TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-517-5p
miRNA Sequence: CCUCUAGAUGGAAGCACUGUCU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr541489 359 138 123 --11447 --
NM_000044chrX------1395
NM_000052chrX93060 2973 2235 2136 2123 1050 883 592 488 1277 ----
NM_000067chr83675 610 113 ------
NM_000084chrX126388 5048 4759 2641 2366 2347 1989 1871 987 953 501 163 12412 --1649
NM_000092chr252922 2827 1351 401 46 ----21514 212
NM_000104chr262489 2268 2224 2102 1922 28 ------
NM_000110chr111165 ------
NM_000112chr5145485 4674 4485 4190 4062 3981 3537 2230 1651 1638 1558 1340 1001 462 --25543 3419 11952
NM_000125chr643605 3552 3322 127 32898 1057 357 13890 22958 1397
NM_000163chr551550 1455 819 558 459 ------
NM_000168chr743111 2388 2244 335 21197 817 12666 1188
NM_000183chr21466 ------
NM_000202chrX53947 2800 2582 1377 66 1678 ----
NM_000210chr251970 1882 1838 931 46 ------
NM_000216chrX14079 23262 1358 13313 23990 167
NM_000222chr461816 1659 1639 1426 1348 630 ----11620
NM_000245chr732120 1580 414 ------
NM_000248chr321191 154 ------
NM_000252chrX3266 149 26 ------
NM_000259chr1546159 6152 6021 2111 15107 14896 21957 1349
NM_000276chrX51912 1901 362 185 28 2687 281 21559 402 --
NM_000337chr576596 5766 5194 4365 2291 385 55 14355 ----
NM_000345chr41702 ------
NM_000346chr1731740 1614 504 11665 --1790
NM_000390chrX83100 2627 2302 928 898 728 562 480 ------
NM_000408chr243035 2968 633 619 32511 601 364 1581 2507 439
NM_000430chr1793289 3019 2830 1250 483 290 208 118 40 13512 12628 --
NM_000439chr552175 1705 588 582 306 11820 1257 --
NM_000448chr1142364 1112 993 722 --2852 837 --
NM_000452chr13--11694 ----
NM_000462chr1511732 ------
NM_000474chr71459 --2704 93 185
NM_000489chrX32175 1174 416 13325 ----
NM_000494chr105654 349 265 238 87 ------
NM_000531chrX1243 ------
NM_000533chrX11956 ------
NM_000544chr6_cox_hap193011 2835 2771 1067 797 530 318 219 78 22723 377 22758 537 --
NM_000555chrX127610 7422 6862 5671 5310 5267 4953 2867 2025 1093 787 449 ----17715
NM_000572chr13193 45 32 ------
NM_000598chr731058 480 143 11188 ----
NM_000618chr12116570 5339 5241 5082 4638 1980 1833 984 634 369 205 11458 ----
NM_000618chr12116570 5339 5241 5082 4638 1980 1833 984 634 369 205 11458 ----
NM_000633chr1884583 4200 3721 1677 1088 922 873 463 ------
NM_000719chr1266591 6112 5025 4752 412 92 25549 4993 24624 2368 15524
NM_000724chr1021309 735 11244 1647 --
NM_000726chr22262 175 ------
NM_000788chr441340 995 583 90 ------
NM_000793chr1454114 3684 3193 660 514 33540 1356 894 23824 3527 --
NM_000809chr4119242 9104 8032 6661 3727 3588 1798 1554 1521 1196 760 27156 280 1878 --
NM_000813chr52660 549 1963 11780 1644
NM_000816chr52593 238 ------
NM_000817chr22874 407 --11213 --
NM_000829chr11------1701
NM_000831chr1126316 6191 5269 5091 5063 4446 4349 4306 4208 2006 1593 717 35172 1266 1176 35674 4170 1440 --
NM_000840chr73172 113 34 ------
NM_000875chr1576955 6516 5382 5054 4588 2063 1380 14283 --1523
NM_000885chr262151 2017 1685 1653 873 660 1327 --1466
NM_000895chr12------127
NM_000899chr1254152 3578 3229 477 277 --1104 --
NM_000910chr451594 1366 777 499 282 11491 ----
NM_000912chr853052 2878 1427 1396 59 --1221 1123
NM_000921chr12176 ------
NM_000935chr331275 835 825 ------
NM_000959chr193868 3758 3298 3264 3085 2648 2486 1381 583 --13538 1751
NM_000962chr992877 2789 2587 2427 853 474 314 156 130 --125 --
NM_000963chr132485 2294 1940 ------
NM_001001323chr1222500 1947 12400 ----
NM_001001395chr1262396 1969 1788 1132 728 602 ------
NM_001001419chr564858 4495 3963 3643 1193 584 11112 --21704 55
NM_001001420chr564858 4495 3963 3643 1193 584 11112 --21704 55
NM_001001549chr772499 2463 1954 952 832 47 31 ------
NM_001001550chr772499 2463 1954 952 832 47 31 ------
NM_001001555chr772499 2463 1954 952 832 47 31 ------
NM_001001664chr243455 3021 2741 951 11422 ----
NM_001001668chr1953643 3556 1603 1584 91 11536 23636 378 13857
NM_001001938chr974117 3422 3045 2629 1243 572 477 1248 13006 11044
NM_001002257chr253434 3327 2392 345 32 22233 2198 ----
NM_001002814chr853653 3145 2928 2827 830 23043 700 --23137 583
NM_001002838chrX41450 1421 429 121 ------
NM_001002860chr1444177 4024 3015 768 22994 1776 23762 3548 --
NM_001002919chr2------1456
NM_001003652chr18128309 7220 7193 7084 6075 5903 5744 3220 2943 515 407 195 11907 ----
NM_001003679chr12499 159 ------
NM_001003688chr4125 --1420 1783
NM_001003712chr1233630 3573 915 ----1846
NM_001003810chr42671 660 --1792 --
NM_001003940chr1542854 1210 1133 46 --32655 1478 1114 --
NM_001003942chr1542854 1210 1133 46 --32655 1478 1114 --
NM_001003943chr1542858 1214 1137 50 --32659 1482 1118 --
NM_001004065chr943309 3281 3157 190 43705 2456 1013 376 43941 2793 2718 909 --
NM_001004316chr3------1284
NM_001004317chr694275 3937 3804 3405 1456 1385 1368 942 430 34193 1034 981 34405 3441 608 13834
NM_001004323chr7--123 ----
NM_001004329chr1241406 1367 94 54 ------
NM_001004419chr1273109 3038 1377 1020 1001 105 74 --1525 --
NM_001005375chrY61519 1142 709 541 273 59 ------
NM_001005386chr292421 2309 2144 2059 1744 706 637 267 218 ------
NM_001005404chr1764097 4007 3890 3335 3035 1127 24464 461 ----
NM_001005463chr103979 852 725 ----12235
NM_001005473chr565544 4677 2651 1641 1531 1227 --26415 5226 --
NM_001005502chr1284570 4381 4170 3568 1813 1149 829 610 1102 ----
NM_001005746chr22262 175 ------
NM_001005747chr22262 175 ------
NM_001005861chr35793 318 273 188 141 ------
NM_001006118chrY1228 ------
NM_001006120chrY1228 ------
NM_001006610chr16--1813 ----
NM_001006612chrX1118 ------
NM_001006613chrX1118 ------
NM_001006614chrX1118 ------
NM_001007023chr1454114 3684 3193 660 514 33540 1356 894 23824 3527 --
NM_001007067chr81425 ------
NM_001007068chr81425 ------
NM_001007069chr81425 ------
NM_001007070chr81425 ------
NM_001007097chr954139 4068 3233 1190 912 13479 13852 --
NM_001007257chr121496 163 ------
NM_001007267chr22774 592 ------
NM_001007466chr665072 4096 1080 446 429 21 14296 1173 --
NM_001007471chr9--1270 ----
NM_001007526chrY1228 ------
NM_001008541chr1021868 1597 11908 ----
NM_001008541chr1021868 1597 11908 ----
NM_001008707chr1411849 --11265 --
NM_001008708chr21244 ------
NM_001008726chr1431351 458 293 ----21486 1142
NM_001008777chr173213 142 51 ----127
NM_001008895chr1311170 --1453 11400
NM_001009554chr474569 3782 3634 3413 3260 3224 1271 14396 13151 14339
NM_001009554chr474569 3782 3634 3413 3260 3224 1271 14396 13151 14339
NM_001009881chr11167 ------
NM_001009882chr11167 ------
NM_001009899chr3125713 5513 5259 5193 5134 4846 4049 2019 1914 1375 566 447 25662 2441 ----
NM_001009958chr71249 ------
NM_001010862chrX63031 2860 2376 1004 866 566 --12358 --
NM_001010867chr1115912 5185 4858 4741 4225 2613 2028 1480 1345 1220 591 14794 1503 16290
NM_001010888chrX84206 4027 1867 1634 934 459 340 109 13157 --1772
NM_001010891chr586448 5128 4601 2545 2207 1684 731 452 ------
NM_001010895chr91617 1671 --1141
NM_001010908chr104782 739 575 525 ------
NM_001010986chrX1232 --21875 87 --
NM_001011513chr453525 3167 3037 307 74 --13612 13427
NM_001011515chr43979 747 729 ------
NM_001011516chr43979 747 729 ------
NM_001011537chr362335 1845 1783 1757 882 355 1469 --1650
NM_001011538chr41847 ----1364
NM_001011546chr20----1122 --
NM_001011645chrX------1395
NM_001011657chrX31190 358 62 ------
NM_001011666chr7116285 6168 5871 5678 5637 4636 4050 2257 1803 792 75 21209 937 --16100
NM_001012393chr1144850 4464 1486 115 --15008 --
NM_001012420chr1572592 2407 2386 2181 1156 1075 885 --1536 --
NM_001012423chr1562592 2407 2181 1156 1075 885 --1536 --
NM_001012456chr7--134 ----
NM_001012614chr43508 498 273 ------
NM_001012761chr522630 2378 11895 12103 --
NM_001012989chrX3645 494 459 ------
NM_001013031chr1052564 2229 1072 887 344 22551 2371 22601 186 --
NM_001013398chr731058 480 143 11188 ----
NM_001013620chr1298260 8098 7891 7101 5468 3367 1902 1620 597 --45661 1083 865 817 11099
NM_001014380chr1395461 4187 3979 2293 1179 743 516 495 313 ------
NM_001014797chr10157540 7396 6789 6269 6157 5875 5745 5690 5379 3069 2741 2609 2370 2299 2243 16006 37159 6883 6471 26112 1546
NM_001014972chr21213 ------
NM_001015877chrX62730 2280 1122 1095 945 303 --42880 2583 2537 328 --
NM_001015882chr9168 ------
NM_001017369chr42735 355 --1850 177
NM_001017415chr13690 175 122 ------
NM_001017416chr13690 175 122 ------
NM_001017424chr121834 1816 11332 ----
NM_001017425chr121834 1816 11332 ----
NM_001017970chr1421971 325 1624 ----
NM_001017995chr584506 4351 4035 4016 3395 1349 210 22 34653 624 351 --11534
NM_001018004chr151639 ------
NM_001018006chr151639 ------
NM_001018007chr151639 ------
NM_001018009chr31894 155 11015 --
NM_001018020chr151639 ------
NM_001018053chr121738 440 1137 --21907 596
NM_001018065chr9124979 3983 3867 2280 2210 2013 1130 745 656 648 626 328 14482 1298 --
NM_001018066chr9124979 3983 3867 2280 2210 2013 1130 745 656 648 626 328 14482 1298 --
NM_001018067chr1115211 4988 4976 4392 4258 4013 1831 1439 1351 383 210 14613 ----
NM_001018068chr1115211 4988 4976 4392 4258 4013 1831 1439 1351 383 210 14613 ----
NM_001018069chr1115211 4988 4976 4392 4258 4013 1831 1439 1351 383 210 14613 ----
NM_001018089chr1583656 3508 3443 1523 829 668 117 58 ----13194
NM_001023567chr153888 539 103 ------
NM_001024660chr321432 432 --1637 --
NM_001024847chr352129 1981 981 763 739 21879 1686 ----
NM_001024934chr61269 ------
NM_001024935chr61269 ------
NM_001024936chr61269 ------
NM_001024948chr163000 2823 2314 1365 924 432 ------
NM_001024956chr1195669 5303 4326 4011 2290 2086 1223 780 617 11875 --15739
NM_001025068chr321203 36 ----11424
NM_001025069chr321203 36 ----11424
NM_001025076chr1063807 1824 1459 1115 1019 854 --21988 506 --
NM_001025077chr10105165 5095 4618 2817 2473 2377 2212 996 671 484 24835 429 21864 983 1700
NM_001025079chr3104163 4087 3136 2780 2686 1453 1230 1220 330 315 13233 ----
NM_001025201chr22712 97 ------
NM_001025252chr8102692 2539 2160 2142 2047 1149 859 853 632 333 13040 12830 --
NM_001025253chr8102692 2539 2160 2142 2047 1149 859 853 632 333 13040 12830 --
NM_001025366chr6--1309 ----
NM_001025366chr6--1309 ----
NM_001025367chr6--1309 ----
NM_001025367chr6--1309 ----
NM_001025368chr6--1309 ----
NM_001025368chr6--1309 ----
NM_001025369chr6--1325 ----
NM_001025369chr6--1325 ----
NM_001025370chr6--1309 ----
NM_001025370chr6--1309 ----
NM_001025580chrX84017 3395 3082 1359 1222 1091 927 209 --11471 11231
NM_001025595chr41596 ------
NM_001029858chr653092 2607 2387 1239 628 32924 516 171 ----
NM_001029859chr1122195 679 123 1600 12331
NM_001029875chr521061 963 --12708 --
NM_001029882chr11280 ------
NM_001029882chr11280 ------
NM_001029883chr292372 2006 1962 1168 1144 1048 941 671 230 12937 12515 --
NM_001029884chr622686 269 2735 665 22535 2135 --
NM_001029989chr152111 29 ------
NM_001030055chr1474663 3609 1836 1497 964 816 50 1195 13485 --
NM_001031692chr71311 ------
NM_001031695chr2284805 4774 3983 2117 1950 1929 1633 817 13343 1766 12156
NM_001031732chr463529 3338 2713 2684 1272 305 ------
NM_001031748chr121237 ------
NM_001031804chr1654004 3917 3780 3536 1116 14446 2532 82 --
NM_001032282chr81819 --1478 --
NM_001032283chr123845 821 237 ----1689
NM_001032284chr123845 821 237 ----1689
NM_001032293chr172249 241 --1488 --
NM_001032380chr1021562 482 193 ----
NM_001032393chrX3738 662 302 ------
