 421 ----1716
NM_017488chr221577 998 --11091 133
NM_017508chr11--11007 22153 697 --
NM_017580chr1042337 434 367 33 ------
NM_017582chr1135 --1254 --
NM_017628chr444239 4008 1535 544 --24280 1886 --
NM_017637chr957934 6919 3773 3578 953 --21443 1209 --
NM_017650chr755300 4112 3761 1756 616 14845 35954 5484 3733 --
NM_017709chr133410 3143 2615 --21259 86 --
NM_017744chr122141 1554 --12191 --
NM_017752chrX2822 329 --11811 11758
NM_017762chr1521001 962 ----11869
NM_017763chr1711175 ----21225 1079
NM_017772chr6----21587 528 --
NM_017778chr81128 11449 ----
NM_017780chr81734 1331 ----
NM_017824chr10----22392 934 1401
NM_017848chrX23312 1390 ----13423
NM_017902chr1085673 5537 4941 4863 4851 2043 1275 170 ------
NM_017943chr14----1138 --
NM_017994chr742958 2806 2653 2529 --12883 --
NM_018013chr652957 2820 2643 2101 1221 ------
NM_018060chr1----1395 --
NM_018063chr10----1350 --
NM_018150chr12626 296 --1893 1199
NM_018157chr121398 12252 1183 --
NM_018167chr142903 265 --1701 --
NM_018202chr1----147 --
NM_018374chr735038 4833 988 --13780 14707
NM_018424chr931855 1812 1690 --11359 --
NM_018440chr896280 5560 2727 2292 1285 826 685 225 176 --28680 6914 --
NM_018462chr31859 --1220 --
NM_018489chr131784 667 292 --2355 140 --
NM_018584chr121046 418 --1959 --
NM_018650chr12631 50 ------
NM_018682chr71714 --175 --
NM_018837chr20138 --1793 --
NM_018945chr622611 872 ------
NM_018947chr744539 3505 3472 3216 --24609 558 --
NM_018976chr1241849 1019 889 603 --11877 --
NM_018983chr41225 ------
NM_018999chr1034666 4340 3890 ----13787
NM_019022chr18----1453 --
NM_019049chr1------1209
NM_019098chr81386 ------
NM_019594chr921473 486 ------
NM_019606chr71455 --1464 --
NM_019842chr6124 --1356 --
NM_020123chr102402 113 ----1235
NM_020144chr711883 --31310 603 419 --
NM_020159chr41559 ----1628
NM_020205chr122314 244 --12874 --
NM_020336chr2033694 3478 2514 ------
NM_020346chr111606 --11261 --
NM_020390chr344652 3817 1197 636 --13592 --
NM_020440chr142387 431 204 132 --22295 1023 --
NM_020466chr643849 3589 1748 1239 1817 34486 3382 1536 --
NM_020526chr161728 1713 1160 455 232 173 ------
NM_020630chr101458 --1276 1140
NM_020640chr31912 12104 11485 --
NM_020699chr133382 1522 683 --11712 --
NM_020713chr2062755 920 840 425 389 191 --32178 2076 1951 --
NM_020734chr1243029 2359 2154 962 --13072 --
NM_020760chr221856 571 --11646 --
NM_020773chr412517 --22533 2493 --
NM_020801chr532259 2088 1058 ----12352
NM_020809chr11----12260 --
NM_020845chr123962 335 79 ----11567
NM_020854chr181358 --11507 --
NM_020856chr194991 362 329 57 --11201 --
NM_020899chr1722049 1864 ------
NM_020919chr2----11290 --
NM_020925chr111194 --11274 --
NM_020935chr234554 1110 234 1600 ----
NM_020940chr1022663 1131 --1364 11809
NM_020951chr1931904 1775 1602 1861 ----
NM_020962chr151501 --22476 2017 --
NM_021005chr151994 ------
NM_021033chr1342404 951 285 237 --11073 --
NM_021132chr102883 505 ------
NM_021202chr2072656 2073 1919 1037 759 633 603 1425 ----
NM_021229chr12129 ------
NM_021627chr3----1113 --
NM_021629chr354806 3194 537 406 184 --14403 --
NM_021728chr141134 --174 --
NM_021785chrX----169 --
NM_021813chr623605 69 --24439 1242 --
NM_021814chr6------11587
NM_021914chr1432262 1589 404 ------
NM_021961chr1146362 5622 2915 2251 --27140 7080 --
NM_021964chr321154 33 12567 22101 2069 --
NM_021998chrX11134 ------
NM_022048chr1546329 6084 5879 2316 11335 24449 2057 11668
NM_022154chr4----136 --
NM_022165chr19163 ------
NM_022166chr1632258 2127 1978 ----14628
NM_022462chr1963807 3423 3411 3349 2895 2303 --13602 --
