TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-5186
miRNA Sequence: AGAGAUUGGUAGAAAUCAGGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000037chr812373 1523 --1773
NM_000038chr511996 11384 11280 1553
NM_000046chr563095 2929 2596 2558 2528 1978 1142 11929 --
NM_000051chr1192553 2443 2256 2201 1143 1077 864 788 437 1619 12231 13468
NM_000052chrX1203 42992 2952 2434 876 12538 --
NM_000061chrX------154
NM_000063chr61278 ------
NM_000081chr131877 1360 202 31891 1657 588 ----
NM_000084chrX116271 5694 5355 5197 4970 4883 4674 2043 629 597 158 --24325 4222 32517 1595 1328
NM_000088chr17------1117
NM_000090chr2167 ----1230
NM_000091chr231943 193 133 22594 1139 ----
NM_000092chr2113808 3628 3587 1718 1530 1365 1296 1266 1205 490 207 13512 14240 --
NM_000108chr731279 96 35 11760 ----
NM_000109chrX32290 736 316 ------
NM_000110chr111100 1135 ----
NM_000112chr5105256 5160 3978 2083 1769 1278 1256 883 770 515 147 1900 1581
NM_000125chr684268 3798 3766 3145 2601 770 295 218 13282 11501 --
NM_000129chr641432 1418 1176 206 11400 ----
NM_000138chr1572421 2243 1989 1808 1622 986 729 1519 2900 100 12385
NM_000139chr1182687 2482 2435 2384 2206 2090 2003 83 12623 ----
NM_000141chr102544 179 ------
NM_000153chr1421665 207 ------
NM_000163chr551566 1530 904 760 644 11864 21727 1583 12262
NM_000167chrX51403 1341 1207 379 335 ------
NM_000170chr93511 451 129 ------
NM_000176chr593744 3385 2523 1573 1321 1192 1128 738 279 13129 22544 530 --
NM_000192chr123451 306 184 ------
NM_000202chrX93944 3252 3201 2839 2530 1265 1153 230 141 21106 604 11023 --
NM_000208chr1964368 4116 3129 1032 890 171 1463 ----
NM_000210chr231764 890 250 32252 1798 1683 ----
NM_000214chr2031380 1211 335 ----11133
NM_000217chr12105339 5313 4903 4104 3532 3458 2118 2102 1261 885 24462 4400 13889 --
NM_000220chr1131095 79 34 2398 252 ----
NM_000227chr181268 ------
NM_000232chr453099 2607 2043 199 152 11038 22508 2344 --
NM_000237chr841580 1203 424 196 ----1169
NM_000240chrX31820 1446 598 31595 643 178 1303 --
NM_000242chr1052053 2010 911 707 278 2982 543 21924 87 --
NM_000248chr322984 676 --22453 2410 11127
NM_000252chrX--21482 124 --1980
NM_000259chr1576189 6066 2471 2414 1037 439 141 45672 1761 1644 1334 --15081
NM_000264chr953259 2561 2212 893 873 1340 11172 --
NM_000266chrX----1219 --
NM_000267chr1793513 3024 2645 2482 1388 1118 1084 1051 484 2606 295 11318 --
NM_000277chr123269 205 157 ------
NM_000280chr112655 217 1729 ----
NM_000282chr13133 ------
NM_000284chrX51959 1885 1823 1764 481 11724 ----
NM_000297chr461822 1747 1359 774 239 128 11488 11528 --
NM_000304chr171750 ------
NM_000314chr1032557 1105 612 23294 3069 22166 141 --
NM_000321chr132465 212 ------
NM_000328chrX2390 315 ----1355
NM_000329chr13910 126 80 ------
NM_000332chr6116613 6227 6091 5901 5582 4785 4641 4463 2425 1640 982 12314 16081 --
NM_000337chr5116516 6163 6088 6048 6038 5123 5011 4969 2519 2286 377 44679 4632 659 449 --15420
NM_000346chr1731299 357 184 21761 1645 11792 --
NM_000362chr2293521 3482 3434 3166 2503 1099 767 295 235 ------
NM_000367chr63903 861 586 22290 2207 --1435
NM_000368chr984544 3866 3502 3397 3080 1806 1182 345 11482 --14772
NM_000390chrX53096 3005 2476 1054 327 32785 964 955 ----
NM_000393chr23754 311 296 1578 12105 --
NM_000408chr252642 2203 2163 838 200 1642 ----
