TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-517a-3p
miRNA Sequence: AUCGUGCAUCCCUUUAGAGUGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000037chr832299 214 153 2500 193 ----
NM_000038chr5------1531
NM_000084chrX16989 ------
NM_000093chr922394 76 ----1640
NM_000096chr31947 ------
NM_000165chr631651 1557 214 ------
NM_000167chrX----2386 129 --
NM_000176chr51444 ------
NM_000189chr21865 ------
NM_000194chrX1110 ------
NM_000210chr2151 1311 ----
NM_000217chr1211481 --11158 --
NM_000245chr731615 1445 778 11986 ----
NM_000248chr311934 ----12083
NM_000259chr1544780 4738 2449 1230 --15011 --
NM_000266chrX2805 354 ------
NM_000282chr13----151 --
NM_000284chrX1150 ------
NM_000293chr165893 857 848 287 153 ------
NM_000314chr1022939 488 ------
NM_000319chr1211051 ----11233
NM_000368chr92860 65 11476 ----
NM_000390chrX12840 13376 ----
NM_000399chr102897 834 ------
NM_000408chr243431 3141 2683 586 13212 ----
NM_000430chr1722811 164 ------
NM_000448chr1132203 2188 550 ------
NM_000451chrX2333 176 --11724 --
NM_000461chr323014 740 14235 13472 --
NM_000484chr21------1282
NM_000555chrX77456 6904 6645 5200 2929 1681 1487 --12649 --
NM_000610chr1112994 --11036 --
NM_000618chr1235570 5352 314 --160 --
NM_000618chr1235570 5352 314 --160 --
NM_000633chr1814192 14559 ----
NM_000641chr1911393 --11583 --
NM_000693chr151619 --11583 --
NM_000719chr1266053 5067 1703 639 594 231 --31153 392 154 --
NM_000721chr122384 25 ------
NM_000793chr1425003 314 13124 ----
NM_000794chr51431 ------
NM_000807chr41578 ------
NM_000810chr151118 --1537 --
NM_000813chr545239 1523 801 674 1606 ----
NM_000816chr51581 ------
NM_000817chr211009 ------
NM_000824chr42332 165 ------
NM_000840chr71123 ------
NM_000844chr31744 ------
NM_000861chr32792 530 --11740 --
NM_000868chrX31941 1911 1823 ----11963
NM_000875chr1536086 5461 1532 14461 ----
NM_000891chr17--11163 12805 --
NM_000899chr1241186 337 324 230 11523 ----
NM_000933chr2021189 399 ----11231
NM_000935chr3--154 ----
NM_000938chr41129 ------
NM_000944chr43933 412 60 ----11533
NM_000945chr211582 --22036 1566 --
NM_000958chr5--1426 ----
NM_000965chr31278 ------
NM_001001132chr213438 188 119 ------
NM_001001323chr1222508 2235 --12311 1416
NM_001001344chrX3716 629 70 ------
NM_001001389chr1112994 --11036 --
NM_001001390chr1112994 --11036 --
NM_001001391chr1112994 --11036 --
NM_001001392chr1113040 --11082 --
NM_001001396chr124316 1441 --14172 --
NM_001001481chr822794 912 1551 1416 --
NM_001001664chr223501 2941 --13152 12908
NM_001001890chr2112661 ------
NM_001001974chr1012008 ------
NM_001002032chr17197 --1653 --
NM_001002033chr171197 --1753 --
NM_001002243chr21897 ------
NM_001002257chr21745 12690 185 --
NM_001002295chr1011024 1346 ----
NM_001002843chr151182 ------
NM_001002919chr2--1427 ----
NM_001003652chr1828400 3110 --26540 1968 --
NM_001003674chr1846506 4827 1693 163 11026 ----
NM_001003675chr1846506 4827 1693 163 11026 ----
NM_001003683chr2127 ------
NM_001003688chr4145 ------
NM_001003760chr623113 2698 ------
NM_001003800chr963551 2550 1469 1320 462 391 ------
NM_001004065chr923490 867 --11504 --
NM_001004317chr632774 1598 229 ------
NM_001004329chr12------11463
NM_001004342chr145698 5240 3947 873 15133 15654 --
NM_001004360chr21274 ------
NM_001005366chr122677 135 ------
NM_001005386chr211683 ------
NM_001005463chr10----22372 1831 --
NM_001005473chr514027 ------
NM_001005526chr2141 133 ----
NM_001005609chrX22851 271 ------
NM_001005849chr171480 ------
NM_001005861chr31617 ------
NM_001006600chr51808 ------
NM_001006610chr161161 ------
NM_001006635chr21242 ------
NM_001006684chrX1207 ------
NM_001006933chrX1194 ------
NM_001007023chr1425003 314 13124 ----
NM_001007102chr61625 ----11570
NM_001007156chr15--11337 1119 --
NM_001007257chr1150 ------
NM_001008225chr7145 --166 --
NM_001008405chr7------193
NM_001008408chr745062 2071 1575 285 ------
NM_001008541chr1021860 851 --1750 --
NM_001008541chr1021860 851 --1750 --
NM_001008701chr1922360 1069 ------
NM_001008723chr10----1414 --
NM_001008738chr51266 ------
NM_001008783chr61308 ------
NM_001008938chr112435 429 ------
NM_001009554chr433689 1671 406 --11895 --
NM_001009554chr433689 1671 406 --11895 --
NM_001009880chr2234905 4778 3623 21051 720 21610 1078 --
NM_001009899chr352254 1606 818 206 61 ------
NM_001009960chr722687 92 ------
NM_001009993chr254098 3909 3271 1512 294 ------
NM_001010861chr122561 485 ------
NM_001010867chr155505 5430 2560 2209 366 14982 11659 --
NM_001010888chrX44520 3733 973 875 14555 ----
NM_001010989chr161374 ------
NM_001010990chr161374 ------
NM_001011553chr71124 ------
NM_001011666chr732590 2025 694 ------
NM_001011713chr142624 52 ------
NM_001011885chr1511750 --2368 94 --
NM_001012393chr1125121 4123 ----1665
NM_001012514chr21976 ------
NM_001012516chr21976 ------
NM_001012661chr111162 ------
NM_001012716chr181272 ------
NM_001012979chrX1194 ------
NM_001012989chrX1190 ------
NM_001013031chr1043389 2941 316 157 ------
NM_001013251chr111162 ------
NM_001013437chr181120 ------
NM_001013843chr151659 ------
NM_001014449chr16--1222 ----
NM_001014451chr16--1222 ----
NM_001015877chrX12349 ------
NM_001017371chr221353 193 ------
NM_001017395chr332583 231 45 ----13515
NM_001017405chr41902 ------
NM_001017424chr1----195 --
NM_001017425chr1----195 --
NM_001017440chr731949 541 49 1368 --15496
NM_001017923chr14------11472
NM_001017926chr821325 547 ------
NM_001017928chr3172 ------
NM_001017969chr91642 ------
NM_001017977chr11360 ------
NM_001018008chr15------1635
NM_001018037chr911222 ------
NM_001018056chr91509 ------
NM_001018074chr51444 ------
NM_001018075chr51444 ------
NM_001018076chr51444 ------
NM_001018077chr51444 ------
NM_001018090chr152471 463 ------
NM_001018091chr152581 573 ------
NM_001018100chr151800 ------
NM_001018102chr152471 463 ------
NM_001018111chr722610 1313 13564 --11326
NM_001023567chr1512446 ------
NM_001024094chr51444 ------
NM_001024218chr14132 ------
NM_001024668chr12------1940
NM_001024858chr1432248 516 495 ------
NM_001024948chr1----11405 --
NM_001025076chr1025632 207 ----15174
NM_001025077chr1026990 1565 ----16532
NM_001025233chr12--1363 11099 --
NM_001025266chr344386 3773 1855 1160 1725 ----
NM_001029858chr633343 1252 474 ------
NM_001029863chr622903 2205 1899 ----
NM_001029875chr51251 ------
NM_001030007chr161103 1716 ----
NM_001030055chr144767 249 188 58 11543 14016 --
NM_001031679chr1233142 2921 1007 ------
NM_001031681chr1712316 ------
NM_001031835chr161287 ------
NM_001032221chr921364 109 ----1651
NM_001032293chr171646 ------
NM_001032393chrX1477 ------
NM_001033059chr61253 ----1195
NM_001033112chr51136 ------
NM_001033117chr333994 1213 394 13946 11393 11205
NM_001033503chr5----1449 --
NM_001033518chr71294 ----1300
NM_001033519chr71294 ----1300
NM_001033520chr71294 ----1300
NM_001033554chr17----1207 --
NM_001033566chr171837 ------
NM_001033568chr171837 ------
NM_001033602chr131901 --11896 --
NM_001033925chr1011357 ------
NM_001034837chr52736 560 ------
NM_001034838chr52736 560 ------
NM_001035chr11848 ----1509
NM_001035260chr1021575 1192 ------
NM_001037132chr7------22071 311
NM_001037133chr7------22071 311
NM_001037164chr71645 ------
NM_001037317chr122561 485 ------
NM_001037339chr121893 1380 --11739 --
NM_001037340chr121893 1380 --11739 --
NM_001037341chr121893 1380 --11739 --
NM_001037341chr121893 1380 --11739 --