NM_001032394chr652508 2496 2226 890 511 22689 440 ----
NM_001032395chr652375 2363 2093 757 378 22556 307 ----
NM_001032730chr11691 ------
NM_001033045chr294235 3778 3001 2867 2812 2794 1524 1187 723 14446 ----
NM_001033049chr2142188 2181 732 297 11832 ----
NM_001033503chr53389 369 119 ------
NM_001033506chr111117 ------
NM_001033557chr221418 1259 11030 1513 --
NM_001033576chr1722543 2497 --12187 21057 91
NM_001033578chr822007 1945 --12174 --
NM_001033602chr1342438 1929 364 227 ------
NM_001033756chr6--1243 ----
NM_001033756chr6--1243 ----
NM_001034845chr41415 ------
NM_001034954chr1052215 887 795 467 440 1354 1752 --
NM_001034955chr1052215 887 795 467 440 1354 1752 --
NM_001034956chr1052215 887 795 467 440 1354 1752 --
NM_001034957chr1052215 887 795 467 440 1354 1752 --
NM_001035505chr2179 ------
NM_001035511chr141611 1417 519 436 --12050 1674
NM_001035512chr151718 1524 626 543 108 --12157 1781
NM_001035513chr151718 1524 626 543 108 --12157 1781
NM_001037131chr211086 ------
NM_001037172chr31998 ------
NM_001037334chr1852435 2314 2188 1943 722 11485 22002 78 --
NM_001037535chrX31390 1371 23 --41031 565 448 41 --
NM_001037536chrX31390 1371 23 --41031 565 448 41 --
NM_001037540chrX31390 1371 23 --41031 565 448 41 --
NM_001037582chr481661 1564 1480 1394 1167 700 555 250 ------
NM_001039465chr141506 ------
NM_001039569chr242803 932 574 316 1746 ----
NM_001039577chr1134248 4210 3437 1819 1735 1526 1408 744 690 616 365 205 97 11006 ----
NM_001039585chr194125 4015 3555 3521 3342 2905 2743 1638 840 --13795 11008
NM_001039590chrX43260 950 581 494 ----13918
NM_001039591chrX43260 950 581 494 ----13918
NM_001039618chr1154166 4110 2333 2169 759 25505 862 ----
NM_001039840chrX85351 4632 4042 2162 1215 1031 428 366 25746 4061 11436 --
NM_001039916chr1221205 381 ------
NM_001039917chr1221205 381 ------
NM_001039918chr1221205 381 ------
NM_001039919chr1221205 381 ------
NM_001039920chr1221205 381 ------
NM_001039937chr1343516 3376 3156 1167 13813 11480 --
NM_001039960chr1221070 274 ------
NM_001040020chr721250 244 ------
NM_001040101chr411229 --2395 93 11360
NM_001040142chr221528 640 1190 ----
NM_001040143chr221528 640 1190 ----
NM_001040152chr794686 4536 4311 3142 1640 1305 874 636 356 14112 24826 3342 13574
NM_001040284chr1665644 5535 5467 5064 4750 1987 --11884 13866
NM_001040402chr432635 1127 489 1310 1517 --
NM_001040424chr2182889 2800 2716 2195 2156 483 182 59 --1406 --
NM_001040429chr1343590 3523 3029 2193 ----12961
NM_001040441chr124816 2183 23518 1982 13535 11424
NM_001040450chr1552657 2350 883 615 194 1984 ----
NM_001040453chr1552657 2350 883 615 194 1984 ----
NM_001040647chr72474 418 --1541 --
NM_001040648chr72474 418 --1541 --
NM_001042355chr16135075 4653 4537 4530 4103 3996 2084 1713 1094 928 914 679 201 1475 44999 4313 4086 3511 25353 1934
NM_001042406chr631242 965 439 ----11153
NM_001042412chr16135075 4653 4537 4530 4103 3996 2084 1713 1094 928 914 679 201 1475 44999 4313 4086 3511 25353 1934
NM_001042440chr561942 1873 1796 1645 419 118 ------
NM_001042441chr561942 1873 1796 1645 419 118 ------
NM_001042442chr561942 1873 1796 1645 419 118 ------
NM_001042443chr561942 1873 1796 1645 419 118 ------
NM_001042444chr561942 1873 1796 1645 419 118 ------
NM_001042445chr561942 1873 1796 1645 419 118 ------
NM_001042446chr561942 1873 1796 1645 419 118 ------
NM_001042473chr1021838 1487 11993 ----
NM_001042548chr22813 635 ----1202
NM_001042550chr931751 1330 529 ------
NM_001042599chr286478 5369 2550 2260 2050 1846 1771 171 22850 259 25455 2297 11881
NM_001042601chr372943 2917 2510 1313 1294 1287 1086 --12001 --
NM_001042603chr1255302 5123 3582 669 365 --1286 --
NM_001042604chr343162 1131 634 555 --23476 1841 13665
NM_001044385chr254063 3093 1368 1184 312 --13002 --
NM_001046chr52905 842 22555 1032 1895 12722
NM_001048183chr153800 3303 3296 2982 664 13114 --1455
NM_001050chr172278 106 --11168 1247
NM_001079874chr142109 1585 1532 201 11503 ----
NM_001099678chr386160 5270 5132 3963 2539 1590 510 188 14003 ----
NM_001100108chr1117111 7101 6979 6609 3186 3000 2935 2837 2440 2049 1798 --15911 --
NM_001106chr3139757 9606 9366 9079 8531 7320 6962 6147 6081 3057 1735 629 423 18353 17539 23810 1606
NM_001107chr141210 ------
NM_001113490chrX52694 2390 661 557 333 33537 461 408 1690 --
NM_001115chr8185 ------
NM_001117chr1812325 1180 ----
NM_001121chr1021563 645 --11215 --
NM_001123chr10----1133 --
NM_001135chr15------1252
NM_001167chrX106466 6184 5945 5235 2605 2305 1899 902 390 325 14711 34394 2511 477 --
NM_001173chr1474663 3609 1836 1497 964 816 50 1195 13485 --
NM_001200chr20148 ------
NM_001201chr453865 3824 2852 2623 280 1291 ----
NM_001204chr256294 6268 2839 1928 1408 --16575 --
NM_001241chr252047 1691 738 602 387 ------
NM_001241chr252047 1691 738 602 387 ------
NM_001254chr172826 405 ----148
NM_001256chr1732535 1810 436 11915 11868 --
NM_001259chr796114 6051 5353 4450 2476 2414 2314 2243 128 11035 35844 2039 104 25054 4002
NM_001269chr1----1970 --
NM_001270chr551083 928 763 329 27 ------
NM_001326chr111174 ------
NM_001328chr43508 498 273 ------
NM_001331chr1122848 873 ----22397 479
NM_001351chr331493 1434 178 ------
NM_001356chrX52425 1765 1676 645 325 ------
NM_001358chr41358 ------
NM_001364chr1164543 4269 3965 3496 1266 42 --11558 --
NM_001386chr811930 11549 ----
NM_001391chr183767 243 205 1335 ----
NM_001394chr82614 208 ------
NM_001401chr93619 542 284 --1272 --
NM_001412chrX43583 3289 1457 1232 13107 13696 --
NM_001415chrX31899 1292 344 ----11746
NM_001418chr111221 ------
NM_001418chr111221 ------
NM_001422chr1131302 475 270 1340 ----
NM_001438chr142989 2497 807 81 ------
NM_001451chr1631194 1068 385 --1510 --
NM_001482chr15----1861 --
NM_001527chr654720 4430 3284 1908 429 ----13214
NM_001530chr1421019 88 1295 ----
NM_001546chr621373 350 280 53 ----
NM_001587chrX51912 1901 362 185 28 2687 281 21559 402 --
NM_001609chr1063961 3479 3165 791 493 313 33974 3893 2905 ----
NM_001616chr242796 2745 2226 47 22451 2163 11330 --
NM_001621chr782784 2465 2452 1879 1095 781 579 161 1422 ----
NM_001621chr782784 2465 2452 1879 1095 781 579 161 1422 ----
NM_001650chr1874021 3841 3235 3045 2917 1244 1043 ------
NM_001656chr511381 ------
NM_001681chr121694 ------
NM_001682chr1212214 12114 --11055
NM_001693chr811255 1919 11021 --
NM_001699chr19101577 1514 1462 1320 1272 1250 1131 459 306 291 --1269 --
NM_001701chr91388 11634 --11200
NM_001709chr1141988 1764 1012 410 --12189 --
NM_001718chr631315 1199 992 ------
NM_001730chr1321337 198 1448 ----
NM_001730chr1321337 198 1448 ----
NM_001750chr561942 1873 1796 1645 419 118 ------
NM_001759chr1264537 3855 3596 1430 340 144 23801 306 14019 --
NM_001777chr3104163 4087 3136 2780 2686 1453 1230 1220 330 315 13233 ----
NM_001789chr31529 21509 486 --21356 1244
NM_001799chr51196 ------
NM_001806chr1912738 11030 22324 25 12070
NM_001822chr22712 97 ------
NM_001858chr684689 4489 3911 3760 1490 1342 1309 50 ------
NM_001859chr963923 2762 2615 1410 858 282 13940 ----
NM_001873chr4172 ------
NM_001874chr1284570 4381 4170 3568 1813 1149 829 610 1102 ----
NM_001880chr2129 ------
NM_001884chr51416 ------
NM_001889chr1137 --1684 1137
NM_001903chr52787 184 ------
NM_001918chr179225 7930 6944 3637 3325 2882 948 15757 --23559 3383
NM_001938chr131689 545 251 11221 --1125
NM_001941chr1863867 2882 1486 1119 1105 1080 --21112 42 13136
NM_001950chr161678 --1659 --
NM_001955chr611101 ------
NM_001957chr442071 1758 1549 1422 ----1396
NM_001967chr31435 --1198 --
NM_001969chr1433486 1281 1023 12629 --22510 175
NM_001970chr171491 ------
NM_001981chr152044 690 674 320 297 ----1682
NM_001982chr1221274 786 2872 285 155 --
NM_001987chr1264145 3894 3177 2718 1457 161 --1371 --
NM_001999chr531086 471 167 --1500 --
NM_002006chr484406 3834 1914 1246 877 304 241 54 14259 13854 --
NM_002009chr1562484 2416 2365 2357 2324 2264 ------
NM_002017chr1121288 1164 ------
NM_002025chrX86616 6207 6112 2741 2441 1070 880 850 28596 3640 27604 7244 16763
NM_002035chr1873960 3783 3575 3447 830 744 227 1344 ----
NM_002040chr2152065 411 351 186 101 --148 --
NM_002069chr731669 504 72 ------
NM_002089chr42652 181 ------
NM_002092chr4134870 4737 4571 4367 4196 3450 3405 1897 1728 920 858 623 170 2546 109 ----
NM_002128chr1342218 2178 1874 172 ------
NM_002136chr121133 ------
NM_002137chr731471 719 710 12136 ----
NM_002138chr42671 660 --1792 --
NM_002163chr162513 426 ------
NM_002165chr201411 ------
NM_002166chr21503 ------
NM_002223chr1253869 3688 2820 1399 585 33242 1199 269 ----
NM_002264chr3114540 4055 3560 3407 1597 1581 925 717 444 276 163 ------
NM_002265chr1721108 928 ----1799
NM_002267chr1352065 1774 673 299 218 11716 ----
NM_002336chr1274430 4015 3986 1268 723 686 550 31190 149 91 23775 69 --
NM_002345chr122523 484 ------
NM_002387chr5115020 4807 3707 3680 3213 1975 1608 1487 946 788 402 --13155 --
NM_002392chr12157 ------
NM_002444chrX51724 279 113 102 89 --1511 1438
NM_002451chr942829 2651 928 178 1161 1409 --
NM_002467chr81432 ------
NM_002469chr12173 ------
NM_002479chr11214 ------
NM_002486chr93870 741 314 ----12247
NM_002489chr72350 31 ------
NM_002500chr211283 ------
NM_002515chr1431433 808 345 --11835 11864
NM_002533chr1123 ------
NM_002545chr1144850 4464 1486 115 --15008 --
NM_002547chrX23308 2946 12663 ----
NM_002556chr1122054 425 1696 ----
NM_002569chr1511541 ------
NM_002577chr373729 3285 2931 2837 2533 827 662 ------
NM_002578chrX--1359 ----
NM_002581chr975159 4449 3490 1698 1668 1247 793 11631 1317 35032 610 392
NM_002583chr12----1494 --
NM_002594chr2021724 745 ------
NM_002595chr1251798 1476 727 604 227 ------
NM_002610chr262634 2499 2205 1947 860 854 ------
NM_002618chr2----140 --
NM_002623chr203686 631 286 --1226 --
NM_002639chr1841131 1053 249 86 ------
NM_002655chr831654 1091 315 --1919 --
NM_002667chr631288 850 21 11274 ----
NM_002670chr331387 1027 157 ------
NM_002706chr22701 542 ------
NM_002709chr243327 3045 1355 967 --12673 1585
NM_002715chr521189 188 ------
NM_002719chr1432000 1749 897 ------
NM_002720chr161261 ------
NM_002731chr143088 1963 1132 970 1807 ----
NM_002734chr1722174 393 --1868 --
NM_002753chr4--1617 ----
NM_002822chr1251540 1470 512 402 300 --11305 --
NM_002837chr1274349 4021 3093 1743 1595 1408 532 31355 815 418 13741 1128
NM_002890chr51679 1361 ----
NM_002892chr1441477 1109 1084 493 ------
NM_002902chr151465 ------
NM_002906chr1141463 928 846 758 12225 ----
NM_002912chr61852 ------
NM_002956chr1261182 1084 1045 916 395 126 ------
NM_002957chr953472 1581 1084 922 340 22977 1026 1428 23580 3416
NM_002958chr35793 318 273 188 141 ------
NM_002959chr163646 3381 2863 1746 1198 900 11058 12756 24035 1650
NM_002968chr161270 --1165 1702
NM_002970chrX2312 40 ------
NM_002977chr212660 12943 1693 --
NM_002994chr451833 1244 792 668 560 1511 161 --
NM_002998chr81165 --11985 --
NM_003001chr151718 1524 626 543 108 --12157 1781
NM_003016chr17--1430 ----
NM_003022chrX11313 ------
NM_003031chr16--1813 ----
NM_003042chr332217 1737 1672 --12251 --
NM_003043chr354241 3161 2653 1460 1094 2828 347 14288 --
NM_003051chr131851 626 301 1503 --1311
NM_003071chr331996 74 49 ----189
NM_003095chr122248 39 ------
NM_003108chr266994 6969 6305 5517 1631 476 14630 36896 6745 318 1524
NM_003114chr81226 --1534 --
NM_003118chr541897 1558 492 434 21992 100 --1791
NM_003133chr11117 3242 163 60 --1155
NM_003139chr11----175 --
