TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-515-5p
miRNA Sequence: UUCUCCAAAAGAAAGCACUUUCUG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000125chr662898 1329 1185 743 357 306 22799 2777 --43461 2840 1427 455
NM_000141chr10----21210 1138 21421 332
NM_000901chr432253 848 150 11875 --21737 1609
NM_001001664chr242984 2808 1445 957 11423 1452 33981 3095 2897
NM_001008801chr1961507 679 428 326 157 73 1596 --1834
NM_001013746chr74460 380 213 45 1297 --11646
NM_001014797chr1067121 2742 2141 2069 1192 959 37161 6533 1547 36976 6960 5141 13135
NM_001024647chr1257096 6682 5873 5773 1229 25236 839 32635 1125 696 25642 1642
NM_001039618chr1173699 2271 2214 1738 1371 760 727 --1621 1914
NM_001100108chr188080 7112 6942 5585 5451 5134 3220 2637 --26522 1787 27223 2456
NM_001106chr3199646 6585 6547 6505 6395 6363 5980 3900 3840 3810 2915 2215 2111 1853 1799 1113 1020 766 720 28942 3278 --43588 3493 3439 800
NM_002657chr2073775 3683 3471 991 914 329 152 1811 1342 1323
NM_004432chr91110 1590 --31652 686 546
NM_004852chr1822524 1096 35076 4584 1262 412522 11997 10973 3341 212056 10015
NM_005399chr164135 3850 3401 1404 379 298 22896 1776 --23284 1040
NM_005596chr944997 2359 2287 1815 14253 35144 2491 1110 26251 82
NM_005955chr144510 4503 3465 1687 --35121 4197 3474 35047 4625 819
NM_006546chr17136578 6548 6375 6211 6087 5483 4762 4407 4079 2607 1912 760 644 35299 1886 985 26043 1180 25041 4062
NM_012193chr1195011 4757 4283 3465 1304 1199 910 289 281 24274 3529 11595 160
NM_012297chr422017 1928 12293 11898 2402 217
NM_013255chr748562 5992 1819 351 38855 8427 7917 11514 27671 2020
NM_014423chr545321 3887 2271 336 25008 4204 45534 5101 5089 3942 25624 1962
NM_015852chr7133619 2680 1133 1049 965 797 629 545 461 377 209 125 41 --1293 --
NM_015886chr865370 1794 1223 1138 604 68 11944 11931 15600
NM_017848chrX33699 1778 426 1197 11410 34551 2937 1468
NM_018416chr1222190 469 22442 59 41829 861 679 528 21875 397
NM_020443chr186623 5068 5044 2675 2181 1780 620 324 26112 4768 15321 46244 5752 992 259
NM_020699chr1125109 5101 5095 5043 4373 3704 1439 1432 1212 722 651 299 35130 3932 3672 11764 35373 4616 848
NM_022491chr12102952 2804 2616 1354 1212 1165 647 488 252 126 33373 981 375 --11137
NM_024989chr256339 3124 1800 1720 780 --11061 1102
NM_025054chr823852 359 11523 24137 2965 23805 609
NM_025179chr194378 3178 3035 1257 1106 1036 283 129 85 21729 1024 21085 543 23371 342
NM_030806chr1128535 7953 7893 7678 7606 7582 6991 6473 2696 1967 1525 1469 26031 1187 47244 1763 1152 504 --
NM_032291chr111870 143 --21205 27
NM_080669chr1774890 4152 3362 1497 1385 652 60 53756 3355 1913 958 516 53213 1881 1469 1440 1024 21137 545
NM_144571chr455953 2605 2174 1072 651 46605 5944 1299 972 16919 25854 4381
NM_152424chrX44174 3119 1839 51 34489 3978 1481 --44247 4146 3017 548
NM_152734chr6164947 4882 4714 4686 4650 4321 3740 3469 3341 2103 1746 1488 965 872 593 367 55181 4840 3552 1808 1429 ----
NM_153456chr1356125 4785 4201 1675 162 ----2935 75
NM_153607chr5------32247 617 294
NM_182503chr623451 1110 11396 22090 1595 31903 1728 786
NM_182515chr1932120 2108 240 1576 25599 999 15480
NM_207406chr4106493 6215 5380 4928 4572 4053 2100 1704 1574 378 16173 26546 1372 --