NM_001037553chr2184649 4335 4189 3453 3415 3283 2010 1697 21527 545 11608 --
NM_001037872chr21170 1493 173 --
NM_001037954chr1132170 1062 134 1957 ----
NM_001039199chr201143 --15026 --
NM_001039538chr22262 42 1971 ----
NM_001039577chr133733 1494 1294 --21596 401 --
NM_001039585chr12744 156 ------
NM_001039590chrX22772 1589 ------
NM_001039591chrX22772 1589 ------
NM_001039840chrX24177 4004 12106 ----
NM_001040057chr711454 ----195
NM_001040101chr411205 ------
NM_001040110chr711627 ------
NM_001040142chr232141 1592 891 ------
NM_001040143chr232141 1592 891 ------
NM_001040152chr711872 ------
NM_001040159chr41429 ------
NM_001040214chr621842 1632 ------
NM_001040272chr922036 772 --1741 12245
NM_001040284chr1621052 453 12371 ----
NM_001040402chr4--12726 ----
NM_001040441chr154596 4461 4244 1782 136 ------
NM_001040709chr112524 ------
NM_001040712chr943162 2947 2835 1277 ------
NM_001042355chr161526 ------
NM_001042404chr1176 ------
NM_001042412chr161526 ------
NM_001042430chr141555 137 ----
NM_001042459chr3------1122
NM_001042517chr131671 ------
NM_001042537chrX21879 85 ------
NM_001042555chr12--34333 3415 1634 ----
NM_001042599chr236771 2856 229 ------
NM_001042603chr1233597 876 153 ------
NM_001071775chr13194 ------
NM_001099678chr314886 ----1265
NM_001100108chr112941 --26595 2580 --
NM_001119chr441233 1171 607 311 ------
NM_001124chr111514 ----1640
NM_001128chr161103 1716 ----
NM_001149chr102191 134 ------
NM_001156chr10172 ------
NM_001173chr144767 249 188 58 11543 14016 --
NM_001186chr2122858 815 ------
NM_001187chr211501 ------
NM_001198chr6--1178 ----
NM_001206chr922129 629 ------
NM_001221chr41119 ----1135
NM_001222chr1071629 1514 1245 783 346 156 146 --11901 --
NM_001241chr21515 ------
NM_001241chr21515 ------
NM_001256chr1712216 ------
NM_001270chr51921 ------
NM_001280chr191680 ------
NM_001284chr5------1436
NM_001292chr151938 --1271 --
NM_001299chr192391 94 ------
NM_001310chr12------1522
NM_001332chr5241 35 ------
NM_001356chrX12440 ------
NM_001358chr4----1329 --
NM_001365chr171168 --1594 --
NM_001378chr2171 ------
NM_001390chr1832912 2322 1176 --23124 654 --
NM_001391chr181898 ------
NM_001394chr81716 ------
NM_001399chrX22851 271 ------
NM_001401chr921377 553 ------
NM_001408chr1------1674
NM_001412chrX23370 778 197 12436 --
NM_001417chr121158 ------
NM_001419chr193788 610 24 --11779 --
NM_001432chr413726 ------
NM_001449chrX2477 269 ----1848
NM_001482chr15------189
NM_001483chr71858 ------
NM_001543chr513938 ----14638
NM_001553chr4127 ------
NM_001614chr172600 34 ------
NM_001614chr172600 34 ------
NM_001616chr21941 ------
NM_001634chr61253 ----1195
NM_001655chr114631 497 413 136 --1125 --
NM_001660chr31674 ------
NM_001663chr14--11953 1741 --
NM_001681chr12152 --190 --
NM_001682chr1232222 1949 1071 --12025 1130
NM_001684chr124033 1158 --13889 --
NM_001690chr31349 ------
NM_001693chr811222 ------
NM_001709chr1142632 917 301 113 ------
NM_001730chr1311043 ------
NM_001730chr1311043 ------
NM_001743chr22214 112 ------
NM_001744chr52159 80 ------
NM_001753chr721844 245 ------
NM_001754chr2112661 ------
NM_001755chr1611668 ------
NM_001759chr1265119 4675 4669 2094 428 413 ------
NM_001788chr71124 ------
NM_001792chr181801 ------
NM_001795chr16----21562 1037 --
NM_001819chr20----1188 --
NM_001825chr5144 ------
NM_001851chr62782 105 ----132
NM_001859chr923714 106 11000 ----
NM_001873chr42718 496 ------
NM_001903chr51585 ------
NM_001918chr148586 7459 7180 2499 17254 13186 --
NM_001949chr622834 440 --12914 --
NM_001964chr51275 ------
NM_001969chr1442999 873 766 717 ------
NM_001980chr1211470 ----1322
NM_001981chr112313 ------
NM_002024chrX1677 1113 ----
NM_002025chrX58304 8274 6281 821 188 15890 38565 5836 3565 --
NM_002026chr21423 ------
NM_002040chr21----22244 121 --
NM_002051chr1011024 1346 ----
NM_002092chr414079 ----11594
NM_002111chr463472 2399 2343 1091 651 450 --11222 --
NM_002126chr1733938 2908 742 ------
NM_002130chr511538 --1284 --
NM_002139chrX--1476 ----
NM_002148chr21667 ------
NM_002193chr231891 1385 21 135 11479 --
NM_002196chr201282 ------
NM_002196chr201282 ------
NM_002202chr51982 ----1136
NM_002210chr221150 338 ----1497
NM_002211chr101340 ------
NM_002214chr721441 589 ------
NM_002232chr111203 ------
NM_002235chr12--11074 ----
NM_002239chr21269 ------
NM_002245chr11450 ------
NM_002247chr1041754 1507 1448 146 --12303 --
NM_002252chr22408 380 ------
NM_002264chr325042 3302 ------
NM_002267chr131790 --1199 --
NM_002268chr3----1577 11646
NM_002270chr552088 1990 1428 1233 517 --14804 --
NM_002271chr1312186 1501 ----
NM_002336chr1234887 4033 3630 22028 1076 ----
NM_002351chrX11674 ------
NM_002359chr1713206 1472 ----
NM_002374chr22262 42 1971 ----
NM_002478chr111556 ------
NM_002499chr15185 ------
NM_002500chr211167 --1994 --
NM_002515chr1421386 640 ------
NM_002519chr11194 ------
NM_002524chr1------1722
NM_002527chr12154 ------
NM_002545chr1125121 4123 ----1665
NM_002552chr211248 ------
NM_002581chr945700 1803 1524 348 --13587 --
NM_002585chr11391 ------
NM_002600chr121893 1380 --11739 --
NM_002607chr7195 ------
NM_002628chr31420 --1213 --
NM_002633chr1170 ------
NM_002687chr142468 104 ------
NM_002711chr71589 ------
NM_002715chr52365 208 ------
NM_002737chr1754955 4592 1253 1000 940 --26638 2414 --
NM_002740chr3149 ------
NM_002742chr14------1507
NM_002745chr2234038 3947 1380 ------
NM_002748chr1511010 11125 --1353
NM_002752chr51108 ------
NM_002806chr14----130 --
NM_002833chr152554 137 11051 ----
NM_002837chr1211319 --14379 --
NM_002839chr943162 2947 2835 1277 ------
NM_002874chr931756 801 172 ------
NM_002886chr31236 --11567 --
NM_002890chr52762 26 ------
NM_002912chr6166 ------
NM_002924chr1--122 1104 --
NM_002942chr321411 1244 ------
NM_002948chr31324 ------
NM_002950chr32376 85 ------
NM_002956chr12----11056 --
NM_002958chr31617 ------
NM_002970chrX1138 ------
NM_002998chr81829 ------
NM_003010chr171270 ------
NM_003017chr611280 11226 ----
NM_003028chr921207 135 ------
NM_003031chr161161 ------
NM_003034chr12198 13037 --15194
NM_003048chr212683 ------
NM_003077chr172715 317 ------
NM_003107chr622260 852 ------
NM_003108chr277011 6915 6904 6760 2897 1904 1677 ------
NM_003111chr221353 193 ------
NM_003112chr723102 3004 ------
NM_003128chr231112 1039 706 ------
NM_003155chr81409 --12521 1141
NM_003178chr311878 --1506 --
NM_003188chr61279 ------
NM_003199chr1814802 ------
NM_003216chr2233100 991 547 ------
NM_003247chr6138 1405 11428 --
NM_003250chr171379 ------
NM_003257chr1521324 192 ----1423
NM_003262chr364741 4688 4269 4167 971 613 ------
NM_003298chr3------16157
NM_003304chr3----11568 --
NM_003326chr111922 140 ----
NM_003336chrX1913 ------
NM_003337chr51182 ------
NM_003340chr41561 ------
NM_003344chr721751 243 ------
NM_003348chr121190 ------
NM_003358chr91139 ------
NM_003375chr101302 ------
NM_003383chr91509 ------
NM_003385chr2----1170 --
NM_003387chr21784 12786 ----
NM_003392chr322791 1630 13848 ----
NM_003400chr2------1214
NM_003410chrX----11001 --
NM_003412chr31743 --21964 597 --
NM_003413chrX------11831
NM_003432chr51405 --1445 --
NM_003452chr91901 ------
NM_003457chr171646 ------
NM_003473chr102811 768 ------
NM_003478chr111172 ------
NM_003483chr121383 --1919 --
NM_003489chr2132988 2903 78 ----12979
NM_003558chr9------1243
NM_003566chr12------13231
NM_003579chr1----1120 --
NM_003586chr163602 74 62 ------
NM_003590chr212622 ------