NM_003155chr822552 358 ------
NM_003157chr32901 288 --2602 46 --
NM_003185chr201450 ------
NM_003199chr1814462 --14828 13697
NM_003216chr2263009 2429 1232 1061 955 905 22437 2383 21166 297 12633
NM_003222chr201308 ------
NM_003236chr263317 2777 2684 2405 2259 1045 22432 201 12862 --
NM_003242chr352129 1981 981 763 739 21879 1686 ----
NM_003244chr18--1325 ----
NM_003247chr631828 460 218 ------
NM_003257chr1521336 227 --191 --
NM_003262chr345085 4454 3747 781 13877 --1839
NM_003286chr201908 1147 11059 --
NM_003320chr1174432 3980 3299 1530 1104 1001 38 14216 23381 1744 --
NM_003337chr53631 342 135 ------
NM_003339chr511067 ------
NM_003341chr31261 ----1440
NM_003344chr741628 1487 1160 157 ------
NM_003360chr41236 ------
NM_003368chr13690 175 122 ------
NM_003375chr102324 147 ------
NM_003376chr6--1309 ----
NM_003376chr6--1309 ----
NM_003392chr373399 3288 3110 1493 1291 803 83 14040 22810 1530 --
NM_003406chr831875 571 544 ------
NM_003411chrY1635 ------
NM_003413chrX41970 1919 1871 1763 ----11234
NM_003418chr31612 ------
NM_003457chr172249 241 --1488 --
NM_003473chr10----1173 --
NM_003483chr1222391 506 ------
NM_003489chr2163077 2927 2544 2536 2160 1077 12406 1968 --
NM_003506chr82918 255 ------
NM_003517chr1----140 --
NM_003566chr122784 248 ------
NM_003567chr1123 ------
NM_003574chr1864944 4887 1905 1397 644 394 15297 ----
NM_003583chr1253637 2643 1102 1005 750 1537 11158 --
NM_003589chr1311170 --1453 11400
NM_003590chr273845 3557 2817 2644 1532 300 122 13608 --1704
NM_003603chr421513 684 ------
NM_003618chr221025 31 ------
NM_003620chr171337 ------
NM_003626chr1121074 191 ------
NM_003629chr162563 1317 1295 992 186 169 12660 ----
NM_003630chr62178 76 --1649 --
NM_003633chr562422 2160 1774 1670 914 833 22605 452 ----
NM_003635chr10183 ------
NM_003645chr15------1179
NM_003654chr111508 ------
NM_003663chr343433 1255 1038 960 --2438 218 --
NM_003664chr52144 23 ------
NM_003671chr962354 2340 1013 679 150 38 13112 22826 915 --
NM_003672chr13537 415 57 ------
NM_003681chr2196107 5920 5882 4958 3926 2447 1470 1431 84 23768 1323 25811 4567 --
NM_003692chr93935 399 133 ------
NM_003701chr132835 818 ------
NM_003758chr1511160 ------
NM_003758chr1511160 ------
NM_003759chr443784 1677 1208 658 --33904 1045 114 --
NM_003760chr1----1713 --
NM_003766chr17--1541 ----
NM_003769chr121324 ------
NM_003787chr1811500 --11649 --
NM_003791chr161123 ------
NM_003797chr11127 ------
NM_003800chr652254 2149 1652 391 359 --12171 --
NM_003816chr831371 945 502 11022 ----
NM_003825chr1511302 ------
NM_003860chr111352 ------
NM_003870chr154608 379 299 63 ------
NM_003873chr1032227 1827 1655 ------
NM_003877chr123838 243 86 ------
NM_003913chr633414 3387 3054 --23363 3215 1158
NM_003924chr451277 1221 591 573 439 ----11476
NM_003930chr732195 1990 54 12439 --1397
NM_003931chr61269 ------
NM_003934chr91132 ------
NM_003980chr6----1105 11144
NM_003982chr142257 55 ----1336
NM_003994chr1254152 3578 3229 477 277 --1104 --
NM_003998chr41619 ------
NM_004028chr1874021 3841 3235 3045 2917 1244 1043 ------
NM_004050chr1452638 2195 1791 997 575 22305 645 22574 2318 --
NM_004075chr122536 452 ------
NM_004080chr71447 ------
NM_004081chrY61519 1142 709 541 273 59 ------
NM_004094chr1432866 1218 878 22512 237 --1573
NM_004096chr1031937 1393 271 ------
NM_004112chr17121509 1480 1244 559 516 477 466 413 403 364 151 21 ------
NM_004114chrX21051 186 ------
NM_004124chr1473384 3176 3155 3131 720 704 552 ----11272
NM_004161chr231274 1148 330 ------
NM_004162chr31405 ------
NM_004171chr11188784 8477 8090 7645 7132 6542 6369 3695 3601 3393 3363 2670 2378 1983 1953 465 251 139 37528 6269 6163 17160 28579 6197
NM_004172chr531689 1413 594 11717 --11552
NM_004175chr221111 ------
NM_004202chrY1621 --2679 260 --
NM_004232chr1853889 2951 2601 743 527 --1217 --
NM_004234chr192150 33 ------
NM_004236chr151527 ------
NM_004272chr541784 1615 333 173 11939 1407 --
NM_004274chr1473193 2482 2454 2258 2157 443 397 32379 2350 1137 ----
NM_004277chr651525 1228 1157 335 154 ------
NM_004282chr61208 ----1199
NM_004293chr961420 1223 981 873 565 547 12936 --23710 3129
NM_004311chr1083121 2872 2794 1047 984 751 314 140 ------
NM_004331chr82245 215 ------
NM_004342chr731985 676 358 ----1177
NM_004349chr8------1236
NM_004389chr22820 788 ------
NM_004397chr1173562 3484 3421 2980 1150 1090 496 13996 11533 --
NM_004415chr61688 ------
NM_004432chr922072 805 1589 ----
NM_004434chr1411849 --11265 --
NM_004437chr173170 3104 2871 2593 2215 1347 173 --23535 1082 --
NM_004440chr61457 ------
NM_004447chr1221078 162 ----11067
NM_004449chr21----1326 --
NM_004456chr7177 ------
NM_004458chrX42603 1945 1825 60 --12314 --
NM_004501chr183614 3231 3076 2919 1421 1151 1031 126 --13647 --
NM_004505chr1721861 1340 ----1399
NM_004516chr1911185 ----1279
NM_004537chr1241525 1029 1018 404 1411 11071 --
NM_004543chr2165 ------
NM_004562chr621447 918 1399 --11406
NM_004571chr2121186 1135 23308 2693 --1663
NM_004586chrX54620 3886 2088 836 198 1743 ----
NM_004612chr994451 3577 3296 1923 1849 1293 1177 979 436 1320 ----
NM_004627chr212713 109 ------
NM_004650chrX4478 400 76 37 11380 11551 --
NM_004654chrY21209 552 ------
NM_004660chrY42296 1697 1476 323 ------
NM_004661chr521129 900 ------
NM_004687chr1751527 1485 280 237 150 --1505 1650
NM_004703chr1732084 1779 1590 1121 3408 138 55 --
NM_004726chrX74856 4508 4050 1876 1472 523 316 15005 ----
NM_004738chr20112623 2370 2333 2192 2165 1610 1007 971 816 390 190 21788 884 22453 2353 1843
NM_004742chr321502 670 ------
NM_004744chr443345 1580 1441 116 --13901 --
NM_004745chr8105201 5020 4873 4795 4764 2429 2119 2075 424 374 15914 1316 --
NM_004757chr41115 130 ----
NM_004768chr11172 ------
NM_004772chr51400 ----1134
NM_004788chr1152239 2165 1769 482 240 1138 ----
NM_004799chr11291 ------
NM_004815chr144560 4120 1547 711 14041 --11445
NM_004834chr263011 2975 2839 1200 1161 76 12132 ----
NM_004844chr31894 155 11015 --
NM_004856chr152580 466 ------
NM_004859chr1763017 2846 2640 2362 804 194 ------
NM_004863chr1445208 5007 3940 1185 1425 --25142 3389
NM_004866chr564748 3913 3492 1515 1414 558 11924 23702 3561 23598 361
NM_004869chr1811324 ------
NM_004904chr7116285 6168 5871 5678 5637 4636 4050 2257 1803 792 75 21209 937 --16100
NM_004946chr53405 126 51 ------
NM_004956chr763551 3430 3413 1021 845 746 --33058 3021 2954 --
NM_004958chr12891 292 --1760 --
NM_004964chr11410 ------
NM_004965chr212713 108 ------
NM_004969chr101401 1106 ----
NM_004973chr61418 ----1131
NM_004985chr12104046 3819 3742 3544 3507 3342 1531 1324 1113 482 ------
NM_004992chrX128304 8036 7230 6943 6033 5888 2791 2372 1930 1589 778 140 38240 6233 360 --21577 511
NM_004992chrX128304 8036 7230 6943 6033 5888 2791 2372 1930 1589 778 140 38240 6233 360 --21577 511
NM_004993chr1461511 1166 1094 1003 487 22 ------
NM_004999chr693443 3295 1759 1200 585 577 381 316 95 23555 2743 14276 11257
NM_005006chr21923 ------
NM_005023chr5----11071 --
NM_005044chrX31473 153 21 ------
NM_005056chr1255546 5367 3826 913 609 --1530 --
NM_005058chrY1228 ------
NM_005065chr1455242 4432 3536 1906 260 14235 --11612
NM_005066chr1149 ------
NM_005068chr631426 1221 591 2579 98 ----
NM_005079chr8102692 2539 2160 2142 2047 1149 859 853 632 333 13040 12830 --
NM_005080chr22--142 ----
NM_005102chr22813 635 ----1202
NM_005124chr6--1738 ----
NM_005140chrX4775 405 71 59 1664 ----
NM_005151chr1852435 2314 2188 1943 722 11485 22002 78 --
NM_005153chr162793 230 ----192
NM_005156chr933875 1087 963 14809 ----
NM_005160chr2296570 5913 5509 4545 2706 2186 2066 1929 1857 34795 2664 2463 15185 --
NM_005168chr221166 261 --21177 477 21306 1113
NM_005171chr12--1977 ----
NM_005188chr1198237 7642 7509 7295 6309 6105 5910 1714 593 47970 7327 6853 5262 27356 29 25602 2265
NM_005197chr1465517 4749 4342 2115 1864 1438 --14864 16049
NM_005235chr286478 5369 2550 2260 2050 1846 1771 171 22850 259 25455 2297 11881
NM_005238chr1143340 2337 1322 1306 23518 3403 --12880
NM_005254chr1531287 510 173 ------
NM_005256chr113690 615 268 1640 ----
NM_005261chr8----1239 --
NM_005311chr772499 2463 1954 952 832 47 31 ------
NM_005316chr1131113 922 63 ------
NM_005338chr733823 3125 1622 --13919 13410
NM_005359chr1886299 4545 4026 2011 1955 1327 782 314 26091 1641 14735 --
NM_005384chr9131 ------
NM_005388chr961394 658 652 578 453 330 --11373 --
NM_005402chr731525 607 466 ------
NM_005409chr44423 370 353 260 1360 ----
NM_005436chr1063716 3538 3417 2845 2833 120 11313 --24049 3141
NM_005440chr1763031 2612 2230 1343 435 143 12377 1795 --
NM_005475chr1273086 2893 2836 2467 2054 942 236 1292 11317 --
NM_005477chr1552348 871 337 218 163 ----2735 365
NM_005477chr1552348 871 337 218 163 ----2735 365
NM_005493chr6183 ------
NM_005497chr1766141 5190 4742 2231 1658 1527 21998 833 2466 145 1253
NM_005537chr132920 216 ------
NM_005546chr562109 2066 2052 2004 507 189 12041 ----
NM_005563chr11102 ----1756
NM_005578chr343984 3913 857 66 13826 1957 --
NM_005587chr151366 ----1939
NM_005596chr965954 5246 4779 2286 1664 423 --16179 14115
NM_005610chr12335 28 ------
NM_005613chr181993 1836 1353 615 412 404 278 49 1766 ----
NM_005625chr81425 ------
NM_005629chrX--1531 ----
NM_005647chrX42912 995 537 106 --12291 --
NM_005655chr81819 --1478 --
NM_005665chr194052 3992 3962 3782 3420 1500 1007 542 284 11546 ----
NM_005668chr564146 3623 1720 1336 704 537 14127 ----
NM_005717chr11853 ------
NM_005722chr292421 2309 2144 2059 1744 706 637 267 218 ------
NM_005725chr151634 674 577 364 230 12093 ----
NM_005742chr21536 ------
NM_005748chr1263266 3067 3009 2301 1199 849 ------
NM_005761chr121159 ------
NM_005765chrX1305 --1160 --
NM_005795chr272838 2633 2358 2256 2125 2000 1074 ------
NM_005822chr651922 869 651 558 209 --12059 1221
NM_005824chr72748 67 ------
NM_005835chr62210 198 ------
NM_005839chr1185 ------
NM_005840chrX127261 6474 6419 6302 5679 5529 2519 2473 2161 1356 1223 1152 16930 23047 1952 15962
NM_005842chr131485 ------
NM_005853chr161578 ------
NM_005859chr51493 1600 ----
NM_005862chr3249 27 1764 2275 43 --
NM_005898chr1142934 2131 1055 758 ------
NM_005899chr171197 ------
NM_005900chr4125 --1420 1783
NM_005901chr18128309 7220 7193 7084 6075 5903 5744 3220 2943 515 407 195 11907 ----
NM_005902chr1594502 4380 4293 3597 3285 3062 1663 410 372 ------
NM_005903chr564858 4495 3963 3643 1193 584 11112 --21704 55
NM_005927chr541249 874 841 205 ------
NM_005930chr141193 ------
NM_005935chr475160 3828 3363 3242 1471 662 288 24420 1069 11143 --
NM_005962chr1021868 1597 11908 ----
NM_005962chr1021868 1597 11908 ----
NM_005966chr242244 444 341 27 ------
NM_006016chr652246 1744 1546 1419 776 ------
NM_006024chr71613 ------
NM_006047chr2073428 3337 3215 3109 2377 991 296 22803 245 --1211
NM_006054chr1111488 ------
NM_006060chr753734 3357 3092 1143 684 --2560 199 --
NM_006089chrX61736 1717 1304 545 366 170 1453 ----
NM_006094chr852297 1521 744 117 49 ------
NM_006095chr431626 849 754 11032 ----
NM_006106chr1143369 1160 1130 1043 13299 22453 2144 --
NM_006107chr171442 ------
NM_006113chr142109 1585 1532 201 11503 ----
NM_006136chr731243 502 138 ------
NM_006139chr23568 461 65 12483 11785 --
NM_006147chr12387 68 ------
NM_006178chr171213 ------
NM_006186chr21244 11229 ----
NM_006195chr91902 ------
NM_006197chr85686 642 620 504 175 1412 ----
NM_006203chr555302 4261 4119 3529 1100 25179 1819 24994 3844 25265 1868
