TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-516b-5p
miRNA Sequence: AUCUGGAGGUAAGAAGCACUUU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000024chr51497 ------
NM_000038chr521871 359 31477 832 556 ----
NM_000052chrX42898 2200 1385 206 12236 ----
NM_000053chr1341789 383 250 96 ------
NM_000081chr121307 686 ------
NM_000084chrX126480 6388 5810 5436 5244 2016 1832 1773 987 820 749 501 16414 22474 2398 --
NM_000090chr21101 1741 1715 --
NM_000092chr253552 2921 866 717 647 33764 3515 3371 ----
NM_000093chr952202 1837 995 830 296 --21594 851 --
NM_000104chr242295 569 444 76 --12588 --
NM_000112chr573632 2216 2011 1950 1812 1558 437 25486 1660 23951 1994 --
NM_000125chr6134066 3552 2956 2949 1576 1539 876 864 712 668 127 98 28 ------
NM_000141chr1021120 1097 ------
NM_000161chr1411825 ------
NM_000168chr743196 2173 1168 427 23308 2449 --12495
NM_000176chr593239 3113 3095 2828 1545 1045 797 741 385 13223 --23463 3089
NM_000192chr12----11182 1336
NM_000208chr1944120 523 374 115 34348 3525 455 --34134 4110 4030
NM_000216chrX33312 2522 79 --13206 --
NM_000217chr1274971 4919 4293 3455 1595 668 420 34191 3612 803 --23793 3409
NM_000222chr411824 ----3375 99 32
NM_000240chrX41854 1546 906 750 1353 1631 --
NM_000259chr15125652 4895 3994 2485 1955 1661 1347 1287 1107 980 303 65 --26152 2533 26160 4916
NM_000264chr952469 1329 1247 882 578 2864 67 ----
NM_000267chr1743428 2163 1357 769 1245 ----
NM_000276chrX31974 1911 401 261 29 1876 --
NM_000278chr1042085 1770 643 28 ------
NM_000314chr103951 568 293 12853 13108 --
NM_000315chr11----136 --
NM_000321chr1321376 112 --21698 1662 --
NM_000330chrX21908 725 --1480 --
NM_000332chr6156913 6623 5983 5615 4501 2410 1663 1064 1058 1000 940 542 486 292 52 25897 1875 76645 6602 6335 5525 4956 1776 242 16292
NM_000333chr32451 182 --11141 --
NM_000337chr585462 5028 4585 4308 2600 2182 1913 385 26597 345 11330 --
NM_000340chr311359 --11054 --
NM_000351chrX44054 3930 2912 938 1950 21733 1303 --
NM_000361chr2061952 1602 1394 746 442 418 21721 35 11538 --
NM_000368chr963897 3346 3015 1357 386 88 44487 655 567 460 33813 3274 1135 --
NM_000386chr173690 125 64 ----1149
NM_000390chrX43422 3356 2225 480 33101 2788 371 ----
NM_000408chr253035 2701 753 580 531 1668 ----
NM_000411chr2162455 2031 1310 1048 890 324 1764 22864 2827 --
NM_000430chr1753478 3364 3289 2747 1313 2504 209 ----
NM_000434chr64432 117 49 35 ------
NM_000435chr192665 173 ------
NM_000441chr742238 1891 219 200 --175 --
NM_000447chr1174 ------
NM_000448chr1163132 3059 2891 2670 2140 2007 11066 22411 674 12477
NM_000461chr383799 3235 3149 2835 1374 982 903 197 13071 ----
NM_000474chr7283 58 ------
NM_000492chr721121 441 ------
NM_000503chr82311 198 11278 --191
NM_000522chr71281 ----147
NM_000523chr2----21149 274 1332
NM_000554chr1933159 2586 2179 11093 22241 277 1285
NM_000555chrX97713 5736 3151 3048 2262 2142 992 247 27 27252 2026 11844 21129 788
NM_000572chr12860 31 ------
NM_000597chr21102 ------
NM_000599chr273666 3437 3299 1762 572 157 55 --44168 3125 3077 1348 1544
NM_000602chr721054 419 ------
NM_000610chr1172931 2248 2110 963 717 511 243 ----22008 501
NM_000615chr1162852 2610 720 658 410 137 ------
NM_000618chr1274809 2576 2321 2203 1987 1356 1121 --11080 15242
NM_000618chr1274809 2576 2321 2203 1987 1356 1121 --11080 15242
NM_000633chr1875155 4206 3407 1671 1639 1541 179 14088 44799 1170 1050 638 13589
NM_000639chr11587 ------
NM_000719chr12146619 6334 5901 5888 5003 4330 4243 4158 2633 2443 2383 2250 1986 166 36592 460 65 76465 6295 5206 5025 4752 4339 502 --
NM_000724chr1031469 735 227 --21822 384 11532
NM_000725chr123966 222 137 --2860 62 --
NM_000726chr251380 977 590 345 175 1913 ----
NM_000756chr81436 ------
NM_000788chr441124 259 45 36 ------
NM_000793chr1433526 2059 532 24029 3834 24633 4451 --
NM_000794chr52412 163 1726 --1248
NM_000807chr4----1677 --
NM_000810chr15140 --1172 --
NM_000813chr551942 1907 1170 1000 204 192 --34660 4567 2118
NM_000817chr21322 ----2376 57
NM_000818chr10----135 1220
NM_000824chr41278 ------
NM_000827chr582169 2040 1850 1601 1593 475 467 66 --1827 --
NM_000831chr1135812 5737 4459 4427 4036 2503 2024 1921 1719 1416 1327 1203 716 26317 5270 55336 4761 1772 1439 301 --
NM_000838chr652437 2298 978 593 199 12084 157 --
NM_000859chr541178 1087 696 150 21464 1128 --1567
NM_000870chr531340 402 163 --11354 --
NM_000872chr1031447 1008 299 1238 --1987
NM_000875chr15126426 5942 4841 4750 2812 2386 2173 2023 1323 1235 1011 643 15960 --1119
NM_000876chr62922 894 ------
NM_000879chr5----1115 --
NM_000883chr72123 112 ------
NM_000883chr72123 112 ------
NM_000885chr2--12142 1616 11701
NM_000899chr1264006 3709 3057 3049 1622 1611 22895 163 1387 1346
NM_000902chr393205 2753 2733 2405 2305 2137 961 718 657 11214 ----
NM_000921chr121520 ------
NM_000922chr112804 710 ------
NM_000933chr2031627 697 222 21303 1117 ----
NM_000962chr953073 2625 1229 701 52 52325 475 431 375 185 22745 212 --
NM_000965chr33989 945 41 149 ----
NM_000990chr1153196 2772 2676 1557 69 23576 765 11395 33855 3476 1514
NM_001001132chr2131390 960 114 ------
NM_001001323chr1232686 156 90 11137 ----
NM_001001389chr1172931 2248 2110 963 717 511 243 ----22008 501
NM_001001390chr1172931 2248 2110 963 717 511 243 ----22008 501
NM_001001391chr1172931 2248 2110 963 717 511 243 ----22008 501
NM_001001392chr1172977 2294 2156 1009 763 557 289 ----22054 547
NM_001001396chr183817 2765 1719 1706 1695 1558 1517 677 31406 984 24 23557 1371 --
NM_001001419chr584723 3382 3280 2098 1544 1211 625 584 2408 243 --14859
NM_001001420chr584723 3382 3280 2098 1544 1211 625 584 2408 243 --14859
NM_001001438chr212128 107 ------
NM_001001484chr1031556 177 64 ------
NM_001001549chr731953 941 918 22507 953 1832 --
NM_001001550chr731953 941 918 22507 953 1832 --
NM_001001555chr731953 941 918 22507 953 1832 --
NM_001001661chr72715 581 1614 ----
NM_001001664chr21173 156 21580 49 --
NM_001001890chr2164101 4049 3001 1141 785 52 43481 2920 2675 950 ----
NM_001001995chrX31590 162 149 31625 684 563 ----
NM_001002252chr12166 ------
NM_001002296chr82176 28 --185 1462
NM_001002762chr1082757 2087 894 533 382 354 226 164 --2271 172 12249
NM_001002814chr8113334 3282 3090 2507 1260 1007 684 655 607 382 299 13654 2870 57 --
NM_001002860chr1463111 2968 1271 1196 622 543 --24319 3547 14025
NM_001002919chr21524 ------
NM_001002926chr752585 2506 2266 773 256 ------
NM_001003406chr2273171 2967 2877 2277 1317 964 191 1323 12412 13138
NM_001003652chr1877309 6920 5763 5672 3012 2334 1928 35806 1285 196 ----
NM_001003681chr2242016 1418 1367 80 11319 1387 --
NM_001003698chr63674 656 217 ------
NM_001003699chr63674 656 217 ------
NM_001003712chr1253743 3155 1210 921 844 ------
NM_001003760chr633450 3312 3289 --22573 2518 23177 2777
NM_001003790chr82586 292 ------
NM_001003791chr82586 292 ------
NM_001003794chr362841 2813 2244 1892 1205 956 22327 326 32908 2428 752 --
NM_001003800chr962363 2354 1115 963 666 444 12518 11361 11369
NM_001003810chr41779 ----1230
NM_001004065chr952934 2792 1404 1346 489 13395 23354 1386 --
NM_001004304chr1252621 2207 437 407 326 12055 12461 --
NM_001004317chr623804 196 --21456 515 1707
NM_001005207chr17------155
NM_001005217chr4176 ------
NM_001005242chr1221553 425 51615 1166 488 171 136 21595 1106 --
NM_001005353chr13427 294 288 11261 ----
NM_001005353chr13427 294 288 11261 ----
NM_001005366chr122672 644 ------
NM_001005375chrY1227 2710 542 11649 --
NM_001005386chr222088 1874 2923 547 --182
NM_001005463chr1052578 1618 960 852 51 --12017 --
NM_001005473chr595814 5543 5482 5271 2462 1146 701 325 153 ------
NM_001005474chr32462 227 11295 --11152
NM_001005502chr12104231 3839 3481 3475 2048 1709 1534 1032 652 84 24435 4325 31052 957 59 --
NM_001005609chrX73671 3571 3472 3392 3160 610 335 1179 63368 3294 2689 2612 370 151 23637 1024
NM_001005739chr21639 1740 ----
NM_001005746chr251380 977 590 345 175 1913 ----
NM_001005747chr251380 977 590 345 175 1913 ----
NM_001005845chr841806 419 204 170 ----1114
NM_001006636chr2157 --1173 --
NM_001006665chr12588 582 1537 ----
NM_001006684chrX1169 ------
NM_001007023chr1433526 2059 532 24029 3834 24633 4451 --
NM_001007097chr954910 4139 3882 3724 514 34069 3560 827 44568 4146 3329 1377 --
NM_001007098chr13882 637 144 ------
NM_001007156chr1571835 1754 1679 481 387 96 73 --41654 1646 1615 741 --
NM_001007237chr142517 2111 1139 976 --22877 270 --
NM_001007246chr2121380 1351 --11921 11900
NM_001007278chr1364852 4666 3362 1552 1106 67 --12061 --
NM_001007466chr664918 4874 4439 171 28 21 25073 1968 --1408
NM_001008220chr583649 3555 3487 2656 1500 1202 911 365 13268 33319 2497 2433 22642 2590
NM_001008239chr1863663 2900 1139 720 390 86 12582 12743 194
NM_001008392chr343532 2834 1396 456 23181 519 1111 --
NM_001008393chr422840 596 ----1741
NM_001008401chr1941427 1305 523 438 ------
NM_001008407chr751798 1368 1292 558 41 ------
NM_001008408chr7114345 4014 3908 1747 1504 1025 942 912 418 161 103 15297 35800 1672 132 15033
NM_001008495chr822198 2189 1442 ----
NM_001008541chr1022149 899 1215 --11786
NM_001008541chr1022149 899 1215 --11786
NM_001008564chr1342235 1629 755 373 11989 11474 --
NM_001008660chr112448 67 ----11000
NM_001008701chr1982576 2552 2444 2206 1950 1148 1128 309 13059 32507 1023 115 --
NM_001008744chr1441300 1054 593 585 ------
NM_001008895chr1331398 204 192 ------
NM_001009555chr421724 155 --1512 --
NM_001009899chr366315 5513 5193 4876 4150 2332 24659 448 ----
NM_001009909chr1123558 155 11427 ----
NM_001009993chr244364 3741 1581 170 23917 3014 13845 --
NM_001010000chr1852895 2173 1108 958 472 32649 261 244 --12604
NM_001010853chr621129 1049 1406 ----
NM_001010861chr132310 2050 1873 12406 11881 --
NM_001010867chr1176470 5874 5668 5026 4994 4614 2078 1941 1901 1748 1600 1506 1453 502 469 415 67 14859 34717 1856 254 35744 1221 658
NM_001010888chrX43569 3311 1633 340 23786 935 1502 11868
NM_001010891chr5166739 6447 6273 6252 5920 5637 5508 4989 4634 4600 2332 1683 1621 1598 757 498 35764 4753 783 16059 --
NM_001010895chr931384 678 88 1701 --11490
NM_001010898chr183186 3052 1318 1252 888 627 148 58 13612 22991 2680 --
NM_001010942chr121179 --1433 --
NM_001010971chr111020 ------
NM_001010986chrX31835 751 86 11925 ----
NM_001011513chr473797 3425 3148 1409 1385 774 132 12846 23167 3037 --
NM_001011546chr201676 ----1817
NM_001011553chr71258 ------
NM_001011554chr2062043 2024 1720 803 467 134 1673 --22092 1973
NM_001011657chrX2417 117 ------
NM_001011666chr731794 471 236 25679 1073 16098 --
NM_001011708chr252771 2713 2695 2398 951 --1386 --
NM_001011713chr1451442 1054 610 439 203 ------
NM_001011722chr12166 71 ----1112
NM_001011722chr12166 71 ----1112
NM_001012393chr11125007 4840 4542 4447 4177 3621 1758 1503 1480 894 165 115 13651 ----
NM_001012420chr1552792 1156 1058 784 397 22551 1931 ----
NM_001012423chr1542792 1156 1058 397 22551 1931 ----
NM_001012426chr653026 2128 710 239 55 2108 49 21365 634 --
NM_001012427chr653026 2128 710 239 55 2108 49 21365 634 --
NM_001012514chr211049 11114 --1395
NM_001012516chr211049 11114 --1395
NM_001012732chr4----1303 125
NM_001012755chrX64357 4341 3075 1088 889 361 24475 4315 23406 373 --
NM_001013031chr1032722 2599 2557 33102 3041 1249 2344 118 22387 1073
NM_001013399chr621163 71 --11015 --
NM_001013406chr731694 1330 118 ------
NM_001013438chr32916 845 1881 --185
NM_001013624chr174427 323 198 107 1127 ----
NM_001013839chr1772560 2210 2097 1604 919 354 129 --22297 1036 --
NM_001014797chr1076613 6470 6110 5745 5200 2390 369 25811 628 --26893 2929
NM_001014831chr193668 585 162 1635 --1273
NM_001014832chr193668 585 162 1635 --1273
NM_001014834chr193668 585 162 1635 --1273
NM_001014835chr193668 585 162 1635 --1273
NM_001015045chr43648 635 577 --1125 --
NM_001015048chr1443125 2773 2175 529 2338 331 --11104
NM_001015049chr1443125 2773 2175 529 2338 331 --11104
NM_001015053chr1731164 426 326 21017 987 11279 1177
NM_001015877chrX42879 2738 1970 621 --1789 --
NM_001015881chrX2164 59 11229 --1341
NM_001015882chr9------1741
NM_001017368chr1742435 2208 446 22 1289 ----
NM_001017392chr1931345 846 349 --1872 2374 277
NM_001017415chr11121 ------
NM_001017416chr11121 ------
NM_001017440chr7227705 7102 7049 6562 6150 6110 5886 5600 4986 3243 2738 2294 1791 1644 1524 624 583 463 335 323 210 170 47920 7631 3303 2929 43032 1411 1179 292 --
NM_001017970chr1472634 2571 2059 975 749 567 403 ------
NM_001018003chr82486 276 ------
NM_001018050chr2283308 2790 2308 1374 1284 1155 801 364 --23157 3091 1356
NM_001018052chr2283308 2790 2308 1374 1284 1155 801 364 --23157 3091 1356
NM_001018053chr141454 622 613 425 11782 1376 --
NM_001018064chr921529 398 ------
NM_001018065chr966042 4659 4574 2025 1292 866 45919 4149 2211 1222 45927 3983 3657 847 --
NM_001018066chr966042 4659 4574 2025 1292 866 45919 4149 2211 1222 45927 3983 3657 847 --
NM_001018067chr155211 4215 3279 1894 248 ------
NM_001018068chr155211 4215 3279 1894 248 ------
NM_001018069chr155211 4215 3279 1894 248 ------
NM_001018074chr593239 3113 3095 2828 1545 1045 797 741 385 13223 --23463 3089
NM_001018075chr593239 3113 3095 2828 1545 1045 797 741 385 13223 --23463 3089
NM_001018076chr593239 3113 3095 2828 1545 1045 797 741 385 13223 --23463 3089
NM_001018077chr593239 3113 3095 2828 1545 1045 797 741 385 13223 --23463 3089
NM_001018090chr153986 775 383 1154 11039 --
NM_001018091chr1541096 885 493 54 31834 264 41 11149 --
NM_001018102chr153986 775 383 1154 11039 --
NM_001018108chr1572096 1585 1424 920 887 531 368 --1449 --
NM_001018111chr773350 2560 823 466 438 182 23 --21086 43 12434
NM_001020658chr131530 604 588 ----1119
NM_001020658chr131530 604 588 ----1119
NM_001020825chr52570 303 ----2938 564
NM_001023567chr1522184 397 11952 ----
NM_001024094chr593239 3113 3095 2828 1545 1045 797 741 385 13223 --23463 3089
NM_001024380chr861984 1849 922 648 441 323 ------
NM_001024381chr861984 1849 922 648 441 323 ------
NM_001024460chr611194 1280 ----
NM_001024596chr1953551 3224 2939 764 188 11225 12449 11032
NM_001024647chr12117400 6833 5982 5781 5673 5383 4854 1413 1380 971 208 47031 6601 1675 1297 --36656 1607 439
NM_001024649chr542316 1980 1048 130 32640 1871 98 --1835
NM_001024660chr32562 503 31433 249 200 ----
NM_001024688chr851900 1731 581 375 55 ------
NM_001024847chr342359 2114 1980 980 12130 --1432
NM_001024858chr1482793 2476 2233 2185 2147 748 661 531 --2260 217 --
NM_001024948chr111249 1433 --1345
NM_001024956chr1135853 4326 699 11355 12086 --
NM_001025076chr1075164 4933 4923 2205 1717 1121 427 34552 1825 958 24425 505 --
NM_001025077chr1066522 6291 6281 2479 1785 227 25910 2316 45783 1863 1215 982 --
NM_001025105chr52552 400 2378 70 ----
NM_001025108chr263939 3354 3184 1016 679 368 --14013 1218
NM_001025201chr23572 549 226 ------
NM_001025232chr123285 278 145 ------
NM_001025266chr3--11502 14328 11330
NM_001025580chrX64098 3481 3006 1343 1194 1090 33763 2847 1686 ----
NM_001025595chr421651 1599 ------
NM_001029858chr642650 2174 1281 883 --1686 12665
NM_001029863chr632376 2273 617 --12654 --
NM_001029864chr2032137 1852 765 31560 507 452 2311 270 31709 172 35
NM_001029875chr552706 2678 2402 2061 1880 --166 --
NM_001029884chr621919 942 22687 347 ----
NM_001029998chr41915 --11131 --
NM_001030055chr1444567 4360 1419 50 11284 14732 11525
NM_001030272chr112337 195 --1170 --
NM_001030273chr112337 195 --1170 --
NM_001031679chr1293166 2935 2639 2596 2476 2351 2294 1101 923 22868 314 23483 2609 12430
NM_001031681chr1742259 2170 1548 303 11643 1851 --
NM_001031690chr783060 2311 1129 847 807 296 169 126 31942 1231 380 12867 1183
NM_001031695chr2265238 4987 3610 3400 1677 1222 --15159 11881
NM_001031702chr31773 --1147 --
NM_001031723chr41414 ------
NM_001031804chr1633022 452 81 --13630 --
NM_001032280chr681602 1561 585 473 467 165 77 61 ------
NM_001032282chr83509 477 265 ------
NM_001032290chr1288 29 ----1488
NM_001032291chr1288 29 ----1488
NM_001032296chr1342374 1841 217 143 1282 32018 1133 1047 --
NM_001032363chr152252 1527 1391 662 127 21492 395 1859 --
NM_001032363chr152252 1527 1391 662 127 21492 395 1859 --
NM_001032394chr672808 2436 1736 587 338 114 75 1283 --22184 721
NM_001032395chr642675 2303 454 205 1150 --22051 588
NM_001032999chr20125071 4606 4481 4294 4188 4181 3948 3405 1775 1452 745 545 11304 23935 1095 24457 3580
NM_001033045chr274160 3748 3306 2931 2844 2827 598 1287 ----
NM_001033049chr2131856 1468 385 ----2733 60
NM_001033059chr651299 1290 580 410 65 1468 ----
NM_001033081chr11350 1475 1663 31397 1224 1183
NM_001033082chr11350 1475 1663 31397 1224 1183
NM_001033087chr2062713 2697 2234 617 553 139 22203 2176 ----
NM_001033117chr364078 3798 1859 1495 1234 236 21895 694 14661 21349 677
NM_001033503chr5122 ------
NM_001033518chr762683 1869 1067 490 341 187 ------
NM_001033519chr762683 1869 1067 490 341 187 ------
NM_001033520chr762683 1869 1067 490 341 187 ------
NM_001033723chr852582 2380 2185 683 282 32060 1060 980 1956 --
NM_001034954chr103810 643 256 23276 310 32506 1106 1017 12380
NM_001034955chr103810 643 256 23276 310 32506 1106 1017 12380
NM_001034956chr103810 643 256 23276 310 32506 1106 1017 12380
NM_001034957chr103810 643 256 23276 310 32506 1106 1017 12380
NM_001035chr1--11240 --1889
NM_001035254chr981779 1604 1035 843 833 544 131 50 --31949 626 85 2505 418
NM_001035260chr1031529 1312 1040 11538 --152
NM_001035512chr152293 2130 779 126 78 2678 627 ----
NM_001035513chr152293 2130 779 126 78 2678 627 ----
NM_001035521chr21812 --1798 --
NM_001037132chr72809 652 --21774 843 2451 37
NM_001037133chr72809 652 --21774 843 2451 37
NM_001037164chr731737 1321 583 ------
NM_001037317chr132310 2050 1873 12406 11881 --
NM_001037332chr542139 1930 1860 779 12361 ----
NM_001037333chr542139 1930 1860 779 12361 ----
NM_001038493chr261269 1173 601 480 359 140 1254 1234 --
NM_001038702chr562488 898 792 425 120 59 --1948 --