NM_003603chr421873 1502 ------
NM_003615chr312931 ------
NM_003617chr123938 1839 ------
NM_003618chr21130 ------
NM_003633chr542022 749 692 31 ------
NM_003663chr31290 ------
NM_003671chr92614 306 ------
NM_003677chr1212081 ----1371
NM_003692chr91953 1349 ----
NM_003704chr4----1599 --
NM_003705chr22609 87 1240 ----
NM_003750chr10--1131 ----
NM_003783chr11966 ------
NM_003799chr1844501 4153 4085 180 ------
NM_003816chr8------1480
NM_003850chr13------1186
NM_003872chr2--22844 679 ----
NM_003885chr1712191 ------
NM_003887chr222049 592 ------
NM_003902chr11615 ------
NM_003913chr654317 3095 1216 631 117 ------
NM_003919chr7----187 --
NM_003927chr181786 ------
NM_003934chr911232 ------
NM_003939chr1023589 2829 --12521 1722
NM_003941chr722362 2239 12199 ----
NM_003947chr3----11316 --
NM_003953chr1----1206 --
NM_003968chr3------1550
NM_003971chr17146 ------
NM_003972chr1031073 1024 863 ------
NM_003994chr1241186 337 324 230 11523 ----
NM_004034chr10172 ------
NM_004037chr12118 87 --1877 --
NM_004055chr11148 --11591 --
NM_004067chr711148 ------
NM_004080chr731417 1167 248 --11468 1201
NM_004114chrX11070 --11105 --
NM_004124chr1413533 ------
NM_004145chr193300 280 26 1958 ----
NM_004162chr31176 ------
NM_004171chr1158907 2741 1996 1377 171 39136 8044 8004 ----
NM_004211chr111128 ------
NM_004263chr2----1460 1579
NM_004272chr521723 1585 ------
NM_004274chr141963 125 ----
NM_004281chr10163 ------
NM_004296chr1433961 3924 412 ------
NM_004302chr123671 558 69 ------
NM_004331chr82844 92 ------
NM_004338chr1846506 4827 1693 163 11026 ----
NM_004349chr81470 ------
NM_004354chr41733 --1849 --
NM_004370chr622020 1437 ------
NM_004383chr151550 1396 ----
NM_004389chr22340 138 ------
NM_004393chr311571 ------
NM_004396chr171272 ------
NM_004397chr1114240 ------
NM_004411chr71509 ------
NM_004430chr842334 2207 557 497 --12218 --
NM_004440chr61556 ------
NM_004449chr211524 1270 ----
NM_004457chr2168 ----1659
NM_004458chrX21853 408 --12586 --
NM_004459chr1722040 1328 ------
NM_004475chr1721147 1134 ------
NM_004492chr15--1187 ----
NM_004496chr1411182 ------
NM_004501chr1--14017 1220 --
NM_004504chr21903 ------
NM_004516chr19----11168 --
NM_004519chr8----1211 --
NM_004550chr11146 ------
NM_004586chrX--1785 14486 --
NM_004593chr31229 ------
NM_004603chr741009 999 753 203 --1179 --
NM_004660chrY12311 ------
NM_004663chr1511539 ------
NM_004673chr111296 ------
NM_004685chr1321060 616 ----11070
NM_004687chr1711946 ----1489
NM_004709chrX11679 ------
NM_004717chr72575 231 1276 ----
NM_004719chr1232488 2415 778 ------
NM_004725chr10----1185 --
NM_004726chrX24735 828 --1853 --
NM_004741chr1011548 ------
NM_004742chr3--1397 ----
NM_004745chr855942 4413 2351 2002 520 26083 1873 ----
NM_004755chr141225 ------
NM_004768chr13403 277 183 ------
NM_004774chr171385 21269 1001 --1445
NM_004795chr1311731 1272 ----
NM_004796chr1412092 ----11912
NM_004798chr2053024 2223 1366 828 226 12969 ----
NM_004801chr2------11482
NM_004815chr1----14732 --
NM_004831chr191900 ------
NM_004839chr151599 ------
NM_004840chrX42143 962 182 176 --1807 --
NM_004845chrX54115 4042 3242 965 404 13705 ----
NM_004850chr221650 646 ------
NM_004866chr543428 1558 595 129 ------
NM_004887chr511115 ------
NM_004896chr1021490 1107 ------
NM_004898chr4------1612
NM_004904chr732590 2025 694 ------
NM_004906chr61106 ------
NM_004921chr111797 1167 ----
NM_004937chr1712681 ------
NM_004939chr21126 ------
NM_004947chr31626 1192 ----
NM_004948chr181433 ----1584
NM_004975chr20--2730 188 --188
NM_004976chr1125087 442 1952 13617 15113
NM_004985chr121276 13886 ----
NM_005010chr7------22071 311
NM_005011chr711627 ------
NM_005054chr21269 --11686 --
NM_005056chr1233841 1120 397 ------
NM_005063chr1013490 ------
NM_005095chr111974 ------
NM_005097chr10----169 --
NM_005103chr11----172 --
NM_005109chr312557 --12119 --
NM_005116chr2023794 3711 ----13326
NM_005156chr935260 3551 578 ------
NM_005181chr8----1743 --
NM_005184chr1921202 464 --1161 --
NM_005197chr1436031 1253 812 21368 1361 ----
NM_005201chr31167 1105 ----
NM_005206chr1711335 1315 ----
NM_005219chr511481 ------
NM_005221chr71134 ------
NM_005222chr71691 ------
NM_005225chr203370 275 215 --1355 --
NM_005233chr3--11849 12250 --
NM_005234chr191321 1286 ----
NM_005235chr236771 2856 229 ------
NM_005238chr1153057 2233 1246 1133 1090 ------
NM_005242chr51943 --1157 --
NM_005249chr141115 ------
NM_005261chr81153 ------
NM_005277chr421550 718 ------
NM_005316chr111782 ------
NM_005339chr424340 449 ------
NM_005342chrX52563 2286 1957 1909 636 ------
NM_005382chr82139 52 --1188 --
NM_005397chr722610 1313 13564 --11326
NM_005402chr7--1131 ----
NM_005406chr1811392 ------
NM_005414chr3----196 --
NM_005433chr182535 102 ------
NM_005436chr1023639 234 ------
NM_005455chr11217 ----1150
NM_005460chr5----1399 --
NM_005465chr121825 1277 ----1204
NM_005493chr61149 ------
NM_005494chr7------1513
NM_005499chr191258 ------
NM_005506chr422038 1789 ------
NM_005522chr71950 ------
NM_005544chr23922 199 137 --1395 --
NM_005574chr111534 ------
NM_005587chr151667 ------
NM_005596chr965589 4770 4710 1386 1323 818 --25353 442 11463
NM_005613chr132142 1512 345 --11687 --
NM_005638chrX11690 ------
NM_005639chr121623 1245 ----
NM_005662chr81324 ------
NM_005722chr211683 ------
NM_005724chr151224 ------
NM_005725chr1----22034 134 --
NM_005738chr71645 ------
NM_005756chrX31093 385 27 ------
NM_005765chrX--1713 ----
NM_005776chr14137 ----1571
NM_005786chr1821129 174 ------
NM_005795chr21379 ----21929 333
NM_005828chr1724621 3488 ------
NM_005834chrX------1217
NM_005839chr1143 ------
NM_005840chrX41960 1445 1107 866 ------
NM_005859chr5----11580 --
NM_005875chr31316 --1139 --
NM_005882chr41902 ------
NM_005898chr112529 202 ------
NM_005900chr4145 ------
NM_005901chr1828400 3110 --26540 1968 --
NM_005902chr1523362 3353 ----11537
NM_005909chr534021 3277 862 ------
NM_005911chr22565 378 1441 ----
NM_005920chr152607 1544 1047 375 297 ------
NM_005933chr111964 ------
NM_005937chr1742988 2842 1489 775 1957 --14132
NM_005941chr832629 1471 262 ----21443 1363
NM_005955chr124570 51 11369 ----
NM_005962chr1021860 851 --1750 --
NM_005962chr1021860 851 --1750 --
NM_005966chr221793 640 ------
NM_005977chr131860 ------
NM_005996chr121630 ------
NM_006007chr954086 1077 955 316 77 ------
NM_006016chr6------1213
NM_006022chr1311023 ------
NM_006037chr253719 3692 3673 838 189 11101 23683 1721 --
NM_006054chr1111579 ------
NM_006080chr722607 394 --11156 22470 2411
NM_006095chr444467 3745 998 624 --24320 3712 --
NM_006106chr111620 --11303 --
NM_006108chr11193 ------
NM_006154chr1522370 153 ------
NM_006160chr17------11148
NM_006166chr121976 --2474 238 --
NM_006178chr17----2372 136 --
NM_006183chr121192 ------
NM_006186chr211002 ------
NM_006203chr533676 1169 62 1440 ----
NM_006206chr4----12297 1499
NM_006207chr81210 ------
NM_006265chr82564 285 ------
NM_006267chr22354 174 ------
NM_006275chr20--1180 ----
NM_006283chr8----11515 1827
NM_006293chr152979 385 ------
NM_006306chrX53607 1694 1586 807 361 1143 14122 11454
NM_006313chr1221704 1089 --11644 --
NM_006352chr11146 --1807 1428
NM_006359chrX21879 85 ------
NM_006364chr14------11174
NM_006366chr61510 --1322 --
NM_006380chr1723792 1528 ------
NM_006403chr61514 --11492 --
NM_006407chr331086 131 100 ------
NM_006420chr20----11009 12791
NM_006451chr51961 ------
NM_006480chr5272 31 ------