NM_006206chr452789 2200 618 387 46 ------
NM_006212chr194745 4213 1988 1739 1021 630 624 550 510 33639 2095 929 64468 1976 1554 848 719 270 23492 2066
NM_006237chr131504 ------
NM_006241chr332007 1703 305 1150 --12182
NM_006251chr563358 2998 2064 1247 540 473 ------
NM_006252chr1106093 5715 5573 5510 4631 2549 2320 2286 2271 722 ------
NM_006256chr132387 2231 795 ------
NM_006275chr201841 --21595 410 1827
NM_006283chr8104393 4033 3394 3061 878 857 485 228 201 185 14102 14804 1710
NM_006298chr652190 1073 495 263 243 ------
NM_006306chrX135088 4939 4204 3770 1884 1565 1097 978 742 732 408 61 30 15784 35840 4798 172 --
NM_006315chr421511 493 11216 21728 1311 --
NM_006323chr4--1653 ----
NM_006329chr141753 ----1516
NM_006352chr12464 137 --1188 11845
NM_006372chr61449 ------
NM_006379chr732179 766 363 ------
NM_006390chr1231411 1354 439 --1289 11574
NM_006393chr1093724 3642 3634 2922 1716 1188 1095 545 219 ------
NM_006407chr351384 1232 1028 953 22 ------
NM_006416chr62218 55 ------
NM_006420chr2053117 3040 2752 1361 1060 3540 469 389 12674 12537
NM_006434chr1052215 887 795 467 440 1354 1752 --
NM_006457chr453525 3167 3037 307 74 --13612 13427
NM_006478chr221215 ------
NM_006482chr1253637 2643 1102 1005 750 1537 11158 --
NM_006489chr1431433 808 345 --11835 11864
NM_006527chr42631 591 ------
NM_006534chr2032876 2684 1252 1264 --1278
NM_006544chr1495533 5479 4538 4144 1640 1553 1274 1169 367 11608 25607 2054 14343
NM_006546chr1786374 5395 5238 4612 4580 4337 2517 1059 --25224 2021 --
NM_006549chr1252764 2599 1968 961 878 12727 31103 916 890 --
NM_006561chr1063807 1824 1459 1115 1019 854 --21988 506 --
NM_006565chr1621151 407 ----11068
NM_006572chr1783359 3106 2863 2707 2508 2233 1372 575 11397 --13536
NM_006577chr251173 1078 485 287 73 ------
NM_006599chr1696290 6051 6035 5892 5014 2986 2312 2288 1411 --1955 1895
NM_006601chr121383 ------
NM_006609chr242247 1933 1913 531 11174 --12452
NM_006614chr333151 1395 256 12641 ----
NM_006620chr694596 3588 3026 1467 1440 851 673 109 29 13830 11023 --
NM_006624chr1031310 358 84 1698 ----
NM_006628chr1564369 3766 3481 1620 1578 206 ------
NM_006646chr1352781 2300 2009 1122 983 12608 22312 487 --
NM_006658chr731013 846 306 2430 62 ----
NM_006682chr722318 67 ------
NM_006704chr131133 ------
NM_006721chr10----1133 --
NM_006722chr321191 154 ------
NM_006729chrX54398 2244 961 859 558 23962 827 22102 1347 14792
NM_006734chr63614 307 63 ------
NM_006745chr42735 355 --1850 177
NM_006746chrX31390 1371 23 --41031 565 448 41 --
NM_006750chr16127893 7828 6478 6348 5508 2860 2306 2007 1878 1696 637 331 --17058 11497
NM_006751chr21738 ------
NM_006766chr81148 --1116 --
NM_006774chr771110 1056 608 436 368 187 156 163 1296 --
NM_006777chrX62929 2498 1795 470 318 150 --22182 460 --
NM_006824chr12210 161 ------
NM_006826chr211211 ----21172 901
NM_006828chr62251 62 ------
NM_006851chr1221012 433 1536 1448 --
NM_006870chr20----1122 --
NM_006897chr12----1207 --
NM_006898chr21805 ------
NM_006908chr711168 ------
NM_006918chr1195669 5303 4326 4011 2290 2086 1223 780 617 11875 --15739
NM_006920chr231834 1631 1405 1585 ----
NM_006924chr1732783 1721 1081 23557 1709 ----
NM_006925chr141506 ------
NM_006930chr531727 1667 309 21305 293 1319 --
NM_006948chr2151769 1672 280 124 111 1754 1288 --
NM_006996chr131322 1287 667 ------
NM_007006chr1633365 3247 1032 --1662 --
NM_007017chr5------122
NM_007026chr17------1378
NM_007034chr13663 416 337 1179 1794 --
NM_007038chr2165655 5432 5171 4168 1448 37 22390 2282 ----
NM_007050chr2087659 6732 6455 5781 5534 5422 5156 516 34966 2028 1250 46724 2650 2594 1257 12285
NM_007064chr321432 432 --1637 --
NM_007084chr1331302 1258 1004 ------
NM_007106chr1352586 2316 923 722 422 --12177 --
NM_007125chrY------11260
NM_007172chr2283003 2738 2650 2487 2275 1332 1081 1003 ------
NM_007187chr131104 ------
NM_007203chr943309 3281 3157 190 43705 2456 1013 376 43941 2793 2718 909 --
NM_007207chr11710 ------
NM_007231chrX51710 1666 680 205 48 1328 ----
NM_007236chr1542021 1906 1521 770 22338 943 12350 --
NM_007246chr41263 ------
NM_007249chr13128709 8470 7642 7629 6999 6899 6609 6467 6157 2471 1832 365 ------
NM_007308chr41702 ------
NM_007324chr11291 ------
NM_007345chr1852327 2280 2265 1803 1741 --12021 --
NM_007350chr12114497 3834 3745 3582 3337 3086 1627 1078 1019 605 267 ------
NM_007358chr151916 1862 1348 437 249 --11752 --
NM_007363chrX3392 288 144 1759 --1133
NM_007373chr1031417 660 155 --1551 --
NM_007375chr132324 2010 159 ------
NM_012069chrX52629 2327 2127 1868 1081 11694 1390 --
NM_012081chr593232 2665 2486 742 706 590 478 326 73 22790 2417 13001 --
NM_012082chr81366 ------
NM_012090chr111149 ------
NM_012096chr353602 2964 2824 953 795 12770 12711 --
NM_012120chr622527 682 ------
NM_012141chr1343516 3376 3156 1167 13813 11480 --
NM_012164chr9137567 7109 6298 6157 5892 5526 4957 4584 2781 2253 2112 1929 259 27413 756 25083 1878 --
NM_012183chr1----1410 --
NM_012193chr11124988 4491 3787 3637 2178 2039 1801 1319 1303 960 547 223 34457 4283 3528 14364 --
NM_012204chr93332 145 85 ----3921 911 355
NM_012214chr2116123 6017 5564 4832 4777 4750 2582 2486 2445 1723 990 16138 --12219
NM_012223chr22492 196 --1110 --
NM_012234chr343041 2705 2518 986 185 23502 3234 --
NM_012243chr12231 179 ------
NM_012247chr101269 ------
NM_012257chr72889 178 ------
NM_012262chr154660 4112 4055 1663 78 13510 13909 13947
NM_012281chr741783 1771 636 181 --11969 --
NM_012287chr3104304 3620 3382 2869 1702 1588 1281 666 272 255 1540 --13827
NM_012294chr7103240 3102 3038 2931 2616 2560 1278 1023 476 408 ----1544
NM_012302chr11948 ----1273
NM_012309chr1174639 3326 1640 1629 1189 1159 370 --14948 --
NM_012316chr174204 4026 1363 1332 664 174 159 1123 35245 3749 1624 --
NM_012330chr1021832 363 --11819 --
NM_012334chr574705 1523 1024 931 511 236 116 ----11493
NM_012343chr51282 ------
NM_012382chr553997 2915 1024 924 443 33054 1494 1290 24306 3864 21584 80
NM_012443chr102121 95 ------
NM_012465chr1062719 2394 2339 1387 364 139 12411 12816 11150
NM_012471chrX61527 1426 1396 1321 791 26 21662 1441 ----
NM_013227chr15------1252
NM_013231chr1473659 3271 1588 1037 967 867 854 1728 ----
NM_013233chr22901 472 --11365 --
NM_013249chr111168 ------
NM_013257chr822007 1945 --12174 --
NM_013261chr463388 3117 3083 2946 1259 272 ------
NM_013277chr123952 362 229 ------
NM_013293chr71648 ----1496
NM_013313chr2263034 2588 1163 1095 861 438 11188 12736 2892 244
NM_013330chr1141 ------
NM_013354chr8------1437
NM_013372chr1542866 973 188 95 21293 218 12685 --
NM_013374chr323043 702 1367 ----
NM_013390chr9----31690 1397 358 --
NM_013396chr2131521 1460 330 ------
NM_013437chr81176 ------
NM_013450chr21777 ------
NM_013943chr152919 2829 2194 1222 734 --2687 273 --
NM_013987chr621447 918 1399 --11406
NM_013989chr1454114 3684 3193 660 514 33540 1356 894 23824 3527 --
NM_013995chrX72584 2007 1621 999 322 294 108 --1656 1779
NM_014011chr222641 487 ----12229
NM_014021chr173482 2902 2234 1069 961 901 701 --12304 --
NM_014048chr1653897 3253 1650 1215 289 23573 463 1881 33994 3735 73
NM_014055chr122369 213 ------
NM_014106chr154635 616 356 174 --1196 22469 1150
NM_014112chr884496 4485 1594 960 726 687 590 346 --24705 3953 --
NM_014117chr1672739 2541 2157 1848 1841 1087 153 --12663 --
NM_014141chr765080 3865 2064 1713 1094 880 2675 47 2308 250 --
NM_014155chr11157513 6600 6369 6295 5789 5763 5535 4885 4871 2798 2091 1835 1613 1378 1294 21140 590 ----
NM_014181chr242690 2507 2074 61 ----187
NM_014213chr22564 140 ------
NM_014214chr181345 ------
NM_014217chr121834 1816 11332 ----
NM_014223chr11772 ------
NM_014241chr101321 ------
NM_014267chr111701 ------
NM_014283chr111351 ------
NM_014294chr8--170 ----
NM_014302chr7--134 ----
NM_014309chr2284795 4764 3973 2107 1940 1919 1623 807 13333 1756 12146
NM_014323chr222833 175 ------
NM_014326chr1511246 ------
NM_014331chr4127090 6785 5701 4980 4850 4765 2195 1424 1201 1178 776 520 --1614 184
NM_014333chr1132170 651 46 --12545 --
NM_014372chr141898 1283 244 168 ------
NM_014382chr32443 57 11174 ----
NM_014392chr411229 --2395 93 11360
NM_014393chr862342 2228 2134 1492 828 490 1612 ----
NM_014394chr1021191 101 ----1174
NM_014423chr5104693 4224 4216 3693 3470 2006 1903 1066 982 783 14445 15472 --
NM_014429chr33690 672 159 --1246 --
NM_014447chr41596 ------
NM_014456chr1021200 616 ------
NM_014469chr111532 ------
NM_014478chr72474 418 --1541 --
NM_014491chr71223 ------
NM_014497chr21213 ------
NM_014575chr31498 ------
NM_014584chr1431065 643 32 ----11206
NM_014606chr42418 186 11333 ----
NM_014616chr353350 3325 1400 1084 451 ------
NM_014636chr973886 3584 3499 3285 1614 1418 743 1291 ----
NM_014660chr721061 767 ------
NM_014666chr51954 --11167 --
NM_014682chr821563 65 ------
NM_014683chr1711711 --11610 11671
NM_014701chr1542814 1216 1104 1090 --22271 1155 --
NM_014702chr673206 2933 2525 2249 1274 967 350 ------
NM_014705chr71428 ------
NM_014720chr1051535 1456 698 269 116 ------
NM_014721chr667016 6140 5542 4768 2332 1789 22353 929 17461 26363 4566
NM_014730chr12124137 3683 3604 3359 1865 1844 1641 1601 1230 571 559 436 15004 11154 --
NM_014730chr12124137 3683 3604 3359 1865 1844 1641 1601 1230 571 559 436 15004 11154 --
NM_014737chr2053338 2996 2849 142 96 13786 --1476
NM_014740chr17167 ------
NM_014746chr284284 3159 1755 1660 995 607 487 348 11013 ----
NM_014755chr283850 3371 3115 2820 1410 1292 526 412 --22754 480 --
NM_014774chr182714 1220 1214 1168 1049 989 636 21 1666 ----
NM_014781chr81246 11159 1820 11084
NM_014783chr1581743 1447 1429 1349 1240 1194 717 285 ------
NM_014793chr151615 ------
NM_014810chr183396 2689 2383 1430 1342 316 310 100 13115 1506 --
NM_014819chr542356 1784 1753 127 ------
NM_014827chr121098 101 ------
NM_014828chr1421797 959 32195 848 732 --21660 194
NM_014832chr1341922 1685 829 285 --11514 --
NM_014836chr1021562 482 193 ----
NM_014838chr2241145 954 886 541 ------
NM_014839chr111681 ----1834
NM_014848chr1542150 545 433 354 ------
NM_014873chr174822 3304 1555 1541 1219 546 404 14122 14158 13398
NM_014877chr1786857 6588 6435 6312 5950 5697 4735 573 16341 27586 5311 15492
NM_014888chr721250 244 ------
NM_014893chrY51925 1904 1758 935 116 ------
NM_014897chr1753062 2811 2804 2509 1180 --1578 --
NM_014899chr572668 2272 2151 932 564 282 219 22728 2617 1430 --
NM_014900chr22475 227 --11024 --
NM_014904chr1053839 3288 1136 552 543 ------
NM_014912chr1073171 3051 2350 521 387 88 32 1415 ----
NM_014914chr211086 ------
NM_014918chr1511463 ------
NM_014923chr1341747 744 521 301 ------
NM_014924chr1433092 2591 98 --32511 2253 397 1701
NM_014934chr1383922 3379 3010 2963 2944 2909 1071 699 11145 ----
NM_014946chr252865 2603 2293 658 249 12422 1111 --
NM_014949chr121041 102 1121 ----
NM_014951chr1042621 2348 204 80 22203 363 ----
NM_014962chr2052338 729 715 680 480 --1238 --
NM_014982chr1475215 5160 4677 4412 4055 3293 1325 --14087 --
NM_014991chr462908 2778 2758 2506 2098 377 ------
NM_014997chr772874 2765 2433 2023 681 361 119 12848 11861 --
NM_015009chr3----1560 --
NM_015026chr1254258 4003 3864 1165 909 --14332 13231
NM_015033chr963293 3238 2570 1003 551 39 --22644 2267 13259
NM_015039chr153492 2981 2770 1570 1169 --23408 3223 33502 375 297
NM_015040chr222478 137 13232 1766 1687
NM_015042chr15124076 3920 3862 3613 3363 3350 3014 1516 1284 769 364 83 23044 210 ----