NM_001038707chr142026 1727 295 51 ------
NM_001038707chr142026 1727 295 51 ------
NM_001039091chrX41037 1014 554 178 --1381 1961
NM_001039199chr2064942 3714 3535 1506 962 430 33842 3134 368 ----
NM_001039350chr72698 348 ----11345
NM_001039459chr761104 841 474 216 142 130 ------
NM_001039479chr1451930 1912 1853 1842 1779 --1757 --
NM_001039538chr253586 2936 2796 2764 2695 ------
NM_001039577chr164393 3832 3780 1559 700 57 1366 34377 3243 97 --
NM_001039590chrX53924 3575 3440 3395 581 11254 ----
NM_001039591chrX53924 3575 3440 3395 581 11254 ----
NM_001039618chr1185263 4797 1658 1512 1263 704 518 100 14414 ----
NM_001039690chr1641807 745 687 216 ----21978 1591
NM_001039709chr20125071 4606 4481 4294 4188 4181 3948 3405 1775 1452 745 545 11304 23935 1095 24457 3580
NM_001039840chrX75736 5333 5315 4924 1879 1031 1010 15936 13984 11021
NM_001039844chr1042453 1981 1896 1070 --12665 --
NM_001039937chr1323478 3426 14184 --13585
NM_001039960chr1251730 1109 457 383 311 ------
NM_001040057chr72371 208 ------
NM_001040101chr431539 1076 394 ------
NM_001040118chr117526 502 490 228 220 56 26 ----1391
NM_001040144chr1641807 745 687 216 ----21978 1591
NM_001040146chr1641807 745 687 216 ----21978 1591
NM_001040152chr772013 1926 1440 1249 1168 1071 573 2841 559 2774 84 --
NM_001040157chr442403 1171 940 237 22797 1831 ----
NM_001040158chr54389 226 145 45 ------
NM_001040172chr531340 402 163 --11354 --
NM_001040173chr531340 402 163 --11354 --
NM_001040181chr32826 229 --1868 --
NM_001040182chr32826 229 --1868 --
NM_001040183chr32826 229 --1868 --
NM_001040199chr32826 229 --1868 --
NM_001040200chr32826 229 --1868 --
NM_001040202chr43922 829 758 1590 1525 --
NM_001040214chr631724 949 709 22282 299 ----
NM_001040272chr932155 1570 732 11830 ----
NM_001040284chr1695910 5609 5386 4639 3967 3884 2078 425 103 ------
NM_001040402chr41967 1416 ----
NM_001040424chr2132725 934 668 --31918 1903 139 1183
NM_001040436chr121620 ----176
NM_001040441chr184702 4568 3534 3488 1880 1422 1026 282 13336 15258 --
NM_001040446chr542178 1736 470 317 --2588 350 --
NM_001040619chr12180 22 ----2553 396
NM_001040624chr852610 2210 1009 492 149 32268 2221 833 21866 1730 --
NM_001040625chr852610 2210 1009 492 149 32268 2221 833 21866 1730 --
NM_001040626chr852610 2210 1009 492 149 32268 2221 833 21866 1730 --
NM_001040627chr852610 2210 1009 492 149 32268 2221 833 21866 1730 --
NM_001040628chr852610 2210 1009 492 149 32268 2221 833 21866 1730 --
NM_001040629chr852610 2210 1009 492 149 32268 2221 833 21866 1730 --
NM_001040630chr852610 2210 1009 492 149 32268 2221 833 21866 1730 --
NM_001040633chr741044 346 208 129 ------
NM_001040709chr162351 2022 1617 964 512 56 165 32239 1848 624 --
NM_001040712chr973284 2991 2786 2453 1236 777 161 12264 ----
NM_001040715chr1651177 992 405 365 240 --21004 46 --
NM_001042355chr1634998 4311 1932 1929 34948 4588 2021 2202 126
NM_001042412chr1634998 4311 1932 1929 34948 4588 2021 2202 126
NM_001042413chr993827 3192 2536 2526 1634 1588 1250 1035 762 1139 13593 --
NM_001042425chr681602 1561 585 473 467 165 77 61 ------
NM_001042453chrX21742 557 ------
NM_001042492chr1743428 2163 1357 769 1245 ----
NM_001042506chrX1473 ------
NM_001042548chr23864 813 200 ------
NM_001042555chr1284278 4031 2986 1271 847 683 562 440 12910 ----
NM_001042599chr2116554 6410 6176 5181 3124 3039 2946 2549 2538 2296 1260 ------
NM_001042601chr342347 2308 2067 2055 12618 ----
NM_001042603chr1294807 4666 2021 1481 925 911 798 669 284 15183 24824 118 --
NM_001042604chr384208 4150 3663 1765 1535 1447 1403 435 13785 --13878
NM_001042646chr371894 1840 1658 1496 1420 1389 1262 ------
NM_001042681chr172071 1949 1781 993 925 764 600 31726 1677 260 1391 --
NM_001042682chr172071 1949 1781 993 925 764 600 31726 1677 260 1391 --
NM_001042682chr172071 1949 1781 993 925 764 600 31726 1677 260 1391 --
NM_001042683chr641551 1370 1306 412 11660 11169 --
NM_001042749chrX31578 760 648 2639 412 11440 --
NM_001042750chrX31578 760 648 2639 412 11440 --
NM_001042751chrX31578 760 648 2639 412 11440 --
NM_001043318chr1453402 3237 3208 1625 1015 ----2831 654
NM_001044385chr274035 3796 2936 2800 1348 1262 839 21587 872 --1920
NM_001044387chr19104009 3764 3256 2663 1104 1092 601 456 227 201 2254 176 1970 1871
NM_001044388chr19104009 3764 3256 2663 1104 1092 601 456 227 201 2254 176 1970 1871
NM_001046chr5141 12074 --130
NM_001050chr1731463 523 139 1107 ----
NM_001071775chr1321709 1424 ------
NM_001083621chr174525 3733 3364 3044 1521 1322 1062 1736 --1297
NM_001087chr21123 ------
NM_001092chr1752280 2225 352 231 47 --1109 --
NM_001099678chr355885 4984 4506 2179 510 22540 1171 15132 --
NM_001100108chr1126295 5763 5660 5288 5217 3186 3134 2994 2677 1520 1126 856 47588 7385 7313 84 17043 --
NM_001106chr3178531 8361 8128 7685 7538 7339 7174 7103 6962 6947 6716 6499 3893 2949 1990 1261 26 39758 6538 1905 26726 1199 28489 7125
NM_001113490chrX63430 2220 942 729 574 333 22589 2451 ----
NM_001126chr13180 141 131 ------
NM_001130chr192704 170 ------
NM_001135chr151284 ------
NM_001146chr83564 109 46 32256 709 552 --184
NM_001148chr441513 750 118 106 --11662 1644
NM_001153chr2------1899
NM_001154chr42178 59 ------
NM_001167chrX86260 5425 4468 4267 2621 2305 1645 343 12371 15350 --
NM_001173chr1444567 4360 1419 50 11284 14732 11525
NM_001178chr112337 195 --1170 --
NM_001186chr213721 650 267 1292 12119 1664
NM_001204chr265446 5311 5301 5074 4740 1670 27351 6276 15347 36131 5953 1100
NM_001206chr931984 624 518 ------
NM_001222chr1051777 1505 1486 1288 31 11344 ----
NM_001237chr42950 293 ------
NM_001237chr42950 293 ------
NM_001241chr221875 737 12162 1838 --
NM_001241chr221875 737 12162 1838 --
NM_001258chr171405 ------
NM_001259chr765353 2038 1840 1683 338 113 34782 4595 257 --1737
NM_001271chr1573044 2736 2147 2026 706 223 83 --1332 --
NM_001290chr42937 270 ------
NM_001292chr152982 203 ------
NM_001293chr111445 ------
NM_001300chr10280 41 --1121 --
NM_001304chr1793682 3625 3596 2624 2341 1510 1024 906 469 53362 2736 2609 953 381 ----
NM_001310chr1242712 2346 550 210 22426 2005 ----
NM_001315chr611726 11503 31807 474 244 --
NM_001331chr1142233 1997 1837 872 ------
NM_001332chr54630 433 426 23 ------
NM_001343chr55426 402 237 107 30 1308 1487 --
NM_001349chr2126 --1235 --
NM_001351chr331621 1153 139 ----1444
NM_001356chrX52525 2141 1765 1588 671 1195 ----
NM_001357chr1175 ------
NM_001364chr1183506 3395 3044 1692 1253 1092 1044 314 ------
NM_001386chr841995 844 786 658 ------
NM_001387chr532939 2873 2359 12722 ----
NM_001389chr211421 ------
NM_001391chr18171 ------
NM_001394chr8----1575 --
NM_001397chr152136 1847 710 385 229 --22526 71 --
NM_001399chrX73671 3571 3472 3392 3160 610 335 1179 63368 3294 2689 2612 370 151 23637 1024
NM_001406chr1761486 1363 1137 699 424 55 ------
NM_001408chr131364 522 314 1264 ----
NM_001412chrX63642 3213 2630 1018 399 299 32964 840 606 ----
NM_001418chr111488 ------
NM_001418chr111488 ------
NM_001419chr1964614 3008 844 710 700 491 14362 44504 3236 730 628 --
NM_001423chr1252053 1832 478 266 232 ------
NM_001427chr721991 563 11413 --11406
NM_001438chr183619 3525 2524 2497 1205 854 807 154 33394 2680 2567 --12792
NM_001448chrX21632 1271 ----11523
NM_001483chr71744 ----1276
NM_001495chr81490 ----1268
NM_001497chr952580 615 604 142 131 11896 1665 --
NM_001498chr641230 1066 339 164 --1944 --
NM_001514chr12467 119 ------
NM_001521chr21812 --1798 --
NM_001542chr142517 2111 1139 976 --22877 270 --
NM_001543chr574308 3346 3226 2956 2949 1657 681 31898 1705 1649 21467 400 11288
NM_001587chrX31974 1911 401 261 29 1876 --
NM_001609chr1073705 3479 3021 2786 1112 584 363 54222 4048 3962 3244 1151 ----
NM_001616chr243131 2338 1258 406 12815 ----
NM_001620chr111764 ------
NM_001621chr772784 2465 2429 2220 781 720 578 1908 ----
NM_001621chr772784 2465 2429 2220 781 720 578 1908 ----
NM_001634chr651299 1290 580 410 65 1468 ----
NM_001654chrX1153 ------
NM_001655chr1152162 1921 1661 1481 37 --1274 --
NM_001659chr1262548 2271 2234 1884 1804 1071 --32308 902 786 --
NM_001662chr72312 257 ------
NM_001663chr142659 289 1901 --11989
NM_001665chr112583 110 ------
NM_001668chr141975 1793 1536 685 --12028 --
NM_001678chr1741710 1610 740 424 --11472 --
NM_001679chr31146 179 ----
NM_001682chr1212400 1851 ----
NM_001690chr322462 2316 --1844 --
NM_001695chr873567 3423 3332 2636 1700 450 88 23209 620 ----
NM_001699chr1961577 1461 1343 1272 1250 291 --31826 1320 268 11132
NM_001704chr6------1535
NM_001707chr72772 689 2786 365 1281 1301
NM_001746chr542316 1980 1048 130 32640 1871 98 --1835
NM_001754chr2164101 4049 3001 1141 785 52 43481 2920 2675 950 ----
NM_001769chr12----1310 --
NM_001788chr71258 ------
NM_001792chr181262 171 --1756
NM_001800chr192484 395 ------
NM_001822chr23572 549 226 ------
NM_001851chr62125 100 ------
NM_001858chr654658 1342 888 745 395 23912 3428 --21310 1099
NM_001859chr983812 3529 3295 2818 2774 760 506 425 12480 1858 --
NM_001874chr12104231 3839 3481 3475 2048 1709 1534 1032 652 84 24435 4325 31052 957 59 --
NM_001891chr41345 ------
NM_001892chr52552 400 2378 70 ----
NM_001895chr20----1429 199
NM_001896chr161338 ------
NM_001904chr3--11082 --175
NM_001918chr1138681 8370 8326 7430 6205 5918 5664 2604 2131 2041 1871 1104 544 27278 5684 17386 --
NM_001920chr122745 147 1197 ----
NM_001921chr4----1303 125
NM_001923chr111230 ------
NM_001931chr1141286 1105 288 126 ------
NM_001936chr72698 348 ----11345
NM_001939chrX83469 2924 2538 1292 957 542 300 85 21242 1231 23222 3037 23144 550
NM_001945chr53905 477 67 ----1342
NM_001946chr124955 914 286 44 ------
NM_001949chr673200 2325 2134 1232 806 759 523 --1233 1134
NM_001957chr441938 1850 1422 445 12138 ----
NM_001964chr52838 216 ----1926
NM_001977chr421507 668 31546 1252 456 ----
NM_001987chr1283117 3036 2889 2669 1637 1553 868 675 22828 1034 --14146
NM_002006chr475501 5242 5111 4968 3942 3600 1410 14983 --1741
NM_002009chr1542484 2342 1897 31 22366 2265 ----
NM_002015chr1342641 2421 737 308 --21182 37 --
NM_002024chrX42237 470 239 178 ------
NM_002025chrX87819 7401 3255 3057 2679 1468 491 21 68830 8382 5846 5644 2231 451 37338 2741 850 --
NM_002026chr22138 132 1961 ----
NM_002040chr2132271 622 350 --22942 2676 --
NM_002048chr9--1275 1201 21006 249
NM_002070chr33926 771 351 --1161 --
NM_002076chr1252696 724 689 437 341 --12443 --
NM_002077chr982158 1939 1796 1534 1519 832 482 264 11707 ----
NM_002092chr454382 3629 811 483 85 34871 3419 244 1858 --
NM_002099chr441944 772 157 56 1130 ----
NM_002103chr1961124 1018 891 705 158 152 2965 943 3779 89 46 2215 182
NM_002106chr4171 ------
NM_002114chr61160 --1486 --
NM_002126chr1763202 3029 2970 2806 1467 527 22686 382 13749 --
NM_002129chr4199 ------
NM_002135chr122439 380 ----1136
NM_002137chr741575 924 772 77 --11877 --
NM_002138chr41779 ----1230
NM_002146chr1731390 582 264 ----11242
NM_002156chr2----179 --
NM_002158chr233304 2801 2647 11299 1699 --
NM_002202chr531077 436 345 ------
NM_002210chr243205 1378 314 177 22447 471 ----
NM_002214chr794964 4905 4625 3648 2064 1848 1743 635 188 --14111 --
NM_002227chr131018 844 134 ------
NM_002230chr1721000 769 --3833 702 422 2811 54
NM_002232chr151383 994 951 851 87 ------
NM_002235chr1261430 440 378 221 89 83 2593 136 ----
NM_002241chr152842 2779 911 791 166 32944 2513 467 12133 --
NM_002247chr101521 --1262 --
NM_002264chr383337 3222 1697 1556 1345 631 624 173 11598 2589 464 --
NM_002265chr1721161 796 ------
NM_002267chr1332049 746 293 ------
NM_002269chr61372 1386 --147
NM_002270chr533767 244 44 13533 14392 --
NM_002271chr1351822 1728 807 583 576 ------
NM_002285chr263939 3354 3184 1016 679 368 --14013 1218
NM_002290chr62976 363 11104 ----
NM_002293chr172710 2531 2338 1829 1085 711 90 11114 1646 --
NM_002296chr131472 1291 41 --1648 --
NM_002298chr132273 248 --31543 1078 65 11590
NM_002310chr585281 5249 4605 2118 1254 890 460 22 56427 5683 4595 4238 4134 --11979
NM_002336chr1264797 3405 749 722 549 455 33680 1930 1848 ----
NM_002355chr123558 122 84 1950 1197 --
NM_002356chr611008 1840 11044 --
NM_002374chr253586 2936 2796 2764 2695 ------
NM_002384chr182638 166 1879 ----
NM_002387chr565051 3680 1497 1450 461 194 21609 403 --14121
NM_002479chr12536 235 ------
NM_002481chr1137742 6813 5898 3165 2296 2085 1735 1637 1548 1224 378 134 65 47369 6644 6035 5076 23007 1704 1438
NM_002485chr851900 1731 581 375 55 ------
NM_002501chr1974122 3908 3263 2959 1439 609 190 --21500 558 23293 1451
NM_002505chr661030 605 484 472 407 222 21493 53 --11090
NM_002522chr1753269 2887 1160 988 908 21590 1316 21181 1170 11554
NM_002524chr12825 104 ------
NM_002527chr121118 ------
NM_002545chr11125007 4840 4542 4447 4177 3621 1758 1503 1480 894 165 115 13651 ----
NM_002577chr343439 826 814 380 2588 208 --13730
NM_002581chr9115030 4295 3872 2272 2181 1698 1428 1240 1171 792 316 23750 1098 24228 699 14713
NM_002588chr51543 --11095 --
NM_002613chr1675115 4097 3952 3454 1813 973 80 --44502 4326 1265 722 --
NM_002639chr186857 822 465 395 86 71 1505 ----
NM_002644chr111152 ----21677 47
NM_002645chr1122397 1019 32287 1143 583 12921 --
NM_002649chr731705 1437 642 1113 11177 --
NM_002651chr14737 596 196 36 ----2276 259
NM_002655chr844943 4370 918 543 --1803 --
NM_002657chr20123549 3388 3059 2877 2755 1390 836 695 230 165 122 96 1179 23704 374 --
NM_002687chr1421253 286 ------
NM_002709chr222367 2271 12459 ----
NM_002711chr7--1787 --1829
NM_002715chr52959 849 --1839 --
NM_002716chr1183628 3526 3462 3092 3064 1332 873 327 23590 623 23687 2602 --
NM_002717chr81106 ------
NM_002726chr6------1471
NM_002731chr131247 1095 337 ------
NM_002734chr173903 893 591 ----12175
NM_002736chr751661 1567 1352 627 350 --11716 --
NM_002737chr17155909 5753 5400 5082 2020 1996 1976 1912 1789 1696 1071 1033 825 760 258 46344 6052 5168 5118 22368 1813 --
NM_002738chr161739 1137 --11016
NM_002740chr322184 197 ------
NM_002745chr2294235 4024 3471 3086 401 251 188 182 88 14394 44468 4124 4112 3485 21115 574
NM_002752chr52402 217 2556 462 ----
NM_002765chrX41037 1014 554 178 --1381 1961
NM_002814chrX2289 184 1742 ----
NM_002819chr1961288 1007 949 908 579 52 ------
NM_002823chr21483 ------
NM_002830chr21133 ------
NM_002834chr122667 21 11123 ----
NM_002839chr973284 2991 2786 2453 1236 777 161 12264 ----
NM_002841chr3180 ------
NM_002843chr1143222 2989 1380 1082 11057 ----
NM_002844chr631369 1354 460 ------
NM_002849chr122897 163 172 --1720
NM_002850chr1921191 830 ------
NM_002857chr1132548 2537 2505 2489 2123 2070 1776 1748 633 605 352 246 172 12044 1514 11912
NM_002858chr141365 421 361 29 ----11195
NM_002868chr1251938 1757 1671 468 163 22076 344 ----
NM_002869chr1142196 1808 235 103 --11435 2796 31
NM_002880chr35763 607 127 101 22 1684 180 --
NM_002886chr395183 4804 4265 4235 4153 3416 3379 3326 1068 24527 553 24327 1578 11353
NM_002890chr52113 60 ------
NM_002892chr1421597 126 --11477 --
NM_002906chr1121521 208 ----11893
NM_002918chr192895 89 ------
NM_002938chr491785 1538 1403 1354 771 278 235 163 57 11871 ----
NM_002941chr32281 251 ------
NM_002945chr172594 262 ------
NM_002953chr12588 582 1537 ----
NM_002955chr63674 656 217 ------
NM_002956chr123541 375 85 11183 ----
NM_002959chr1144032 3645 3314 3300 3159 2833 2763 1692 1198 1192 1068 583 388 76 13432 ----
NM_002994chr42126 43 21664 612 ----
NM_002999chr2081562 1485 1376 1369 1189 325 274 116 1143 ----
NM_003001chr152293 2130 779 126 78 2678 627 ----
NM_003012chr842973 2741 1951 458 22349 1272 --12198
NM_003013chr44814 577 106 63 --138 --
NM_003028chr973640 3189 2894 961 935 832 366 33600 2719 287 --1144
NM_003034chr1277518 7279 6845 3214 2756 2350 1592 2874 280 --13193
NM_003042chr361759 849 804 742 237 115 ------
NM_003043chr383526 3370 3360 3213 3014 2789 921 526 54005 3724 3250 1461 1331 23182 2696 --
NM_003045chr13164672 3781 3490 3384 3331 3246 3215 2022 1755 1432 1307 1240 752 568 557 185 --2767 203 --
NM_003051chr141772 1646 626 453 --1309 --
NM_003060chr551137 1026 413 193 84 ----1896
NM_003069chrX1223 ------
NM_003070chr93825 342 229 ------
NM_003072chr19296 41 ------
NM_003076chr1221185 101 11163 31091 367 262 --
NM_003081chr2021020 824 ------
NM_003096chr21176 ------
NM_003108chr2116304 4472 2880 2860 2561 2454 2208 2109 1828 787 521 --16822 24857 439
NM_003112chr742834 2521 132 27 ----1764
NM_003113chr22574 314 --1168 --
NM_003127chr9------1233
NM_003137chr662087 1785 1397 898 652 111 ------
NM_003144chr621997 747 22209 2180 --1580
NM_003150chr1751939 1926 945 903 114 12398 ----
NM_003155chr842238 887 774 325 11118 --11805
NM_003161chr1753507 1038 953 443 97 13402 1128 --
NM_003162chr2----1979 --
NM_003174chr101294 1121 ----
NM_003179chrX41093 984 578 418 1893 31369 463 365 --
NM_003184chr82742 426 137 ----
NM_003189chr142558 1049 558 64 --33290 2299 600 12585
NM_003199chr1865150 4827 1055 925 850 704 1247 ----
NM_003202chr571644 1615 1258 1192 614 345 329 ----1248
NM_003211chr1251084 669 634 228 106 ------
NM_003215chr471536 1405 1327 457 166 154 138 11052 ----
NM_003216chr2263340 3155 3031 1165 1107 351 13010 22965 782 --
NM_003217chr1251620 1382 1292 681 311 11980 ----
NM_003220chr681602 1561 585 473 467 165 77 61 ------
NM_003234chr332126 2052 51 21814 512 11689 22311 241
NM_003239chr143776 435 122 11064 1392 1236
NM_003242chr342359 2114 1980 980 12130 --1432
NM_003246chr1541433 786 432 275 ------
NM_003247chr62728 92 --1171 --
NM_003253chr2161746 1698 1682 1554 1462 613 ------
NM_003262chr363679 3468 3211 1277 894 643 21702 1015 ----
NM_003269chr63153 120 88 ----1533
NM_003274chr2131193 96 84 1507 ----
NM_003298chr3136101 5190 4925 4855 4362 4318 4001 2483 2264 1592 1389 1007 872 34559 698 44 --1783
NM_003337chr561584 1197 631 480 421 129 ------
NM_003340chr421162 180 ------
NM_003342chr1763089 2315 1283 859 281 239 ------
NM_003347chr2272108 1783 624 592 538 58 22 11860 ----
NM_003348chr1231321 471 123 --11600 --
