TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-516a-5p
miRNA Sequence: UUCUCGAGGAAAGAAGCACUUUC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000332chr667021 4550 2602 1910 1786 1035 25438 5079 ----
NM_000430chr1713531 --12804 --
NM_000462chr1521594 358 ----1604
NM_000719chr1214893 ----26574 2292
NM_000814chr1533165 2930 710 12751 13110 1366
NM_001001484chr104951 488 364 29 ----1325
NM_001001995chrX------1746
NM_001002838chrX31242 600 296 1336 ----
NM_001005502chr1234830 3644 1346 14487 13659 1294
NM_001005845chr8------11276
NM_001011708chr242348 2209 2194 960 11966 --22871 2450
NM_001012393chr1124224 1625 15204 11415 13941
NM_001013438chr31750 ----1373
NM_001018004chr151450 --1675 --
NM_001025077chr1017543 24961 1835 --1350
NM_001025100chr1863679 2901 2667 2523 1199 496 1456 --12650
NM_001031812chr5------1479
NM_001033047chr41854 --1435 --
NM_001037582chr42525 220 ----11378
NM_001040108chr141157 12444 32904 2404 2373 --
NM_001040450chr1522724 1111 ----22191 42
NM_001040712chr9------184
NM_001042494chr1531436 1422 1215 --13203 --
NM_001042604chr311584 11774 --14893
NM_001042749chrX11381 --11868 --
NM_001206chr922963 563 ----12872
NM_001219chr7------11588
NM_001326chr11------1145
NM_001417chr12154 --11308 --
NM_001482chr15------1391
NM_001560chrX22650 406 --1579 31801 689 40
NM_001663chr141363 ------
NM_001827chr9------181
NM_001980chr1221810 378 --22149 33 --
NM_002429chr1211526 ----1423
NM_002508chr121986 1356 21741 778 11705 11523
NM_002519chr11----11506 --
NM_002901chr11------1741
NM_002912chr61391 ------
NM_002977chr223278 1027 --13439 --
NM_003246chr15------176
NM_003253chr2121563 212 --1676 --
NM_003410chrX--11245 --12991
NM_003418chr31527 ------
NM_003463chr622133 1288 12989 139 12055
NM_003590chr243915 649 154 131 ----1233
NM_003913chr643461 3381 3309 470 --1354 --
NM_004080chr71476 ------
NM_004687chr172764 448 ----1123
NM_004745chr846206 2721 2247 1993 36816 5415 1142 15467 --
NM_004760chr72700 483 ------
NM_004852chr18412219 11725 4269 1880 --21641 332 --
NM_004902chr20159 ----148
NM_005188chr1157271 2700 1581 898 207 17564 --16473
NM_005358chr1311359 --1249 --
NM_005376chr1----21171 1041 --
NM_005402chr721737 1576 ----1733
NM_005596chr945573 5282 4126 2438 ----21289 1052
NM_005742chr2----1824 --
NM_005749chr17------173
NM_005933chr1112852 --1524 12614
NM_005986chr1342675 2250 2231 772 11880 2306 247 --
NM_006139chr22169 137 --32612 2269 891 --
NM_006166chr1222114 1886 ----1168
NM_006252chr134939 2123 1730 1103 36817 5035 657 --
NM_006534chr2032533 763 755 ----13287
NM_006546chr1785337 4301 2204 1964 991 219 53 24 22237 142 14868 15677
NM_006726chr4--11022 --1347
NM_006754chr71912 ----167
NM_006807chr1711216 ----198
NM_006813chr61857 --1210 161
NM_006885chr1612984 ----11612
NM_006931chr1231774 641 465 --11462 --
NM_007286chr51159 ----11970
NM_012164chr987515 6547 6530 6195 5480 2222 287 162 ------
NM_012316chr164990 4690 4227 3724 915 447 14093 2954 909 --
NM_013231chr1442838 1599 734 624 ----148
NM_014007chr921000 21 ----11117