NM_015046chr972760 650 590 580 468 282 75 ------
NM_015049chr253066 3059 2856 2407 809 11177 13214 --
NM_015051chr993031 2798 2358 2219 2186 965 947 438 320 12593 ----
NM_015061chr91805 ------
NM_015068chr753538 3388 3163 492 157 12964 23678 1321 12426
NM_015071chr565637 5385 4684 2187 1592 1509 45923 5649 5337 1429 --15517
NM_015090chr195535 4097 3952 1993 1361 776 660 246 224 24015 1311 --1927
NM_015091chr141616 ------
NM_015092chr1644260 4201 3742 1084 --13212 11853
NM_015094chr2264021 3882 2962 2900 1832 1410 --1894 11876
NM_015107chrX72436 2298 2136 1970 569 326 190 ------
NM_015115chr432635 1127 489 1310 1517 --
NM_015120chr23300 284 118 152 ----
NM_015130chr41402 ------
NM_015149chr111984 1670 1732 21630 1483
NM_015156chr1453706 2692 1625 447 100 ------
NM_015170chr862341 2025 511 474 135 43 1430 ----
NM_015172chr131547 1174 299 ------
NM_015173chr42250 199 ------
NM_015187chr42679 322 1853 ----
NM_015191chr1112005 1985 ----
NM_015200chr432097 1795 1047 --2420 317 11894
NM_015206chr1563804 2446 2386 607 386 221 ------
NM_015208chr1833230 884 244 ------
NM_015213chr111134 --1164 --
NM_015215chr123021 2428 ------
NM_015216chr551229 527 467 390 151 ------
NM_015231chr111784 --1257 --
NM_015233chr1342438 1929 364 227 ------
NM_015236chr451532 1136 1041 566 413 --11260 --
NM_015239chr91426 --1355 --
NM_015245chr63631 351 331 ----11977
NM_015247chr16135075 4653 4537 4530 4103 3996 2084 1713 1094 928 914 679 201 1475 44999 4313 4086 3511 25353 1934
NM_015266chr2094280 2741 1481 1108 1023 756 709 351 305 --42811 743 685 177 --
NM_015267chr1241844 531 333 300 11978 11371 --
NM_015269chr11167 ------
NM_015285chr1821724 567 11771 11618 --
NM_015286chr1552436 1591 1564 453 250 --1791 21660 271
NM_015291chr151199 1115 494 120 107 11300 12503 12741
NM_015310chr888412 7998 7982 3327 2320 1410 844 420 25547 1617 37472 2231 1767 16075
NM_015313chr11104087 3863 3713 3220 3061 1862 1783 1374 1136 425 ------
NM_015336chr1222158 1918 ------
NM_015344chr862093 1942 1773 1759 1713 770 11844 ----
NM_015346chr144627 495 474 367 11507 --1225
NM_015347chr1242978 1833 916 406 ----1822
NM_015365chrX84017 3395 3082 1359 1222 1091 927 209 --11471 11231
NM_015370chr22124 ------
NM_015378chr162264 1959 636 428 274 198 1834 ----
NM_015385chr1052215 887 795 467 440 1354 1752 --
NM_015387chr241748 1348 408 66 ------
NM_015393chr453455 3319 3245 2530 603 ----23098 2850
NM_015396chr321162 1006 ------
NM_015455chr533779 2716 2548 --13161 11463
NM_015465chr53633 211 187 ------
NM_015496chr83241 230 81 ----1100
NM_015497chr151875 ----11028
NM_015525chr631035 905 354 181 ----
NM_015535chr253701 3087 1467 1454 584 12797 --2578 344
NM_015541chr311246 ------
NM_015553chr665118 4081 4051 3829 1440 1273 33810 1872 698 2463 277 --
NM_015554chr1562504 1946 1797 792 203 184 12338 12296 --
NM_015560chr332591 844 724 ------
NM_015564chr573001 2958 2914 1377 867 778 336 ------
NM_015565chr213378 176 123 --2742 547 --
NM_015569chr154094 4018 1008 755 317 --1207 13588
NM_015571chr622272 2261 --11892 --
NM_015578chr1911546 --11598 --
NM_015601chr10----1829 --
NM_015626chr172938 252 ------
NM_015640chr1115211 4988 4976 4392 4258 4013 1831 1439 1351 383 210 14613 ----
NM_015676chr141257 ------
NM_015697chr41286 --1117 --
NM_015711chr191821 ------
NM_015713chr8103071 2747 2624 1413 1318 859 802 793 540 526 13261 ----
NM_015833chr2142188 2181 732 297 11832 ----
NM_015845chr18--127 ----
NM_015852chr732860 2323 1462 111133 1049 965 797 629 545 461 377 209 125 41 ----
NM_015866chr121496 163 ------
NM_015878chr83451 194 23 ------
NM_015879chr18177840 7729 7441 6691 6445 6359 5691 5589 5266 2780 2327 1776 1757 1560 1010 319 203 22471 84 12097 12432
NM_015886chr865572 4950 4873 2048 1163 562 25476 604 11011 11794
NM_015891chr631990 1656 1648 --1329 --
NM_015905chr72421 34 ------
NM_015934chr21188 ------
NM_016009chr174398 4016 3940 1765 697 688 186 23718 3289 ----
NM_016018chr822348 2051 12567 --1432
NM_016025chr161440 ------
NM_016026chr1411344 1227 ----
NM_016040chr142474 1079 1014 466 --11802 --
NM_016076chr172921 2474 2233 2173 475 233 83 156 12983 --
NM_016103chr53389 369 119 ------
NM_016120chrX1388 ------
NM_016125chr171117 ------
NM_016129chr41143 ------
NM_016133chr221592 1569 1624 ----
NM_016141chr34596 271 162 91 ------
NM_016173chr394410 4176 3784 3553 1383 1343 903 144 133 --2606 592 --
NM_016206chr3198918 8346 7433 7008 6981 6831 5949 5731 5585 5532 3086 3016 2879 2336 2063 1686 1257 859 582 21554 1086 48017 7190 6545 2658 --
NM_016217chr663284 3203 3065 2331 2284 386 1444 23644 2518 --
NM_016227chr111351 ------
NM_016231chr1771317 1128 579 458 199 154 50 --172 --
NM_016255chr652878 2646 2525 212 91 --21149 455 --
NM_016260chr296993 6907 6598 6164 6023 2683 1586 1382 1234 --16977 --
NM_016271chr183865 827 429 ------
NM_016275chr352654 2474 2205 1765 862 11702 11848 --
NM_016303chrX1118 ------
NM_016315chr231579 1494 1296 --1601 --
NM_016322chr933139 2095 230 ----12977
NM_016337chr141189 ------
NM_016357chr121836 2373 195 --11199
NM_016376chr1753955 3124 1609 1530 770 13557 2952 445 13141
NM_016396chr152679 220 --12728 1558
NM_016401chr11--1119 ----
NM_016413chr131447 ------
NM_016422chr1162776 2610 2297 719 343 206 13059 12908 --
NM_016424chr1711947 ------
NM_016448chr11134 ------
NM_016467chr211341 ------
NM_016470chr201522 ------
NM_016506chr113506 263 167 ------
NM_016507chr1722090 1097 22355 1077 ----
NM_016530chr1573575 2990 1163 1129 1000 371 35 11188 13553 13669
NM_016531chr464245 3819 3382 1356 765 653 22940 2815 24167 2849 --
NM_016544chr262781 951 672 325 236 56 13746 11225 13636
NM_016571chr6127 ------
NM_016578chr111116 ------
NM_016607chrX41451 1248 686 22 ------
NM_016620chr131053 945 535 ------
NM_016654chr1531287 510 173 ------
NM_016824chr1021563 645 --11215 --
NM_017420chr141133 --13570 --
NM_017437chr1452036 741 407 384 278 1337 1568 --
NM_017447chr2164092 4051 3633 3121 1304 1066 1341 1179 --
NM_017450chr1711025 ------
NM_017519chr621114 40 ------
NM_017528chr7176 ------
NM_017545chr201197 2584 470 ----
NM_017551chr1042635 2542 2487 866 ----11789
NM_017553chr152306 44 --11195 --
NM_017563chr3116156 6073 5189 4506 4253 2440 2339 1646 1194 819 460 14654 ----
NM_017594chr983352 3104 2046 1178 872 781 640 376 11290 1184 --
NM_017610chr1562049 735 692 452 205 112 ------
NM_017612chr12------1234
NM_017623chr272222 2142 1780 960 628 115 56 ----11012
NM_017628chr455075 4911 3944 3374 194 23974 236 34641 4122 3802 --
NM_017635chr1131367 1105 227 ------
NM_017637chr968852 7081 6892 6521 3003 2248 ------
NM_017643chr1752209 1965 951 643 433 ------
NM_017644chr385033 4310 3712 3518 1679 1502 1344 445 --34968 3281 1913 --
NM_017650chr795901 4893 3784 2302 1075 732 522 466 117 34699 4354 3750 11542 11101
NM_017654chr761711 1644 1477 1295 366 272 ----11437
NM_017658chr1431645 407 382 34216 3528 3412 ----
NM_017686chr121056 243 ----1796
NM_017699chr331483 1302 486 11408 ----
NM_017709chr171726 1443 1414 1356 1166 76 48 1606 11028 --
NM_017712chr19136316 6123 5558 5133 4923 2166 1811 1754 1682 1657 1392 1305 115 24274 942 12233 --
NM_017737chr151709 1532 496 376 74 ------
NM_017754chr653662 3464 3150 1785 847 ----23515 1651
NM_017769chr1462195 935 755 544 509 378 ------
NM_017798chr2031242 999 938 11092 21174 402 --
NM_017811chr932599 2407 336 ------
NM_017813chr875394 5047 4571 3770 2246 1987 1289 12125 ----
NM_017831chr1863493 3409 3211 1708 1391 973 24505 4390 ----
NM_017845chr41604 1528 ----
NM_017847chr12772 226 ----11739
NM_017848chrX54272 3986 3222 1481 75 11778 11675 1196
NM_017890chr831624 1236 735 1326 --11383
NM_017922chr142602 252 ------
NM_017944chr1173096 3027 2930 2686 2067 1008 610 --22834 1039 --
NM_017988chr121717 ------
NM_017994chr762665 2259 2068 2034 899 872 11979 1866 1286
NM_018003chr1551949 1834 950 783 620 21887 938 12085 1975
NM_018010chr341442 1164 1085 589 ------
NM_018014chr2----11007 --
NM_018017chr1082533 2515 2306 2246 2174 1976 1856 714 --12468 --
NM_018027chr1052451 2212 2023 962 279 ----22421 2168
NM_018028chr1911291 ------
NM_018030chr1831121 422 400 1825 ----
NM_018036chr1484281 3927 2743 2722 1401 1184 1050 627 ------
NM_018046chr531920 653 438 ------
NM_018047chr51874 ------
NM_018061chr131753 1563 1522 ----1587
NM_018063chr10----1429 --
NM_018078chr42742 416 ------
NM_018085chr1147825 7570 7232 6555 6016 5799 3261 2788 1555 964 882 701 278 235 37418 7399 5828 15170 27629 5590
NM_018086chr22574 358 --1142 11836
NM_018092chr1611152 ------
NM_018095chr113506 263 167 ------
NM_018100chr632892 1240 325 --1834 33270 1351 295
NM_018105chr821182 1176 ------
NM_018155chr332699 2247 227 ----13002
NM_018156chr162264 1959 636 428 274 198 1834 ----
NM_018157chr1232012 1994 1059 ------
NM_018159chrX51212 1123 1091 593 446 ----11524
NM_018167chr146829 372 330 282 218 90 ------
NM_018184chr32460 183 --1828 --
NM_018202chr11197 ------
NM_018222chr1141823 1425 1265 1194 ------
NM_018227chr442419 896 857 286 1711 12477 --
NM_018247chr613080 ------
NM_018254chr132060 1608 97 --1221 --
NM_018263chr21468 --1169 12352
NM_018266chr33787 709 259 11095 ----
NM_018275chr71387 ------
NM_018287chr1021303 959 ----11352
NM_018293chr33937 525 150 --1106 --
NM_018313chr372121 2000 1899 1806 815 594 319 1480 ----
NM_018318chr122731 148 ------
NM_018323chr451510 1231 489 297 34 ------
NM_018325chr941426 1258 507 446 ------
NM_018330chr102480 63 ------
NM_018340chr1674682 4445 4147 3805 3775 3616 3122 --13208 --
NM_018364chr153264 1165 1064 710 293 1850 ----
NM_018374chr764885 4684 3925 3863 3653 1107 --11018 11302
NM_018375chr1421921 124 --3623 397 174 --
NM_018383chr241954 823 698 34 ----11692
NM_018387chr9--160 ----
NM_018429chr552091 1973 615 605 40 12470 21967 80 --
NM_018440chr8158575 7952 7826 7761 7350 7158 6964 6678 5774 3080 1638 832 730 650 612 22101 1323 16817 146
NM_018451chr132796 237 ------
NM_018452chr6_random62717 2482 1473 1267 1207 716 23778 2745 --155
NM_018465chr91200 ------
NM_018490chr1131900 1422 1226 ------
NM_018553chr1731628 1585 697 11308 --11577
NM_018566chr154881 4874 1920 1751 231 14780 --13547
NM_018640chr1262396 1969 1788 1132 728 602 ------
NM_018649chr101235 ------
NM_018650chr142108 1519 636 306 --12160 --
NM_018652chr152955 179 ------
NM_018657chr33615 585 294 ----1632
NM_018667chr1612619 ------
NM_018718chr721557 671 --11501 --
NM_018845chr1------1207
NM_018890chr711168 ------
NM_018898chr541939 1502 602 149 1110 ----
NM_018899chr541939 1502 602 149 1110 ----
NM_018900chr541939 1502 602 149 1110 ----
NM_018901chr541939 1502 602 149 1110 ----
NM_018902chr541939 1502 602 149 1110 ----
NM_018903chr541939 1502 602 149 1110 ----
NM_018904chr541939 1502 602 149 1110 ----
NM_018905chr541939 1502 602 149 1110 ----
NM_018906chr541939 1502 602 149 1110 ----
NM_018907chr541939 1502 602 149 1110 ----
NM_018908chr541939 1502 602 149 1110 ----
NM_018909chr541939 1502 602 149 1110 ----
NM_018910chr541939 1502 602 149 1110 ----
NM_018911chr541939 1502 602 149 1110 ----
NM_018947chr7124993 4693 4605 3726 3616 3312 3256 3064 1808 1626 1024 331 33754 1659 314 11208 --
NM_018948chr12951 442 1384 1141 --
NM_018970chr762224 1259 1247 862 589 408 ------
NM_018976chr1222817 1812 12149 --1644
NM_018992chr1631416 1064 355 ----21272 117
NM_018994chr11449 ------
NM_018999chr1083814 3342 3285 3017 3005 1833 1553 577 --24863 4337 --