NM_003350chr81105 1895 ----
NM_003359chr431283 845 50 1495 ----
NM_003363chr31546 ------
NM_003368chr11121 ------
NM_003369chr1132604 1111 244 1427 11753 --
NM_003371chr942126 346 70 51 ------
NM_003374chr52642 161 2635 263 1124 158
NM_003380chr101272 ------
NM_003387chr262464 1985 719 684 509 216 12263 1200 --
NM_003389chr94494 353 218 149 ------
NM_003390chr111244 ------
NM_003409chr1811285 --2924 446 --
NM_003410chrX52216 1943 1218 992 519 --11031 12606
NM_003412chr322633 1099 1966 12620 22682 1088
NM_003417chr19139779 9337 8905 8567 7555 6198 6148 6072 3341 2195 772 141 68 28752 6248 36819 6658 2505 17171
NM_003439chr773158 2811 2491 1410 1070 946 55 33324 1368 1342 23465 2571 12228
NM_003458chr3113992 3786 3395 3256 3176 2871 2465 1151 886 535 266 --12544 1336
NM_003468chr243903 3261 2793 877 13982 --14214
NM_003470chr1661561 642 548 424 96 83 11441 ----
NM_003478chr1132972 2940 2378 --22512 386 --
NM_003483chr1232879 2205 2196 ------
NM_003488chr172965 741 ----1104
NM_003498chr1642765 2008 1108 809 32389 2001 1803 1189 --
NM_003507chr231266 546 391 ------
NM_003557chr12586 305 11601 1243 1600
NM_003566chr122933 924 ------
NM_003574chr1894944 4674 4484 4243 4188 3984 3842 2038 317 ------
NM_003576chr1342374 1841 217 143 1282 32018 1133 1047 --
NM_003583chr1253228 2978 2637 857 548 23928 209 1415 --
NM_003589chr1331398 204 192 ------
NM_003590chr261289 1224 702 353 183 122 12476 --12818
NM_003603chr432110 2022 1849 ----21514 334
NM_003607chr183876 3701 3365 3050 2918 1412 866 769 1405 --12847
NM_003618chr21104 ----132
NM_003629chr1113503 3391 3200 3160 3104 3078 2727 1386 1209 608 185 1651 ----
NM_003632chr174737 305 111 29 --1838 --
NM_003633chr511870 ------
NM_003644chr17166070 6027 5450 4859 4704 4594 4485 4468 2435 2352 2066 2017 1804 1212 858 358 24238 136 1378 --
NM_003651chr121215 164 1597 --
NM_003654chr112597 244 ------
NM_003655chr17----1489 1716
NM_003658chr112836 85 ------
NM_003659chr21277 ------
NM_003663chr322770 960 43447 3318 2551 1039 1492 --
NM_003670chr351357 1266 1078 440 382 ------
NM_003671chr952767 2556 2229 748 37 12238 23183 707 22703 350
NM_003686chr1------164
NM_003709chr22311 78 ------
NM_003735chr51543 --11095 --
NM_003736chr51543 --11095 --
NM_003743chr282170 1925 1917 1896 1829 1803 520 108 21774 1669 --21851 619
NM_003749chr132973 595 ------
NM_003750chr102971 292 ------
NM_003759chr464028 3693 2866 1043 366 53 14010 1568 1602
NM_003760chr1------1566
NM_003766chr171173 ------
NM_003769chr12173 ------
NM_003791chr161106 ------
NM_003795chr62194 108 --1492 --
NM_003816chr821420 33 ----1503
NM_003825chr1541202 430 277 71 ------
NM_003831chr1861706 1603 1488 1202 466 21 21555 538 --11235
NM_003845chr12----179 --
NM_003861chr1462744 2720 2690 2500 913 537 --12447 --
NM_003872chr25934 806 649 600 38 42282 2254 396 116 12322 --
NM_003877chr123931 343 337 1652 1181 --
NM_003887chr231840 1782 681 ----1419
NM_003888chr1531336 1265 388 ------
NM_003902chr13792 692 245 ------
NM_003909chr832261 2098 694 31877 909 871 ----
NM_003913chr6104127 4000 3785 3054 2984 2959 2845 1324 750 98 ------
NM_003924chr431593 1490 666 --11277 --
NM_003934chr911019 ------
NM_003939chr1043356 1650 324 215 14156 24028 2957 --
NM_003941chr772460 2317 2193 1970 1962 1912 1663 1950 ----
NM_003953chr142857 2791 1131 369 1297 1941 --
NM_003966chr567717 6424 6291 5715 5516 2387 36307 1677 767 46217 3079 1168 85 --
NM_003971chr171213 ------
NM_003987chr1042085 1770 643 28 ------
NM_003988chr1042162 1847 720 105 ------
NM_003994chr1264006 3709 3057 3049 1622 1611 22895 163 1387 1346
NM_004016chrX32498 1021 730 1750 1819 --
NM_004018chrX32498 1021 730 1750 1819 --
NM_004021chrX32498 1021 730 1750 1819 --
NM_004022chrX32498 1021 730 1750 1819 --
NM_004023chrX32498 1021 730 1750 1819 --
NM_004024chr12618 22 ----3581 462 305
NM_004035chr1764921 4883 4636 3148 1476 150 31240 929 220 --134
NM_004036chr21237 ------
NM_004050chr1442317 1062 662 242 2998 690 12472 11102
NM_004056chr82314 100 ------
NM_004077chr1221341 927 11136 1295 1905
NM_004081chrY1227 2710 542 11649 --
NM_004087chr31416 1214 --11934
NM_004089chrX2164 59 11229 --1341
NM_004093chr1352769 2132 891 622 600 --1480 --
NM_004094chr1462743 2695 2474 1961 884 81 --1297 --
NM_004096chr1032002 1545 1445 ------
NM_004097chr24824 747 577 322 ------
NM_004099chr922042 803 1816 42074 1949 429 407 --
NM_004100chr622005 148 22405 135 ----
NM_004112chr1741758 1480 1216 403 11491 11380 --
NM_004113chr352004 1793 1663 756 74 ------
NM_004124chr1453176 2806 2216 1270 704 1553 22202 236 --
NM_004132chr101470 1276 31092 94 85 1335
NM_004162chr321030 881 ------
NM_004170chr921398 509 --1128 11301
NM_004171chr11128360 7368 7150 6864 6542 3392 3363 2873 2032 1862 1753 1252 19305 38762 6036 366 27015 466
NM_004172chr541689 655 593 87 1388 --1745
NM_004181chr4186 ------
NM_004200chr1142158 1038 390 198 --22763 314 11188
NM_004227chr742655 2586 2013 1949 42397 506 450 290 52320 2285 812 215 122 --
NM_004229chrX22260 69 --2698 571 --
NM_004231chr72270 39 ------
NM_004232chr1843889 3700 3595 2601 23224 1439 ----
NM_004236chr15------1198
NM_004238chr21310 ------
NM_004274chr1453078 2831 2482 1156 305 1398 --13194
NM_004280chr6----162 --
NM_004287chr1772406 2294 2246 2224 2010 851 748 --11997 --
NM_004293chr923347 596 1908 23851 472 12819
NM_004295chr1751245 1216 1013 514 171 1490 1926 --
NM_004311chr105851 503 323 157 108 1784 ----
NM_004319chr143127 1182 866 165 11263 --1765
NM_004323chr962076 2053 1951 550 521 87 --1362 22390 671
NM_004331chr821016 130 ------
NM_004342chr731481 485 175 32002 1986 359 --11640
NM_004349chr851268 1014 1008 959 131 ------
NM_004365chr51313 ------
NM_004385chr52263 227 ------
NM_004393chr322062 799 1475 21804 901 --
NM_004397chr1164188 3901 3484 2979 2854 887 54138 3203 1491 1151 482 ----
NM_004423chr362658 1946 1018 896 654 123 11907 2752 711 12079
NM_004427chr14784 467 313 274 --2771 428 --
NM_004429chrX11336 ------
NM_004430chr862315 1978 1934 1030 293 36 ------
NM_004432chr921479 371 12028 ----
NM_004437chr172562 2523 2400 1081 744 297 173 12216 33534 694 96 --
NM_004438chr252576 2550 2199 1065 546 22929 2142 22649 2155 --
NM_004450chr142272 114 ------
NM_004454chr312177 1542 ----
NM_004458chrX--32343 1045 389 12313 161
NM_004459chr171346 --1539 --
NM_004464chr434164 215 97 23116 1409 22897 64 --
NM_004468chr12609 141 ----2238 124
NM_004475chr173982 49 26 ------
NM_004481chr132664 2555 262 --1822 --
NM_004491chr1974153 3559 1679 1550 713 311 253 12691 ----
NM_004494chr131070 292 198 ------
NM_004499chr52174 166 ------
NM_004500chr1431426 1417 100 ----2756 535
NM_004501chr123669 1609 ----13524
NM_004506chr62595 507 ------
NM_004514chr1752851 1897 1032 1026 610 43014 2064 1169 499 ----
NM_004537chr1221497 1029 11526 ----
NM_004549chr1121071 23 1415 1621 --
NM_004554chr14101670 1589 1380 1345 741 636 589 402 357 282 --1365 --
NM_004571chr21153264 3104 3057 2922 2844 2667 2623 2403 2397 1314 1154 984 924 661 361 --13255 --
NM_004575chr431250 1200 99 1416 31166 269 21 --
NM_004586chrX75157 4590 3465 2088 1732 1359 1251 13798 15376 14167
NM_004588chr1153717 3555 3413 929 553 12697 32950 718 375 --
NM_004602chr2021095 93 ------
NM_004612chr933705 2975 451 1606 33937 979 38 --
NM_004626chr113736 729 108 ------
NM_004643chr142820 620 ------
NM_004645chr172835 646 --1672 --
NM_004656chr371222 1026 949 812 774 506 118 ------
NM_004660chrY42209 1530 667 215 1188 ----
NM_004664chr12------165
NM_004673chr11452 --11019 11498
NM_004684chr4130 ----159
NM_004685chr1343011 2850 2574 185 32910 2891 2143 ----
NM_004703chr1742008 967 407 137 12263 21712 226 11835
NM_004719chr1211019 12011 --22782 2056
NM_004725chr10----1433 --
NM_004726chrX85331 4496 2225 1150 1131 979 570 374 12188 15095 --
NM_004734chr1312678 41990 1193 673 559 13177 12162
NM_004736chr141785 132 85 74 11535 ----
NM_004738chr2072452 2111 1048 1007 970 693 476 ----11964
NM_004742chr311699 ------
NM_004745chr8125499 5435 5201 5064 4794 4389 4365 2101 1409 1402 1356 1202 35774 5021 1106 11651 34911 4874 644
NM_004748chr1553165 2998 2970 2618 1154 24072 98 13135 --
NM_004760chr732490 2435 1993 --11588 22068 272
NM_004781chr131608 270 254 2393 342 ----
NM_004781chr131608 270 254 2393 342 ----
NM_004796chr14--1854 21571 337 1747
NM_004804chr252748 2283 864 689 188 --1124 12779
NM_004808chr1053154 2680 2188 2114 961 21317 22 ----
NM_004811chr112490 146 --127 --
NM_004815chr133671 3454 1710 54937 4121 3442 3393 832 --11982
NM_004817chr93268 121 86 2227 171 ----
NM_004818chr122558 83 162 ----
NM_004822chr1764005 3482 2887 1337 965 285 1810 ----
NM_004834chr233010 311 242 --22593 34 1319
NM_004840chrX3519 350 35 --1340 --
NM_004845chrX83963 3813 3727 1565 1473 1151 553 240 --23918 810 12690
NM_004850chr231757 246 49 ------
NM_004856chr154484 395 100 80 ------
NM_004857chr1431796 883 128 23641 1134 13090 1108
NM_004859chr171856 ------
NM_004862chr1631549 1273 1243 --1108 11422
NM_004863chr1495107 4907 4209 3296 1765 1311 988 771 456 175 13387 --
NM_004866chr584349 4009 1753 1660 1585 1132 1026 50 35029 4749 3914 --11958
NM_004869chr18185 --1127 --
NM_004873chr1443125 2773 2175 529 2338 331 --11104
NM_004874chr82193 113 ------
NM_004884chr1541457 668 631 589 --122 --
NM_004893chr54389 226 145 45 ------
NM_004898chr452918 2530 572 484 92 2866 513 1312 --
NM_004902chr202770 270 1333 ----
NM_004904chr731794 471 236 25679 1073 16098 --
NM_004912chr731694 1330 118 ------
NM_004926chr1431673 415 34 ------
NM_004937chr1752624 2535 1913 668 254 12008 ----
NM_004952chr12849 706 --1713 --
NM_004956chr794457 4221 3912 3659 3057 3043 2921 1302 891 44374 3330 3203 1662 13029 12816
NM_004965chr21156 ----1109
NM_004966chr101144 1893 1242 --
NM_004969chr10152 ------
NM_004976chr1195037 4563 3783 1923 1637 855 690 414 35 --34426 1829 649 --
NM_004978chr131534 1250 420 ------
NM_004985chr1253186 2956 1725 1531 1323 13343 ----
NM_004992chrX168275 8166 7230 7213 6686 6495 3375 3021 3011 2804 1708 1347 1311 936 644 154 48363 6300 5843 2145 47755 6849 5744 1575 36155 6137 2612
NM_004992chrX168275 8166 7230 7213 6686 6495 3375 3021 3011 2804 1708 1347 1311 936 644 154 48363 6300 5843 2145 47755 6849 5744 1575 36155 6137 2612
NM_004995chr142433 240 ------
NM_004999chr663794 3007 1283 728 486 315 31005 586 578 --23154 1374
NM_005010chr72809 652 --21774 843 2451 37
NM_005016chr12189 ------
NM_005017chr3------151
NM_005020chr73570 515 180 ------
NM_005023chr52377 303 11217 ----
NM_005028chr1072364 2187 1707 1696 729 341 130 41684 1601 809 517 ----
NM_005032chrX165 ------
NM_005045chr71969 ------
NM_005056chr1285051 4910 1725 1169 1155 1042 913 528 15427 25068 362 1109
NM_005057chr131898 1544 735 1564 ----
NM_005063chr1063526 2886 1383 976 470 120 1889 1371 --
NM_005066chr12617 26 ------
NM_005088chrX2880 210 ------
NM_005093chr20125071 4606 4481 4294 4188 4181 3948 3405 1775 1452 745 545 11304 23935 1095 24457 3580
NM_005095chr122131 1375 11770 --1232
NM_005102chr23864 813 200 ------
NM_005109chr342247 1972 694 659 ----1636
NM_005110chr52534 46 --1283 --
NM_005116chr20124171 3816 3587 3459 3390 3056 2866 1713 1630 365 311 261 23663 3125 23848 358 --
NM_005121chr1752706 1297 1131 894 265 ----23333 377
NM_005148chr173423 378 33 --1117 1109
NM_005154chr151528 ------
NM_005156chr994350 4078 3961 1976 1902 1702 1567 331 232 24607 871 156 --
NM_005168chr251513 1316 1176 549 476 ------
NM_005190chr621163 71 --11015 --
NM_005197chr1496197 6046 4484 4390 4342 2061 1693 1587 309 1938 ----
NM_005206chr1721433 126 --1985 --
NM_005207chr2273649 2571 2553 2532 1261 822 803 --12608 12471
NM_005220chr1741337 526 317 154 --2228 137 1281
NM_005235chr2116554 6410 6176 5181 3124 3039 2946 2549 2538 2296 1260 ------
NM_005238chr1142849 535 511 122 1104 12758 --
NM_005241chr31298 ------
NM_005245chr41159 ------
NM_005254chr1511286 ------
NM_005257chr1851007 402 231 216 79 2375 256 ----
NM_005259chr221097 216 ------
NM_005263chr14362 332 233 108 1462 ----
NM_005264chr10187 ------
NM_005271chr10--1429 --11190
NM_005276chr1241791 1650 1390 1374 --1239 21326 88
NM_005276chr1241791 1650 1390 1374 --1239 21326 88
NM_005308chr101504 ------
NM_005311chr731953 941 918 22507 953 1832 --
NM_005324chr1731901 1438 720 11705 --21759 770
NM_005329chr16112178 1979 1952 1870 1748 1646 1488 1472 768 602 233 2835 558 1287 --
NM_005334chrX41499 1146 468 49 --21550 35 --
NM_005336chr261846 1667 478 442 259 28 --21526 174 --
NM_005338chr7104011 3918 3692 2878 2770 1622 1353 1341 738 233 --43408 3125 821 714 --
NM_005339chr443542 3385 558 323 1535 24071 1080 --
NM_005342chrX42133 2047 1053 557 22115 2055 --1152
NM_005347chr951448 1339 1326 1063 489 ------
NM_005349chr41569 ------
NM_005359chr18116370 5952 5293 5179 5114 4192 2035 1619 612 595 279 14062 --21956 191
NM_005378chr21350 ------
NM_005381chr21404 ------
NM_005385chr352699 2123 829 607 355 11768 ----
NM_005397chr773350 2560 823 466 438 182 23 --21086 43 12434
NM_005399chr163745 3500 1639 1410 1087 121 --33212 1158 596 --
NM_005400chr252652 962 751 374 320 13080 ----
NM_005402chr711469 11199 ----
NM_005406chr1841379 1201 530 114 ------
NM_005409chr41370 ----1424
NM_005410chr54253 141 55 38 ------
NM_005413chr21434 ------
NM_005417chr2061887 1763 1334 723 536 335 11986 ----
NM_005433chr1832511 683 443 12822 ----
NM_005436chr1033716 2652 469 12846 12833 13800
NM_005440chr1742503 2412 434 193 --12745 --
NM_005443chr42498 478 ------
NM_005455chr131633 1439 1238 ------
NM_005458chr932264 2069 353 11590 ----
NM_005465chr132024 1547 186 2459 413 11656 --
NM_005474chr1731164 426 326 21017 987 11279 1177
NM_005475chr1282694 2610 2466 2363 2207 1238 999 93 13315 12400 --
NM_005476chr951095 913 394 341 154 --21077 34 --
NM_005477chr1572620 2377 1851 1007 749 293 57 12026 --12148
NM_005477chr1572620 2377 1851 1007 749 293 57 12026 --12148
NM_005487chr2242016 1418 1367 80 11319 1387 --
NM_005497chr17126140 5936 5770 5716 5375 4809 4470 3963 2238 525 244 103 22069 934 12294 --
NM_005506chr421090 553 32675 988 571 12638 1294
NM_005520chr51192 ------
NM_005523chr71576 ------
NM_005563chr15754 677 256 140 134 ------
NM_005578chr334570 3654 1646 33914 858 619 1956 --
NM_005596chr9116178 5300 4553 4312 4140 2345 1444 1334 928 680 423 14324 11629 15247
NM_005603chr1851852 1562 822 669 455 ------
NM_005604chr642153 2110 2066 1745 ------
NM_005611chr1641120 831 160 64 ------
NM_005613chr162189 1949 1889 1669 207 87 --2404 397 --
NM_005614chr71347 --2889 144 --
NM_005630chr331936 1903 274 11945 130 11604
NM_005638chrX11512 11583 2196 152 --
NM_005639chr1261908 1807 643 456 354 94 21615 1314 ----
NM_005655chr83509 477 265 ------
NM_005668chr574328 4172 4100 2897 1375 1008 473 --24341 779 --
NM_005707chr1541140 493 289 43 ------
NM_005715chr682723 2468 2444 2046 1910 880 590 375 22082 43 1412 11777
NM_005717chr13977 945 935 ----11312
NM_005719chr12150 --129 --
NM_005721chr2----1862 --
NM_005722chr222088 1874 2923 547 --182
NM_005730chr1283209 2920 2725 2466 1121 619 564 509 13674 1481 --
NM_005732chr531067 245 223 31477 1266 1178 1932 --
NM_005738chr731737 1321 583 ------
NM_005739chr1521507 400 ------
NM_005742chr22635 59 1782 122 --
NM_005746chr732337 1809 145 ----12102
NM_005748chr1252972 2629 1046 906 187 23068 2520 ----
NM_005759chr274659 1839 1628 1438 916 519 81 41574 1378 951 309 14722 --
NM_005760chr2198 ------
NM_005766chr1361385 1225 1082 978 482 196 ------
NM_005768chr121123 ------
NM_005775chr82486 276 ------
NM_005785chr1271686 1604 1434 1261 614 290 56 1302 --1461
NM_005789chr1742080 1496 598 577 11930 21486 253 --
NM_005795chr253026 2256 2125 2000 317 ------
NM_005797chr114586 224 135 89 ------
NM_005798chr1364852 4666 3362 1552 1106 67 --12061 --
NM_005802chr91721 ------
NM_005808chr343532 2834 1396 456 23181 519 1111 --
NM_005822chr671922 1801 1771 769 748 584 558 11899 ----
NM_005826chr1----149 --
NM_005828chr1773654 3474 3204 926 912 141 87 33334 3283 1687 --13988
NM_005832chr3----1579 --
NM_005840chrX137640 7575 6810 4718 2316 1951 1866 1439 890 607 444 206 23 26120 2162 36530 5960 1922 --
NM_005843chr241420 505 278 258 11611 11702 --
NM_005857chr121108 62 ------
NM_005859chr511050 ------
NM_005871chr103371 345 129 ------
NM_005876chr22315 67 ------
NM_005884chr193668 585 162 1635 --1273
NM_005885chr541632 1281 469 137 11163 --11420
NM_005898chr1192643 2101 1245 1231 957 916 724 509 483 ------
NM_005901chr1877309 6920 5763 5672 3012 2334 1928 35806 1285 196 ----
NM_005902chr15114044 3995 3301 2945 2857 1737 1590 1104 887 528 481 14179 1911 --
NM_005903chr584723 3382 3280 2098 1544 1211 625 584 2408 243 --14859
NM_005909chr574205 4037 3997 2915 2681 1136 694 2767 46 13674 --
NM_005910chr1753889 3329 3030 2759 1325 --23732 2512 --
NM_005911chr231216 593 131 --11036 --
NM_005924chr73386 229 120 --1347 --
NM_005935chr495057 4878 4194 3530 3352 1759 1125 828 70 1289 21772 1229 --
NM_005941chr852701 2686 1453 1040 215 23825 507 ----
NM_005955chr1104415 4284 4105 4059 3523 1015 1008 732 613 127 11824 ----
NM_005962chr1022149 899 1215 --11786
NM_005962chr1022149 899 1215 --11786
NM_005964chr1731469 1232 132 --2310 159 1983
NM_005977chr133953 654 382 2749 200 ----
NM_005990chr542719 1741 1084 1051 ------
NM_005996chr1261236 1068 605 288 277 30 ------
NM_005999chr131506 1478 1274 11579 1283 --
NM_006007chr954471 3121 2905 1056 926 --23749 103 --
NM_006010chr31200 ------
NM_006016chr642149 815 683 558 22127 104 ----
NM_006022chr131149 ------
NM_006036chr222294 297 2988 859 1285 --
NM_006038chr2051896 1874 1365 404 231 11840 1573 --
NM_006047chr2053421 3199 296 80 59 ----1565
NM_006055chr231133 609 465 3513 281 133 --1648
NM_006060chr794116 4093 3670 3610 3357 3323 3317 418 327 1226 ----
NM_006067chr1641046 919 686 27 ----1183
NM_006094chr821598 812 150 ----
NM_006095chr4123735 3017 2885 1626 1571 1429 1280 1019 603 414 140 83 --11440 --