NM_006489chr1421386 640 ------
NM_006504chr1012484 ------
NM_006539chr16175 ------
NM_006544chr1425834 4214 --15866 --
NM_006554chr21242 ------
NM_006557chr911650 ------
NM_006559chr111043 ------
NM_006561chr1025632 207 ----15174
NM_006577chr211083 ------
NM_006593chr2------1770
NM_006595chr111775 ------
NM_006601chr12------1227
NM_006614chr333083 2630 726 ------
NM_006621chr121358 470 ------
NM_006622chr5--1113 ----
NM_006624chr10------11801
NM_006625chr1------181
NM_006625chr1------181
NM_006625chr1------181
NM_006628chr1521768 682 ----122
NM_006654chr12--34333 3415 1634 ----
NM_006667chrX----2429 173 --
NM_006670chr6----138 --
NM_006699chr13794 767 665 ------
NM_006706chr51187 --147 --
NM_006717chr952690 2644 2401 1287 1222 ------
NM_006722chr311934 ----12083
NM_006729chrX35219 4090 643 ------
NM_006738chr1544255 3311 621 421 13139 ----
NM_006769chr11551 ------
NM_006775chr622494 1233 ----1467
NM_006777chrX22246 761 ------
NM_006788chr1811850 ----11346
NM_006811chr201760 ------
NM_006815chr1211297 ------
NM_006822chr17------1190
NM_006832chr142374 162 ------
NM_006852chr171153 ------
NM_006874chr4--1919 --11235
NM_006885chr16--13288 ----
NM_006888chr1432914 319 170 --12499 --
NM_006896chr71874 ------
NM_006908chr721494 48 ------
NM_006914chr92466 429 ------
NM_006920chr212001 --2595 565 --
NM_006922chr221931 943 --12154 --
NM_006931chr1221695 775 ------
NM_006937chr171480 ------
NM_006940chr1211202 --1599 --
NM_006997chr101433 ------
NM_006999chr521507 136 ------
NM_007034chr1------1131
NM_007036chr53929 219 126 ------
NM_007038chr2145780 5102 4008 1612 ------
NM_007078chr1023024 875 ----1896
NM_007084chr132462 59 ------
NM_007106chr1311133 ------
NM_007129chr13--1190 ----
NM_007159chr31627 --11753 --
NM_007191chr121188 ------
NM_007200chr1544255 3311 621 421 13139 ----
NM_007203chr923490 867 --11504 --
NM_007212chr111660 ------
NM_007222chr821325 547 ------
NM_007235chr121197 ------
NM_007236chr1511753 --1123 --
NM_007242chr16--1222 ----
NM_007246chr41906 1847 ----
NM_007249chr1336646 3051 2250 29370 491 16714 16822
NM_007276chr71967 ------
NM_007308chr4--1457 ----
NM_007331chr412241 --12447 --
NM_007342chr7------1240
NM_007353chr722188 488 ------
NM_007358chr12582 283 ------
NM_007375chr11334 1817 12418 1966
NM_009588chr61381 ------
NM_012064chr122975 293 ------
NM_012081chr512612 ----1798
NM_012082chr81965 ------
NM_012093chr12808 183 ----11173
NM_012156chr202922 424 --13257 --
NM_012157chr31863 1298 ----
NM_012214chr215353 11766 14154 25618 4554
NM_012238chr10----11549 --
NM_012249chr213562 --1754 --
NM_012257chr7------1346
NM_012261chr201516 ------
NM_012281chr732463 540 481 ------
NM_012294chr7--13204 --23163 374
NM_012297chr421783 890 ------
NM_012300chr512055 ------
NM_012301chr711852 ----2425 329
NM_012307chr181296 ----1222
NM_012309chr1134433 3660 434 --1331 --
NM_012316chr124019 539 ------
NM_012325chr2011444 ------
NM_012327chr182614 605 1198 ----
NM_012328chr71402 --196 --
NM_012330chr10176 ------
NM_012347chr6------136
NM_012417chr171129 ------
NM_012421chr1----1304 --
NM_012425chr1022766 920 --12150 --
NM_012428chr152958 304 ------
NM_012446chr51193 ------
NM_012479chr732237 1744 437 ------
NM_013238chr131587 ------
NM_013281chr2011293 ------
NM_013372chr1513033 --1157 --
NM_013374chr3------1595
NM_013381chr1231789 352 303 ------
NM_013390chr921800 1178 ------
NM_013396chr21----1375 --
NM_013434chr231924 1657 22 ------
NM_013434chr231924 1657 22 ------
NM_013437chr81139 ------
NM_013444chrX1331 ------
NM_013449chr1232230 618 351 ------
NM_013943chr143247 2880 1265 416 ----1102
NM_013958chr81112 ------
NM_013959chr81112 ------
NM_013961chr81112 ------
NM_013962chr81112 ------
NM_013989chr1425003 314 13124 ----
NM_013995chrX22218 1867 ------
NM_014011chr2--12519 ----
NM_014023chr1032372 2192 387 ----1154
NM_014043chr31260 ------
NM_014057chr921512 328 ------
NM_014060chrX--178 ----
NM_014106chr1522721 846 ------
NM_014112chr835411 5198 1561 ------
NM_014141chr745281 4728 3283 636 ------
NM_014154chr31214 ------
NM_014189chr441233 1171 607 311 ------
NM_014190chr431585 1523 663 ------
NM_014191chr121241 --2685 655 --
NM_014216chr1431597 1420 427 ------
NM_014217chr1----195 --
NM_014223chr11732 ----1750
NM_014245chr32764 362 ------
NM_014267chr111172 ------
NM_014271chrX1635 1785 ----
NM_014294chr81123 ------
NM_014315chr142125 35 ------
NM_014319chr1221432 332 11413 1246 --
NM_014325chr1211512 ------
NM_014380chrX1209 ------
NM_014392chr411205 ------
NM_014395chr421959 1945 ------
NM_014415chr311440 11727 ----
NM_014445chr311881 --1651 --
NM_014472chr101103 ------
NM_014500chrX1250 ------
NM_014504chr71483 --11433 --
NM_014515chr121813 ----1735
NM_014548chr1521057 480 ------
NM_014574chr14----11328 --
NM_014583chr31490 ------
NM_014592chr52736 560 ------
NM_014606chr411055 ------
NM_014615chr16------1124
NM_014616chr31834 ------
NM_014635chr21233 --11664 --
NM_014636chr954157 3996 490 417 22 ------
NM_014653chr1212191 1701 1152 --
NM_014655chr1------12325
NM_014667chr32817 37 ------
NM_014670chr22545 106 ------
NM_014677chr821311 88 ------
NM_014683chr1721497 852 ------
NM_014685chr161374 ------
NM_014711chr161770 ------
NM_014713chr21490 ------
NM_014717chr191644 ------
NM_014720chr1021552 586 ------
NM_014721chr655855 5592 1852 1028 724 ------
NM_014723chr2012429 13263 ----
NM_014732chr1655060 4890 3767 1648 1198 --11656 195
NM_014743chr421163 262 ------
NM_014746chr213752 ----14117
NM_014747chr175790 4584 4171 955 739 194 111 ----11071
NM_014751chr821635 816 ------
NM_014755chr254078 4032 1519 334 79 ------
NM_014756chr112435 429 ------
NM_014774chr1--11306 ----
NM_014779chr321036 274 --11045 --
NM_014781chr81488 ------
NM_014802chr121151 ------
NM_014810chr113603 1672 ----
NM_014812chr1176 ------
NM_014820chr311861 ------
NM_014824chr11----185 --
NM_014839chr112165 ------
NM_014841chr611365 --1240 --
NM_014850chr333994 1213 394 13946 11393 11205
NM_014859chr1711093 ------
NM_014873chr114682 ------
NM_014877chr1756181 5963 5748 5673 875 16460 16893 --
NM_014890chr3------1122
NM_014903chr12------11696
NM_014912chr102890 866 --12644 --
NM_014913chr1821376 276 ------
NM_014921chr1922360 1069 ------
NM_014923chr131327 ----1561
NM_014926chr31145 ------
NM_014932chr31613 --1622 --
NM_014943chr821109 840 ------
NM_014947chr132694 1934 972 22073 641 13014 13128
NM_014949chr1155 ------
NM_014951chr1041925 963 845 654 ------
NM_014953chr1313913 ------
NM_014969chr1--1111 1880 --
NM_014974chr101511 --11687 --
NM_014978chr101502 --11733 --
NM_014982chr14----15124 1245
NM_014988chr411888 --11933 --
NM_014989chr641529 1431 1407 824 ------
NM_014990chr1431220 1201 267 1220 ----
NM_014991chr41942 --12950 --
NM_014996chr32989 251 ------
NM_014997chr722924 1149 --12004 --
NM_014999chr121599 ------
NM_015008chr332583 231 45 ----13515
NM_015009chr31702 ------
NM_015020chr1613167 ------
NM_015024chr8--11107 ----
NM_015025chr21202 12744 ----
NM_015032chr1311085 --12129 --
NM_015039chr114179 --11325 --
NM_015051chr913174 --11352 --
NM_015052chr7------1157
NM_015053chr112313 ------
NM_015059chr1552460 1585 1218 569 261 --22940 171 --
NM_015068chr71724 ------
NM_015071chr536159 1911 518 13956 2774 629 --
NM_015075chrX31743 872 290 ----12150
NM_015076chr634310 2796 220 ------
NM_015087chr1312421 ------
NM_015091chr142641 600 ------
NM_015100chr121996 436 ----1694