NM_019001chr343162 1131 634 555 --23476 1841 13665
NM_019022chr1852759 2523 1261 924 67 ------
NM_019027chr412561 21666 425 12490 --
NM_019036chr631242 965 439 ----11153
NM_019072chr584042 3510 1539 1374 1231 774 490 170 --12921 --
NM_019083chr131052 465 203 1178 ----
NM_019084chr1041951 822 697 555 11655 11697 --
NM_019087chr52691 601 ------
NM_019091chr21736 1782 --1890
NM_019095chr201227 ------
NM_019117chrX53061 3010 1221 412 254 13222 12969 11286
NM_019555chr341819 1701 408 232 1464 ----
NM_019597chrX3738 662 302 ------
NM_019610chr151920 1646 1595 1456 412 11718 ----
NM_019842chr61299 ------
NM_019891chr161206 983 834 523 516 276 3389 175 28 11299 --
NM_019903chr1021563 645 --11215 --
NM_020122chr245932 4046 4024 2102 15666 ----
NM_020123chr1021434 1251 ----11188
NM_020133chr6146420 6289 6081 5803 5612 5308 5018 4213 4029 2407 2370 2306 2286 1627 ----11495
NM_020156chr71401 ------
NM_020159chr441403 1364 1111 304 ------
NM_020177chr542720 2658 1092 1084 --23159 672 --
NM_020180chr1821165 1054 ------
NM_020199chr541104 497 276 256 --1180 --
NM_020207chr93858 534 246 11282 11263 --
NM_020342chr261948 1855 1839 842 538 516 --1582 --
NM_020347chr35736 725 139 132 117 --1278 --
NM_020357chr351421 1076 478 295 163 ------
NM_020381chr671899 1753 1371 803 578 547 525 2360 48 --11427
NM_020382chr12----1312 --
NM_020403chr131334 ------
NM_020420chrY61519 1142 709 541 273 59 ------
NM_020443chr1106786 6434 6128 5952 5090 2399 1897 1695 670 505 1620 12674 --
NM_020455chr652508 2496 2226 890 511 22689 440 ----
NM_020463chr231254 929 355 --11109 --
NM_020645chr112453 160 1180 ----
NM_020651chr221700 1340 ------
NM_020653chr171158 ------
NM_020718chr16166426 6384 5965 5577 5345 4782 4685 2488 2392 2306 1790 1765 973 909 593 50 ----21732 306
NM_020727chr2183590 3204 1522 1446 1223 378 207 176 --13598 13649
NM_020732chr621114 40 ------
NM_020734chr1222595 1169 13172 ----
NM_020742chrX31992 1971 1824 11093 ----
NM_020747chr51833 ------
NM_020748chr171147 ------
NM_020752chr1022370 1797 22275 1852 --11111
NM_020766chrX53109 3043 1682 1675 389 12902 14304 11601
NM_020768chr522748 196 ----11095
NM_020772chr17128252 8186 7111 6059 2675 2495 1708 1230 1191 833 704 42 --13064 --
NM_020774chr1895848 5692 4926 4204 1664 1191 627 571 119 ------
NM_020782chr1274832 1893 1507 1489 1442 1032 779 ------
NM_020796chr522489 1067 ------
NM_020801chr521651 158 12161 12346 --
NM_020808chr11272 ------
NM_020809chr1141874 1637 818 598 1278 --1258
NM_020810chr1453361 3302 2458 1425 407 22854 1461 ----
NM_020830chr243098 2695 730 381 12480 --22204 1260
NM_020841chr1233630 3573 915 ----1846
NM_020844chr8107177 6583 6288 5561 4793 4684 3037 2647 2051 1469 15307 --11541
NM_020861chr62440 261 ------
NM_020899chr1762441 1982 1869 1652 367 131 ----12487
NM_020918chr1083377 3303 3245 2609 1101 804 604 361 --13469 1718
NM_020921chr14103325 2726 2463 2254 1446 1281 865 622 351 114 ------
NM_020922chrX41450 1421 429 121 ------
NM_020925chr121237 55 ----1981
NM_020927chr1642107 1887 509 276 --12333 11703
NM_020948chr1--12829 ----
NM_020952chr9--1270 ----
NM_021005chr1511027 ------
NM_021007chr221528 640 1190 ----
NM_021069chr421513 684 ------
NM_021072chr532590 815 118 ------
NM_021090chr2233686 2008 1448 11204 24897 1021 --
NM_021115chr221119 ------
NM_021116chr799078 8290 7709 5852 5606 3483 3257 2161 1530 22033 246 1703 --
NM_021120chrX42703 2599 358 120 22433 639 ----
NM_021127chr1841446 1361 1108 1017 1299 ----
NM_021144chr92465 354 ------
NM_021159chr431123 578 517 --11266 --
NM_021165chr1--1755 ----
NM_021190chr111330 ------
NM_021202chr2072464 2134 1937 1074 1023 823 669 12429 32689 2544 2118 1694
NM_021255chr1473945 3812 3136 2915 640 439 66 ------
NM_021629chr333769 3695 1174 21238 649 --33103 917 41
NM_021631chr8185 ------
NM_021639chr11841 ------
NM_021645chr1352290 2278 1917 1630 169 11616 2782 750 --
NM_021647chr474569 3782 3634 3413 3260 3224 1271 14396 13151 14339
NM_021815chr232788 1233 1042 32008 1117 271 --161
NM_021825chr111145 ------
NM_021911chr52660 549 1963 11780 1644
NM_021913chr19101577 1514 1462 1320 1272 1250 1131 459 306 291 --1269 --
NM_021960chr142150 2005 270 94 --1851 --
NM_021961chr1177460 6500 2971 2330 1939 1187 500 ------
NM_021964chr3106203 5229 4450 4303 4191 2383 2221 1098 233 38 ------
NM_021998chrX1402 ------
NM_021999chr132556 289 ----1335
NM_022037chr21641 ------
NM_022075chr12823 215 ------
NM_022079chr10----1829 --
NM_022123chr142509 67 ------
NM_022130chr5----11413 11354
NM_022133chr851698 1617 550 46 29 11563 ----
NM_022143chr71395 ------
NM_022166chr1644444 4348 1578 1287 --26208 5785 24342 4125
NM_022173chr21641 ------
NM_022336chr232311 1519 190 1971 160 --
NM_022351chr822646 2564 22929 2500 1361 23372 3029
NM_022459chr1375469 3888 1599 1259 350 225 27 14366 ----
NM_022462chr19203215 3054 3047 2743 2711 2679 2649 2618 2558 2528 2498 2437 2355 1490 1426 1392 1366 930 823 792 13725 13682 --
NM_022473chr1574281 3900 3228 1253 809 208 190 11065 13606 --
NM_022474chr1442620 2580 2070 2004 12421 11792 --
NM_022484chr721356 344 ----1365
NM_022491chr1263406 2915 2544 2365 1218 1064 --138 12952
NM_022497chr322611 109 32815 2405 102 2934 810 1395
NM_022650chr51679 1361 ----
NM_022726chr62586 348 11425 ----
NM_022733chr13737 391 109 ------
NM_022781chr932876 2855 1001 ------
NM_022817chr232301 653 127 ------
NM_022818chr1651481 1274 1232 654 27 1439 ----
NM_022828chr541563 1428 392 130 11159 1118 --
NM_022893chr233044 2789 2241 ------
NM_022898chr1444287 3999 1709 389 ------
NM_022900chr721046 56 ----179
NM_022912chr252917 1170 850 706 362 22693 2368 12532 1619
NM_022913chr5122 ------
NM_022977chrX42603 1945 1825 60 --12314 --
NM_023000chr1441477 1109 1084 493 ------
NM_023001chr1441477 1109 1084 493 ------
NM_023016chr232829 929 239 1547 --22359 253
NM_023037chr1331151 346 334 ------
NM_023923chr153800 3303 3296 2982 664 13114 --1455
NM_023929chr832594 1810 772 1626 12840 --
NM_024007chr532937 740 512 13080 --12001
NM_024019chr41728 ------
NM_024057chr121114 ------
NM_024061chr71249 ------
NM_024063chr15179 ------
NM_024089chr131181 ------
NM_024345chr9135950 5854 5542 5199 4412 4369 2352 2175 1271 1250 668 83 63 15658 11932 --
NM_024529chr13416 278 25 ----1316
NM_024539chrX31106 434 244 ------
NM_024561chr1331344 1311 292 ------
NM_024567chr8138 ------
NM_024586chr11502 ------
NM_024611chr1583656 3508 3443 1523 829 668 117 58 ----13194
NM_024626chr121388 120 --21639 129 --
NM_024631chr111531 ------
NM_024639chr672329 2279 1911 1151 1139 925 893 12515 12260 11933
NM_024646chr163319 3313 3289 2579 1549 1405 11041 33449 3431 2649 --
NM_024665chr394631 4107 4011 3176 3109 1493 1046 493 253 ------
NM_024692chr251769 1481 1300 1206 581 ------
NM_024713chr1531517 1176 1029 ------
NM_024761chr955042 4161 1905 1165 452 --13836 12016
NM_024770chr276530 6411 5466 4700 2625 1805 1462 --25767 4948 --
NM_024798chr1592514 2229 2083 2047 1135 1083 958 198 172 --11037 12920
NM_024817chr1565565 5155 4793 4376 4233 2084 44412 4222 1193 404 11609 11808
NM_024828chr911059 ----11204
NM_024945chr92234 52 ------
NM_024947chr3129533 9346 9177 9129 7772 6569 6282 6219 1804 564 506 81 11751 37860 6012 656 16404
NM_024949chr463926 3912 3758 1222 907 486 14254 --11190
NM_024953chr1212646 11076 1721 --
NM_024971chr9--1270 ----
NM_024989chr297047 5619 5544 3284 2224 2031 1455 1284 899 11800 ----
NM_024991chr1052215 887 795 467 440 1354 1752 --
NM_025054chr874190 4005 2613 1529 1265 982 623 ------
NM_025073chr164670 3908 3019 1181 367 135 24192 25 21735 1408 --
NM_025133chr231071 912 845 ------
NM_025134chr161125 11614 ----
NM_025135chr181453 ------
NM_025146chr31730 1775 ----
NM_025154chr711038 ------
NM_025160chr154280 3918 2809 797 395 ------
NM_025181chr2----1763 --
NM_025191chr182677 2637 2526 2156 1047 890 417 315 --23186 158 --
NM_025205chr41246 ------
NM_025208chr112677 405 ------
NM_025235chr1031892 830 468 --11623 1854
NM_030625chr1022612 1995 --1333 --
NM_030627chr531124 578 289 ----11019
NM_030647chr754221 517 430 87 63 --25730 47 1411
NM_030648chr484728 3765 3395 1954 1869 1714 1470 1372 24425 1404 14446 --
NM_030650chr243498 2935 967 249 --23018 1032 --
NM_030660chr1461511 1166 1094 1003 487 22 ------
NM_030674chr1295663 5270 5035 4468 2180 1895 1088 1013 415 --55647 3666 2277 2038 1811 15170
NM_030755chr1463097 3040 2745 2486 2222 114 12026 22098 487 1352
NM_030762chr1231664 1239 545 ------
NM_030789chr201272 ------
NM_030791chr1441250 699 626 226 ------
NM_030799chr531542 1414 1393 --12129 11632
NM_030816chr143441 3271 2353 1346 23001 2966 --11404
NM_030817chr1283293 3168 2934 2729 2689 2670 2402 1520 1355 --11174
NM_030820chr61683 ------
NM_030920chr131912 1884 243 --1429 --
NM_030934chr111746 ------
NM_030939chr6----1390 --
NM_030953chr531392 649 53 21346 1334 11054 --
NM_030958chr81398 ------
NM_030959chr61293 ------
NM_031157chr121133 ------
NM_031243chr731471 719 710 12136 ----
NM_031275chr113479 390 141 ------
NM_031292chr121665 ------
NM_031296chr431945 830 695 --2607 249 --
NM_031369chr42671 660 --1792 --
NM_031370chr42671 660 --1792 --
NM_031411chr541939 1502 602 149 1110 ----
NM_031422chr181512 ------
NM_031427chr1485936 5816 5696 5597 5044 3881 2158 216 15396 15228 --
NM_031435chr1243426 3151 3141 2897 1321 12169 --
NM_031438chr551842 1591 1445 696 320 171 ----
NM_031442chrX4672 405 369 180 ------
NM_031453chr1041994 1972 941 593 31591 817 86 ----
NM_031469chr663613 2673 1405 1313 1247 558 ----12840
NM_031483chr2092603 2569 2317 1401 1357 1061 736 336 141 --13293 1103
NM_031844chr183614 3231 3076 2919 1421 1151 1031 126 --13647 --
NM_031849chr541939 1502 602 149 1110 ----
NM_031857chr541939 1502 602 149 1110 ----
NM_031858chr171197 ------
NM_031860chr541939 1502 602 149 1110 ----
NM_031862chr171197 ------
NM_032012chr963883 3459 3351 2080 1882 30 --24734 4502 13944
NM_032042chr572434 2070 1822 982 888 425 161 ----1999
NM_032047chr371718 1682 1640 650 595 213 150 ----1765
NM_032050chr222833 175 ------
NM_032116chr1395461 4187 3979 2293 1179 743 516 495 313 ------
NM_032128chr431050 801 264 ------
NM_032138chr132145 111 ------
NM_032144chr211292 --11315 --
NM_032145chr621737 1187 11402 ----
NM_032182chr10--1320 ----
NM_032186chr131053 945 535 ------
NM_032189chr1385023 4805 4198 3711 2018 1870 1351 1240 ------
NM_032193chr1131920 515 123 ------
NM_032288chr362335 1845 1783 1757 882 355 1469 --1650
NM_032291chr131536 1304 195 ------
NM_032293chr91249 ------
NM_032315chr1276 24 ----150
NM_032320chr11----1608 --
NM_032321chr233023 1245 98 23039 639 ----
NM_032352chr142976 507 ------
NM_032373chr10105878 5328 5253 5085 4717 4548 3888 583 467 89 15758 1963 --
NM_032441chrX31190 358 62 ------
NM_032446chr563684 3463 2458 656 624 229 1200 13622 22834 1062
NM_032458chrX53060 2610 2082 1275 633 --43210 2913 2867 658 --
NM_032472chr21174 ------
NM_032499chr152705 145 ------
NM_032505chr352327 1976 1839 691 538 ------
NM_032582chr1721873 1359 ----1410
NM_032594chr14140 --1188 1291
NM_032601chr21181 ------
NM_032622chr431541 1198 1061 ------
NM_032626chr162236 27 ------
NM_032663chr1241285 444 98 24 ------
NM_032765chr52264 208 ------
NM_032796chrX159 2763 235 1292 --
NM_032832chr671505 1467 1405 1307 1166 337 70 ----1191
NM_032842chr751581 1330 427 126 30 11198 11091 1402