NM_006106chr1142889 2452 1005 414 23078 1131 ----
NM_006108chr1152294 893 749 205 40 11557 134 --
NM_006116chr2251117 1063 481 452 142 11210 --11595
NM_006121chr12129 ------
NM_006135chr151343 952 464 413 23 --11265 --
NM_006139chr252739 2275 1067 711 88 ------
NM_006145chr195286 232 175 133 40 ------
NM_006153chr32578 495 ------
NM_006154chr1521983 1018 22649 1156 ----
NM_006162chr1871545 1467 1251 643 559 93 28 ------
NM_006166chr1232281 2063 1644 ------
NM_006180chr921529 398 ------
NM_006183chr121187 ------
NM_006190chr23386 105 61 ------
NM_006196chr2180 ------
NM_006203chr585211 5099 4884 4442 3843 3718 3549 910 2646 370 ----
NM_006206chr432415 2340 344 32201 880 58 1719 12452
NM_006210chr191282 --1197 --
NM_006224chr1782260 1826 1017 673 584 163 153 118 --22235 2201 --
NM_006243chr11765 --1664 --
NM_006245chr62922 112 ------
NM_006246chr1411009 ------
NM_006251chr552990 2111 910 902 455 12065 ----
NM_006256chr162515 1692 1114 1068 795 191 1826 ----
NM_006265chr841230 973 594 144 1260 11315 --
NM_006283chr884629 4555 4513 3931 3246 3017 1526 1310 33177 202 78 44062 3925 3108 1099 --
NM_006288chr114861 228 140 42 ------
NM_006306chrX45087 4534 3622 731 15212 25839 3846 --
NM_006310chr171872 11250 --1160
NM_006315chr464269 1727 1061 352 326 247 --23575 273 --
NM_006317chr52775 266 --1612 --
NM_006323chr41249 ------
NM_006329chr141277 --1661 --
NM_006330chr821375 1221 ------
NM_006335chr1--159 --1868
NM_006350chr51338 ----137
NM_006352chr12652 391 ------
NM_006367chr13968 430 75 ------
NM_006371chr395131 4442 3795 2094 1702 1658 1349 819 756 14177 24656 442 --
NM_006378chr961341 577 444 389 345 47 ------
NM_006380chr1763644 3537 3455 2789 1045 42 13880 ----
NM_006386chr2231595 834 26 --12335 12133
NM_006390chr121439 ----11259
NM_006393chr1084274 4128 3336 1441 1427 984 941 873 1546 --12923
NM_006400chr12192 ------
NM_006434chr103810 643 256 23276 310 32506 1106 1017 12380
NM_006451chr51916 ------
NM_006454chr4102155 1963 1059 808 760 239 190 122 70 59 1295 ----
NM_006455chr174960 877 634 359 --1921 --
NM_006457chr473797 3425 3148 1409 1385 774 132 12846 23167 3037 --
NM_006469chr121208 619 ------
NM_006482chr1253228 2978 2637 857 548 23928 209 1415 --
NM_006497chr171797 ------
NM_006516chr141494 491 215 129 1148 --1176
NM_006517chrX42298 2120 863 205 12282 22078 153 --
NM_006526chr2032086 1881 1630 --1729 1749
NM_006534chr2063015 2701 2203 450 412 83 --12406 1613
NM_006537chr15150 ------
NM_006540chr861339 633 378 215 60 27 1979 --1600
NM_006544chr1485689 5206 5129 3947 1524 1415 255 61 14640 ----
NM_006546chr17126610 5980 5753 5223 5149 4605 4336 4157 2020 814 336 153 21285 31 34811 4086 280 26229 5396
NM_006557chr931241 459 25 ------
NM_006558chr81202 ------
NM_006561chr1075164 4933 4923 2205 1717 1121 427 34552 1825 958 24425 505 --
NM_006565chr1611150 ----1323
NM_006593chr2------1714
NM_006599chr16118119 7792 7378 6999 5644 5014 2705 2654 2522 655 250 27580 1861 26328 5569 11325
NM_006602chr203551 174 132 ------
NM_006603chrX31578 760 648 2639 412 11440 --
NM_006609chr22973 256 22248 1914 ----
NM_006612chr171465 ------
NM_006614chr362686 2564 2289 1362 1025 187 1118 ----
NM_006621chr151289 821 676 532 217 11407 1418 --
NM_006629chr1882045 1035 680 669 494 326 183 67 ------
NM_006646chr1332356 2323 791 22010 1123 ----
NM_006650chr583649 3555 3487 2656 1500 1202 911 365 13268 33319 2497 2433 22642 2590
NM_006654chr1284278 4031 2986 1271 847 683 562 440 12910 ----
NM_006675chr1283328 3190 3012 2954 2856 2536 2283 1116 --2279 88 --
NM_006682chr762552 2318 2145 1985 576 58 1926 123 --
NM_006696chr5181 ------
NM_006706chr51221 ------
NM_006708chr641205 935 845 119 132 21199 263 --
NM_006710chr2------134
NM_006717chr962835 2549 2175 1179 663 79 12450 22608 1235 --
NM_006726chr42449 300 ------
NM_006729chrX115055 4968 4825 4695 4154 3854 3743 2222 2019 1596 1472 23642 962 ----
NM_006731chr9105743 5260 4461 3928 3717 2331 2302 2169 2017 1597 ----12216
NM_006738chr1564172 3751 3185 2912 2848 802 33387 2866 782 14623 --
NM_006742chr1671651 1510 1338 707 488 148 128 --32013 717 605 --
NM_006750chr16167538 7210 7056 6822 6232 5984 5571 3052 3002 2747 2412 2264 1878 636 473 96 57513 6933 2294 926 415 11579 --
NM_006751chr23307 205 116 --1240 --
NM_006766chr852418 1915 1860 480 91 --12440 --
NM_006769chr13744 730 74 ------
NM_006777chrX32263 1980 1970 22297 56 ----
NM_006788chr1831963 1789 225 12099 ----
NM_006818chr12870 718 --2390 356 1270
NM_006819chr111339 ------
NM_006851chr1242681 2087 889 312 2416 104 21164 1079 --
NM_006852chr1752847 1912 826 233 195 --21010 356 --
NM_006854chr721626 34 ------
NM_006856chr121267 --11092 --
NM_006870chr201676 ----1817
NM_006888chr1453178 2764 2406 785 640 --12390 136
NM_006896chr72814 176 ------
NM_006902chr142753 2740 1024 633 1547 2447 437 --
NM_006918chr1135853 4326 699 11355 12086 --
NM_006920chr211496 --11834 --
NM_006922chr232541 733 584 1795 ----
NM_006930chr521881 1774 1513 ----
NM_006931chr1211945 --1804 --
NM_006941chr2231128 186 180 ----2901 746
NM_006946chr114551 531 513 198 ------
NM_006951chr104834 708 642 531 ------
NM_006981chr932888 2595 918 1950 12338 --
NM_006990chr161720 1632 1624 1543 750 723 1579 1714 --
NM_007008chr22617 590 ------
NM_007011chr15116695 6525 5763 5630 4705 2493 1735 1417 824 439 26 34199 2224 2026 42660 1090 841 176 11582
NM_007013chr81294 ------
NM_007026chr171440 ------
NM_007027chr3----1119 --
NM_007034chr12825 229 1417 ----
NM_007038chr2144459 2421 771 103 45807 3904 1344 517 1916 --
NM_007039chr141294 21977 619 --12037
NM_007042chr372498 2078 1763 1698 784 463 137 22394 609 ----
NM_007050chr20167502 7210 7033 6578 5898 5719 5275 3037 2897 2799 2611 1785 1740 1652 484 33 35782 2604 2218 37700 7403 2531 16096
NM_007052chrX2169 50 ------
NM_007054chr543824 3003 1416 1281 1905 12984 --
NM_007064chr32562 503 31433 249 200 ----
NM_007067chr1751441 1342 1223 1084 418 ------
NM_007078chr1062774 2691 2224 1118 789 182 12979 2560 248 1649
NM_007084chr132360 224 11066 ----
NM_007106chr131929 2423 92 1260 181
NM_007111chr13129 ------
NM_007114chr343005 2528 715 685 ------
NM_007125chrY2164 43 11241 1585 1197
NM_007137chrX85240 4439 4088 3916 1954 1626 1099 1051 32220 1560 160 11942 --
NM_007144chr17127 --1403 --
NM_007146chr1742740 2369 2171 509 ----11065
NM_007159chr3------21638 39
NM_007166chr112448 67 ----11000
NM_007173chr1131702 1519 970 1815 ----
NM_007174chr1231682 1671 288 12344 --1160
NM_007178chr123383 133 72 ------
NM_007189chr751557 1509 1209 251 208 --1442 --
NM_007191chr121508 ------
NM_007200chr1564172 3751 3185 2912 2848 802 33387 2866 782 14623 --
NM_007203chr952934 2792 1404 1346 489 13395 23354 1386 --
NM_007204chr12547 154 ------
NM_007235chr122501 43 ------
NM_007245chr16----1816 --
NM_007249chr13109193 8948 8470 7141 7102 3601 3567 2870 1892 1644 57994 7000 5917 2226 1598 17011 17643
NM_007250chrX3239 202 88 1383 ----
NM_007282chr31735 ------
NM_007283chr362841 2813 2244 1892 1205 956 22327 326 32908 2428 752 --
NM_007287chr393205 2753 2733 2405 2305 2137 961 718 657 11214 ----
NM_007288chr393205 2753 2733 2405 2305 2137 961 718 657 11214 ----
NM_007289chr393205 2753 2733 2405 2305 2137 961 718 657 11214 ----
NM_007292chr1764921 4883 4636 3148 1476 150 31240 929 220 --134
NM_007331chr431041 431 239 22634 2309 --11781
NM_007347chr153946 619 331 --22122 1286 --
NM_007349chr71101 ------
NM_007350chr1274397 4148 3776 2824 1779 1522 944 31628 606 497 13478 --
NM_007363chrX1130 ------
NM_012073chr51100 --11022 --
NM_012081chr543255 2719 2330 1467 43500 2306 1476 591 22882 73 --
NM_012089chr11181 11429 --1989
NM_012095chr1023516 2799 22806 1114 ----
NM_012096chr373712 3450 3262 2411 977 653 353 ------
NM_012102chr172071 1949 1781 993 925 764 600 31726 1677 260 1391 --
NM_012104chr1152418 1336 1202 284 174 23702 354 1948 --
NM_012104chr1152418 1336 1202 284 174 23702 354 1948 --
NM_012105chr212143 60 ------
NM_012118chr41390 --1169 --
NM_012137chr152878 2812 2554 982 427 1753 --12747
NM_012141chr1323478 3426 14184 --13585
NM_012158chr1331566 394 117 ------
NM_012164chr9147159 7095 6610 6366 6072 5672 4890 4583 2827 2580 1806 1656 1437 551 25527 4604 25410 1877 12113
NM_012166chr92223 149 --1460 2417 141
NM_012180chr42119 24 --2513 37 --
NM_012193chr11125254 4988 4521 4298 3637 3554 2038 1765 1650 841 431 316 2473 308 24424 3292 35224 2052 1350
NM_012197chr931154 1079 335 ----2232 31
NM_012210chr941427 1152 457 109 1125 --1133
NM_012214chr276302 4294 2506 1716 1702 1661 1507 36083 4751 2402 25540 4302 --
NM_012215chr1021857 1723 2756 451 --189
NM_012234chr342324 1302 956 440 21045 987 1755 1849
NM_012243chr11204 1180 ----
NM_012249chr272641 1115 1098 1010 441 431 394 12599 ----
NM_012250chr1121383 174 ------
NM_012262chr144717 3761 1227 1115 21729 310 ----
NM_012264chr2251954 815 189 150 64 --11750 --
NM_012264chr2251954 815 189 150 64 --11750 --
NM_012281chr761968 1910 802 687 328 181 21784 1772 --1531
NM_012287chr344313 3076 271 255 33372 3156 465 ----
NM_012288chr695536 4620 4049 3751 1604 1053 1022 867 571 25211 661 35268 2265 971 1817
NM_012290chr23589 461 43 11239 ----
NM_012294chr733347 2808 1022 33357 3314 2617 2484 476 12583
NM_012297chr452249 919 772 553 208 1652 ----
NM_012302chr11305 1949 ----
NM_012306chr1293212 2677 2319 2278 1273 1230 898 451 317 12901 33451 1398 30 --
NM_012309chr1154241 4133 3791 1774 1490 33671 1554 888 3843 370 172 21641 852
NM_012316chr1145563 5516 4923 4860 4294 4185 3817 3761 3755 3734 1701 1356 464 364 --1809 --
NM_012319chr181947 1919 11022 --
NM_012330chr101448 ------
NM_012334chr554429 3394 3177 918 67 24385 1081 34146 3260 2906 --
NM_012338chr711266 3891 829 80 --11041
NM_012382chr574305 3733 1582 1507 924 645 120 --13997 14298
NM_012384chr2091942 1839 1774 1648 987 919 673 560 203 --12189 11976
NM_012416chr931048 906 853 1386 --1138
NM_012420chr1062135 1715 1493 753 622 552 21664 375 ----
NM_012425chr1032436 719 30 12688 --21927 1711
NM_012428chr151188 ------
NM_012448chr1762388 1888 1810 948 435 23 ------
NM_012464chr441994 690 303 161 12198 12869 --
NM_012479chr782650 2190 904 748 693 445 362 307 ------
NM_012482chr11662 ------
NM_012486chr1174 ------
NM_013227chr151284 ------
NM_013230chrY21565 466 11704 1530 --
NM_013231chr1453875 3699 2971 1588 755 33487 855 483 23540 476 11613
NM_013236chr2241088 1013 985 505 --1355 --
NM_013255chr7168747 8406 7986 6131 5587 5501 3078 2820 2592 2409 1894 1119 965 528 323 232 58059 6948 5775 883 783 15894 --
NM_013261chr433401 3244 1042 12947 ----
NM_013263chr161135 170 ----
NM_013275chr164749 326 167 156 --1520 --
NM_013277chr123952 351 245 --1109 --
NM_013279chr1141939 349 278 170 1801 ----
NM_013281chr2031152 993 604 ------
NM_013286chr3113459 2934 2444 1459 1322 802 725 520 460 417 336 23502 3353 22896 1066 --
NM_013313chr2283505 2970 2432 1010 771 608 438 242 11164 ----
NM_013314chr10----135 --
NM_013316chr71790 ----11046
NM_013322chr761569 1541 1170 1076 1069 554 1683 ----
NM_013341chr252771 2713 2695 2398 951 --1386 --
NM_013348chr1951002 965 941 479 286 21253 870 21098 1048 11142
NM_013357chr82136 121 --1239 --
NM_013361chr192647 142 ------
NM_013374chr323141 31 22681 1931 --1807
NM_013377chr12------1694
NM_013381chr1242074 949 378 257 1340 1750 --
NM_013410chr13427 294 288 11261 ----
NM_013443chr961136 905 791 421 322 145 ------
NM_013989chr1433526 2059 532 24029 3834 24633 4451 --
NM_013995chrX32330 2265 302 ------
NM_014001chr1721465 1133 --11539 --
NM_014007chr91191 ------
NM_014021chr142902 2303 1114 901 11094 13192 22786 2128
NM_014023chr1032111 1822 1110 22476 1003 --1456
NM_014042chr11135 ------
NM_014048chr1684213 3441 2036 1710 1634 880 704 265 33473 1774 566 21914 259 --
NM_014059chr13------146
NM_014089chr1342235 1629 755 373 11989 11474 --
NM_014154chr32564 470 11501 1255 --
NM_014155chr11106652 6382 5788 5475 5221 5108 4810 2287 1004 291 --11835 16363
NM_014159chr3149 ------
NM_014181chr231884 507 223 12601 11143 --
NM_014183chr202273 218 ------
NM_014190chr451852 1605 1204 1160 382 --1273 191
NM_014243chr421958 1885 ------
NM_014245chr32348 36 ----1181
NM_014250chr2242016 1418 1367 80 11319 1387 --
NM_014253chrX41664 500 457 80 32033 314 265 ----
NM_014263chr1031374 1063 390 11128 11198 --
NM_014264chr4------196
NM_014271chrX----1715 2704 114
NM_014289chrX41398 911 228 193 --11155 1571
NM_014299chr1951788 1469 864 42 36 1463 31764 551 505 --
NM_014309chr2265228 4977 3600 3390 1667 1212 --15149 11871
NM_014325chr1242271 1496 155 125 1759 1814 --
NM_014331chr485367 4849 4758 2146 1593 1424 1095 82 46220 1308 1179 641 11081 --
NM_014332chrX1119 ------
NM_014350chr521174 804 1107 1289 --
NM_014352chr1141088 1016 317 25 11451 31397 611 162 193
NM_014376chr542139 1930 1860 779 12361 ----
NM_014392chr431539 1076 394 ------
NM_014405chr1752328 2162 1801 1541 27 --31700 767 129 --
NM_014417chr192347 157 ------
NM_014421chr4183 --2741 349 --
NM_014423chr595309 4599 4187 4063 3805 3419 2181 994 270 34774 1582 784 14224 14352
NM_014447chr421650 1598 ------
NM_014454chr61803 1104 ----
NM_014456chr1021890 517 21157 617 ----
NM_014472chr103681 605 76 1523 159 --
NM_014488chr111202 ------
NM_014491chr71417 ------
NM_014494chr16----22127 1620 --
NM_014498chr32335 81 ------
NM_014500chrX156 ------
NM_014504chr731817 1505 805 31456 691 79 ----
NM_014554chr1261590 1432 847 642 295 265 ----1557
NM_014562chr23721 309 277 ------
NM_014569chr72233 86 21046 472 11430 11320
NM_014586chr21124588 4505 4387 3530 3453 1706 1604 1234 1126 986 434 231 34277 1780 1504 32999 1767 207 133
NM_014607chr221730 1506 12104 22067 310 --
NM_014615chr1663036 3008 2547 775 468 138 --11350 1147
NM_014623chr6136 ------
NM_014634chr2272730 2667 2649 2635 918 729 700 --1590 13561
NM_014636chr954143 3043 1461 800 757 21520 1320 23786 29 13500
NM_014647chr1642017 1719 906 725 1688 ----
NM_014660chr71955 --2767 724 --
NM_014665chr8103208 3100 2903 2758 2528 2497 1164 968 421 321 --13137 --
NM_014666chr531166 221 170 --1193 --
NM_014676chr131530 604 588 ----1119
NM_014682chr812046 --151 --
NM_014686chr1962389 2252 2220 2106 1688 241 ------
NM_014689chr22460 231 ----1136
NM_014690chr783060 2311 1129 847 807 296 169 126 31942 1231 380 12867 1183
NM_014701chr1572851 2649 1292 1215 360 210 29 --22270 703 32167 2131 844
NM_014702chr663205 3184 3129 3025 2152 131 ------
NM_014705chr7----1700 1736
NM_014709chr22185 90 --1163 --
NM_014717chr191224 ------
NM_014721chr687361 7157 6736 6671 5874 5379 4564 2733 14769 14514 36411 2840 861
NM_014729chr842222 495 279 240 11561 ----
NM_014730chr12114787 4621 4548 4329 4310 3438 1589 1379 1024 436 198 24038 1642 33683 1777 448 23851 3494
NM_014730chr12114787 4621 4548 4329 4310 3438 1589 1379 1024 436 198 24038 1642 33683 1777 448 23851 3494
NM_014733chr53673 357 55 ------
NM_014735chrX51977 1863 1325 756 204 ------
NM_014739chr634064 3329 1162 23316 1645 ----
NM_014741chr1151519 1367 809 711 405 --12073 --
NM_014742chr205613 516 452 240 197 1345 1590 --
NM_014743chr482514 2454 1929 1180 539 394 119 61 12881 21988 386 --
NM_014747chr1155023 4745 4708 4612 4006 3796 3701 1476 1219 1152 1109 1092 753 729 579 15452 52187 1598 1275 1167 342 15425
NM_014751chr832172 854 553 ------
NM_014754chr83730 231 29 --1359 1910
NM_014761chr163824 415 178 --1162 --
NM_014767chr1063334 3089 3074 2702 2311 408 183 ----
NM_014772chr1843602 2469 1068 940 --12360 1828
NM_014774chr132714 2290 87 1197 1682 --
NM_014776chr1252578 2526 2318 1127 62 12052 178 --
NM_014781chr8--21187 456 --1247
NM_014786chr1151152 1125 993 220 45 ------
NM_014788chr943004 2754 2176 749 1628 129 1504
NM_014800chr761104 841 474 216 142 130 ------
NM_014802chr124383 348 218 190 1447 ----
NM_014810chr152821 2772 1328 1202 830 32384 1431 1054 12735 --
NM_014819chr532097 1784 950 2542 507 --1277
NM_014822chr43570 147 71 2124 111 ----
NM_014826chr183876 3701 3365 3050 2918 1412 866 769 1405 --12847
NM_014827chr121553 1444 1102 ----
NM_014829chr562074 1899 842 273 261 210 22048 770 ----
NM_014830chr1263470 3103 2662 1004 508 315 2935 472 23337 1170 --
NM_014832chr1351955 1512 1327 829 260 21686 1523 ----
NM_014838chr2282798 2532 2001 1947 928 804 172 130 22675 2242 11062 --
NM_014839chr122016 71 21682 137 ----
NM_014844chr1484167 4061 3431 3256 1464 849 307 103 21674 169 31371 334 62 --
NM_014848chr155997 913 272 150 85 2546 44 --1382
NM_014850chr364078 3798 1859 1495 1234 236 21895 694 14661 21349 677
NM_014860chr232445 130 29 --1643 --
NM_014868chr123871 798 181 ------
NM_014870chr174525 3733 3364 3044 1521 1322 1062 1736 --1297
NM_014871chr122420 100 1244 ----
NM_014873chr194651 4129 3220 1501 1189 856 522 499 41 24815 1542 13934 33060 547 405
NM_014876chr2221532 39 --2350 122 --
NM_014877chr1797584 7041 5343 5270 5230 1748 1359 960 911 25369 2837 25431 2893 11668
NM_014883chr43648 635 577 --1125 --
NM_014892chr61452 ------
NM_014893chrY1176 21759 484 --11905
NM_014897chr1763261 3124 2811 1255 988 401 11181 2810 781 129
NM_014901chr532281 598 123 --11511 --
NM_014904chr1053796 3568 3159 3055 407 33840 3317 1030 --1309
NM_014906chr1783887 3861 3690 2945 2846 931 308 143 --23803 1166 --
NM_014912chr10--32249 1365 406 11353 1831
NM_014913chr1851498 1077 452 413 135 1372 ----
NM_014918chr1551177 513 500 452 291 ------
NM_014920chr62504 347 23713 1374 1958 12361
NM_014921chr1982576 2552 2444 2206 1950 1148 1128 309 13059 32507 1023 115 --
NM_014924chr1462510 2491 2407 2094 699 62 ------
NM_014934chr1332908 2591 288 22934 28 --1277
NM_014938chr1252369 2243 2004 1626 826 12124 22052 592 1604
NM_014939chr1831155 1085 399 ------
NM_014946chr242768 2409 2224 896 1342 --23067 2856
NM_014947chr172880 2599 2517 2248 2092 391 310 12527 ----
NM_014949chr12688 323 ------
NM_014950chr141142 ------
NM_014951chr1052552 1044 664 585 285 22604 57 --12058