NM_015101chr132756 2122 846 --12131 --
NM_015115chr4--12726 ----
NM_015116chr13----11692 --
NM_015132chr711656 --1412 --
NM_015137chr821970 1961 ------
NM_015155chr1013094 --12427 --
NM_015170chr831669 1433 500 1457 ----
NM_015176chr12674 662 ------
NM_015192chr2032978 221 31 --1706 --
NM_015208chr1822604 775 ------
NM_015215chr133063 3006 687 --12945 11209
NM_015225chr922464 713 ------
NM_015233chr131901 --11896 --
NM_015234chr631401 1342 1193 ------
NM_015236chr411176 ------
NM_015247chr161526 ------
NM_015251chr1622060 1583 ------
NM_015264chr2234905 4778 3623 21051 720 21610 1078 --
NM_015265chr21455 ------
NM_015272chr161579 ------
NM_015277chr1821320 734 ------
NM_015286chr1521615 398 ------
NM_015310chr826210 2449 ----12531
NM_015317chr21971 12625 ----
NM_015336chr122980 409 --2743 689 --
NM_015347chr1212949 ------
NM_015355chr17--1232 ----
NM_015393chr463583 3523 2977 2504 824 455 ------
NM_015394chr1222427 597 ------
NM_015396chr31362 ----11286
NM_015416chr12------1940
NM_015423chr1121719 1491 ------
NM_015447chr9--1117 ----
NM_015455chr51979 ------
NM_015458chr825028 4700 ------
NM_015460chr3--11719 ----
NM_015461chr18------172
NM_015475chr2----1811 --
NM_015497chr15174 ----1955
NM_015526chr1921463 1445 ------
NM_015532chr152471 463 ------
NM_015542chr1011155 ------
NM_015553chr634942 4094 136 --14915 --
NM_015564chr523048 2466 ------
NM_015565chr21----11975 --
NM_015569chr133219 3101 569 ------
NM_015576chr332557 933 565 ------
NM_015578chr1911576 ------
NM_015609chr12529 421 ------
NM_015610chr71294 ----1300
NM_015630chr2--1317 ----
NM_015678chr132533 54 ------
NM_015834chr211943 --1905 --
NM_015866chr1150 ------
NM_015878chr81791 ------
NM_015885chr11----1261 --
NM_015888chr112772 ------
NM_015902chr81603 ------
NM_015906chr134313 4004 1258 ------
NM_015908chr7----180 --
NM_015915chr14----129 --
NM_015920chr152640 631 ------
NM_015949chr71920 ------
NM_015984chr13180 142 103 ------
NM_015995chr1575552 5169 5156 4718 1567 1016 943 ------
NM_016003chr71294 ----1300
NM_016009chr11154 11395 14863 --
NM_016053chr12131 ------
NM_016073chr15------1231
NM_016075chr1342944 2170 988 346 ------
NM_016076chr11311 ------
NM_016103chr5----1449 --
NM_016126chr1----124 --
NM_016131chr221618 775 ------
NM_016132chr1512581 ------
NM_016147chr1121116 433 ------
NM_016152chr31278 ------
NM_016185chr171197 --1753 --
NM_016226chr121310 ------
NM_016260chr247414 7370 2699 2097 12850 ----
NM_016277chr61538 ------
NM_016281chr1221147 1097 ------
NM_016284chr16124 ------
NM_016287chr122032 1467 ------
NM_016302chr3--1197 ----
NM_016308chr11797 ------
NM_016315chr211775 ------
NM_016316chr21170 1493 173 --
NM_016320chr111967 ----11027
NM_016322chr932394 349 219 ------
NM_016351chr7------1413
NM_016357chr12--199 ----
NM_016395chr1511764 --1181 --
NM_016396chr1511009 ------
NM_016423chr141400 ------
NM_016436chr2021646 97 --1575 --
NM_016472chr1411130 ------
NM_016480chr51136 ------
NM_016485chr631808 711 37 --12042 --
NM_016569chr121630 ------
NM_016587chr71967 ------
NM_016603chr511373 11460 ----
NM_016620chr1------11083
NM_016623chr81614 ------
NM_016631chr211702 ------
NM_016651chr1421002 825 --11014 --
NM_016823chr1721205 488 1185 ----
NM_016950chr41429 ------
NM_017409chr122775 191 ------
NM_017412chr811159 11268 169 --
NM_017420chr1423554 3217 ----1147
NM_017423chr411881 ------
NM_017450chr171460 ------
NM_017455chr152958 304 ------
NM_017551chr1022507 913 ------
NM_017594chr963205 2748 2612 2362 1127 355 ------
NM_017610chr152245 76 --12056 --
NM_017628chr424559 141 24242 1538 --1307
NM_017633chr61182 ------
NM_017634chr81321 ------
NM_017635chr11----1638 --
NM_017649chr10------1322
NM_017650chr745837 4759 417 339 ------
NM_017657chr21897 ------
NM_017658chr14--23583 121 1995 151
NM_017661chr151182 ------
NM_017664chr13199 --1171 --
NM_017667chr71113 --1440 --
NM_017680chr9--1768 ----
NM_017691chr151335 ------
NM_017693chr13--1339 ----
NM_017709chr11237 11223 ----
NM_017719chr332107 169 156 ------
NM_017737chr12455 121 --1114 --
NM_017741chr41322 11070 11865 --
NM_017778chr821302 426 ----11461
NM_017811chr922544 1054 ------
NM_017813chr831465 750 91 ------
NM_017830chr42343 71 --1710 --
NM_017847chr12361 239 ------
NM_017848chrX--1816 ----
NM_017849chr232628 2335 1984 12557 ----
NM_017902chr1041733 1277 343 96 ------
NM_017933chr211476 ------
NM_017938chrX11939 12094 ----
NM_017994chr721946 197 --12930 --
NM_018027chr1023194 2058 ------
NM_018084chr21553 ------
NM_018092chr16140 ------
NM_018120chr8------1406
NM_018121chr1022995 744 ------
NM_018126chr411306 1368 11229 --
NM_018133chr312035 ------
NM_018151chr21755 --1691 --
NM_018176chr411537 --1189 --
NM_018179chr12----171 --
NM_018181chr18----11361 --
NM_018184chr321911 532 1432 ----
NM_018191chr131165 ------
NM_018197chr20--1756 1242 --
NM_018200chr15----12107 --
NM_018206chr162545 227 ------
NM_018211chr112243 --11449 --
NM_018237chr10185 ------
NM_018243chr433901 497 336 1273 1546 --
NM_018247chr622787 31 ------
NM_018299chr822794 912 1551 1416 --
NM_018307chr171837 ------
NM_018318chr121950 ------
NM_018351chr1224284 469 --14217 --
NM_018362chr1133637 1554 1442 ------
NM_018364chr113693 ------
NM_018367chr111356 ------
NM_018374chr72746 548 15264 ----
NM_018403chr333470 3399 3123 ------
NM_018416chr1222627 825 ------
NM_018425chr1032260 1653 226 ------
NM_018439chr1822011 941 --12549 --
NM_018442chr11360 ------
NM_018444chr812096 11993 1433 --
NM_018452chr6_random33823 2753 889 --11543 --
NM_018557chr211501 ----1613
NM_018584chr111067 170 ----
NM_018685chr7--1102 ----
NM_018695chr51808 ------
NM_018697chr731812 230 136 ----1318
NM_018718chr722197 688 ------
NM_018834chr52910 858 ------
NM_018844chr7------1335
NM_018890chr721494 48 ------
NM_018898chr512102 ------
NM_018899chr512102 ------
NM_018900chr512102 ------
NM_018901chr512102 ------
NM_018902chr512102 ------
NM_018903chr512102 ------
NM_018904chr512102 ------
NM_018905chr512102 ------
NM_018906chr512102 ------
NM_018907chr512102 ------
NM_018908chr512102 ------
NM_018909chr512102 ------
NM_018910chr512102 ------
NM_018911chr512102 ------
NM_018955chr171140 ------
NM_018963chr2121370 1239 ------
NM_018970chr722880 922 ------
NM_018993chr201571 ------
NM_018999chr1024475 1422 --13354 --
NM_019004chr7--12137 ----
NM_019006chr151104 ------
NM_019022chr1832590 266 131 ------
NM_019044chr221895 1068 --14490 --
NM_019045chrX------1278
NM_019058chr10--2548 222 ----
NM_019084chr1011711 11791 ----
NM_019094chr1263773 3587 2820 1511 723 134 --12687 --
NM_019106chr221203 --12579 13127
NM_019590chr1021157 984 ------
NM_019593chr2051093 1050 774 755 436 ------
NM_019597chrX1477 ------
NM_019605chr1139 ------
NM_019842chr61160 ----2152 58
NM_020122chr215127 25221 3803 2395 374 --
NM_020123chr101597 ----11078
NM_020132chr2184649 4335 4189 3453 3415 3283 2010 1697 21527 545 11608 --
NM_020133chr664384 4040 3954 1793 1271 110 11709 ----
NM_020141chr111664 ------
NM_020177chr532643 1062 660 136 --11201
NM_020182chr2023201 2435 ------
NM_020194chr21244 ------
NM_020226chr42586 308 ------
NM_020231chr3----1634 --
NM_020317chr1------132
NM_020337chr421220 336 1818 23079 1005 --
NM_020341chr2031333 711 217 --1458 --
NM_020362chr1----149 --
NM_020403chr1321426 1374 ------
NM_020416chr422442 1751 --1861 --
NM_020432chr731868 783 703 ------
NM_020440chr122343 148 ------