NM_032859chr13102965 2795 2706 2519 2484 1598 1263 743 715 68 --11195 --
NM_032869chr8262 55 21375 467 11879 1198
NM_032873chr1133046 878 204 --33246 1241 625 11626
NM_032876chr1431904 746 725 --1636 1320
NM_032933chr181370 ----2656 493
NM_032961chr42957 304 --1217 11249
NM_032968chrX1670 --12691 13166
NM_032969chrX1670 --12691 13166
NM_032973chrY23537 670 ----13161
NM_032978chr183767 243 205 1335 ----
NM_032979chr183767 243 205 1335 ----
NM_032981chr183767 243 205 1335 ----
NM_033012chr132835 818 ------
NM_033023chr71504 ------
NM_033044chr111149 ------
NM_033049chr3168 1815 2346 60 --
NM_033121chr1261863 606 580 515 298 78 ------
NM_033132chr13--11462 ----
NM_033135chr112677 405 ------
NM_033138chr731985 676 358 ----1177
NM_033139chr731985 676 358 ----1177
NM_033140chr731985 676 358 ----1177
NM_033157chr731985 676 358 ----1177
NM_033211chr51447 --21457 200 --
NM_033222chr92976 228 ------
NM_033224chr7127376 7363 7074 6936 6636 6585 6367 6044 2744 488 429 316 35693 3009 55 14877 --
NM_033225chr853226 2599 2423 1067 483 --11261 1595
NM_033281chr51136 ------
NM_033284chrY1127 ------
NM_033285chr864462 3924 3620 1746 230 134 11404 ----
NM_033290chrX52930 2778 1499 876 724 --1219 --
NM_033300chr131169 492 58 ----1545
NM_033326chr112436 357 ----21583 711
NM_033331chr962354 2340 1013 679 150 38 13112 22826 915 --
NM_033360chr12104167 3940 3863 3665 3628 3463 1652 1445 1234 603 ------
NM_033401chr161339 ------
NM_033502chr61136 122 ----
NM_033503chr1542854 1210 1133 46 --32655 1478 1114 --
NM_033505chr286631 6358 5441 5423 4868 4492 4465 4315 14713 26208 4344 --
NM_033631chr1113738 3732 2783 2655 2587 2412 1092 885 724 366 358 1803 1491 --
NM_033642chrX21051 186 ------
NM_033656chr2175809 5742 4776 4444 4215 887 716 21733 1581 15290 --
NM_044472chr11127 ------
NM_052832chr852215 2163 983 815 90 11888 12309 --
NM_052834chr1821724 567 11771 11618 --
NM_052840chr1531104 623 337 ------
NM_052879chr1263208 2912 2654 1408 1039 194 1701 ----
NM_052885chr1264597 4318 4017 3989 3420 130 ----14089
NM_052886chr852012 1946 1579 1496 452 ------
NM_052900chr82634 338 ------
NM_052904chr611199 --1268 --
NM_052907chr1284231 3613 3564 910 516 413 365 56 1217 --1680
NM_052917chr253367 3283 907 773 146 --21354 632 --
NM_052918chr1052763 2428 1271 1086 543 22750 2570 22800 385 --
NM_052932chr1162512 1762 999 923 550 197 ------
NM_052958chr82252 239 ----1100
NM_052978chr1431724 445 275 --1283 3666 456 111
NM_053001chr8----1277 129
NM_053002chr321176 313 ------
NM_053016chr957636 5051 2084 1310 873 --46997 6938 5327 525 11277
NM_053025chr3------2438 276
NM_053026chr3------2438 276
NM_053027chr3------2438 276
NM_053028chr3------2438 276
NM_053031chr3------2438 276
NM_053032chr3------2438 276
NM_053064chr1482584 2212 1118 523 392 221 128 119 ----12251
NM_053281chrX--1332 ----
NM_054016chr161793 1682 1609 1279 791 480 --11573 --
NM_054016chr161793 1682 1609 1279 791 480 --11573 --
NM_054016chr161793 1682 1609 1279 791 480 --11573 --
NM_054022chr174748 619 601 234 ------
NM_054026chr8--1109 ----
NM_057158chr82614 208 ------
NM_057159chr93619 542 284 --1272 --
NM_058170chr141542 1102 1096 305 ------
NM_058191chr211156 ------
NM_058241chr251947 1591 638 502 287 ------
NM_058241chr251947 1591 638 502 287 ------
NM_080391chr12598 76 --143 --
NM_080392chr12647 125 --192 --
NM_080546chr962032 2015 1717 1517 549 328 ------
NM_080552chr20----1689 --
NM_080591chr992877 2789 2587 2427 853 474 314 156 130 --125 --
NM_080597chr1831121 422 400 1825 ----
NM_080666chr1431351 458 293 ----21486 1142
NM_080669chr1774103 1864 1716 1262 197 190 59 34152 3755 1497 1514 13797
NM_080671chr251566 787 513 434 419 2542 49 ----
NM_080872chr883864 3526 3436 1522 929 533 526 465 ------
NM_080927chr343286 2055 1326 474 22934 1218 1613 --
NM_130434chr1541194 1153 904 775 ------
NM_130439chr1021868 1597 11908 ----
NM_130439chr1021868 1597 11908 ----
NM_130798chr1511302 ------
NM_130831chr332591 844 724 ------
NM_130832chr332591 844 724 ------
NM_130833chr332591 844 724 ------
NM_130834chr332591 844 724 ------
NM_130835chr332591 844 724 ------
NM_130836chr332591 844 724 ------
NM_130837chr332591 844 724 ------
NM_130838chr1511732 ------
NM_130839chr1511732 ------
NM_130847chr1155299 4858 4118 2291 1590 24817 1770 --12204
NM_133170chr2087659 6732 6455 5781 5534 5422 5156 516 34966 2028 1250 46724 2650 2594 1257 12285
NM_133265chrX52694 2390 661 557 333 33537 461 408 1690 --
NM_133334chr4106039 5154 4841 3914 2378 2175 1825 1262 576 332 ----13884
NM_133370chr463529 3338 2713 2684 1272 305 ------
NM_133445chr993457 3321 3313 1459 1445 602 456 185 112 13152 33380 1370 424 --
NM_133446chr101264 ------
NM_133476chr1221205 381 ------
NM_133499chrX2328 287 ------
NM_133638chr5----21207 1195 1508
NM_134265chr172938 252 ------
NM_138270chrX32175 1174 416 13325 ----
NM_138285chr22421 120 ------
NM_138286chr19114346 4085 3895 3865 3724 2966 2791 1450 1155 523 396 13409 ----
NM_138288chr142560 93 --21622 1585 --
NM_138375chr181919 ------
NM_138444chr1364542 4265 3858 3006 1224 541 ------
NM_138468chr295824 5337 4962 1979 1727 1150 271 137 76 21166 522 ----
NM_138555chr152580 466 ------
NM_138559chr2----1997 --
NM_138576chr1444287 3999 1709 389 ------
NM_138713chr1696290 6051 6035 5892 5014 2986 2312 2288 1411 --1955 1895
NM_138714chr1696290 6051 6035 5892 5014 2986 2312 2288 1411 --1955 1895
NM_138731chr1474187 4170 3733 3262 2985 1086 935 --12995 --
NM_138771chr731320 1304 1298 ------
NM_138782chr5----1383 --
NM_138980chr4--2486 281 ----
NM_138981chr4--1617 ----
NM_138982chr4--2486 281 ----
NM_138994chr161339 ------
NM_139048chr331159 140 53 ------
NM_139168chr521551 715 1343 12015 --
NM_139207chr1272199 1703 1692 1405 1379 536 252 --11745 --
NM_139286chr9------174
NM_144571chr445740 5294 5122 2140 26604 4416 25937 2173 --
NM_144574chr141182 ------
NM_144578chr1475074 2029 1713 1518 953 716 95 --15563 --
NM_144599chr1555217 3555 2143 1549 1171 --13543 --
NM_144642chr31395 1175 ----
NM_144643chr41355 --133 --
NM_144664chr1142574 2456 845 405 ------
NM_144668chr122124 115 ------
NM_144721chr422634 1025 --22534 117 1997
NM_144728chr11710 ------
NM_144729chr11710 ------
NM_144949chr222641 487 ----12229
NM_144963chr852315 1077 976 947 651 --12026 --
NM_144967chrX2706 695 ------
NM_144988chr12242 24 ------
NM_145000chr51258 ------
NM_145011chr1032001 1509 406 1442 ----
NM_145037chr33608 124 22 21240 453 --11251
NM_145115chr742297 1442 849 149 ------
NM_145165chr1452726 1171 488 376 342 11098 21795 172 12947
NM_145246chr101253 --1377 --
NM_145259chr276871 6854 6298 2130 2091 836 412 26305 4706 12731 --
NM_145263chr442321 2185 920 176 12266 ----
NM_145307chr1053948 3634 564 473 231 24421 3132 --1690
NM_145332chr62106 54 --1624 --
NM_145333chr62106 54 --1624 --
NM_145341chr1021200 616 ------
NM_145647chr82204 67 ------
NM_145686chr263011 2975 2839 1200 1161 76 12132 ----
NM_145687chr263011 2975 2839 1200 1161 76 12132 ----
NM_145690chr831875 571 544 ------
NM_145698chr1021838 1487 11993 ----
NM_145728chr1552436 1591 1564 453 250 --1791 21660 271
NM_145808chr72752 662 ------
NM_147150chr943309 3281 3157 190 43705 2456 1013 376 43941 2793 2718 909 --
NM_147175chrX2274 127 --11814 --
NM_148174chr83451 194 23 ------
NM_148898chr71223 ------
NM_148899chr71223 ------
NM_148904chr11502 ------
NM_148905chr11502 ------
NM_148906chr11502 ------
NM_148907chr11502 ------
NM_148908chr11502 ------
NM_148909chr11502 ------
NM_148957chr1362602 2496 2307 2192 924 85 22027 711 ----
NM_152236chr221215 ------
NM_152261chr1222379 704 1513 ----
NM_152263chr185606 2352 2182 1877 941 695 77 27 16000 24581 3890 --
NM_152271chr81176 ------
NM_152275chr261527 1504 566 548 526 254 --22404 1472 --
NM_152282chr31998 ------
NM_152309chr1092118 1756 871 657 637 595 536 502 395 ------
NM_152329chr141138 ------
NM_152388chr254063 3093 1368 1184 312 --13002 --
NM_152400chr41841 1814 ----
NM_152409chr542748 2710 822 30 --23299 254 --
NM_152420chr91136 ------
NM_152433chr1121289 311 ----1330
NM_152437chr1242319 1935 1541 586 32121 1902 869 ----
NM_152440chr1251166 1053 879 423 195 ------
NM_152443chr143491 451 445 --1382 1580
NM_152446chr141399 ------
NM_152450chr152646 560 ------
NM_152455chr1551825 763 472 156 50 12524 --11817
NM_152529chr294235 3778 3001 2867 2812 2794 1524 1187 723 14446 ----
NM_152536chr33926 328 60 ------
NM_152545chr41480 ------
NM_152564chr831624 1236 735 1326 --11383
NM_152597chr151627 ------
NM_152622chr552795 2344 1016 706 601 12241 11005 --
NM_152624chr567058 5794 1836 710 630 568 --56737 6084 5959 5519 534 --
NM_152641chr1252306 1863 960 719 528 ------
NM_152665chr131082 349 304 ------
NM_152666chr11295 ------
NM_152678chr312556 ------
NM_152699chr333585 2729 2596 21001 536 1607 13712
NM_152737chr651916 1906 1793 1733 1302 --11776 12021
NM_152740chr73706 671 121 ------
NM_152756chr533619 3416 864 1501 13021 --
NM_152765chr811924 12310 ----
NM_152774chr732538 2366 2329 ----1563
NM_152787chrX43838 2795 1353 427 --33178 2998 1244 --
NM_152793chr764831 4627 4495 4325 3550 1995 13170 1260 --
NM_152835chr172364 2137 1824 1054 316 293 115 ------
NM_152836chr851698 1617 550 46 29 11563 ----
NM_152837chr851698 1617 550 46 29 11563 ----
NM_152838chr2073428 3337 3215 3109 2377 991 296 22803 245 --1211
NM_152903chr132986 136 ------
NM_152991chr111557 --1625 --
NM_152994chr21595 ------
NM_152995chr42246 42 ------
NM_152998chr7177 ------
NM_153018chr1753191 2376 1133 684 583 ------
NM_153020chr651334 1214 1156 563 169 ------
NM_153042chr661512 640 556 497 318 241 ------
NM_153050chr2233686 2008 1448 11204 24897 1021 --
NM_153051chr2233686 2008 1448 11204 24897 1021 --
NM_153207chr123707 476 90 --11152 --
NM_153223chr521507 452 ------
NM_153235chr632389 2369 618 21911 90 ----
NM_153256chr1031288 714 599 --1141 --
NM_153261chr1631313 1189 1077 ----11213
NM_153267chr91859 --1121 --
NM_153365chr422373 1709 --12445 11114
NM_153371chr1331558 513 43 ------
NM_153456chr1386231 6111 5710 5057 5050 4262 1139 250 44785 3873 611 162 --34931 4897 1675
NM_153464chr191778 1237 ----
NM_153499chr1252862 2697 2066 1059 976 12825 31201 1014 988 --
NM_153500chr1252862 2697 2066 1059 976 12825 31201 1014 988 --
NM_153605chr311201 --11521 --
NM_153607chr552880 2001 1168 837 398 13054 ----
NM_153610chr51598 ------
NM_153645chr2283003 2738 2650 2487 2275 1332 1081 1003 ------
NM_153690chr31658 ------
NM_153707chr9122 ------
NM_153816chr61371 ------
NM_170606chr711869 ------
NM_170672chr231161 282 98 --1441 --
NM_170695chr18--1325 ----
NM_170706chr153492 2981 2770 1570 1169 --23408 3223 33502 375 297
NM_170709chr822007 1945 --12174 --
NM_170731chr1141988 1764 1012 410 --12189 --
NM_170732chr1141988 1764 1012 410 --12189 --
NM_170733chr1141988 1764 1012 410 --12189 --
NM_170734chr1141988 1764 1012 410 --12189 --
NM_170735chr1141988 1764 1012 410 --12189 --
NM_170774chr2053338 2996 2849 142 96 13786 --1476
NM_171998chrX62348 2293 2231 2015 1636 790 ------
NM_172037chr841420 1077 307 160 ----1961
NM_172070chr232093 761 332 ----1195
NM_172071chr167232 5617 5470 2436 2241 600 15526 12827 --
NM_172127chr41418 ------
NM_172128chr41374 ------
NM_172193chr14------11225
NM_172216chr1252764 2599 1968 961 878 12727 31103 916 890 --
NM_172218chr81226 --1534 --
NM_172226chr1252862 2697 2066 1059 976 12825 31201 1014 988 --