NM_014961chr432072 1378 796 ------
NM_014964chr1751896 1876 1713 959 120 11759 12064 1318
NM_015002chr1262300 1993 1666 1458 843 494 ----22040 64
NM_015020chr1653751 3558 3466 3313 2825 23242 1507 12750 11419
NM_015023chr171656 1570 1179 1171 1154 471 346 --21287 512 --
NM_015026chr1264257 4100 3689 3548 1009 271 14052 --11489
NM_015032chr1332923 2732 972 2916 872 1566 --
NM_015033chr962184 1053 997 742 143 73 33121 3045 903 ----
NM_015035chr20116171 5515 5117 5023 4759 4058 2174 989 964 863 276 35966 1715 133 56554 4719 2231 2209 1938 --
NM_015039chr193565 3552 3500 3212 3063 1300 680 206 199 23009 1240 33407 373 295 --
NM_015042chr1544091 4068 3753 3216 --1175 14077
NM_015044chr1643101 2822 2652 2556 ------
NM_015045chr1021488 442 --1863 --
NM_015046chr962230 2043 1119 191 161 75 21083 938 ----
NM_015052chr71188 --1393 1461
NM_015060chr71195 ------
NM_015064chr1283643 2952 2933 2218 586 507 299 233 136 --12736
NM_015071chr5106454 6286 5734 5703 5274 5244 5233 4006 420 61 --31992 1574 1509 22362 330
NM_015072chr141406 ------
NM_015073chr1931450 801 111 --31832 670 359 2712 375
NM_015075chrX81989 1677 1631 1600 1430 657 623 142 --1281 --
NM_015076chr653303 2826 396 283 48 ------
NM_015077chr17144392 3650 3587 3523 3420 3362 3313 3299 3175 1471 1280 1162 839 622 14230 42859 1877 1657 1509 --
NM_015079chr1562952 2678 2352 2084 742 391 42275 2207 696 623 ----
NM_015090chr1156112 5558 5420 4756 4356 3859 2409 1744 1406 1137 1013 925 875 192 101 35599 4789 2191 1392 11424
NM_015093chr611383 ----1489
NM_015094chr2274116 3586 2855 1884 1737 679 113 14647 21874 783 13481
NM_015107chrX42366 2167 410 242 2604 424 2779 492 --
NM_015115chr41967 1416 ----
NM_015132chr72364 302 139 --11665
NM_015143chr43933 328 210 ------
NM_015144chr1633410 1450 334 23547 2587 ----
NM_015153chr6------1631
NM_015155chr1032482 885 675 11051 --1417
NM_015156chr1431401 419 136 43568 3396 1305 448 33443 2540 339 --
NM_015161chr162516 140 ------
NM_015170chr832330 687 366 22342 400 ----
NM_015172chr151337 1189 1051 244 114 31548 1203 1175 ----
NM_015176chr131474 1426 24 1113 ----
NM_015178chr832309 1856 664 --52130 1904 672 526 321 21873 1710
NM_015184chr33429 260 40 ------
NM_015185chrX52180 1908 1867 593 567 1329 --12354
NM_015191chr1132658 305 64 22105 1832 2875 717 1672
NM_015192chr2052178 963 729 140 41 ----123
NM_015199chr3--32332 2002 188 --12866
NM_015200chr431944 300 51 ----21786 111
NM_015208chr1884054 3969 3584 2834 1610 1201 846 450 12459 ----
NM_015219chr1772560 2210 2097 1604 919 354 129 --22297 1036 --
NM_015221chr103974 532 334 11146 11205 1197
NM_015225chr922588 1003 13176 1756 --
NM_015226chr16103373 3207 2791 2609 2580 2528 1079 923 911 607 --22370 1374 1831
NM_015242chr117526 502 490 228 220 56 26 ----1391
NM_015245chr672720 2344 1957 1708 397 330 235 1261 22211 207 --
NM_015247chr1634998 4311 1932 1929 34948 4588 2021 2202 126
NM_015267chr1251950 1829 1780 1348 878 21642 602 ----
NM_015270chr1252011 1819 1551 866 257 --31634 697 101 --
NM_015271chr421255 702 33785 2989 585 33459 3142 789 13072
NM_015275chr1241973 1890 702 279 ------
NM_015278chr673481 3324 2889 2712 701 664 300 43114 1043 253 105 --1173
NM_015282chr262165 908 657 592 324 143 ------
NM_015284chr152066 2001 1991 1944 1515 41900 1475 558 218 1225 11765
NM_015288chr593820 3025 2693 2511 568 390 323 216 77 ----12533
NM_015296chr131926 ------
NM_015299chr14103108 2896 2714 1573 1180 731 284 97 50 40 --32723 1558 1346 33535 1455 757
NM_015308chr112848 734 ----1355
NM_015310chr8167706 7524 7241 7015 6589 6469 5706 5672 2366 2087 1765 1606 1535 1318 844 492 67999 6240 3328 1881 888 254 36073 5713 2310 11483
NM_015313chr1163805 3553 3406 1724 1373 76 21420 260 --11251
NM_015314chr752069 1615 744 387 126 12148 ----
NM_015315chr533392 3175 2188 ------
NM_015326chr162811 2459 2081 1160 89 25 11090 ----
NM_015328chr7112403 2178 1966 1933 1907 1245 1086 974 930 344 326 --1818 --
NM_015339chr202768 138 ----1185
NM_015344chr821807 809 1363 --11371
NM_015347chr1232786 2082 681 22979 2477 ----
NM_015353chr1762723 2705 2225 1732 688 30 1218 123 12235
NM_015355chr17--1297 --11340
NM_015365chrX64098 3481 3006 1343 1194 1090 33763 2847 1686 ----
NM_015375chr1104834 4536 4436 4365 3576 1983 940 761 398 30 13381 11176 --
NM_015379chr7189 ------
NM_015385chr103810 643 256 23276 310 32506 1106 1017 12380
NM_015396chr31460 ------
NM_015397chr931959 1831 310 ------
NM_015419chrX3954 832 441 ----1823
NM_015439chr63400 347 60 ------
NM_015443chr17----11453 155
NM_015444chr32660 173 ------
NM_015455chr543338 719 412 375 --11372 12962
NM_015460chr371535 1469 1334 811 571 180 39 21936 162 ----
NM_015477chr151858 --1890 --
NM_015488chr251691 1390 1377 1167 569 --21606 267 11577
NM_015497chr15------2894 388
NM_015509chr1221418 562 1497 ----
NM_015532chr153986 775 383 1154 11039 --
NM_015534chr11383 --1171 --
NM_015535chr264044 3612 3061 1291 1083 159 23088 1233 12569 --
NM_015542chr1041045 197 109 64 ----21235 464
NM_015550chr793475 3411 2985 2608 2533 2293 1447 1313 96 12589 --11417
NM_015553chr674722 4417 3901 1925 842 462 275 --1317 13176
NM_015554chr1542477 812 631 26 21947 793 22613 1838 --
NM_015557chr163212 2970 2506 430 283 41 12236 11023 --
NM_015564chr532547 2508 554 33002 2725 607 ----
NM_015565chr2111630 11888 1741 --
NM_015568chr20154287 3477 3453 3188 3001 2967 2951 1685 1369 1095 1009 725 613 120 53 13052 1313 --
NM_015569chr164094 4018 1878 1145 884 721 1563 23436 355 21156 756
NM_015570chr751805 1766 1170 363 190 --21607 1591 --
NM_015571chr631891 952 199 134 12369 --
NM_015575chr232809 2603 2574 --32963 2702 824 12950
NM_015576chr33863 455 25 ------
NM_015577chr531728 235 57 --1229 21617 1171
NM_015578chr1931642 783 279 ------
NM_015609chr172652 2557 2491 2023 1956 1092 831 21068 920 --11038
NM_015610chr762683 1869 1067 490 341 187 ------
NM_015626chr171326 ------
NM_015635chr942097 1902 1369 316 ------
NM_015640chr155211 4215 3279 1894 248 ------
NM_015646chr121179 --1433 --
NM_015651chr941957 1497 1388 191 --21925 79 --
NM_015668chr81159 ------
NM_015678chr131381 ------
NM_015680chr22541 73 ------
NM_015687chr61239 ------
NM_015713chr822312 287 1541 22321 859 21319 757
NM_015719chr193773 215 156 ------
NM_015723chr73681 627 582 ------
NM_015833chr2131856 1468 385 ----2733 60
NM_015844chr182638 166 1879 ----
NM_015846chr182638 166 1879 ----
NM_015847chr182638 166 1879 ----
NM_015855chr112798 771 ------
NM_015874chr41569 ------
NM_015879chr18137753 7729 7512 7441 7110 5857 5448 5310 2780 1776 1560 1066 884 37796 1741 1172 --36127 2415 70
NM_015886chr875172 4944 4873 4560 1660 1560 1533 34701 4108 2049 11366 11147
NM_015902chr81740 ------
NM_015906chr154488 3951 1631 1529 876 34170 1569 735 --11171
NM_015981chr562884 2328 2188 1022 703 429 --1182 --
NM_015984chr11535 ------
NM_016003chr762683 1869 1067 490 341 187 ------
NM_016019chr751008 999 959 97 22 ------
NM_016021chr672405 2333 1129 1065 537 160 152 2883 769 --23013 2291
NM_016023chr811493 --11906 --
NM_016025chr1651253 738 725 567 40 11494 2636 25 --
NM_016041chr171353 ----1121
NM_016045chr2031701 409 232 --136 --
NM_016072chr121416 12106 --1689
NM_016075chr1363013 2957 2571 1048 890 352 2192 158 ----
NM_016076chr132971 2827 1222 126 --1463
NM_016083chr633972 3805 971 22848 61 1190 --
NM_016089chr361990 1472 1422 1364 140 56 11695 32034 1740 1517 --
NM_016099chr82176 28 --185 1462
NM_016100chr202301 164 --134 --
NM_016103chr5122 ------
NM_016107chr541390 1016 356 21 ------
NM_016121chr11994 ------
NM_016125chr171106 ------
NM_016132chr152680 308 12413 ----
NM_016133chr211550 --180 --
NM_016152chr33989 945 41 149 ----
NM_016169chr1051268 1027 973 184 59 21252 555 12602 --
NM_016203chr741044 346 208 129 ------
NM_016206chr3108958 8242 7189 6927 6077 5585 2739 2670 2214 1521 27335 6127 11798 17973
NM_016217chr633297 2906 2517 23692 1436 --1885
NM_016218chr521205 489 ------
NM_016234chr103806 625 227 ------
NM_016248chr1343401 3183 2458 365 53926 3606 2715 2604 1186 12983 --
NM_016255chr643165 2912 2034 111 32526 2297 175 ----
NM_016257chr1112322 2229 1094 1077 1015 680 608 506 468 200 98 11184 63364 3278 3152 2642 2209 415 --
NM_016258chr13735 272 219 --1108 --
NM_016260chr256109 2876 1877 1258 378 42894 1383 789 351 36129 5900 480 --
NM_016264chr195570 466 364 105 46 ------
NM_016269chr411143 ------
NM_016272chr2252779 2555 2085 718 329 32676 2514 125 ----
NM_016277chr621333 667 1156 ----
NM_016281chr122914 61 ------
NM_016289chr242055 1635 422 151 31941 622 227 1915 11664
NM_016297chr283040 2754 2659 2363 873 828 563 320 1665 12971 11364
NM_016315chr221823 330 ------
NM_016322chr952641 2149 2095 2021 230 13140 12594 --
NM_016356chr642753 602 458 360 --12567 --
NM_016396chr1532755 2619 236 ----1962
NM_016426chr2242049 760 639 324 ------
NM_016441chr22912 836 ------
NM_016442chr51853 31721 1616 1499 1893 --
NM_016454chr151243 ------
NM_016492chr17------1131
NM_016505chr12694 610 ------
NM_016506chr112444 80 ----1507
NM_016513chr62504 347 23713 1374 1958 12361
NM_016516chr21639 1740 ----
NM_016521chrX129 ------
NM_016522chr1111287 ------
NM_016525chr94801 680 268 94 --2962 277 --
NM_016530chr15104096 3915 3679 1436 1429 1406 1162 626 371 155 12872 22766 590 --
NM_016542chrX21742 557 ------
NM_016545chr13825 721 594 ------
NM_016569chr1261236 1068 605 288 277 30 ------
NM_016577chr3104304 3551 2894 1810 1733 1715 655 533 521 493 --24224 1500 11250
NM_016578chr111218 ------
NM_016586chr141165 ------
NM_016592chr2031247 545 287 ------
NM_016603chr531777 1764 735 --21785 823 --
NM_016605chr581885 1818 1786 1675 815 708 689 148 --32418 1809 1696 --
NM_016621chr11104353 4256 3964 3827 3749 3576 3335 2889 392 122 1838 33981 3220 1482 24200 68
NM_016626chr1821411 419 ------
NM_016631chr212915 172 ----1157
NM_016654chr1511286 ------
NM_016834chr1753889 3329 3030 2759 1325 --23732 2512 --
NM_016835chr1753889 3329 3030 2759 1325 --23732 2512 --
NM_016841chr1753889 3329 3030 2759 1325 --23732 2512 --
NM_016929chr6104580 3358 3110 1846 1117 824 684 530 144 61 --11671 --
NM_016930chr43398 133 72 ----1831
NM_016936chr1651642 1473 1351 746 261 --11756 --
NM_016952chr1183953 3887 3263 2887 1637 1243 1174 478 33007 1387 1124 ----
NM_017412chr821058 971 1397 11385 --
NM_017415chr574012 3856 1237 1117 799 773 737 1525 43699 3179 1067 821 13156
NM_017420chr1463526 2567 1515 710 626 100 ------
NM_017437chr1441747 566 495 199 1594 --1279
NM_017447chr2164041 3442 2751 1659 1479 169 24052 2931 ----
NM_017452chr2021095 93 ------
NM_017453chr2021095 93 ------
NM_017454chr2021095 93 ------
NM_017455chr151188 ------
NM_017488chr221434 588 ------
NM_017544chrX1375 ------
NM_017551chr1022541 1787 --12673 --
NM_017558chr162479 409 ------
NM_017563chr3136073 6030 5941 5764 5572 5262 4817 4562 4480 4473 4414 2464 341 22473 2309 --25445 2441
NM_017577chr32482 231 --11272 --
NM_017580chr1052318 1903 751 409 358 ------
NM_017590chr2272236 2219 2205 374 297 290 284 12698 1677 1547
NM_017596chr184362 3685 3481 2855 1785 1465 1216 255 --21353 1001 --
NM_017610chr1521305 205 ----1453
NM_017622chr172124 66 ------
NM_017628chr474055 3561 3534 1725 1192 800 386 21798 1389 1163 13324
NM_017629chr141799 435 345 97 11558 177 --
NM_017632chr41109 ------
NM_017633chr642690 647 455 39 23176 1107 ----
NM_017634chr8--185 --11542
NM_017637chr998924 8363 6376 6089 6023 5961 5905 3612 893 43004 2987 2211 1014 38905 2274 1220 --
NM_017643chr1742395 968 456 125 ------
NM_017644chr3124843 4724 4497 4298 3957 3280 1698 1689 1527 1383 1344 494 11844 15041 --
NM_017650chr775948 5488 4621 4247 4084 958 116 44781 3946 1650 1426 35901 732 74 --
NM_017654chr71105 21478 1148 1114 --
NM_017666chrX81872 816 771 563 467 294 222 152 ----2579 281
NM_017667chr71577 ------
NM_017668chr163178 107 23 ----1781
NM_017686chr151086 931 812 779 98 --1435 --
NM_017693chr1341434 1264 1160 180 21352 1233 1142 --
NM_017709chr173267 2926 1498 1433 1274 934 76 --11100 --
NM_017712chr19186315 5874 5848 5777 5385 5133 5045 4827 2531 2406 2166 2123 2101 1311 1002 272 169 96 45622 5008 4924 375 16190 --
NM_017730chr31709 ------
NM_017734chr12485 205 ------
NM_017736chr1652933 2581 2226 650 631 33188 1119 885 ----
NM_017737chr13752 632 568 ------
NM_017740chr1621715 41 ------
NM_017742chr1821227 466 21939 1459 2786 242 --
NM_017744chr142195 2044 780 734 21930 456 ----
NM_017753chr9--1897 --1388
NM_017784chr3126 ------
NM_017786chr82665 196 ------
NM_017791chr1431310 396 52 ------
NM_017794chr91304 173 ----
NM_017798chr2031241 1043 77 ------
NM_017811chr963031 2949 2733 2641 2439 2001 22535 2360 ----
NM_017812chr7142 ------
NM_017813chr865428 5089 4895 4571 2246 1333 14599 25730 956 --
NM_017824chr1042453 2359 1984 615 1801 1280 --
NM_017831chr18124602 4535 4488 4360 4008 3939 3788 3118 1682 1410 1046 788 11392 14513 --
NM_017847chr171857 845 771 607 517 226 33 1207 ----
NM_017848chrX54558 4105 1806 543 351 44581 1287 1272 581 21489 174 1110
NM_017849chr263174 2804 2754 1238 504 288 32693 2109 1991 11202 --
NM_017866chr831071 739 130 1966 ----
NM_017880chr21419 ------
NM_017896chr2073460 3256 2756 2643 2240 977 270 23334 2765 --13017
NM_017902chr10104786 4505 4442 4370 3951 3589 1650 1021 826 553 14142 44921 4456 4325 1155 --
NM_017919chr995519 5502 4712 2302 1932 1825 1183 979 865 33894 3755 426 14591 --
NM_017938chrX41555 814 653 55 22116 683 ----
NM_017945chr3------1883
NM_017948chr92360 96 ------
NM_017952chr284143 3437 3239 1379 1291 1221 984 248 34544 3945 1735 ----
NM_017953chr1136 ----1866
NM_017994chr752967 2851 2487 637 118 1178 2865 284 22035 1037
NM_018010chr331584 1085 509 ------
NM_018014chr22928 148 11193 ----
NM_018015chrX2954 179 ------
NM_018017chr1062192 1976 1165 1138 632 466 --12737 --
NM_018027chr1043086 2985 2077 841 22259 48 12023 --
NM_018031chr32589 254 ------
NM_018036chr1423039 2743 23777 1299 33379 3277 72 --
NM_018045chr162930 2483 2345 2309 595 83 22303 1053 ----
NM_018063chr101354 ------
NM_018067chr11505 ----1571
NM_018084chr222287 54 --12525 12032
NM_018086chr2184 1289 ----
NM_018092chr162502 73 --155 --
NM_018095chr112444 80 ----1507
NM_018121chr1052966 2753 1242 1233 431 --22104 2097 --
NM_018124chr1652295 2188 1754 943 626 21625 101 ----
NM_018125chr12166 71 ----1112
NM_018126chr421581 79 ------
NM_018137chr131290 431 135 --1454 11279
NM_018157chr1222876 385 --161 22419 610
NM_018178chr151999 1791 1370 331 144 ------
NM_018182chr1771726 1455 686 393 277 181 97 ----1432
NM_018200chr1572570 2219 1882 956 398 303 256 12035 12057 --
NM_018201chr921718 28 --22449 607 32012 1960 1951
NM_018205chr1052352 2074 2003 747 534 --32155 1610 361 --
NM_018239chr1052352 2074 2003 747 534 --32155 1610 361 --
NM_018244chr202503 283 175 11190 152
NM_018246chr842664 2158 1904 511 1496 ----
NM_018247chr642585 2532 900 437 2969 889 ----
NM_018254chr151901 1663 220 203 97 --1896 --
NM_018266chr3------1990
NM_018287chr1021303 1120 ----1917
NM_018293chr31582 42772 1913 223 151 --12313
NM_018302chr462458 2302 1973 1687 925 505 32172 1606 843 ----
NM_018319chr1441300 1054 593 585 ------
NM_018323chr4189 ----1298
NM_018327chr2041244 490 194 162 ------
NM_018334chr71182 ------
NM_018351chr1264199 4024 3238 3086 1758 1522 14647 14157 13741
NM_018362chr1173849 3239 2506 1478 1410 798 166 ------
NM_018373chr1496331 5850 4826 4396 4269 3986 3923 1532 1441 1795 26140 1260 --
NM_018374chr784133 4002 3653 3601 1150 871 313 239 1845 13499 --
NM_018403chr333520 3510 2997 ------
NM_018409chr442367 2126 2002 848 22585 352 ----
NM_018440chr8118160 7621 7584 6738 6585 6389 5659 3063 2597 832 458 68565 7953 6978 2791 1497 379 ----
NM_018444chr851783 442 403 126 89 22106 770 ----
NM_018448chr1231221 510 203 2795 181 ----
NM_018451chr132858 796 ------
NM_018469chr1731299 438 375 1255 ----
NM_018555chr1932147 1985 180 21716 107 22096 769 --
NM_018566chr174671 4644 3544 3282 1372 742 505 147 ----
NM_018602chr154594 494 407 218 ------
NM_018638chr1284713 3999 3441 1320 1302 965 838 24 25095 3865 ----
NM_018650chr121512 306 1428 --1851
NM_018682chr71221 ------
NM_018691chr541047 772 193 151 --21020 259 --
NM_018704chr11367 11774 ----
NM_018710chr811228 ------
NM_018715chr142163 1625 867 354 11937 11648 --
NM_018718chr781586 1478 828 498 443 371 226 148 283 47 ----
NM_018837chr203731 186 83 ------
NM_018844chr731667 195 171 31877 800 81 11984 166
NM_018847chr9157 1455 21245 549 --
NM_018912chr51543 --11095 --
NM_018913chr51543 --11095 --
NM_018914chr51543 --11095 --
NM_018915chr51543 --11095 --
NM_018916chr51543 --11095 --
NM_018917chr51543 --11095 --
NM_018918chr51543 --11095 --
NM_018919chr51543 --11095 --
NM_018920chr51543 --11095 --
NM_018921chr51543 --11095 --
NM_018922chr51543 --11095 --
NM_018923chr51543 --11095 --
NM_018924chr51543 --11095 --
NM_018925chr51543 --11095 --
NM_018926chr51543 --11095 --
NM_018927chr51543 --11095 --
NM_018928chr51543 --11095 --
NM_018929chr51543 --11095 --
NM_018945chr653695 3022 1062 357 34 --13443 1270
NM_018947chr794780 4733 4378 4074 3659 3036 1875 1529 96 54950 3617 3313 3065 731 --13649
NM_018948chr121077 59 1364 ----
NM_018958chr1543913 2881 1426 559 53482 3434 2949 1169 331 13263 1126
NM_018959chr193709 269 250 2535 516 ----
NM_018970chr712607 ------
NM_018976chr1282650 2235 1905 1052 1001 941 804 261 21813 514 ----
NM_018979chr1232597 1737 183 21748 1616 1240 --
NM_018981chr231307 1161 1125 ------
NM_018994chr12463 52 --1139 --
NM_018999chr1084335 3687 3148 1865 961 592 466 386 143 1248 --
NM_019001chr384208 4150 3663 1765 1535 1447 1403 435 13785 --13878
NM_019041chr61550 32336 2142 2122 11014 11789
NM_019042chr73959 235 80 21207 978 ----
NM_019045chrX173 ------
NM_019050chr4----12072 22235 739
NM_019063chr272113 1791 1538 593 522 355 33 --11639 --
NM_019071chr74660 225 100 37 --1580 --
NM_019072chr543510 3193 2756 334 13287 ----
NM_019074chr153318 306 284 ----1874