NM_020443chr156605 5794 4556 4548 1016 ------
NM_020466chr6----13794 --
NM_020475chr832236 151 90 2437 130 ----
NM_020476chr832236 151 90 2437 130 ----
NM_020477chr832236 151 90 2437 130 ----
NM_020478chr832299 214 153 2500 193 ----
NM_020480chr832236 151 90 2437 130 ----
NM_020546chr51335 ------
NM_020647chr811525 --1636 --
NM_020651chr221602 1177 ------
NM_020697chr82310 124 --11250 --
NM_020718chr1636267 4184 1595 14391 16438 --
NM_020734chr1241314 1182 1116 1108 --1638 --
NM_020752chr1022719 2517 ------
NM_020755chr611333 1123 ----
NM_020760chr21504 --11460 1700
NM_020768chr513228 --1525 --
NM_020772chr1738140 6453 592 ------
NM_020776chr1813061 ------
NM_020805chr1821210 366 ------
NM_020806chr14132 ------
NM_020810chr141704 ------
NM_020819chr611181 ------
NM_020824chr10----1719 --
NM_020850chr1612343 13225 ----
NM_020856chr191284 ------
NM_020858chr151680 ------
NM_020865chr3----1150 --
NM_020866chr131829 ------
NM_020868chr21274 ------
NM_020872chr32320 82 ------
NM_020888chr121560 417 ----11673
NM_020918chr1043260 3045 2393 1070 ----12538
NM_020940chr1012841 ------
NM_020948chr132847 987 537 ------
NM_020958chr141307 ------
NM_020987chr102191 134 ------
NM_021005chr151972 ------
NM_021007chr232141 1592 891 ------
NM_021033chr13--1940 11323 --
NM_021061chr82694 42 ------
NM_021069chr421873 1502 ------
NM_021072chr532243 1671 1012 ------
NM_021106chr91220 ------
NM_021111chr911093 ------
NM_021116chr748298 1827 1143 637 ------
NM_021120chrX32994 2029 245 --2949 369 --
NM_021132chr1041368 1118 885 835 ------
NM_021136chr14----1260 --
NM_021159chr42265 100 ------
NM_021183chrX22275 1673 ------
NM_021184chr62114 62 ------
NM_021190chr11946 ------
NM_021202chr2012320 ------
NM_021222chr141311 1189 264 56 11124 ----
NM_021229chr122276 128 1451 ----
NM_021240chr9------1638
NM_021242chrX1745 ------
NM_021252chr101455 ------
NM_021253chr611242 ------
NM_021269chr19----21981 1924 --
NM_021620chr6--1642 ----
NM_021622chr1012008 ------
NM_021638chr441789 564 459 422 --33656 1560 105 13837
NM_021647chr433689 1671 406 --11895 --
NM_021722chr71234 ----1372
NM_021723chr7------1413
NM_021813chr622003 495 --14433 --
NM_021814chr61361 ------
NM_021911chr545239 1523 801 674 1606 ----
NM_021949chrX31011 924 365 ------
NM_021954chr132916 564 --13258 --
NM_021961chr1135148 4525 1296 24998 991 ----
NM_021967chr5----21070 954 --
NM_022037chr211003 ------
NM_022049chr121826 1685 ----1414
NM_022051chr1----1185 --
NM_022073chr1421457 1337 ------
NM_022130chr541079 356 172 149 ------
NM_022144chrX154 ------
NM_022170chr72442 142 ------
NM_022173chr211003 ------
NM_022351chr823632 821 ------
NM_022459chr1335927 1627 1178 ------
NM_022469chr11749 1407 --13281
NM_022477chr2021373 108 ------
NM_022566chr152599 159 ------
NM_022650chr52762 26 ------
NM_022726chr611495 11456 ----
NM_022733chr1----11062 --
NM_022751chr181218 ------
NM_022758chr662972 2786 2778 2744 2077 181 ------
NM_022763chr3------11274
NM_022771chr12----11017 --
NM_022781chr912456 12743 ----
NM_022838chrX1325 ------
NM_022841chr151885 --12247 --
NM_022845chr1611622 ------
NM_022893chr2----1265 --
NM_022894chr211166 ------
NM_022898chr1414793 --1872 --
NM_022900chr71241 ------
NM_022977chrX21853 408 --12586 --
NM_022978chr5----21070 954 --
NM_023012chr12193 ------
NM_023037chr1311028 ------
NM_023079chr171743 ------
NM_023934chrX22094 401 1436 11814 --
NM_024007chr522318 1953 ------
NM_024046chr341243 937 226 92 ------
NM_024086chr1732753 2674 100 ------
NM_024092chr1121236 889 ------
NM_024294chr662972 2786 2778 2744 2077 181 ------
NM_024312chr1211261 1145 ----
NM_024329chr121573 521 --1195 --
NM_024336chr16----1330 --
NM_024416chr921512 328 ------
NM_024511chr452914 2368 2151 592 375 13492 ----
NM_024556chr11------1330
NM_024569chr1----1283 --
NM_024581chr6148 ------
NM_024582chr41213 ------
NM_024616chr331462 1274 472 1488 ----
NM_024631chr112229 134 ------
NM_024645chr821162 1003 ------
NM_024646chr113862 ----1302
NM_024665chr334190 3665 652 --11521 1508
NM_024713chr1521543 628 ------
NM_024721chr811643 ------
NM_024740chr1163632 3289 3206 2986 981 206 --13376 --
NM_024744chr212592 12443 ----
NM_024755chr151659 ------
NM_024795chr21575 ----11121
NM_024896chr91187 12372 ----
NM_024900chr43666 468 99 --21571 569 --
NM_024900chr43666 468 99 --21571 569 --
NM_024920chr411047 ------
NM_024948chr10----1737 --
NM_024949chr424966 1903 ------
NM_024989chr222237 1030 --27915 301 --
NM_025054chr8198 --1138 --
NM_025133chr211055 ------
NM_025134chr161157 ------
NM_025138chr131400 --1436 --
NM_025147chr21268 ------
NM_025179chr123225 275 13463 13997 1317
NM_025235chr10------12102
NM_025238chr1511547 --1165 --
NM_030621chr1421384 1145 ------
NM_030627chr521364 222 12528 12795 --
NM_030637chr141278 ------
NM_030639chrX31777 412 406 ------
NM_030650chr224158 3521 2596 533 ----
NM_030775chr121928 --1764 --
NM_030806chr137272 2609 131 12398 ----
NM_030918chr144479 3405 2107 1229 11885 13998 14068
NM_030920chr1----176 --
NM_030923chr22602 21 ------
NM_030926chr21976 ------
NM_030938chr171444 --1799 --
NM_031216chr1831925 853 47 11464 ----
NM_031271chr811705 ------
NM_031365chr2------149
NM_031366chr2------149
NM_031411chr512102 ------
NM_031418chr1122693 2582 --12729 11098
NM_031422chr18------1379
NM_031426chr922763 1956 ------
NM_031427chr1445898 4791 1010 650 ------
NM_031431chr1311570 ------
NM_031442chrX12054 --1731 --
NM_031445chr242695 2564 2243 802 ------
NM_031468chr731949 541 49 1368 --15496
NM_031469chr6----23187 170 13112
NM_031475chr12277 255 ------
NM_031476chr1612330 ----12749
NM_031483chr2012684 1531 ----
NM_031844chr1--14017 1220 --
NM_031845chr22262 42 1971 ----
NM_031847chr22262 42 1971 ----
NM_031849chr512102 ------
NM_031857chr512102 ------
NM_031860chr512102 ------
NM_031992chr72442 142 ------
NM_032013chr2021373 108 ------
NM_032160chr1853887 3755 3186 1702 107 ------
NM_032174chr11344 1563 ----
NM_032182chr10----1541 --
NM_032186chr1------11083
NM_032193chr1121404 174 ------
NM_032199chr10------13207
NM_032228chr1111181 --13285 11096
NM_032246chr151266 ------
NM_032316chr32176 108 --11890 --
NM_032329chr2--1786 ----
NM_032379chr111145 ------
NM_032430chr191392 ------
NM_032436chr13--1398 ----
NM_032438chr61625 ----11570
NM_032439chr101428 1408 ----
NM_032440chr103301 221 78 ------
NM_032445chr1541941 1685 1677 106 11873 ----
NM_032451chr16176 ------
NM_032457chr473797 3696 3551 3109 2522 389 210 ----1337
NM_032458chrX12679 ------
NM_032505chr312144 ------
NM_032557chr4----1634 --
NM_032590chr122849 307 ------
NM_032595chr1711550 ------
NM_032632chr1411929 ------
NM_032642chr121928 --1764 --
NM_032646chr1711703 ------
NM_032682chr343418 2795 2693 456 --13577 --
NM_032689chr191339 ------
NM_032711chr1713206 1472 ----
NM_032727chr1021313 645 ------
NM_032737chr1922650 2470 ------
NM_032828chr1944319 1697 782 411 ------
NM_032859chr13----1450 --
NM_032869chr811777 --11793 --
NM_032926chrX1194 ------
NM_032932chr1765383 5040 4492 1754 383 218 --15904 1923
NM_032943chr111145 ------
NM_032961chr4133 ------
NM_032968chrX24248 918 ------
NM_032969chrX24248 918 ------
NM_032973chrY24240 918 ------
NM_032975chr1832912 2322 1176 --23124 654 --
NM_032978chr181898 ------
NM_032979chr181898 ------
NM_032980chr1832912 2322 1176 --23124 654 --
NM_032981chr181898 ------
NM_033014chr921512 328 ------
NM_033020chr134313 4004 1258 ------