NM_172242chr102128 102 ------
NM_172373chr1311154 --11269 --
NM_173060chr561942 1873 1796 1645 419 118 ------
NM_173061chr561942 1873 1796 1645 419 118 ------
NM_173063chr561942 1873 1796 1645 419 118 ------
NM_173075chr421572 1351 ------
NM_173083chr111106 ------
NM_173167chr1722543 2497 --12187 21057 91
NM_173171chr21244 11229 ----
NM_173172chr221004 552 11537 ----
NM_173173chr21244 11229 ----
NM_173207chr18--1325 ----
NM_173208chr18--1325 ----
NM_173209chr18--1325 ----
NM_173210chr18--1325 ----
NM_173211chr18--1325 ----
NM_173214chr1696290 6051 6035 5892 5014 2986 2312 2288 1411 --1955 1895
NM_173468chr4116036 4349 4061 2162 1556 1459 1443 1406 962 175 86 35086 4269 1037 23821 2245 --
NM_173469chr151186 ------
NM_173473chr1042566 1821 782 511 ------
NM_173475chr1611666 --1586 --
NM_173487chr44808 753 668 327 ------
NM_173491chr52329 29 ------
NM_173508chr111058 ------
NM_173576chr1052349 2156 847 730 719 11713 ----
NM_173582chr1166058 4762 4375 3920 549 511 22179 1897 1192 --
NM_173602chr1242861 2474 1503 315 1589 1973 --
NM_173642chr1129226 8749 6575 6465 6219 3513 3124 2327 2129 1627 467 73 36808 3699 2230 18933 --
NM_173647chr22868 438 --11066 --
NM_173648chr21728 ------
NM_173654chr371825 1768 1501 791 536 492 326 ----11640
NM_173694chrX1298 --21941 153 --
NM_173797chr521207 963 ------
NM_173808chr163991 3966 3860 3227 1176 512 13241 1251 --
NM_173822chr221592 337 ----1525
NM_173848chr81154 ------
NM_173854chr1112096 1945 1836 1588 1516 567 510 377 302 283 103 --22128 1871 --
NM_174886chr18--1325 ----
NM_174890chr10168 ------
NM_174900chr441276 231 206 75 11101 ----
NM_174902chr1131257 1141 649 ------
NM_174934chr1151450 1282 742 457 252 32884 2692 408 --23157 468
NM_175610chr1521336 227 --191 --
NM_175634chr8------1236
NM_175635chr8------1236
NM_175636chr8------1236
NM_175736chr12137023 6621 6313 2988 2894 1796 1516 1273 924 567 411 401 316 21336 645 --12131
NM_175767chr51541 ------
NM_175854chr1341913 1693 726 229 21951 964 ----
NM_175856chr52732 522 ------
NM_175861chr1255488 1984 735 654 332 45155 4053 1491 316 24559 1118 --
NM_175863chr621114 40 ------
NM_175866chr131416 1222 962 --1217 --
NM_176814chr72996 966 ------
NM_176823chr153328 3237 3113 2600 2593 --13042 --
NM_177553chr113690 615 268 1640 ----
NM_177947chrX41451 1248 686 22 ------
NM_177948chrX41451 1248 686 22 ------
NM_177968chr221859 1476 ----11368
NM_177969chr22701 542 ------
NM_177972chr1174432 3980 3299 1530 1104 1001 38 14216 23381 1744 --
NM_178123chr241075 792 714 389 ------
NM_178151chrX127610 7422 6862 5671 5310 5267 4953 2867 2025 1093 787 449 ----17715
NM_178152chrX127610 7422 6862 5671 5310 5267 4953 2867 2025 1093 787 449 ----17715
NM_178153chrX127610 7422 6862 5671 5310 5267 4953 2867 2025 1093 787 449 ----17715
NM_178423chr71989 --1218 --
NM_178425chr71989 --1218 --
NM_178581chr201272 ------
NM_178585chr462908 2778 2758 2506 2098 377 ------
NM_178586chr1432000 1749 897 ------
NM_181054chr1431165 829 234 1441 ----
NM_181302chr141182 ------
NM_181308chr141182 ------
NM_181332chrX31992 1971 1824 11093 ----
NM_181353chr201668 ------
NM_181358chr154018 3564 3192 1482 1219 13091 ----
NM_181443chr2052338 729 715 680 480 --1238 --
NM_181457chr231254 1060 95 1877 11181 --
NM_181458chr231387 1193 228 11010 11314 --
NM_181460chr231200 1006 41 1823 11127 --
NM_181504chr563545 2718 1552 210 133 54 ----21269 386
NM_181523chr563545 2718 1552 210 133 54 ----21269 386
NM_181524chr563545 2718 1552 210 133 54 ----21269 386
NM_181659chr2032876 2684 1252 1264 --1278
NM_181659chr2032876 2684 1252 1264 --1278
NM_181672chrX71547 1437 745 618 383 352 250 11963 ----
NM_181673chrX71547 1437 745 618 383 352 250 11963 ----
NM_181702chr8----1239 --
NM_181713chr22280 146 ------
NM_181714chr631244 290 75 ------
NM_181746chr12823 215 ------
NM_181780chr331450 1403 112 ------
NM_181782chr631840 428 163 ------
NM_181787chr833701 2373 569 ------
NM_181789chr1522293 101 12379 ----
NM_181836chr521055 358 ------
NM_181838chr511067 ------
NM_181844chr1781396 1317 733 707 628 622 537 246 --1647 --
NM_182485chr441253 946 834 721 2953 659 ----
NM_182493chr16105308 5173 4817 4536 4353 4070 3672 2033 1660 688 13946 11290 13885
NM_182503chr6105604 3996 3937 1752 1621 1109 558 353 256 169 1325 45343 4998 3450 1637 14637
NM_182515chr1956246 5440 5074 2266 1761 2575 240 --15044
NM_182551chr253434 3327 2392 345 32 22233 2198 ----
NM_182569chr172273 214 ------
NM_182607chrX31454 700 347 ------
NM_182620chr1742253 2153 1851 640 ----192
NM_182643chr852297 1521 744 117 49 ------
NM_182646chr441253 946 834 721 2953 659 ----
NM_182666chr31261 ----1440
NM_182691chr741260 1224 960 229 ------
NM_182692chr741260 1224 960 229 ------
NM_182697chr741628 1487 1160 157 ------
NM_182700chr761931 1574 1301 657 474 369 11290 31922 1518 353 --
NM_182763chr142139 1994 259 83 --1840 --
NM_182765chr1032341 1929 641 11955 ----
NM_182898chr7116285 6168 5871 5678 5637 4636 4050 2257 1803 792 75 21209 937 --16100
NM_182899chr7116285 6168 5871 5678 5637 4636 4050 2257 1803 792 75 21209 937 --16100
NM_182918chr21----1326 --
NM_182943chr331275 835 825 ------
NM_182948chr143088 1963 1132 970 1807 ----
NM_182977chr51282 ------
NM_183004chr1433486 1281 1023 12629 --22510 175
NM_183238chr1282913 1562 1141 1124 883 662 308 153 33332 1508 866 --32986 2449 1372
NM_183353chrX1388 ------
NM_183397chr2094870 4859 4379 3626 1532 1337 1282 674 495 24137 665 33929 3403 1276 --
NM_194071chr784911 4785 4661 4624 3494 1713 1606 965 24013 1764 11858 --
NM_194247chr244459 823 654 101 ------
NM_194250chr21367 ------
NM_194282chr472690 2296 987 521 472 402 71 ----1900
NM_194283chr543943 3275 2681 36 --13032 11625
NM_194285chr1133339 2264 90 11286 131 --
NM_194291chr842976 2890 2796 1984 --1781 --
NM_194313chr971954 1925 1867 1675 493 376 65 1270 1554 --
NM_194314chr154599 4554 4199 3938 2004 --15017 --
NM_194317chr242681 870 657 443 ------
NM_194328chr932876 2855 1001 ------
NM_194329chr932876 2855 1001 ------
NM_194330chr932876 2855 1001 ------
NM_194332chr932876 2855 1001 ------
NM_194356chr1262365 2179 1830 1519 799 531 ------
NM_194434chr1864944 4887 1905 1397 644 394 15297 ----
NM_194439chr431263 960 454 ----1320
NM_194463chrX31106 434 244 ------
NM_197972chr1141 ------
NM_198066chr1472833 2462 2173 1216 187 148 59 ------
NM_198086chr1431904 746 725 --1636 1320
NM_198123chr82634 338 ------
NM_198124chr82634 338 ------
NM_198128chr183865 827 429 ------
NM_198158chr321191 154 ------
NM_198159chr321191 154 ------
NM_198177chr321191 154 ------
NM_198178chr321191 154 ------
NM_198181chr1562360 2168 1177 767 573 88 --12527 --
NM_198217chr132920 216 ------
NM_198218chr132920 216 ------
NM_198219chr132920 216 ------
NM_198225chr1021562 482 193 ----
NM_198240chr1261182 1084 1045 916 395 126 ------
NM_198243chr153694 277 41 --1316 --
NM_198267chr72774 598 ----1663
NM_198268chr154018 3564 3192 1482 1219 13091 ----
NM_198269chr154018 3564 3192 1482 1219 13091 ----
NM_198270chrX62796 1060 915 430 384 171 --13383 --
NM_198273chr532825 1159 45 ----197
NM_198320chr1284570 4381 4170 3568 1813 1149 829 610 1102 ----
NM_198353chr42408 170 ------
NM_198381chr1131302 475 270 1340 ----
NM_198399chr321203 36 ----11424
NM_198401chr821322 145 1282 --1455
NM_198439chr1121289 311 ----1330
NM_198468chr674550 4296 4110 3809 1840 770 114 ----13394
NM_198484chr395691 5672 5034 4992 4857 4559 1416 233 102 1632 16213 --
NM_198506chr431286 1093 590 11233 1226 --
NM_198513chr831927 1454 815 21291 234 ----
NM_198549chr132739 2627 2105 ------
NM_198569chr652375 2363 2093 757 378 22556 307 ----
NM_198581chr2117067 6472 6115 6070 5513 4886 2946 2365 1641 918 319 15021 27045 2112 12442
NM_198793chr3104159 4083 3132 2776 2682 1449 1226 1216 326 311 13229 ----
NM_198829chr711168 ------
NM_198834chr1741993 574 108 50 1519 --138
NM_198836chr1741993 574 108 50 1519 --138
NM_198837chr1741993 574 108 50 1519 --138
NM_198838chr1741993 574 108 50 1519 --138
NM_198839chr1741993 574 108 50 1519 --138
NM_198844chr171897 ------
NM_198900chr12137023 6621 6313 2988 2894 1796 1516 1273 924 567 411 401 316 21336 645 --12131
NM_198903chr52593 238 ------
NM_198904chr551773 1299 850 593 238 ------
NM_198956chr761931 1574 1301 657 474 369 11290 31922 1518 353 --
NM_198965chr121300 ------
NM_198966chr121300 ------
NM_198968chr1383922 3379 3010 2963 2944 2909 1071 699 11145 ----
NM_199003chr821466 1460 ------
NM_199078chr272222 2142 1780 960 628 115 56 ----11012
NM_199168chr1021249 172 ------
NM_199188chr1263208 2912 2654 1408 1039 194 1701 ----
NM_199190chr1263208 2912 2654 1408 1039 194 1701 ----
NM_199321chr171897 ------
NM_199324chr453337 3056 2987 2275 1183 --21077 940 --
NM_199436chr252865 2603 2293 658 249 12422 1111 --
NM_199461chr104643 395 322 284 --12632 12726
NM_199478chrX11956 ------
NM_199482chr241748 1348 408 66 ------
NM_201269chr131053 945 535 ------
NM_201428chr1111488 ------
NM_201429chr1111488 ------
NM_201430chr1111414 ------
NM_201516chr7158 ------
NM_201567chr31529 21509 486 --21356 1244
NM_201570chr1021309 735 11244 1647 --
NM_201571chr1021309 735 11244 1647 --
NM_201572chr1021309 735 11244 1647 --
NM_201590chr1021309 735 11244 1647 --
NM_201593chr1021309 735 11244 1647 --
NM_201596chr1021309 735 11244 1647 --
NM_201597chr1021309 735 11244 1647 --
NM_201995chr111152 ------
NM_203301chr141176 ------
NM_203342chr173170 3104 2871 2593 2215 1347 173 --23535 1082 --
NM_203343chr173170 3104 2871 2593 2215 1347 173 --23535 1082 --
NM_203354chr141193 ------
NM_203355chr141193 ------
NM_203356chr141193 ------
NM_203364chr1121149 452 1100 --1442
NM_203399chr11102 ----1756
NM_203401chr11102 ----1756
NM_203406chr542714 1168 1001 245 1345 ----
NM_203446chr2121075 1008 --21939 343 --
NM_203459chr141771 968 790 492 --12527 --
NM_203463chr274750 4636 4286 4218 1839 1231 416 --11800 14555
NM_203487chr131334 ------
NM_203488chr141421 ------
NM_205768chr12464 137 --1188 11845
NM_206594chr142989 2497 807 81 ------
NM_206595chr142989 2497 807 81 ------
NM_206840chr1123 ------
NM_206853chr633906 2957 1416 12864 12772 --
NM_206854chr625167 4218 24125 245 14033 --
NM_206855chr626132 5183 25090 1210 14998 165
NM_206876chr243327 3045 1355 967 --12673 1585
NM_206907chr563358 2998 2064 1247 540 473 ------
NM_206909chr888412 7998 7982 3327 2320 1410 844 420 25547 1617 37472 2231 1767 16075
NM_206944chr9--1270 ----
NM_206945chr9--1270 ----
NM_206946chr9--1270 ----
NM_206947chr9--1270 ----
NM_206966chr51192 ------
NM_207015chr342020 1797 1700 312 ------
NM_207032chr2021489 576 ----11344
NM_207033chr2021397 484 ----11252
NM_207034chr2021397 484 ----11252
NM_207303chr10104136 4000 3889 3762 3685 2592 1661 1456 1125 257 13791 1975 13756
NM_207332chr8174 ------
NM_207391chr19----1919 --
NM_207396chr151862 1666 440 137 36 --11365 --
NM_207406chr4126524 6465 6395 6100 6017 4336 4143 4117 2052 1450 1203 1001 26281 4795 45806 4682 1830 649 --
NM_207422chrX3334 256 81 ------
NM_207645chr1111139 ------
NM_207647chr922118 616 22436 2209 11605 11674
NM_212467chr1592505 2454 2045 1839 1805 1760 1059 888 823 1312 22114 298 --
NM_212471chr1722174 393 --1868 --
NM_212472chr1722174 393 --1868 --
NM_212535chr161127 ------
NM_212554chr1021525 58 11010 --1278
NM_212558chr91673 --22763 335 --
NM_213589chr274897 3886 3761 2078 1694 815 375 --13869 14599
NM_213606chr1012398 21094 435 ----