NM_019087chr52125 98 --11481 11468
NM_019094chr1233736 501 143 ----13385
NM_019114chr941762 557 498 80 32403 714 274 12292 --
NM_019590chr1021486 572 1332 ----
NM_019592chr93296 153 139 2853 208 1127 --
NM_019593chr2063162 3116 2840 2208 2055 1102 ------
NM_019596chr2172734 2472 931 718 678 392 161 --12718 --
NM_019604chr11----1245 --
NM_019613chr1731133 278 167 --145 --
NM_019859chr1031478 1039 330 1269 --11018
NM_019860chr1031526 1087 378 1317 --11066
NM_019885chr262359 2133 942 411 210 199 12971 22109 1138 --
NM_019891chr121298 314 1517 ----
NM_019895chr32826 229 --1868 --
NM_020122chr265890 4944 3742 2087 1498 1376 ------
NM_020141chr161701 1471 388 327 255 182 11633 ----
NM_020150chr1042199 1891 1613 410 ------
NM_020159chr41641 ------
NM_020168chr1561224 1200 1163 1056 410 147 11189 1553 11023
NM_020182chr2073208 2961 2936 2848 2279 944 708 13247 23007 2785 --
NM_020198chr1741088 325 214 98 ------
NM_020226chr41573 ------
NM_020239chr142026 1727 295 51 ------
NM_020240chr562488 898 792 425 120 59 --1948 --
NM_020245chr644824 4780 4345 77 24979 1874 --1314
NM_020307chr31121 ----1131
NM_020310chr1752359 2267 2091 264 86 21047 886 1415 12485
NM_020336chr2063790 2978 2814 2799 986 32 23826 1476 13405 --
NM_020337chr42527 51 ------
NM_020338chr10103619 3280 2509 2408 2306 433 421 388 360 348 13351 11432 --
NM_020340chr641936 1658 1601 193 1570 12286 --
NM_020342chr241925 1855 669 581 ----1843
NM_020348chr1082711 2328 1938 954 816 627 175 40 --11875 1397
NM_020357chr3----21368 1312 --
NM_020362chr12281 213 --186 --
NM_020420chrY1227 2710 542 11649 --
NM_020429chr7102713 2494 2302 2245 2237 2082 1901 1233 484 102 ------
NM_020432chr74900 526 255 90 32126 1926 38 ----
NM_020436chr20------150
NM_020438chr931256 429 345 --21097 31 --
NM_020455chr672808 2436 1736 587 338 114 75 1283 --22184 721
NM_020457chr161275 ------
NM_020463chr221240 376 2930 356 ----
NM_020465chr1661978 1845 1785 1564 661 304 --1164 --
NM_020474chr1831875 1795 153 1474 ----
NM_020532chr22617 590 ------
NM_020654chr3------21099 506
NM_020655chr1631491 1007 265 1461 ----
NM_020666chr5--1918 --138
NM_020673chr2086695 6584 5616 5605 1918 1655 1552 209 ----26999 2898
NM_020689chr202533 254 1287 ----
NM_020699chr175317 4967 4711 4673 3843 896 238 14313 --23377 1574
NM_020718chr1676225 5576 4782 2488 1911 909 304 35979 5594 5027 11117 --
NM_020727chr2183734 3541 3211 1534 1452 1032 808 739 13775 ----
NM_020728chr763079 2859 2583 2248 200 29 1392 --12358
NM_020739chr1553165 2998 2970 2618 1154 24072 98 13135 --
NM_020742chrX42323 2303 501 194 11825 1103 11972
NM_020752chr1042443 2257 1108 555 ------
NM_020766chrX84240 3977 3708 3316 3161 1599 987 109 --11069 --
NM_020768chr572689 2630 2200 1298 959 647 196 --11284 --
NM_020772chr17116171 3211 3063 2957 2548 2292 2205 2022 1863 1834 252 11841 25339 918 --
NM_020774chr18116056 4926 4756 4347 2349 2053 1970 1524 1480 627 488 15693 ----
NM_020783chr182462 407 12067 1237 --
NM_020792chr342310 1717 432 352 11091 --1581
NM_020796chr532152 1027 274 --12271 22490 773
NM_020801chr532413 586 91 ------
NM_020804chr682138 2116 1954 1933 801 771 602 91 12684 52286 2196 2152 465 358 --
NM_020805chr1841852 1530 1340 231 --11282 11699
NM_020810chr1463488 3361 3310 1319 750 605 ------
NM_020813chr1972294 1015 962 799 384 207 113 --1856 12382
NM_020824chr103499 53 22 --1624 --
NM_020825chr1673810 3620 3369 3062 2681 1237 813 --12878 --
NM_020830chr251257 1205 608 391 235 ----12696
NM_020834chr1451885 1852 1748 405 126 21830 1309 --1357
NM_020839chr341241 1149 1009 632 --11225 --
NM_020841chr1253743 3155 1210 921 844 ------
NM_020858chr1541953 1903 915 859 11703 ----
NM_020860chr42469 120 1148 ----
NM_020861chr6--3441 271 71 21108 494 1509
NM_020873chr32203 195 ------
NM_020899chr1732292 730 267 12198 2780 221 12097
NM_020918chr1063468 3239 2404 2255 1373 1017 23246 2501 ----
NM_020925chr111398 ------
NM_020927chr1641955 1851 1685 593 42086 1929 795 277 12062 11669
NM_020935chr244509 4199 3976 1744 11524 --13188
NM_020940chr1032114 571 261 2510 241 ----
NM_020946chr951551 600 542 451 195 --21069 311 --
NM_020948chr141288 884 661 277 23639 2423 ----
NM_020956chr19124536 4221 3734 1838 1760 1682 1589 1079 772 596 231 178 1352 14551 1314
NM_020962chr1542522 2421 1731 664 --1326 --
NM_020967chr2071137 1109 879 826 400 288 243 ------
NM_020975chr1041652 1592 1267 256 1480 31778 1377 528 --
NM_020977chr441513 750 118 106 --11662 1644
NM_020981chr22792 72 1729 ----
NM_020983chr1252011 1819 1551 866 257 --31634 697 101 --
NM_021003chr142248 141 ------
NM_021032chr352004 1793 1663 756 74 ------
NM_021033chr1323057 1383 1129 ----
NM_021038chr363172 2882 2184 1286 721 705 1178 ----
NM_021069chr432110 2022 1849 ----21514 334
NM_021072chr521691 94 1639 ----
NM_021079chr1793294 3097 2960 2633 2377 1042 416 222 194 --22677 488 --
NM_021090chr2294865 4310 4137 3809 3373 3176 1652 1614 940 24062 955 14975 --
NM_021096chr2273171 2967 2877 2277 1317 964 191 1323 12412 13138
NM_021097chr242469 2168 1016 797 2652 235 1254 1576
NM_021116chr7248928 8506 7843 7744 7097 6492 6074 6063 5932 3296 2652 2382 1949 1772 1754 1006 856 802 481 299 233 142 76 49 58827 1493 1224 1197 1038 87519 3046 2474 2343 2238 1910 1560 349 11025
NM_021140chrX------3354 211 179
NM_021144chr91147 1355 ----
NM_021156chr2051066 1030 317 177 125 ------
NM_021158chr204808 665 573 94 1106 ----
NM_021167chr762635 1009 873 568 140 26 21925 1063 ----
NM_021202chr20102627 2577 2543 2346 1904 1246 1232 546 353 309 22135 1194 --11881
NM_021222chr131320 559 483 --1928 1104
NM_021229chr122334 328 ------
NM_021240chr91544 ----1705
NM_021255chr1463840 3688 3193 2752 624 394 53946 2792 2673 2522 440 166 --
NM_021259chr16299 41 ------
NM_021260chr1441204 991 958 124 ----11388
NM_021627chr32154 24 --11163 --
NM_021629chr394686 4319 4114 3789 3172 1964 1451 1174 915 23770 847 13629 --
NM_021637chrX41328 1132 460 32 ------
NM_021638chr4103903 3265 1933 1863 1538 1298 1047 1020 718 21 44646 4451 1459 968 34533 4027 112 --
NM_021648chr662028 1844 1782 915 523 139 --12127 --
NM_021705chr661030 605 484 472 407 222 21493 53 --11090
NM_021722chr7----157 --
NM_021728chr142715 59 ------
NM_021738chr101294 1121 ----
NM_021785chrX----1138 --
NM_021809chr2062146 2005 468 304 125 32 --1208 1279
NM_021813chr6125829 5208 5167 4861 1880 1834 1150 1130 702 293 54 44 25302 4206 15350 --
NM_021814chr62589 552 ------
NM_021815chr242720 2039 1233 433 ------
NM_021818chr1411373 11433 --11335
NM_021824chr22218 91 ------
NM_021830chr102867 584 ------
NM_021911chr551942 1907 1170 1000 204 192 --34660 4567 2118
NM_021913chr1961577 1461 1343 1272 1250 291 --31826 1320 268 11132
NM_021914chr1462312 2100 2090 1856 1753 49 ----12456
NM_021932chr11147 1283 ----
NM_021943chr652112 1711 1686 1429 334 ------
NM_021945chr662576 2367 2257 1173 812 636 13312 21035 28 --
NM_021954chr1332588 1212 589 13560 3627 396 22 --
NM_021960chr142639 2022 1857 850 ------
NM_021961chr11125639 5300 5215 5022 4992 4795 4629 2776 2209 2002 1590 1493 37461 2972 1940 1257 12560
NM_021962chr1752280 2225 352 231 47 --1109 --
NM_021964chr364222 1239 1133 1098 910 398 22540 665 12603 --
NM_021977chr673660 3237 3190 1141 657 634 144 23081 38 ----
NM_021991chr174703 309 294 194 --3536 244 125 1514
NM_021998chrX2575 487 ----11380
NM_022048chr1595133 4498 4258 4187 1790 1531 887 870 378 24386 1591 35222 4483 694 25969 1082
NM_022049chr121894 727 ------
NM_022098chr2241411 1010 523 310 ------
NM_022130chr53463 385 298 --11412 --
NM_022138chr63514 362 319 ----1187
NM_022140chr541975 1850 720 113 1854 11532 --
NM_022166chr16116331 5642 3991 2243 2201 1444 1136 797 563 320 284 11122 15613 1497
NM_022170chr721590 1264 --21108 399 11548
NM_022336chr24851 693 384 206 22210 1948 1589 --
NM_022351chr833276 2843 2606 ------
NM_022373chr72241 41 ------
NM_022456chr12117400 6833 5982 5781 5673 5383 4854 1413 1380 971 208 47031 6601 1675 1297 --36656 1607 439
NM_022458chr762568 2484 975 849 346 210 2445 392 148 22209 108
NM_022459chr1363860 2477 2121 1267 1239 1211 24703 1770 32245 962 477 --
NM_022462chr19223638 3399 3214 3112 3054 2995 2711 2573 2528 2420 2372 1522 1457 1451 1392 1227 792 759 753 698 531 368 62744 2619 2499 2438 2356 1367 33309 2558 2453 --
NM_022465chr1282641 2457 2448 1045 804 753 469 378 --22397 2028 --
NM_022467chr191442 ------
NM_022470chr321250 826 ------
NM_022474chr1432590 1879 1785 --11770 --
NM_022491chr1263406 2692 2505 2365 400 208 1769 ----
NM_022553chr62206 92 ------
NM_022572chr251691 1390 1377 1167 569 --21606 267 11577
NM_022650chr52113 60 ------
NM_022652chr124955 914 286 44 ------
NM_022716chr142597 2584 868 477 1391 2291 281 --
NM_022719chr2283871 3662 2958 2948 2410 843 671 75 ----11160
NM_022735chr131690 680 570 51537 1496 1437 1180 526 ----
NM_022739chr172391 284 ------
NM_022748chr782896 2698 2552 2526 1971 1138 139 111 11075 12568 --
NM_022755chr932583 1680 837 --12287 --
NM_022756chr141352 1091 396 27 ------
NM_022758chr642906 2717 2506 1061 ----1557
NM_022763chr353036 2757 2533 280 61 ----12327
NM_022780chr241826 1262 561 530 158 --2448 123
NM_022781chr953066 2422 956 722 89 --12800 1387
NM_022824chr531325 1219 527 --1497 --
NM_022826chr23810 486 165 ------
NM_022829chr2062043 2024 1720 803 467 134 1673 --22092 1973
NM_022831chr131496 641 161 --1340 --
NM_022841chr1532416 536 138 --1758 --
NM_022842chr372296 1098 1073 1037 690 346 318 23332 1191 ----
NM_022893chr252673 2112 1157 436 76 12242 ----
NM_022894chr231251 584 119 --11621 --
NM_022900chr72327 34 ----157
NM_022910chr1661978 1845 1785 1564 661 304 --1164 --
NM_022912chr292942 2531 1978 1113 1051 875 661 617 21 ----11171
NM_022918chr1131584 563 93 21717 158 ----
NM_022970chr1021120 1097 ------
NM_022977chrX--32343 1045 389 12313 161
NM_023000chr1421597 126 --11477 --
NM_023001chr1421597 126 --11477 --
NM_023012chr12185 ------
NM_023016chr252554 2032 1924 182 146 ----12262
NM_023018chr151640 1481 331 274 154 21548 1475 ----
NM_023068chr2041502 1384 602 58 11556 21182 25 --
NM_023076chr1662719 2260 1200 736 297 44 12100 12323 --
NM_023079chr1741297 684 576 466 --21654 97 --
NM_024017chr1771736 1531 1267 573 471 336 192 ------
NM_024052chr1792144 2048 2004 1957 712 688 564 537 328 22832 853 22794 2263 --
NM_024087chrX3605 522 26 ------
NM_024090chr41264 1500 --21377 396
NM_024106chr192345 49 ------
NM_024294chr642906 2717 2506 1061 ----1557
NM_024341chr19104009 3764 3256 2663 1104 1092 601 456 227 201 2254 176 1970 1871
NM_024345chr985982 5405 5199 5095 2047 1789 728 254 45543 4413 4370 669 --12353
NM_024422chr1831350 748 391 1659 ----
NM_024423chr1874027 3924 1592 1548 1171 430 104 12712 21628 1574 --
NM_024429chr741044 346 208 129 ------
NM_024501chr25498 475 176 162 67 ------
NM_024529chr1----11071 --
NM_024541chr1021738 250 ----1234
NM_024546chr132900 845 ----1401
NM_024548chr351493 1121 622 153 146 31719 1658 673 ----
NM_024551chr1221737 836 12519 --1920
NM_024551chr1221737 836 12519 --1920
NM_024561chr13164 11232 ----
NM_024567chr82516 293 ------
NM_024569chr132934 2868 446 1374 11018 --
NM_024586chr12226 208 ------
NM_024607chr854327 1508 698 523 177 22996 1375 23350 3289 23673 1337
NM_024626chr121541 1283 1121 11396 --
NM_024638chr331993 738 237 12272 --11827
NM_024639chr642864 2604 1931 380 11026 22110 2003 11912
NM_024646chr132981 2479 394 11390 ----
NM_024659chr2157 --1173 --
NM_024665chr374165 3898 3175 3053 1575 1117 401 24724 1272 ----
NM_024674chr142679 2291 285 150 --21180 828 1654
NM_024689chrX51464 1354 722 496 296 149 11255 1160
NM_024692chr23590 368 139 1529 --11359
NM_024721chr82890 358 ----12038
NM_024740chr1183977 3664 3040 1426 1076 744 540 52 11649 ----
NM_024749chr121821 68 ----1906
NM_024751chr422021 1432 ------
NM_024770chr2156698 6673 5765 5636 5466 5437 5007 4947 4622 2393 2163 1811 1529 529 441 24262 2626 16377 --
NM_024780chr1621066 432 ------
NM_024798chr1522357 826 ----22786 2230
NM_024811chr1141714 531 333 270 --1126 11654
NM_024830chr581586 1413 882 798 700 544 129 117 11917 ----
NM_024834chr103423 309 60 ------
NM_024837chr1531339 490 42 --170 --
NM_024852chr13507 96 67 ------
NM_024866chr2283463 3387 3182 2520 2237 1341 570 58 11050 31160 542 273 --
NM_024873chr451107 950 781 287 228 ------
NM_024889chr1031745 1703 37 ----11561
NM_024920chr431511 414 289 ------
NM_024947chr397189 6478 6034 3595 2612 2466 2247 1927 979 37773 2102 82 ----
NM_024949chr464455 4394 4379 4187 3859 1216 13338 ----
NM_024969chr22209 124 --1774 --
NM_024989chr288127 7922 7344 6962 1361 1284 898 882 37807 6929 1160 15820 13285
NM_024991chr103810 643 256 23276 310 32506 1106 1017 12380
NM_025040chr1911877 11595 --11665
NM_025047chr32374 363 1160 ----
NM_025054chr872840 2758 2586 1529 1426 1049 623 33260 2614 943 ----
NM_025080chr112256 23 187 ----
NM_025083chr15101922 1773 1762 1520 1503 1307 1299 710 508 391 --1230 --
NM_025134chr164860 722 488 144 31753 997 869 ----
NM_025147chr251062 945 925 733 399 182 ----
NM_025154chr73591 458 353 11176 1527 --
NM_025160chr163806 2950 1492 1240 857 559 13616 --11617
NM_025164chr1132008 417 329 --12228 --
NM_025179chr194442 4131 3736 3505 3487 3191 1867 1621 183 1706 23884 3444 13956
NM_025191chr163561 3292 3240 3213 904 874 12937 ----
NM_025195chr831360 1285 1240 1742 1766 --
NM_025235chr1072211 2037 1792 1776 1423 562 227 ------
NM_025237chr1761574 1566 1302 616 362 141 --1290 --
NM_025239chr92382 287 ------
NM_030576chr1762391 1950 1629 997 738 320 ----22573 153
NM_030579chr1653544 3483 3263 1113 864 13649 ----
NM_030625chr1032232 1927 1619 11041 ----
NM_030627chr543813 2716 1424 1017 1755 12940 --
NM_030637chr14----2685 231 --
NM_030647chr745683 3861 1803 684 25950 4980 --15543
NM_030648chr474142 3908 3749 2012 1531 1511 23 11834 --13576
NM_030650chr254256 3897 2991 991 124 --13839 13103
NM_030664chr1031556 177 64 ------
NM_030674chr12125815 5735 5034 4253 3665 2037 1901 1809 1692 1650 650 360 --15646 --
NM_030755chr1432399 837 114 1146 12097 --
NM_030758chr2231138 401 199 ----11271
NM_030759chr103508 317 200 ------
NM_030763chrX1788 1126 ----
NM_030767chr982739 2524 2054 1070 640 308 261 127 12062 ----
NM_030773chr2041842 1187 470 303 ----21217 489
NM_030786chr141815 639 281 172 ------
NM_030791chr142166 66 11480 11493 --
NM_030795chr84372 61 45 26 ------
NM_030799chr542128 1921 1497 870 11394 ----
NM_030800chr15169 1471 --186
NM_030806chr1149254 8062 7725 6872 6525 5935 5805 3365 3243 3082 2286 1079 458 268 27844 2357 47061 6582 5714 2337 19188
NM_030809chr1242321 1986 1962 1683 ----1525
NM_030817chr1232934 1171 475 43169 757 516 445 11190 2469 60
NM_030821chr41609 1712 ----
NM_030881chr2231595 834 26 --12335 12133
NM_030914chr94364 261 231 76 --1135 --
NM_030918chr1135390 5267 5231 4990 4975 4764 1179 882 780 681 631 106 42 1770 23748 720 --
NM_030926chr211049 11114 --1395
NM_030939chr63868 465 83 ------
NM_030952chr141111 1103 1084 200 ----11121
NM_030953chr541445 614 449 105 21469 1312 1362 --
NM_031243chr741575 924 772 77 --11877 --
NM_031244chr651122 1030 880 303 289 ------
NM_031266chr52174 166 ------
NM_031268chr1675115 4097 3952 3454 1813 973 80 --44502 4326 1265 722 --
NM_031272chr172105 81 ------
NM_031284chr153375 157 126 ----1878
NM_031314chr1431426 1417 100 ----2756 535
NM_031369chr41779 ----1230
NM_031370chr41779 ----1230
NM_031419chr32462 227 11295 --11152
NM_031427chr1474382 4353 2043 1907 1772 1178 245 65817 5801 1418 503 431 394 15597 --
NM_031438chr511733 1321 ----
NM_031439chr841823 1271 248 197 ------
NM_031442chrX63131 2877 905 672 548 494 ----11955
NM_031445chr233340 960 479 22557 284 13355 --
NM_031453chr106940 847 806 790 687 243 ------
NM_031459chr151557 1283 1256 440 393 --1408 --
NM_031468chr7227705 7102 7049 6562 6150 6110 5886 5600 4986 3243 2738 2294 1791 1644 1524 624 583 463 335 323 210 170 47920 7631 3303 2929 43032 1411 1179 292 --
NM_031469chr682909 2838 2673 1363 1138 1085 824 558 43614 2993 1573 616 23793 3593 --
NM_031483chr2033531 3329 1015 1178 ----
NM_031844chr123669 1609 ----13524
NM_031845chr253586 2936 2796 2764 2695 ------
NM_031847chr253586 2936 2796 2764 2695 ------
NM_031886chr1952322 2117 1945 1704 533 22553 2542 ----
NM_031940chr861984 1849 922 648 441 323 ------
NM_031989chr12189 ------
NM_031990chr1961288 1007 949 908 579 52 ------
NM_031991chr1961288 1007 949 908 579 52 ------
NM_031992chr721590 1264 --21108 399 11548
NM_032012chr9115052 4828 4666 3942 3685 3556 3486 1678 774 209 83 44478 4016 1635 1121 12080 --
NM_032041chr852610 2210 1009 492 149 32268 2221 833 21866 1730 --
NM_032042chr552325 1902 1859 441 161 41872 957 740 557 1449 --
NM_032047chr332189 1699 762 1151 ----
NM_032088chr51543 --11095 --
NM_032092chr51543 --11095 --
NM_032102chr1142905 2663 2264 753 22897 2635 1475 --
NM_032104chr13511 267 198 --2146 47 1571
NM_032105chr1127875 6946 6031 2429 2218 1868 1770 1681 1357 511 267 198 47502 6777 6168 5209 43140 1837 146 47 1571
NM_032121chrX32513 1732 848 12776 1551 --
NM_032139chr193248 237 120 1694 ----
NM_032144chr211664 1409 --1648
NM_032146chr31154 ------
NM_032148chr122370 115 ------
NM_032153chr331040 723 197 1743 --22073 875
NM_032160chr1833051 1438 350 --11407 --
NM_032174chr131142 512 106 11155 31093 1004 81 --
NM_032181chr22212 110 --1784 --
NM_032182chr1041591 1537 1506 1326 ------
NM_032199chr1053616 1270 1091 505 179 21134 294 1244 --
NM_032208chr293046 1382 1247 915 875 619 253 65 40 23538 2293 --1245
NM_032221chr2031817 631 247 ------
NM_032233chr141768 ------
NM_032242chr372202 2179 1256 1243 957 721 565 --33315 991 355 12244
NM_032246chr1531072 903 890 ------
NM_032268chr1652415 2408 1111 681 137 1758 32023 1132 55 12605
NM_032283chr141865 1450 1280 569 --21665 1210 --
NM_032289chr561549 387 195 94 67 43 --1277 1492
NM_032291chr12522 258 1583 ----
NM_032312chr22232 111 ------