NM_033023chr7171 ------
NM_033055chr1------1127
NM_033058chr82859 159 ------
NM_033081chr2021286 1137 ------
NM_033083chr323362 867 ------
NM_033132chr1321860 1790 ------
NM_033224chr777727 6991 6873 6204 5225 1707 667 15273 ----
NM_033272chr22296 269 ------
NM_033284chrY160 ------
NM_033285chr844126 3774 633 325 --1658 --
NM_033305chr911222 ------
NM_033326chr112752 496 ------
NM_033331chr92614 306 ------
NM_033360chr121397 14007 ----
NM_033389chr1742963 1876 711 128 11724 ----
NM_033394chr211040 ------
NM_033425chr1132170 1062 134 1957 ----
NM_033480chr6------136
NM_033481chr6------136
NM_033505chr276173 4412 4223 4140 2500 779 229 --26367 2406 --
NM_033514chr22143 30 ------
NM_033637chr1023589 2829 --12521 1722
NM_033642chrX11070 --11105 --
NM_033644chr512055 ------
NM_033645chr512055 ------
NM_052849chr151667 ------
NM_052851chr13172 ------
NM_052869chr1711703 ------
NM_052874chr163705 486 234 ------
NM_052885chr1214691 ------
NM_052907chr121255 ------
NM_052910chr133756 520 273 1466 --1458
NM_052918chr1043588 3140 515 356 ------
NM_052927chr5----1227 --
NM_052958chr81620 ------
NM_052966chr13836 150 73 ------
NM_052968chr11--1551 ----
NM_052971chr51138 ------
NM_053016chr925801 181 16200 ----
NM_053025chr321797 1651 ------
NM_053026chr321797 1651 ------
NM_053027chr321797 1651 ------
NM_053028chr321797 1651 ------
NM_053031chr321797 1651 ------
NM_053032chr321797 1651 ------
NM_053043chr745062 2071 1575 285 ------
NM_053064chr141137 ----1775
NM_054016chr111774 11547 ----
NM_054016chr111774 11547 ----
NM_054016chr111774 11547 ----
NM_054033chr21377 ------
NM_057158chr81716 ------
NM_057159chr921377 553 ------
NM_057175chr4--1825 ----
NM_057180chr121310 ------
NM_058172chr41615 131 ----
NM_058191chr211802 ------
NM_058241chr21415 ------
NM_058241chr21415 ------
NM_078485chr62782 105 ----132
NM_080599chr1011155 ------
NM_080645chr622020 1437 ------
NM_080669chr1734097 3659 353 --11610 --
NM_080872chr822630 343 ------
NM_130391chr943162 2947 2835 1277 ------
NM_130392chr943162 2947 2835 1277 ------
NM_130393chr943162 2947 2835 1277 ------
NM_130435chr1012484 ------
NM_130439chr1021860 851 --1750 --
NM_130439chr1021860 851 --1750 --
NM_130773chr22716 289 ------
NM_130795chr91220 ------
NM_130808chr33452 436 161 ------
NM_130847chr1135165 3582 1822 ------
NM_133264chr1732416 1509 428 --21177 87 --
NM_133334chr451614 1486 1473 1112 776 11083 --1313
NM_133372chr51266 ------
NM_133445chr912506 23698 1495 ----
NM_133496chr113046 --156 --
NM_134427chr91220 ------
NM_138316chr10----11223 --
NM_138357chr1021545 1526 --1701 --
NM_138370chr22593 89 ------
NM_138426chr7----22182 67 --
NM_138444chr1321822 917 ----13191
NM_138473chr1224354 113 ------
NM_138494chr722687 92 ------
NM_138576chr1414793 --1872 --
NM_138635chr733236 2761 591 --1221 --
NM_138731chr1443649 2765 1586 621 ------
NM_138735chr2------11464
NM_138970chr1412092 ----11912
NM_139014chr632175 830 239 1523 ----
NM_139068chr52457 239 ------
NM_139069chr52457 239 ------
NM_139070chr51108 ------
NM_139132chr111967 ----11027
NM_139136chr122893 307 ------
NM_139156chr12118 87 --1877 --
NM_139168chr51641 1101 ----
NM_139244chr61716 ------
NM_139283chr1221905 398 ------
NM_139318chr141218 ------
NM_139321chr20130 --2490 143 --
NM_144488chr91220 ------
NM_144489chr91220 ------
NM_144574chr141144 ------
NM_144588chr1011174 ------
NM_144632chr221747 643 ------
NM_144633chr31474 187 149 --
NM_144635chr311109 ----1152
NM_144642chr31424 ----1534
NM_144664chr11----1273 --
NM_144723chr5------1549
NM_144726chr51364 ------
NM_144767chr1544255 3311 621 421 13139 ----
NM_144775chr1744639 3686 913 67 11112 ----
NM_144949chr2--12519 ----
NM_145000chr51443 ------
NM_145011chr101807 ------
NM_145049chr5--1838 ----
NM_145206chr101176 ------
NM_145239chr1611017 --21241 1209 --
NM_145259chr226046 2317 1142 12076 --
NM_145279chr11685 1243 11810 --
NM_145296chr191893 ------
NM_145331chr61279 ------
NM_145728chr1521615 398 ------
NM_145733chr22----1368 1916
NM_145753chr311200 --11622 --
NM_145799chrX11020 --127 --
NM_145800chrX1875 --127 --
NM_145805chr151463 --149 --
NM_145808chr722906 2461 ------
NM_145891chr1611701 ------
NM_145892chr1611701 ------
NM_145893chr1611823 ------
NM_145913chr121717 ------
NM_147150chr923490 867 --11504 --
NM_147156chr1011193 ------
NM_147175chrX----12009 --
NM_148174chr81791 ------
NM_148977chr10----11223 --
NM_148978chr10----11223 --
NM_152253chr2234029 611 135 ------
NM_152265chr111188 ------
NM_152280chr11617 ------
NM_152305chr3----1634 --
NM_152400chr4----11590 --
NM_152409chr52830 182 ----11429
NM_152414chr821421 454 --11635 --
NM_152451chr151800 ------
NM_152470chr1844000 3989 3690 3246 ----1753
NM_152478chr191525 ------
NM_152519chr22524 105 ------
NM_152556chr712526 --12067 --
NM_152594chr151185 1532 ----
NM_152622chr512400 ------
NM_152641chr1212353 ------
NM_152653chr31504 ------
NM_152678chr312385 ------
NM_152688chr6--1338 ----
NM_152724chr1022766 920 --12150 --
NM_152734chr654280 2012 1680 340 125 ------
NM_152756chr513239 ------
NM_152758chr812698 ------
NM_152765chr81548 ----1557
NM_152774chr731955 683 316 ------
NM_152787chrX33910 3636 774 ------
NM_152789chr711454 ----195
NM_152793chr724873 3605 23667 474 ----
NM_152835chr122793 364 ------
NM_152860chr122164 96 ------
NM_152904chr17----1207 --
NM_152989chr1211202 --1599 --
NM_153035chr122849 2407 ------
NM_153038chr21720 ------
NM_153184chr311691 ----1645
NM_153188chr552088 1990 1428 1233 517 --14804 --
NM_153207chr1224074 303 11159 ----
NM_153235chr621673 534 ------
NM_153252chrX1344 ------
NM_153257chr191391 ------
NM_153262chr1----12746 12787
NM_153333chrX1207 ------
NM_153367chr1022604 97 ------
NM_153464chr191353 --1761 --
NM_153607chr52154 80 ------
NM_153616chr151680 ------
NM_153617chr151680 ------
NM_153618chr151680 ------
NM_153620chr711341 ------
NM_153634chr1221540 1127 11410 1188 --
NM_153689chr21438 12353 ----
NM_153748chr122893 307 ------
NM_153810chr1034841 3548 3192 24376 914 13458 --
NM_153812chr122146 1990 --2746 720 --
NM_153836chr2------1743
NM_170665chr1224215 3887 --23925 414 --
NM_170672chr221739 320 ------
NM_170706chr114179 --11325 --
NM_170719chr131400 --1436 --
NM_170731chr1142632 917 301 113 ------
NM_170732chr1142632 917 301 113 ------
NM_170733chr1142632 917 301 113 ------
NM_170734chr1142632 917 301 113 ------
NM_170735chr1142632 917 301 113 ------
NM_172016chr611242 ------
NM_172070chr222004 833 ------
NM_172071chr127267 1836 ------
NM_172127chr421496 130 ----1146
NM_172128chr421452 86 ----1102
NM_172169chr1071629 1514 1245 783 346 156 146 --11901 --
NM_172170chr1071629 1514 1245 783 346 156 146 --11901 --
NM_172171chr1071629 1514 1245 783 346 156 146 --11901 --
NM_172173chr1071629 1514 1245 783 346 156 146 --11901 --
NM_172375chr1421152 1071 ------
NM_173074chr2151 ------
NM_173156chr11300 --12022 1158
NM_173171chr211002 ------
NM_173172chr211310 ------
NM_173173chr211002 ------
NM_173359chr311911 ------
NM_173463chr444326 2990 2853 362 21221 35 13574 --
NM_173468chr42578 482 11000 ----
NM_173491chr51371 ----144
NM_173495chrX21008 891 ------
NM_173500chr15157 ------
NM_173505chr1811013 ----1161
NM_173511chr223224 1031 ------
NM_173552chr31672 ------
NM_173576chr101540 ------
NM_173602chr1222549 259 ------
NM_173648chr211026 --1102 --
NM_173662chr4132 ------
NM_173694chrX11886 181 ----
NM_173698chrX11428 --11921 --