NM_022465chr1222430 551 1518 2663 54 --
NM_022475chr4139 --1713 --
NM_022484chr721038 347 --11094 --
NM_022552chr2----1832 --
NM_022648chr243603 1308 992 536 --23278 1588 --
NM_022719chr2273801 2489 1487 1284 1074 431 257 --53691 2860 2702 716 171 --
NM_022730chr24958 418 142 23 ------
NM_022735chr1----11601 11673
NM_022749chr841397 1148 446 68 ----11038
NM_022776chr321144 143 --1547 --
NM_022843chr13------1583
NM_022893chr2----12995 12281
NM_022898chr1431516 787 132 24284 1532 24630 269 11332
NM_023016chr252711 1859 1052 732 716 12797 --1502
NM_023071chr12------11104
NM_023075chr18----1197 --
NM_023079chr1731478 245 192 --180 --
NM_024511chr463446 2366 1282 590 457 209 --12715 --
NM_024590chr411978 ------
NM_024613chr8------11542
NM_024665chr344634 3678 1340 869 ------
NM_024700chr1----1227 --
NM_024721chr8----1870 --
NM_024749chr132291 843 182 ----1598
NM_024824chr141329 --21555 478 --
NM_024884chr1431064 890 180 12933 ----
NM_024887chr141886 1681 1582 80 ------
NM_024947chr378492 8328 7577 7210 6541 2996 866 --28819 2015 --
NM_025057chr141290 --1198 --
NM_025134chr161525 ----1241
NM_025164chr1121976 578 --11347 --
NM_025191chr11454 12957 --12423
NM_025212chr4----130 --
NM_025248chr1762481 2453 2419 2330 1969 864 1899 1722 --
NM_030621chr1423384 3074 --21345 1311 --
NM_030625chr10------1260
NM_030627chr511257 ------
NM_030640chr12----1662 --
NM_030648chr443592 1880 1666 1075 ----14421
NM_030650chr263519 1688 981 677 588 74 --1525 --
NM_030767chr952808 2222 2146 726 525 --1839 --
NM_030780chr82635 66 --11504 --
NM_030791chr1431653 1511 293 --2723 604 --
NM_030949chr6----21378 555 --
NM_030981chr115775 495 96 71 33 --11157 --
NM_031372chr41349 ----1301
NM_031417chr1972539 2376 2105 1991 762 534 217 ------
NM_031422chr18----1502 1525
NM_031435chr1283094 2989 2748 2733 2453 479 447 67 --12489 --
NM_031445chr232511 692 555 --11358 --
NM_031483chr2011139 --23053 417 --
NM_032021chr111215 --1937 --
NM_032047chr3----12057 --
NM_032229chr1311065 1180 1998 --
NM_032239chr4----21377 1214 --
NM_032268chr1652771 2151 1016 254 116 --23044 279 1819
NM_032408chr721073 1061 --1216 --
NM_032424chr11----1571 --
NM_032457chr423315 537 ----23284 2878
NM_032491chr122817 421 --11048 --
NM_032505chr322376 281 12387 ----
NM_032873chr1134455 607 256 --34268 3523 3504 13741
NM_032918chr1241149 912 288 227 11242 1331 --
NM_033119chr16------164
NM_033211chr511986 --1176 --
NM_033224chr766871 6202 3105 2632 854 837 ------
NM_033274chr532938 457 393 ----1650
NM_033389chr1764036 3712 3595 3521 448 337 --34717 4341 3388 --
NM_033407chr11236 ------
NM_052875chr1141360 657 586 29 --32184 1902 1529 12038
NM_052880chr222977 437 --11393 --
NM_053023chr1123287 508 --1965 --
NM_053025chr311175 1184 ----
NM_053056chr1183104 3018 2959 2831 2407 1985 771 550 ----1362
NM_057175chr411974 ------
NM_057749chr8--1160 ----
NM_058172chr441704 1138 416 28 ------
NM_058191chr211900 --1780 --
NM_080743chr662281 2139 1922 1790 257 82 11665 ----
NM_080867chr1443837 1866 1585 311 --1332 --
NM_080927chr343140 379 325 136 1436 ----
NM_101395chr2133475 1275 1178 --21027 89 --
NM_130446chr353593 3179 2723 1251 674 --23965 279 --
NM_130459chr931527 1027 560 ------
NM_133171chr2011044 ----11075
NM_133329chr2197 ----1318
NM_133445chr9----12442 23462 708
NM_133496chr121524 50 14241 23879 1363 --
NM_134424chr12----1823 --
NM_138357chr10----1179 --
NM_138426chr7----1511 --
NM_138473chr12104674 4352 3885 3671 3162 1571 1148 930 914 902 --1785 --
NM_138476chr14----125 --