NM_014141chr733885 3835 88 14830 21491 156 1391
NM_014293chr2253671 2617 1484 1368 52 --11593 --
NM_014458chr1------178
NM_014602chr3------157
NM_014612chr9------11214
NM_014616chr3--22707 216 12942 1432
NM_014810chr11184 ------
NM_014872chr921679 83 --12377 --
NM_014926chr3----1289 --
NM_014982chr141527 ----13777
NM_015026chr1221536 1249 13383 --11906
NM_015061chr9------1655
NM_015071chr545297 2070 869 69 15916 31289 962 482 12585
NM_015509chr12253 34 --11567 --
NM_015525chr6------1348
NM_015542chr101385 ----1257
NM_015553chr633594 3369 201 ----11124
NM_016206chr337509 3218 2544 37828 3556 3311 12532 36655 6441 157
NM_016287chr131863 1659 736 ----11964
NM_016929chr622818 93 --24453 593 --
NM_017418chr9------177
NM_017554chr321518 858 --2469 186 --
NM_017607chr191513 ------
NM_017637chr978059 7817 7738 7362 3293 1626 541 28587 3690 48612 8098 6494 165 --
NM_017644chr334934 928 400 --13604 --
NM_017714chr201710 --1131 --
NM_017771chr31152 ------
NM_017831chr1823738 610 11570 1197 --
NM_017848chrX1810 --11789 11698
NM_018084chr222939 2182 --1868 12300
NM_018085chr147851 6667 2507 1670 12044 41766 1345 1234 74 --
NM_018945chr622852 2657 --11137 13177
NM_018963chr21------11355
NM_018999chr1024630 1920 11792 11494 11825
NM_019091chr2------1959
NM_019113chr19----184 --
NM_020198chr1711012 ----1505
NM_020228chr113847 269 242 ------
NM_020231chr3------1159
NM_020432chr71370 21944 1852 1264 --
NM_020765chr11275 ----1292
NM_020850chr1622547 1045 11124 23293 2326 --
NM_021252chr1021623 483 --11567 --
NM_021961chr1156355 5081 5016 2478 352 --12795 1282
NM_021998chrX------11351
NM_022780chr211579 --1386 --
NM_022898chr1434658 3336 766 --11636 13259
NM_025054chr813703 13051 --21067 561
NM_030628chr11------1167
NM_030958chr8------158
NM_031890chr2232615 2001 36 --13087 12817
NM_031900chr5------1185
NM_032256chr12143 --1316 --
NM_032446chr513304 22548 1026 21547 794 --
NM_032560chr141357 ----1955
NM_032788chr211424 ------
NM_032968chrX1708 11704 ----
NM_032973chrY1708 11698 ----
NM_033222chr911327 ----135
NM_033224chr737865 6605 5073 ----2509 183
NM_033407chr1------1164
NM_052864chr41262 1522 --12216
NM_052925chr191321 --11058 --
NM_058237chr141216 --1881 --
NM_078469chr101457 ------
NM_080867chr1423577 185 --24827 3560 --
NM_080927chr343377 2766 1056 667 --1341 --
NM_133496chr143760 1647 1634 693 ------
NM_138459chr623631 2518 --3689 618 151 --
NM_138966chr181241 ----1445
NM_139283chr122606 150 32262 903 163 1140 --
NM_144963chr831857 1019 484 --1228 --
NM_145313chr1031616 1437 75 ----11461
NM_145808chr7--1934 --12213
NM_152253chr2263234 1717 1086 680 351 337 ------
NM_152857chr61697 ----1297
NM_153825chr431697 728 418 3697 379 98 183 --
NM_172071chr137223 6323 1728 --16082 1510
NM_173510chr2211852 ------
NM_173511chr221417 1261 --12701 --
NM_175736chr1257420 6558 5947 2665 129 27277 5090 11476 --
NM_181783chr1231471 722 338 ----1576
NM_182488chr13------1846
NM_183238chr1212748 ----1393
NM_199133chr51980 --1842 --
NM_203451chr13122 --12362 --
NM_206853chr6------13657