NM_173797chr51234 ------
NM_173798chrX------199
NM_173807chr1--1451 ----
NM_173808chr121183 529 ------
NM_173854chr112273 ------
NM_174858chr12808 183 ----11173
NM_174890chr101242 ------
NM_174909chr5------1705
NM_174921chr411070 --142 --
NM_175061chr721908 118 ------
NM_175610chr1521324 192 ----1423
NM_175624chr1247106 2971 2606 1781 ------
NM_175625chr1247106 2971 2606 1781 ------
NM_175634chr81470 ------
NM_175635chr81470 ------
NM_175636chr81470 ------
NM_175747chr63935 249 88 ------
NM_175748chr1412030 ------
NM_175767chr511659 21396 701 ----
NM_175873chr521365 174 ------
NM_175907chr1832674 2526 2335 12369 ----
NM_176787chr182614 605 1198 ----
NM_176801chr431585 1523 663 ------
NM_177423chr112117 36 ------
NM_177438chr1421384 1145 ------
NM_177452chr1441011 958 728 328 --11595 --
NM_177951chr142829 274 ------
NM_177968chr22648 312 ------
NM_177990chr2031333 711 217 --1458 --
NM_177996chr202922 424 --13257 --
NM_178006chr13172 ------
NM_178007chr13172 ------
NM_178010chr1211202 --1599 --
NM_178123chr21705 ------
NM_178135chr411288 --133 --
NM_178140chr532343 1896 650 ------
NM_178151chrX77456 6904 6645 5200 2929 1681 1487 --12649 --
NM_178152chrX77456 6904 6645 5200 2929 1681 1487 --12649 --
NM_178153chrX77456 6904 6645 5200 2929 1681 1487 --12649 --
NM_178313chr211351 ------
NM_178496chr311474 ------
NM_178507chr111720 1714 ----
NM_178539chr121191 ------
NM_178585chr41942 --12950 --
NM_178812chr811202 ------
NM_181302chr141144 ------
NM_181308chr141144 ------
NM_181358chr111163 ------
NM_181453chr21233 --11664 --
NM_181481chr1846506 4827 1693 163 11026 ----
NM_181482chr1846506 4827 1693 163 11026 ----
NM_181483chr1846506 4827 1693 163 11026 ----
NM_181552chr71893 ------
NM_181571chr102797 147 ------
NM_181598chr14----129 --
NM_181672chrX1161 11874 ----
NM_181673chrX1161 11874 ----
NM_181702chr81153 ------
NM_181741chr211248 ------
NM_181742chr211248 ------
NM_181762chrX1913 ------
NM_181777chrX1913 ------
NM_181876chr422442 1751 --1861 --
NM_181886chr41561 ------
NM_181887chr41561 ------
NM_181888chr41561 ------
NM_181889chr41561 ------
NM_181890chr41561 ------
NM_181891chr41561 ------
NM_181893chr41561 ------
NM_182485chr451439 881 768 739 46 1843 ----
NM_182503chr6--14983 11405 --
NM_182527chr2222196 2072 --11901 --
NM_182540chrX1661 ------
NM_182551chr21745 12690 185 --
NM_182641chr1722040 1328 ------
NM_182646chr451439 881 768 739 46 1843 ----
NM_182691chr72945 578 ------
NM_182692chr72945 578 ------
NM_182697chr721751 243 ------
NM_182717chr1021202 552 ------
NM_182718chr102797 147 ------
NM_182719chr102797 147 ------
NM_182720chr1021202 552 ------
NM_182721chr1021202 552 ------
NM_182722chr1021202 552 ------
NM_182723chr1021202 552 ------
NM_182724chr102797 147 ------
NM_182725chr102797 147 ------
NM_182760chr32394 179 ------
NM_182765chr1021851 744 ------
NM_182769chr102797 147 ------
NM_182770chr102797 147 ------
NM_182771chr102797 147 ------
NM_182772chr102797 147 ------
NM_182789chr51961 ------
NM_182797chr2021209 419 ----11251
NM_182800chr7----180 --
NM_182830chr141669 148 ----
NM_182850chr102797 147 ------
NM_182853chr1021202 552 ------
NM_182898chr732590 2025 694 ------
NM_182899chr732590 2025 694 ------
NM_182907chr6--1178 ----
NM_182918chr211524 1270 ----
NM_182920chr34960 304 272 80 ----11033
NM_182943chr3--154 ----
NM_182970chr2023093 1207 --1928 --
NM_182976chr11104 ------
NM_183004chr1442999 873 766 717 ------
NM_183011chr1021202 552 ------
NM_183012chr1021202 552 ------
NM_183013chr1021202 552 ------
NM_183043chr131860 ------
NM_183044chr131860 ------
NM_183060chr102797 147 ------
NM_183079chr2031531 1497 552 ------
NM_183227chr61538 ------
NM_183237chr32826 424 ------
NM_183323chr51961 ------
NM_183376chr1512430 ------
NM_183422chr1311023 ------
NM_184085chr82747 47 ------
NM_184086chr82747 47 ------
NM_184087chr82747 47 ------
NM_194247chr223059 1677 ------
NM_194272chr151354 2870 368 ----
NM_194301chr1431048 1029 95 148 ----
NM_194317chr232441 2307 2114 --32273 316 66 --
NM_194328chr912456 12743 ----
NM_194329chr912456 12743 ----
NM_194330chr912456 12743 ----
NM_194332chr912456 12743 ----
NM_194356chr1221593 26 ----1445
NM_197977chr91901 ------
NM_198158chr311934 ----12083
NM_198159chr311934 ----12083
NM_198177chr311934 ----12083
NM_198178chr311934 ----12083
NM_198181chr1522811 2066 ------
NM_198195chr3------1550
NM_198215chr101382 ------
NM_198240chr12----11056 --
NM_198261chr12193 ------
NM_198262chr12193 ------
NM_198268chr111163 ------
NM_198269chr111163 ------
NM_198273chr532414 2406 286 ------
NM_198353chr4------1481
NM_198391chr2011293 ------
NM_198396chr17----1337 --
NM_198400chr1522370 153 ------
NM_198467chr71603 ------
NM_198513chr81616 ------
NM_198595chr441789 564 459 422 --33656 1560 105 13837
NM_198718chr11295 ------
NM_198721chr4--124 ----
NM_198829chr721494 48 ------
NM_198902chr151224 ------
NM_198903chr51581 ------
NM_198904chr51581 ----1737
NM_198963chr2--2373 126 ----
NM_198965chr121410 ------
NM_198966chr121410 ------
NM_199040chr1263773 3587 2820 1511 723 134 --12687 --
NM_199044chr122690 2026 ------
NM_199076chr10------1322
NM_199169chr2023201 2435 ------
NM_199170chr2023201 2435 ------
NM_199171chr2023201 2435 ------
NM_199189chr52910 858 ------
NM_199324chr443364 1403 1197 1007 ----12322
NM_199330chr151599 ------
NM_199331chr151599 ------
NM_199332chr151599 ------
NM_199426chr20--1756 1242 --
NM_201266chr2--22844 679 ----
NM_201269chr1------11083
NM_201279chr2--22844 679 ----
NM_201403chr11685 1243 11810 --
NM_201413chr21------1282
NM_201414chr21------1282
NM_201428chr1111579 ------
NM_201429chr1111579 ------
NM_201430chr1111505 ------
NM_201568chr11300 --12022 1158
NM_201569chr11300 --12022 1158
NM_201591chr421550 718 ------
NM_201592chr421550 718 ------
NM_201999chr4--1919 --11235
NM_203327chr2023794 3711 ----13326
NM_203349chr1532126 1864 838 ----1243
NM_203350chr11112 ----145
NM_203364chr112907 60 ------
NM_203365chr23558 125 54 ------
NM_203372chr2168 ----1659
NM_203391chrX----2386 129 --
NM_203394chr1241838 1743 208 91 ------
NM_203404chr12118 87 --1877 --
NM_203406chr511790 ------
NM_203437chr21897 ------
NM_203454chr1--123 ----
NM_203458chr1--13506 ----
NM_203459chr111617 ------
NM_203487chr1321426 1374 ------
NM_203504chr421783 890 ------
NM_203505chr421783 890 ------
NM_205768chr11146 --1807 1428
NM_206852chr14----1260 --
NM_206854chr674168 3710 2041 1081 554 326 147 ------
NM_206855chr675133 4675 2046 1519 1291 1112 684 ------
NM_206857chr14----1260 --
NM_206860chr101433 ------
NM_206861chr101433 ------
NM_206862chr101433 ------
NM_206866chr2122858 815 ------
NM_206909chr826210 2449 ----12531
NM_206915chrX1209 ------
NM_206917chrX1209 ------
NM_206927chr111145 ------
NM_206928chr111145 ------
NM_206929chr111145 ------
NM_206930chr111145 ------
NM_207043chr122020 1690 12266 ----
NM_207044chr122020 1690 12266 ----
NM_207047chr122020 1690 12266 ----
NM_207171chr121996 436 ----1694
NM_207303chr1024093 1504 ------
NM_207306chr134566 1341 171 1275 1152 --
NM_207325chr1921625 646 ------
NM_207372chr1022335 395 ------
NM_207429chr1131031 663 446 ------
NM_207645chr111283 ------
NM_212460chr71645 ------
NM_212474chr21423 ------
NM_212475chr21423 ------
NM_212476chr21423 ------
NM_212478chr21423 ------
NM_212482chr21423 ------
NM_213589chr234172 419 152 15180 ----
NM_213654chr31214 ------