NM_138479chr1----1111 --
NM_138731chr1423757 619 --13390 --
NM_139246chr942003 1605 1596 1577 ------
NM_139283chr121467 --11659 --
NM_144571chr415808 16195 12445 --
NM_144582chr282413 1950 1915 1646 1043 484 207 91 ------
NM_144631chr2------198
NM_145008chr112616 155 --1627 --
NM_145176chr643224 3070 2831 194 --12537 --
NM_145260chr23707 238 153 --194 --
NM_145263chr422083 924 --1246 --
NM_145313chr103649 426 164 ------
NM_152253chr22104136 4027 3759 3603 3149 3112 3089 2826 1372 952 ------
NM_152261chr1222383 49 --1472 --
NM_152264chr111797 --1966 --
NM_152280chr11367 --13131 1209
NM_152407chr552606 1184 404 259 198 --192 --
NM_152523chr2----1499 --
NM_152636chr1132797 2484 441 --1397 --
NM_152641chr1242807 2761 2063 1965 --1808 --
NM_152678chr362065 1947 1811 915 713 318 --22713 230 --
NM_152695chrX12203 --11521 --
NM_152787chrX43647 3483 3277 632 --13893 --
NM_152835chr142288 1923 1073 642 --12415 --
NM_152860chr12------11246
NM_152890chr1----1168 --
NM_152994chr2----1439 --
NM_153207chr1253353 3204 1383 1156 239 ------
NM_153235chr611692 --12453 179
NM_153246chr63354 346 317 --11967 --
NM_153332chr81172 --1521 --
NM_153365chr442337 1948 758 86 ------
NM_153487chr641351 1305 1190 588 --23093 174 --
NM_153607chr532866 856 255 --13142 --
NM_153619chr1531124 798 46 --1933 --
NM_170746chr11----1162 --
NM_171998chrX32156 820 508 --2897 219 --
NM_172373chr13----1216 --
NM_173083chr1----1131 --
NM_173355chr22883 84 --1384 --
NM_173468chr445727 2260 1096 469 15508 --15857
NM_173475chr16----1167 --
NM_173495chrX22533 365 --1114 --
NM_173519chr8----1239 --
NM_173595chr1254840 4231 955 475 80 --24021 1207 --
NM_173642chr158840 8618 7479 5727 120 35804 2998 2315 29041 277 --
NM_173822chr2----1640 --
NM_173851chr863970 3782 3562 3037 1353 1346 --23176 168 21553 1535
NM_174911chr822473 290 --1847 --
NM_175061chr72686 354 ------
NM_175852chr142893 540 173 128 --12683 --
NM_175866chr12441 173 --1100 --
NM_175884chr7----11132 --
NM_176814chr711161 195 1189 --
NM_177424chr1--1516 ----
NM_177968chr21227 ------
NM_178812chr811377 --11146 --
NM_180989chr131784 --12292 1770
NM_181354chr81394 ------
NM_181504chr51538 --22809 2557 --
NM_181714chr611252 ----11866
NM_181825chr222175 141 --129 --
NM_181836chr5----2616 68 12354
NM_182579chr12887 426 --1662 --
NM_182580chr172361 2170 2151 960 809 699 448 --1714 1771
NM_182691chr7----1135 --
NM_182765chr1031625 425 165 --1293 --
NM_182767chr121228 ----1585
NM_182830chr1422289 461 --140 --
NM_182944chr14125 ----1341
NM_182975chr12753 76 ------
NM_183416chr12709 474 11412 ----
NM_194282chr443035 2010 1218 576 1763 12158 --
NM_194285chr1142549 2446 394 106 ----13443
NM_194314chr135323 3634 1810 24083 719 33537 1841 1587 --
NM_194317chr221923 1068 ----11834
NM_198066chr1432753 2184 1920 1937 ----
NM_198279chrX--1257 --194
NM_198465chrX22131 369 --1201 12547
NM_198468chr6--13240 23697 3121 --
NM_198485chr341818 1755 1738 1019 ------
NM_198513chr81241 1200 1653 --
NM_198859chr354665 4255 3119 1815 1753 23445 960 ----
NM_199168chr103535 432 132 --11203 11013
NM_199355chr161193 ----11193
NM_199461chr1022859 870 --2381 289 --
NM_201997chr11----2364 275 --
NM_203364chr1121185 836 --11253 --
NM_203406chr521934 356 ----12157
NM_205833chrX----1277 --
NM_206853chr61778 --1434 --
NM_206854chr622039 914 --21695 787 --
NM_207371chr10----11326 --
NM_207422chrX----2946 246 --
NM_207645chr11----2395 162 --
NM_212558chr92356 161 1598 12949 --
NM_213589chr254170 3954 2059 585 298 ------
NM_213604chr191911 --1199 1214