NM_032315chr1----148 125
NM_032316chr352045 935 643 249 171 12065 22286 2272 --
NM_032319chr22317 22 ------
NM_032320chr112204 188 1294 1589 --
NM_032353chr173445 119 43 ------
NM_032373chr1065054 4139 3887 3641 1569 1496 35086 4950 4464 1663 --
NM_032383chr33959 953 445 2422 230 ----
NM_032403chr51543 --11095 --
NM_032424chr1111311 --142 1331
NM_032431chr1151022 914 236 215 179 1315 2716 409 --
NM_032436chr133874 355 219 ------
NM_032440chr1052573 2365 1965 904 703 ----1694
NM_032441chrX2417 117 ------
NM_032445chr1542189 2183 148 99 12452 ----
NM_032457chr453654 1505 1423 1217 465 23268 794 23220 140 --
NM_032458chrX53209 3068 2300 2082 951 --11119 --
NM_032509chr852342 1836 1602 913 85 22109 1730 12026 22431 574
NM_032510chr1862087 1636 823 736 135 32 11535 ----
NM_032521chr2032640 844 24 ------
NM_032538chr642312 981 511 452 1498 52631 2399 1807 783 476 --
NM_032569chr1631500 687 388 11934 1533 --
NM_032578chr1021533 1367 ------
NM_032595chr173334 149 91 ------
NM_032603chr21727 --2482 163 --
NM_032632chr142584 165 --21734 510 --
NM_032636chr1288 29 ----1488
NM_032682chr373588 2523 2292 1375 1329 951 517 --1791 --
NM_032689chr1951410 1080 353 266 210 --11566 --
NM_032727chr102242 118 --1389 --
NM_032737chr1972625 1920 897 586 432 169 96 2824 426 ----
NM_032765chr52999 185 1837 1899 --
NM_032788chr251597 585 502 419 335 11076 ----
NM_032801chr1132236 2105 1981 1115 ----
NM_032824chr22329 139 ------
NM_032826chr7115427 5391 5178 4325 3383 1981 1794 1438 538 439 131 ----13356
NM_032837chr1751370 1344 631 568 307 11785 ----
NM_032859chr1331088 842 237 ------
NM_032867chr114568 492 231 177 ------
NM_032869chr831914 1878 717 11551 ----
NM_032873chr1164593 4160 3637 3020 442 180 --2878 624 --
NM_032875chr175308 185 131 72 51 ------
NM_032892chr15------1217
NM_032947chr51365 ----1260
NM_032978chr18171 ------
NM_032979chr18171 ------
NM_032981chr18171 ------
NM_032983chr792843 2703 2353 1152 889 410 331 143 22 11361 1986 --
NM_033020chr154488 3951 1631 1529 876 34170 1569 735 --11171
NM_033030chr2124 21500 594 ----
NM_033058chr82791 35 2704 666 --1956
NM_033117chr9------1278
NM_033129chr2082023 1415 1297 816 760 742 701 359 --31812 1782 1344 --
NM_033132chr1321597 698 --11899 --
NM_033136chr5----1213 1699
NM_033137chr5----1213 1699
NM_033138chr731481 485 175 32002 1986 359 --11640
NM_033139chr731481 485 175 32002 1986 359 --11640
NM_033140chr731481 485 175 32002 1986 359 --11640
NM_033143chr434495 546 428 23447 1740 23228 395 --
NM_033157chr731481 485 175 32002 1986 359 --11640
NM_033181chr633972 3805 971 22848 61 1190 --
NM_033222chr941056 1006 976 250 ------
NM_033224chr7177808 7363 7185 7138 6630 6547 6418 5323 3090 2999 2403 1974 1214 1161 733 428 340 57769 6937 6045 1208 717 17916 --
NM_033225chr823055 592 12600 22674 2268 1263
NM_033274chr543462 2714 2363 211 --22667 289 22922 121
NM_033285chr841426 1129 863 219 11248 14018 --
NM_033290chrX43534 3024 2870 953 12598 --23054 1021
NM_033315chr176868 705 654 647 445 225 ----1358
NM_033331chr952767 2556 2229 748 37 12238 23183 707 22703 350
NM_033360chr1253307 3077 1846 1652 1444 13464 ----
NM_033387chr982582 2545 2474 1869 893 387 111 75 --1987 --
NM_033389chr1774200 3225 3182 987 572 437 257 24610 30 ----
NM_033505chr2116230 5261 4868 4683 4491 4315 4179 4109 2329 1010 727 22518 345 14563 --
NM_033542chr2052026 1285 636 488 482 --31673 1333 70 --
NM_033551chr533392 3175 2188 ------
NM_033624chr1262300 1993 1666 1458 843 494 ----22040 64
NM_033637chr1043356 1650 324 215 14156 24028 2957 --
NM_033656chr2195558 5357 5085 4901 4215 1508 1393 1255 715 25339 1751 ----
NM_052811chr1364852 4666 3362 1552 1106 67 --12061 --
NM_052820chr94494 353 218 149 ------
NM_052879chr1253277 1470 800 361 322 1998 ----
NM_052885chr1244479 1644 600 294 64152 4018 3392 1507 764 131 24715 618 --
NM_052886chr832012 1946 84 ----11580
NM_052896chr141881 1780 1711 47 12433 12169 --
NM_052900chr8------126
NM_052905chr23674 562 205 ------
NM_052907chr1273200 3135 2831 1710 1437 655 365 22955 1282 13193 --
NM_052917chr242731 2418 2282 1006 1147 12160 --
NM_052918chr1042921 2798 2756 2263 33301 3240 1448 2543 317 22586 1272
NM_052928chr1761657 1418 1217 618 446 320 --21619 1501 --
NM_052932chr1132309 430 419 2924 551 ----
NM_052934chr151852 1478 1409 655 339 22144 1711 1174 --
NM_052978chr1431724 618 393 --2664 282 --
NM_053002chr32925 900 2949 314 ----
NM_053016chr967334 6839 6535 4945 558 472 47699 2345 1311 1285 37924 5614 5313 17954
NM_053023chr1132625 1025 285 21200 591 12851 --
NM_053025chr321376 463 11613 1436 1145
NM_053026chr321376 463 11613 1436 1145
NM_053027chr321376 463 11613 1436 1145
NM_053028chr321376 463 11613 1436 1145
NM_053031chr321376 463 11613 1436 1145
NM_053032chr321376 463 11613 1436 1145
NM_053042chr421286 339 22468 1944 --1121
NM_053043chr7114345 4014 3908 1747 1504 1025 942 912 418 161 103 15297 35800 1672 132 15033
NM_053056chr1133138 1981 952 13172 187 12859
NM_053064chr1473104 2635 2212 1232 1118 127 30 31000 974 803 21206 904 --
NM_053279chr832682 1939 85 ------
NM_053281chrX2422 46 ------
NM_054112chr201179 ------
NM_057158chr8----1575 --
NM_057169chr1252578 2526 2318 1127 62 12052 178 --
NM_057170chr1252578 2526 2318 1127 62 12052 178 --
NM_057178chr1742435 2208 446 22 1289 ----
NM_058229chr8------127
NM_058240chr1441348 1324 580 21 ------
NM_058241chr221775 637 12062 1738 --
NM_058241chr221775 637 12062 1738 --
NM_078470chr1052325 2173 2101 1920 458 1503 153 --
NM_078473chr861984 1849 922 648 441 323 ------
NM_078476chr671390 1149 690 374 291 228 43 --1118 --
NM_078485chr62125 100 ------
NM_079421chr192484 395 ------
NM_080546chr921627 485 42064 2033 1952 1696 1935 11822
NM_080591chr953073 2625 1229 701 52 52325 475 431 375 185 22745 212 --
NM_080599chr1041045 197 109 64 ----21235 464
NM_080664chr142739 98 ----11525
NM_080669chr17104861 3526 3075 1845 1549 1288 1279 613 375 335 1198 34252 4139 3190 23317 3086
NM_080676chr2062713 2697 2234 617 553 139 22203 2176 ----
NM_080717chr12----11182 1336
NM_080738chr151888 1844 1580 1458 1273 --2611 33 21803 667
NM_080743chr622536 141 11736 12323 --
NM_080867chr1464820 4471 3659 3652 491 308 24769 1046 --11127
NM_130385chr1192991 2691 2656 2485 2406 1114 1069 1013 511 --22512 2213 --
NM_130391chr973284 2991 2786 2453 1236 777 161 12264 ----
NM_130392chr973284 2991 2786 2453 1236 777 161 12264 ----
NM_130393chr973284 2991 2786 2453 1236 777 161 12264 ----
NM_130434chr15--2905 415 --1852
NM_130438chr2173310 3124 3105 2236 1144 1122 890 22451 2147 ----
NM_130439chr1022149 899 1215 --11786
NM_130439chr1022149 899 1215 --11786
NM_130442chr761104 841 474 216 142 130 ------
NM_130797chr72698 348 ----11345
NM_130798chr1541202 430 277 71 ------
NM_130811chr2021020 824 ------
NM_130830chr373741 3510 3098 2770 2620 1025 340 --12479 11566
NM_130846chr122897 163 172 --1720
NM_133170chr20167502 7210 7033 6578 5898 5719 5275 3037 2897 2799 2611 1785 1740 1652 484 33 35782 2604 2218 37700 7403 2531 16096
NM_133171chr2051225 863 840 513 278 ------
NM_133264chr1773702 3194 2629 1238 994 768 238 13658 33569 3433 3119 11015
NM_133265chrX63430 2220 942 729 574 333 22589 2451 ----
NM_133334chr4105746 4586 3968 2526 2262 2149 804 347 290 234 --42448 2378 2098 1800 --
NM_133367chr653092 1361 1089 973 480 1678 23308 320 --
NM_133368chr16144 ------
NM_133445chr9123811 3782 3721 3220 3035 2433 1369 1154 1007 962 456 184 33534 1446 732 32870 1340 193 23668 3444
NM_133482chr531067 245 223 31477 1266 1178 1932 --
NM_133493chr653787 3097 2826 1678 40 43705 3168 1477 534 --23947 279
NM_133496chr164183 3792 3739 1083 529 391 ------
NM_133503chr122745 147 1197 ----
NM_133504chr122745 147 1197 ----
NM_133505chr122745 147 1197 ----
NM_133506chr122745 147 1197 ----
NM_133507chr122923 325 1375 1133 --
NM_133631chr32281 251 ------
NM_133646chr285494 4732 4035 3374 1801 1038 1004 647 55519 5060 4690 4139 1091 15012 1766
NM_134265chr171326 ------
NM_134428chr9125 ------
NM_138316chr102392 147 ------
NM_138333chr932240 206 147 1966 11765 --
NM_138335chr42733 336 ------
NM_138338chr2283308 2790 2308 1374 1284 1155 801 364 --23157 3091 1356
NM_138357chr1021216 517 --11448 --
NM_138423chr1522086 707 11589 --122
NM_138426chr77946 515 506 408 297 288 56 12137 ----
NM_138444chr1374803 4588 3202 3173 317 119 27 1374 ----
NM_138457chr653026 2128 710 239 55 2108 49 21365 634 --
NM_138458chr241061 842 347 276 ------
NM_138459chr623493 318 11338 3569 545 495 --
NM_138473chr1254565 4509 3144 1912 816 23217 1521 ----
NM_138555chr154484 395 100 80 ------
NM_138559chr22918 138 11183 ----
NM_138609chr54389 226 145 45 ------
NM_138610chr54389 226 145 45 ------
NM_138619chr1721465 1133 --11539 --
NM_138635chr752645 2626 1282 627 203 21972 998 2344 176 --
NM_138638chr1462312 2100 2090 1856 1753 49 ----12456
NM_138694chr673193 2849 2663 2468 2450 1441 922 23554 1097 ----
NM_138713chr16118119 7792 7378 6999 5644 5014 2705 2654 2522 655 250 27580 1861 26328 5569 11325
NM_138714chr16118119 7792 7378 6999 5644 5014 2705 2654 2522 655 250 27580 1861 26328 5569 11325
NM_138727chr142195 2044 780 734 21930 456 ----
NM_138728chr142195 2044 780 734 21930 456 ----
NM_138731chr1413609 33834 3263 990 --13734
NM_138736chr1674173 3330 3287 938 868 812 433 --23562 1272 --
NM_138771chr711298 ----1572
NM_138782chr551965 939 287 236 28 2857 341 ----
NM_138809chr552742 1790 865 471 248 ------
NM_138959chr196750 6352 5723 1698 1485 1398 1384 759 378 42401 2210 2071 1247 1537 15235
NM_138967chr1541800 1657 575 185 --22238 560 12055
NM_138970chr14--1854 21571 337 1747
NM_138971chr1152418 1336 1202 284 174 23702 354 1948 --
NM_138971chr1152418 1336 1202 284 174 23702 354 1948 --
NM_138972chr1152418 1336 1202 284 174 23702 354 1948 --
NM_138972chr1152418 1336 1202 284 174 23702 354 1948 --
NM_138973chr1152418 1336 1202 284 174 23702 354 1948 --
NM_138973chr1152418 1336 1202 284 174 23702 354 1948 --
NM_138991chr212143 60 ------
NM_138992chr212340 257 ------
NM_139012chr611726 11503 31807 474 244 --
NM_139015chr1241536 1465 1311 457 1354 ----
NM_139035chrX1223 ------
NM_139045chr93825 342 229 ------
NM_139062chr174385 367 64 54 ------
NM_139068chr51533 2687 593 ----
NM_139069chr51533 2687 593 ----
NM_139070chr52402 217 2556 462 ----
NM_139071chr1221185 101 11163 31091 367 262 --
NM_139072chr22780 213 ----1822
NM_139168chr51125 11724 ----
NM_139181chr117526 502 490 228 220 56 26 ----1391
NM_139201chr122630 533 ------
NM_139207chr1252171 1703 1592 1478 506 22200 642 ----
NM_139214chrY185 --167 153
NM_139276chr1751939 1926 945 903 114 12398 ----
NM_139279chr242878 2656 1073 950 1917 1937 --
NM_139283chr1242526 2297 2035 878 11988 --1735
NM_139312chr1031374 1063 390 11128 11198 --
NM_139319chr1221794 379 21442 260 ----
NM_139321chr2083736 3716 3338 2666 2597 514 238 184 ------
NM_144571chr475305 5242 2727 1110 965 432 106 25225 4753 ----
NM_144578chr1494980 4206 4082 3966 3580 1753 1254 1112 687 13511 11009 --
NM_144579chr272331 2281 2031 1177 937 859 671 --1779 --
NM_144586chr23510 331 41 11261 ----
NM_144590chr1032739 2190 241 --12075 --
NM_144598chr15----1137 1116
NM_144599chr1545495 4479 3707 3555 55150 4686 4261 3388 1329 --14909
NM_144628chr20103022 2999 2854 2718 2508 2219 2091 1899 616 103 --21098 157 --
NM_144632chr251947 1790 1518 1475 149 --21589 175 --
NM_144642chr331271 312 126 2487 396 --11168
NM_144710chr231429 1058 950 1232 ----
NM_144767chr1564172 3751 3185 2912 2848 802 33387 2866 782 14623 --
NM_144775chr17104953 4325 3520 3189 3029 1962 1674 1620 1146 978 --1479 --
NM_144777chr131234 184 ----
NM_144973chr1264924 4329 2015 1868 1258 579 12050 34851 954 410 --
NM_145000chr51409 ----1221
NM_145008chr111704 ------
NM_145025chr641204 1086 254 196 ------
NM_145036chr17257 34 ------
NM_145049chr53862 235 128 ------
NM_145055chr1863663 2900 1139 720 390 86 12582 12743 194
NM_145102chr72233 86 21046 472 11430 11320
NM_145117chr1153343 2992 2408 1196 143 12415 1465 --
NM_145165chr1442944 2726 2089 1123 32441 2325 343 1171 --
NM_145185chr1911790 ----1751
NM_145206chr1022989 886 ----12593
NM_145253chr161136 --1259 2625 468
NM_145274chr171668 ------
NM_145306chr101416 ------
NM_145307chr1064582 4551 1404 231 206 57 24156 875 13948 --
NM_145313chr101385 ----11101
NM_145320chr793475 3411 2985 2608 2533 2293 1447 1313 96 12589 --11417
NM_145321chr793475 3411 2985 2608 2533 2293 1447 1313 96 12589 --11417
NM_145322chr793475 3411 2985 2608 2533 2293 1447 1313 96 12589 --11417
NM_145341chr1021890 517 21157 617 ----
NM_145659chr161111 ------
NM_145686chr233010 311 242 --22593 34 1319
NM_145687chr233010 311 242 --22593 34 1319
NM_145714chr16----1281 --
NM_145753chr321138 26 ------
NM_145756chr1831128 468 434 ------
NM_145793chr10187 ------
NM_145798chr171589 ------
NM_145805chr15176 ------
NM_145808chr73727 454 96 --22572 752 127
NM_145861chr151888 1844 1580 1458 1273 --2611 33 21803 667
NM_147150chr952934 2792 1404 1346 489 13395 23354 1386 --
NM_147156chr1021458 333 ------
NM_147175chrX2756 417 ------
NM_147189chr831735 1605 424 22153 738 ----
NM_147223chr292353 2108 2100 2079 2012 1986 703 291 165 31957 1852 1568 --22034 802
NM_147233chr282170 1925 1917 1896 1829 1803 520 108 21774 1669 --21851 619
NM_148177chr8------127
NM_148414chr16----1364 --
NM_148415chr16----1304 --
NM_148416chr16----1281 --
NM_148894chr431030 314 201 ------
NM_148898chr71417 ------
NM_148899chr71417 ------
NM_148904chr12226 208 ------
NM_148905chr12226 208 ------
NM_148906chr12226 208 ------
NM_148907chr12226 208 ------
NM_148908chr12226 208 ------
NM_148909chr12226 208 ------
NM_148921chr1751896 1876 1713 959 120 11759 12064 1318
NM_148977chr102392 147 ------
NM_148978chr102392 147 ------
NM_152240chr321250 826 ------
NM_152253chr2274073 3848 3290 2735 1673 1437 1425 33539 936 804 41518 1369 433 424 --
NM_152261chr1232174 427 202 ------
NM_152263chr184771 4257 1839 1663 1209 661 504 460 ------
NM_152280chr143036 2141 878 449 --23326 316 --
NM_152289chr1941590 1567 1209 1147 ------
NM_152309chr106903 859 831 637 53 29 3872 751 396 ----
NM_152316chr112507 171 ------
NM_152327chr14189 ------
NM_152334chr153761 656 218 ------
NM_152342chr162454 32 ------
NM_152344chr1741309 1076 61 27 ------
NM_152384chr252022 1927 597 164 43 11539 ----
NM_152388chr274035 3796 2936 2800 1348 1262 839 21587 872 --1920
NM_152390chr2------1431
NM_152407chr522367 613 23266 2424 --11295
NM_152414chr841192 1046 475 40 ------
NM_152424chrX54220 3831 1145 304 233 ----1891
NM_152437chr1242307 2045 1947 256 1818 11984 12438
NM_152446chr141713 ------
NM_152470chr1862817 2596 1233 858 463 399 ----23173 194
NM_152493chr131517 619 77 1129 11404 190
NM_152510chr222660 355 ------
NM_152520chr21142 ------
NM_152529chr274160 3748 3306 2931 2844 2827 598 1287 ----
NM_152542chr43852 693 436 ------
NM_152553chr62411 190 1482 ----
NM_152557chr741279 1103 559 82 ------
NM_152622chr563080 2192 1161 1016 706 609 23505 2164 ----
NM_152624chr5147393 7058 6311 6145 5809 5518 5094 4537 4526 2150 1755 1118 891 836 36360 1695 1595 ----
NM_152629chr993827 3192 2536 2526 1634 1588 1250 1035 762 1139 13593 --
NM_152641chr1242413 1836 719 264 11813 12115 --
NM_152682chr411271 --1482 --
NM_152699chr333454 161 98 --13585 --
NM_152724chr1032436 719 30 12688 --21927 1711
NM_152726chr132415 365 ------
NM_152733chr6166195 5921 5833 5456 5028 4700 2234 2104 2063 1758 1599 1207 1143 927 514 109 24334 4007 35989 5958 2588 26330 1378
NM_152734chr6155092 5034 4869 4676 4666 4567 4356 3722 3687 2151 1592 978 535 303 32 24439 516 1841 --
NM_152738chr61118 ------
NM_152740chr72682 499 ------
NM_152744chr793046 2936 2818 2611 2544 1297 429 278 48 --1936 1827
NM_152748chr7150 ------
NM_152756chr563653 3446 3144 3020 1615 1562 --21711 553 --
NM_152758chr82963 893 --12216 --
NM_152780chrX3423 405 251 --1507 --
NM_152787chrX43651 1313 1273 1243 ------
NM_152789chr72371 208 ------
NM_152838chr2053421 3199 296 80 59 ----1565
NM_152857chr61807 1279 2366 217 --
NM_152858chr61807 1279 2366 217 --
NM_152860chr1241379 1195 398 258 --2392 59 1439
NM_152890chr12369 279 21229 1114 ----
NM_152896chr92676 248 ------
NM_152902chr131795 1313 201 ------
NM_152903chr1342247 2005 1812 773 ----1410
NM_152924chr15116695 6525 5763 5630 4705 2493 1735 1417 824 439 26 34199 2224 2026 42660 1090 841 176 11582
NM_152994chr23572 95 35 --2543 446 --
NM_153025chr16111575 1424 589 525 486 476 412 284 221 157 93 11156 ----
NM_153029chr16104069 3943 3680 3650 3426 1610 1446 1297 1078 469 1252 11394 --
NM_153035chr133242 2753 2169 --1582 12060
NM_153050chr2294865 4310 4137 3809 3373 3176 1652 1614 940 24062 955 14975 --
NM_153051chr2294865 4310 4137 3809 3373 3176 1652 1614 940 24062 955 14975 --
NM_153184chr321595 1255 21942 71 ----
NM_153188chr533767 244 44 13533 14392 --
NM_153235chr652179 1934 1638 953 155 42390 2326 1959 1651 ----
NM_153261chr161603 --1231 --
NM_153262chr143135 2501 2231 731 13107 --1251
NM_153333chrX1169 ------
NM_153343chr432430 2015 1655 1200 --1561
NM_153354chr52336 306 1958 ----
NM_153367chr1053696 3689 3590 837 568 32976 2787 288 23536 938 --
NM_153371chr1332365 2339 240 31638 1572 234 ----
NM_153450chr114657 244 163 88 ------
NM_153453chr6----1112 1664
NM_153456chr1395948 5648 5310 4444 2492 2328 2251 1174 916 24104 695 25743 4929 35051 1749 1573
NM_153487chr694807 4453 4292 3632 3187 3167 1216 612 418 21290 569 11919 --
NM_153499chr1282856 2761 2408 2155 1041 900 584 489 31023 1003 419 1987 --
NM_153500chr1282856 2761 2408 2155 1041 900 584 489 31023 1003 419 1987 --
NM_153607chr543199 1131 730 184 33119 2881 2002 --1838
NM_153616chr1541953 1903 915 859 11703 ----
NM_153617chr1541953 1903 915 859 11703 ----
NM_153618chr1541953 1903 915 859 11703 ----
NM_153619chr1553191 3141 989 720 148 22941 645 21097 316 --
NM_153620chr751470 680 595 402 275 21201 219 --11111
NM_153689chr252200 1723 1577 642 69 --12223 --
NM_153707chr91130 ------
NM_153810chr10104759 4361 3364 3278 1900 1797 1123 959 885 68 14031 23680 1337 --
NM_153819chr111194 ------
NM_153828chr22617 590 ------
NM_170665chr1294353 4248 3636 3223 3142 922 688 423 155 --44075 3576 3382 129 --
NM_170672chr221511 1345 --1282 --
NM_170679chr531186 1079 479 ------
NM_170696chr1531336 1265 388 ------
NM_170697chr1531336 1265 388 ------
NM_170706chr193565 3552 3500 3212 3063 1300 680 206 199 23009 1240 33407 373 295 --
NM_170720chr1951002 965 941 479 286 21253 870 21098 1048 11142
NM_170750chrX1330 1888 ----
NM_171825chr562884 2328 2188 1022 703 429 --1182 --
NM_172037chr82388 272 31078 351 308 ----
NM_172058chr82311 198 11278 --191
NM_172059chr82311 198 11278 --191
NM_172060chr82311 198 11278 --191
NM_172071chr1106315 6096 5710 5461 5039 1914 600 489 302 238 22464 115 12826 --
NM_172103chr622005 148 22405 135 ----
NM_172105chr622005 148 22405 135 ----
NM_172169chr1051777 1505 1486 1288 31 11344 ----
NM_172170chr1051777 1505 1486 1288 31 11344 ----
NM_172171chr1051777 1505 1486 1288 31 11344 ----
NM_172173chr1051777 1505 1486 1288 31 11344 ----
NM_172226chr1282856 2761 2408 2155 1041 900 584 489 31023 1003 419 1987 --
NM_172230chr1151022 914 236 215 179 1315 2716 409 --
NM_172238chr6126 ------
NM_172337chr142715 59 ------
NM_172388chr1871545 1467 1251 643 559 93 28 ------
NM_172389chr1871545 1467 1251 643 559 93 28 ------
NM_173054chr71969 ------
NM_173082chr641288 1107 1043 149 11397 ----
NM_173157chr122439 380 ----1136
NM_173172chr241333 1067 1035 535 1623 ----
NM_173198chr932888 2595 918 1950 12338 --
NM_173200chr932888 2595 918 1950 12338 --
NM_173214chr16118119 7792 7378 6999 5644 5014 2705 2654 2522 655 250 27580 1861 26328 5569 11325
NM_173468chr475007 2243 1856 1527 1502 1431 535 41890 1444 1392 963 1799 14062
NM_173470chrX22417 109 12614 --22223 510
NM_173480chr191152 ----161
NM_173511chr263080 2886 2878 517 111 103 12572 ----
NM_173515chr62831 183 ------
NM_173552chr32979 105 1838 ----
NM_173576chr1042349 1458 516 355 1376 ----
NM_173582chr1145415 5343 1484 191 24376 4178 --15448
NM_173595chr1284488 4302 3808 3567 3555 1622 1164 513 11795 35197 4495 3449 --
NM_173602chr1243575 1087 1009 966 13357 ----
NM_173642chr1138748 7180 6705 6547 5833 3448 3112 3063 2933 2271 2240 1043 704 46762 2377 2328 853 --17405
NM_173681chr771865 1826 544 319 307 247 236 ------
NM_173694chrX31901 817 152 11991 ----
NM_173808chr134166 3860 512 23472 3228 1481 --
NM_173848chr83823 665 571 ------
NM_173851chr833632 3600 1525 11098 --23690 1300
NM_174890chr102602 562 ------
NM_174909chr51124 ------
NM_174911chr843168 2672 2611 1486 1506 23276 1297 23037 2815
NM_174921chr411170 1144 ----
NM_175056chr362163 2130 1749 787 451 436 ------
NM_175061chr751722 1532 858 257 248 ------
NM_175063chr1931020 786 475 11108 ----
NM_175077chr2051347 419 319 292 43 1532 ----
NM_175623chr12117400 6833 5982 5781 5673 5383 4854 1413 1380 971 208 47031 6601 1675 1297 --36656 1607 439
NM_175634chr851268 1014 1008 959 131 ------
NM_175635chr851268 1014 1008 959 131 ------
NM_175636chr851268 1014 1008 959 131 ------
NM_175709chr2282890 2473 2072 2025 1957 1914 292 58 11973 32297 914 543 12419
NM_175733chr1151718 1369 430 151 93 1392 1524 21475 495
NM_175736chr12197495 7294 7120 6949 6766 5633 5536 3145 3122 2391 2262 2129 1969 1673 1438 1045 401 276 190 --37738 6621 5388 12644
NM_175767chr571760 1713 1566 1488 1407 1296 422 31851 742 570 ----
NM_175847chr1961288 1007 949 908 579 52 ------
NM_175852chr172829 2260 2253 2094 1914 894 709 --32502 499 387 --
NM_175854chr1332189 857 134 21914 988 ----
NM_175907chr1852387 1803 333 281 266 1462 ----
NM_175921chr564016 3204 1344 1074 921 486 14100 --1401
NM_176801chr451852 1605 1204 1160 382 --1273 191
NM_176814chr741474 581 573 200 ------
NM_176823chr1143797 2933 2495 1354 1135 1046 740 502 379 369 293 211 187 120 33496 2446 768 4918 585 453 26 --
NM_176863chr1742080 1496 598 577 11930 21486 253 --
NM_176871chr882923 2656 2450 2345 1144 532 467 248 ------
NM_177422chr13507 96 67 ------
NM_177452chr143937 779 641 12296 1579 --
NM_177559chr20----1429 199
NM_177560chr20----1429 199
NM_177952chr142248 141 ------
NM_177974chr1522086 707 11589 --122
NM_177976chr31154 ------
NM_177999chr992533 1015 778 755 725 461 375 320 149 13037 ----
NM_178011chr1063140 2741 2628 2312 621 449 1585 ----
NM_178013chr1482626 2264 2257 2165 1105 1045 560 392 21979 100 22538 1159 --
NM_178037chr1283643 2952 2933 2218 586 507 299 233 136 --12736
NM_178038chr1283643 2952 2933 2218 586 507 299 233 136 --12736
NM_178123chr21940 ------
NM_178126chr1732142 2069 522 --1392 --
NM_178140chr532329 1766 233 --11732 1187
NM_178151chrX97713 5736 3151 3048 2262 2142 992 247 27 27252 2026 11844 21129 788
NM_178152chrX97713 5736 3151 3048 2262 2142 992 247 27 27252 2026 11844 21129 788
NM_178153chrX97713 5736 3151 3048 2262 2142 992 247 27 27252 2026 11844 21129 788
NM_178423chr72254 217 1345 ----
NM_178425chr72254 217 1345 ----
NM_178426chr142075 1893 1636 785 197 12128 --
NM_178427chr141975 1793 1536 685 --12028 --
NM_178439chr21551 128 ----
NM_178441chr1441204 991 958 124 ----11388
NM_178466chr201129 ------
NM_178498chr1173361 3211 787 775 586 577 326 11027 ----
NM_178507chr111738 --1642 --
NM_178554chr383033 3018 1413 1311 1176 1086 800 281 13045 2919 863 --
NM_178584chr231429 1058 950 1232 ----
NM_178815chr1032677 436 198 ------
NM_180976chr62922 112 ------
NM_180977chr62922 112 ------
NM_181077chr1532177 397 213 11950 ----
NM_181332chrX42323 2303 501 194 11825 1103 11972
NM_181336chr671352 1318 1206 1168 1068 860 433 1559 3458 155 55 21147 1024
NM_181349chr7102713 2494 2302 2245 2237 2082 1901 1233 484 102 ------
NM_181351chr1162852 2610 720 658 410 137 ------
NM_181354chr811248 ------
NM_181356chr64957 880 375 158 1745 ----
NM_181358chr133134 1384 264 --13422 14019
NM_181361chr3----1579 --
NM_181442chr202768 138 ----1185
NM_181486chr12----11182 1336
NM_181504chr533057 1394 75 1590 --2993 861
NM_181521chr1686540 6533 6459 4893 4792 2034 1625 709 46377 5373 4515 1047 --22218 667
NM_181523chr533057 1394 75 1590 --2993 861
NM_181524chr533057 1394 75 1590 --2993 861
NM_181527chr202301 164 --134 --
NM_181643chr141631 1620 1419 291 ----150
NM_181645chr112465 261 ------
NM_181659chr2063015 2701 2203 450 412 83 --12406 1613
NM_181659chr2063015 2701 2203 450 412 83 --12406 1613
NM_181670chr121197 11036 ----
NM_181671chr172234 91 --1283 --
NM_181672chrX21927 1437 ------
NM_181673chrX21927 1437 ------
NM_181705chr595027 5019 4337 4063 3844 3553 2089 1917 1684 35127 4936 1057 11336 15576
NM_181723chr81441 ----1270
NM_181784chr2102333 1965 1906 1895 1805 1688 1630 994 348 150 22389 1886 1737 --
NM_181886chr421162 180 ------
NM_181887chr421162 180 ------
NM_181888chr421162 180 ------
NM_181889chr421162 180 ------
NM_181890chr421162 180 ------
NM_181891chr421162 180 ------
NM_181892chr421209 227 ------
NM_181893chr421162 180 ------
NM_182470chr155477 467 459 177 24 --1570 --
NM_182471chr155477 467 459 177 24 --1570 --
NM_182485chr433647 3631 3582 13101 ----
NM_182488chr132951 274 ------
NM_182493chr1684536 3883 3633 3548 1516 1364 1081 384 34354 4339 32 15252 --
NM_182503chr6115439 5342 4997 4841 4531 3996 3936 1987 1140 452 304 2413 207 31636 1306 1101 1399
NM_182515chr19106570 4793 4522 4086 2432 2162 1804 1755 1034 91 1777 25747 4320 --
NM_182540chrX3605 322 106 --1682 --
NM_182580chr162372 1816 1743 870 341 120 ----21659 666
NM_182620chr1762018 1828 1420 682 90 50 12208 12153 --
NM_182641chr171346 --1539 --
NM_182643chr821598 812 150 ----
NM_182644chr34534 308 300 284 ------
NM_182645chr6----1112 1664
NM_182646chr433647 3631 3582 13101 ----
NM_182680chrX----136 --
NM_182691chr71198 2961 537 --11193
NM_182692chr71198 2961 537 --11193
NM_182700chr751401 1301 521 82 70 11361 ----
NM_182762chr7105421 5356 5282 5224 5122 4838 4793 2227 868 536 34513 4296 2414 ----
NM_182763chr142628 2011 1846 839 ------
NM_182764chr2051225 863 840 513 278 ------
NM_182765chr1021438 696 ------
NM_182767chr1251887 1347 612 397 385 ------
NM_182789chr51916 ------
NM_182797chr2031647 717 242 21323 1137 ----
NM_182830chr1452224 1935 1831 240 192 1684 ----
NM_182898chr731794 471 236 25679 1073 16098 --
NM_182899chr731794 471 236 25679 1073 16098 --
NM_182920chr321064 967 1996 11371 11382
NM_182931chr71221 ------
NM_182935chr392108 2026 1900 1885 1740 1617 598 232 218 12137 2321 252 2848 303
NM_182936chr1441348 1324 580 21 ------
NM_182948chr131247 1095 337 ------
NM_182964chr1153343 2992 2408 1196 143 12415 1465 --
NM_182970chr20124039 3740 3466 3320 3271 3087 3064 1326 1143 627 485 262 43480 1438 804 371 33429 2615 966 12697
NM_183002chr1441348 1324 580 21 ------
NM_183043chr133953 654 382 2749 200 ----
NM_183044chr133953 654 382 2749 200 ----
NM_183227chr621333 667 1156 ----
NM_183237chr32410 98 ----1243
NM_183238chr1263579 3311 3045 2447 883 850 --22652 1124 --
NM_183243chr72123 112 ------
NM_183243chr72123 112 ------
NM_183323chr51916 ------
NM_183381chr31735 ------
NM_183383chr31735 ------
NM_183384chr31735 ------
NM_183397chr20104948 4084 3927 1958 1275 987 914 674 494 445 --24900 3402 --
NM_183422chr131149 ------
NM_184234chr202770 270 1333 ----
NM_194247chr284394 4248 4200 3368 2993 2832 1474 1105 34373 3207 1726 ----
NM_194278chr1453402 3237 3208 1625 1015 ----2831 654
NM_194281chr181218 ------
NM_194283chr543287 2930 2722 1310 22595 820 21447 36 --
NM_194285chr1153237 703 178 168 30 12572 22955 63 --
NM_194286chr12146093 5814 5709 5246 4956 4336 4054 2039 1925 1419 1148 1063 972 838 24175 2414 24866 167 15005
NM_194291chr8------22891 2071
NM_194314chr144991 1080 654 100 24600 821 ----
NM_194317chr241734 870 804 533 1885 11963 --
NM_194318chr1342356 1892 1625 1018 22378 2143 11992 --
NM_194328chr953066 2422 956 722 89 --12800 1387
NM_194329chr953066 2422 956 722 89 --12800 1387
NM_194330chr953066 2422 956 722 89 --12800 1387
NM_194332chr953066 2422 956 722 89 --12800 1387
NM_194358chr1271686 1604 1434 1261 614 290 56 1302 --1461
NM_194359chr1271686 1604 1434 1261 614 290 56 1302 --1461
NM_194434chr1894944 4674 4484 4243 4188 3984 3842 2038 317 ------
NM_194442chr131472 1291 41 --1648 --
NM_194454chr731694 1330 118 ------
NM_194455chr731694 1330 118 ------
NM_194456chr731694 1330 118 ------
NM_197941chr542400 2155 1910 1071 1437 ----
NM_197970chr2124 21500 594 ----
NM_198040chr14784 467 313 274 --2771 428 --
NM_198057chrX2164 59 11229 --1341
NM_198074chr131225 924 152 1313 --1462
NM_198123chr8------126
NM_198124chr8------126
NM_198147chr173962 256 100 --1826 --
NM_198148chr102957 307 ------
NM_198181chr1552561 1177 1077 766 483 --11825 --
NM_198189chr2------134
NM_198240chr123541 375 85 11183 ----
NM_198243chr153876 688 41 ------
NM_198261chr12185 ------
NM_198262chr12185 ------
NM_198268chr133134 1384 264 --13422 14019
NM_198269chr133134 1384 264 --13422 14019
NM_198270chrX22346 731 1334 11073 --
NM_198281chr433135 1060 883 --22591 2165 11309
NM_198291chr2061887 1763 1334 723 536 335 11986 ----
NM_198320chr12104231 3839 3481 3475 2048 1709 1534 1032 652 84 24435 4325 31052 957 59 --
NM_198324chr1221341 927 11136 1295 1905
NM_198391chr2031152 993 604 ------
NM_198392chr692241 1998 1696 1548 1542 1501 1458 550 433 12117 12101 32371 2305 2075
NM_198393chr172105 81 ------
NM_198400chr1521983 1018 22649 1156 ----
NM_198465chrX62876 1009 946 300 196 69 21827 388 162 --
NM_198468chr674237 3613 3386 3345 1669 994 923 1771 ----
NM_198484chr3156286 6229 5807 5691 5393 5350 4768 4602 4484 2526 2389 2046 1416 1281 47 25757 4982 36212 4206 170 25035 2029
NM_198485chr351659 409 362 310 58 22188 1992 ----
NM_198490chr393352 3299 2861 2567 2162 1372 756 506 377 --2486 75 --
NM_198513chr82261 56 --2815 581 --
NM_198560chr393804 3478 3471 3102 3017 2904 2520 426 337 --52596 520 438 285 137 --
NM_198567chr51145 ------
NM_198568chr621067 295 --2838 260 21237 60
NM_198569chr642675 2303 454 205 1150 --22051 588
NM_198581chr267192 7133 7008 2111 679 231 16987 27016 4708 --
NM_198595chr4103903 3265 1933 1863 1538 1298 1047 1020 718 21 44646 4451 1459 968 34533 4027 112 --
NM_198834chr1731904 1558 186 11751 22275 1916 21994 1712
NM_198836chr1731904 1558 186 11751 22275 1916 21994 1712
NM_198837chr1731904 1558 186 11751 22275 1916 21994 1712
NM_198838chr1731904 1558 186 11751 22275 1916 21994 1712
NM_198839chr1731904 1558 186 11751 22275 1916 21994 1712
NM_198859chr364717 4304 4236 4147 1758 1527 --11975 --
NM_198880chr31709 ------
NM_198883chr1149 ------
NM_198896chr1142196 1808 235 103 --11435 2796 31
NM_198900chr12197495 7294 7120 6949 6766 5633 5536 3145 3122 2391 2262 2129 1969 1673 1438 1045 401 276 190 --37738 6621 5388 12644
NM_198904chr531833 1319 386 21412 477 11552 --
NM_198956chr751401 1301 521 82 70 11361 ----
NM_198968chr1332908 2591 288 22934 28 --1277
NM_198969chr192704 170 ------
NM_198970chr192704 170 ------
NM_198991chr181693 ----1527
NM_199040chr1233736 501 143 ----13385
NM_199129chr2041149 494 325 71 --195 --
NM_199169chr2073208 2961 2936 2848 2279 944 708 13247 23007 2785 --
NM_199170chr2073208 2961 2936 2848 2279 944 708 13247 23007 2785 --
NM_199171chr2073208 2961 2936 2848 2279 944 708 13247 23007 2785 --
NM_199188chr1253277 1470 800 361 322 1998 ----
NM_199190chr1253277 1470 800 361 322 1998 ----
NM_199320chr451826 902 529 143 128 ------
NM_199320chr451826 902 529 143 128 ------
NM_199324chr483240 3109 2633 2375 1162 1076 939 353 1211 ----
NM_199346chr21148 ------
NM_199355chr161380 --155 --
NM_199421chr1464820 4471 3659 3652 491 308 24769 1046 --11127
NM_199436chr242768 2409 2224 896 1342 --23067 2856
NM_199440chr2----179 --
NM_199461chr1093063 2574 2487 1047 1010 896 589 528 212 31215 396 234 ----
NM_199462chr1104834 4536 4436 4365 3576 1983 940 761 398 30 13381 11176 --
NM_199487chr202503 283 175 11190 152
NM_199511chr34811 701 636 227 1655 ----
NM_199512chr34811 701 636 227 1655 ----
NM_201266chr25934 806 649 600 38 42282 2254 396 116 12322 --
NM_201279chr25934 806 649 600 38 42282 2254 396 116 12322 --
NM_201432chr17166070 6027 5450 4859 4704 4594 4485 4468 2435 2352 2066 2017 1804 1212 858 358 24238 136 1378 --
NM_201433chr17166070 6027 5450 4859 4704 4594 4485 4468 2435 2352 2066 2017 1804 1212 858 358 24238 136 1378 --
NM_201521chr61376 ------
NM_201522chr61376 ------
NM_201523chr61376 ------
NM_201570chr1031469 735 227 --21822 384 11532
NM_201571chr1031469 735 227 --21822 384 11532
NM_201572chr1031469 735 227 --21822 384 11532
NM_201590chr1031469 735 227 --21822 384 11532
NM_201593chr1031469 735 227 --21822 384 11532
NM_201596chr1031469 735 227 --21822 384 11532
NM_201597chr1031469 735 227 --21822 384 11532
NM_201629chr93268 121 86 2227 171 ----
NM_201632chr571644 1615 1258 1192 614 345 329 ----1248
NM_201634chr581743 1714 1357 1291 713 444 428 99 ----1347
NM_203282chr1921703 1484 11187 ----
NM_203283chr41569 ------
NM_203284chr41569 ------
NM_203305chr981779 1604 1035 843 833 544 131 50 --31949 626 85 2505 418
NM_203327chr20124171 3816 3587 3459 3390 3056 2866 1713 1630 365 311 261 23663 3125 23848 358 --
NM_203342chr172562 2523 2400 1081 744 297 173 12216 33534 694 96 --
NM_203343chr172562 2523 2400 1081 744 297 173 12216 33534 694 96 --
NM_203346chr261846 1667 478 442 259 28 --21526 174 --
NM_203349chr1521939 698 ----1181
NM_203364chr11185 ------
NM_203379chr103806 625 227 ------
NM_203380chr103806 625 227 ------
NM_203399chr15754 677 256 140 134 ------
NM_203401chr15754 677 256 140 134 ------
NM_203406chr542915 871 642 633 ----1246
NM_203451chr1331524 259 245 12391 ----
NM_203458chr143409 1017 696 370 22363 1466 --12879
NM_203459chr1----22526 397 125
NM_203464chr13427 294 288 11261 ----
NM_203504chr452249 919 772 553 208 1652 ----
NM_203505chr452249 919 772 553 208 1652 ----
NM_205768chr12652 391 ------
NM_205836chr52607 21 ------
NM_206538chr195909 675 432 384 364 1997 ----
NM_206594chr183619 3525 2524 2497 1205 854 807 154 33394 2680 2567 --12792
NM_206595chr183619 3525 2524 2497 1205 854 807 154 33394 2680 2567 --12792
NM_206854chr643637 1699 1335 665 ------
NM_206855chr644602 2300 1630 171 1817 ----
NM_206866chr213721 650 267 1292 12119 1664
NM_206876chr222367 2271 12459 ----
NM_206907chr552990 2111 910 902 455 12065 ----
NM_206909chr8167706 7524 7241 7015 6589 6469 5706 5672 2366 2087 1765 1606 1535 1318 844 492 67999 6240 3328 1881 888 254 36073 5713 2310 11483
NM_207009chr102855 332 1376 ----
NM_207012chr1023516 2799 22806 1114 ----
NM_207113chr731368 347 94 ------
NM_207119chr1052352 2074 2003 747 534 --32155 1610 361 --
NM_207292chr363172 2882 2184 1286 721 705 1178 ----
NM_207293chr363172 2882 2184 1286 721 705 1178 ----
NM_207294chr363172 2882 2184 1286 721 705 1178 ----
NM_207295chr363172 2882 2184 1286 721 705 1178 ----
NM_207296chr363172 2882 2184 1286 721 705 1178 ----
NM_207297chr363197 2907 2209 1311 746 730 1203 ----
NM_207299chr9--1897 --1388
NM_207306chr174190 3910 3627 1688 1674 1621 103 24140 3577 21536 194 --
NM_207343chr111375 ----1466
NM_207372chr1031958 596 333 11691 ----
NM_207423chr102361 118 ------
NM_207481chr241437 1237 983 174 ------
NM_207520chr22617 590 ------
NM_207521chr22617 590 ------
NM_207577chr1151867 1842 715 464 425 1135 ----
NM_207645chr1131247 919 37 11317 ----
NM_212460chr731737 1321 583 ------
NM_212464chr1561876 1680 1480 832 381 359 ------
NM_212471chr173903 893 591 ----12175
NM_212472chr173903 893 591 ----12175
NM_212474chr22138 132 1961 ----
NM_212475chr22138 132 1961 ----
NM_212476chr22138 132 1961 ----
NM_212478chr22138 132 1961 ----
NM_212482chr22138 132 1961 ----
NM_213589chr234354 2178 84 24898 1695 --11812
NM_213590chr1364852 4666 3362 1552 1106 67 --12061 --
NM_213606chr1052682 762 606 353 29 --1894 --
NM_213648chr571644 1615 1258 1192 614 345 329 ----1248
NM_213654chr32564 470 11501 1255 --