NM_000430chr1763656 3305 2469 835 508 467 43774 2365 666 654 ----
NM_000439chr592210 2043 2022 1903 1637 1586 864 628 370 ------
NM_000448chr1153286 2995 980 868 757 12285 ----
NM_000452chr1331741 1305 349 21830 119 --11344
NM_000454chr211273 196 ----
NM_000458chr171929 1609 1742 1905
NM_000460chr31375 ------
NM_000461chr373852 3617 3495 3050 1698 985 718 11735 ----
NM_000462chr1521324 599 ------
NM_000480chr1161490 1251 1154 1076 674 520 ----2436 43
NM_000484chr2141073 966 952 781 ------
NM_000489chrX43368 2823 1312 204 1758 1121 13285
NM_000493chr631081 204 26 1802 --1219
NM_000503chr841746 1421 462 133 --2103 69 --
NM_000510chr1151423 930 377 286 236 31320 1210 278 11052 --
NM_000518chr11----125 --
NM_000522chr74836 362 306 151 1463 --1279
NM_000531chrX1328 --1228 --
NM_000533chrX41928 1496 1288 329 11275 ----
NM_000538chr1361776 1694 371 331 174 90 ------
NM_000549chr1121 ------
NM_000555chrX156189 6103 4932 3083 3037 2642 2613 2598 2545 2500 1943 1394 1324 724 337 32176 1215 454 65574 5031 4970 2383 922 708 --
NM_000578chr211509 ----1501
NM_000582chr42417 355 --121 --
NM_000599chr284361 4100 3047 2833 1835 1667 887 154 14524 11344 --
NM_000601chr72402 319 ------
NM_000610chr1152534 2152 691 176 110 32358 2079 844 ----
NM_000617chr1222324 583 ----11819
NM_000618chr12146344 6024 5356 5060 4992 4675 4445 4434 4377 2390 2024 1599 472 358 24614 4278 11553 --
NM_000618chr12146344 6024 5356 5060 4992 4675 4445 4434 4377 2390 2024 1599 472 358 24614 4278 11553 --
NM_000635chr191383 ------
NM_000663chr1633007 2712 319 12580 ----
NM_000671chr42255 145 ------
NM_000680chr8--2295 36 ----
NM_000681chr1031293 1081 1016 ------
NM_000683chr41529 --1447 --
NM_000686chrX61381 556 379 115 103 94 11484 ----
NM_000719chr12106738 6484 6366 6312 5703 4586 2627 1989 1915 1162 25554 5545 ----
NM_000721chr132639 2523 982 --12460 --
NM_000724chr1041894 1263 489 371 --21396 1297 --
NM_000726chr251133 358 313 273 38 --11069 --
NM_000783chr10186 --1136 --
NM_000793chr14115121 4178 1641 1483 1420 1118 656 643 615 559 138 12011 34073 4050 1092 13664
NM_000807chr43713 275 69 1257 ----
NM_000809chr4149181 8852 8111 7640 6995 6439 3322 3234 3131 2964 2182 1870 1628 373 65888 3288 3090 2660 2539 2259 39138 6331 2839 --
NM_000813chr575483 5056 4307 4240 2029 1399 1081 14493 ----
NM_000814chr1563767 3593 3067 2796 464 278 13263 --11168
NM_000824chr42382 71 ------
NM_000826chr472523 2517 995 955 458 162 94 --1741 --
NM_000828chrX31973 1365 220 31652 857 304 ----
NM_000829chr111844 2905 287 11778 11802
NM_000831chr166209 6151 6113 5593 803 550 34457 1684 902 11716 --
NM_000838chr662767 2356 2055 1734 1075 44 12226 ----
NM_000844chr321020 1000 ------
NM_000856chr4--1112 1131 1340
NM_000865chr6--1223 ----
NM_000866chr351911 1529 1418 1380 371 ------
NM_000875chr1546813 5392 2390 1309 26896 2520 1293 --
NM_000876chr6------11448
NM_000891chr1763513 2744 2571 2405 2365 1287 12558 ----
NM_000899chr12124017 3586 3503 3320 3108 3060 1721 1569 1448 1317 770 459 12954 2946 604 --
NM_000901chr472503 2425 1792 1665 790 693 196 --11001 12044
NM_000902chr32671 241 --1684 13210
NM_000908chr51138 2737 126 ----
NM_000933chr2041802 1184 1168 542 11122 --1386
NM_000944chr442150 1710 544 397 12018 ----
NM_000945chr241683 1593 1460 495 ------
NM_000963chr142284 2273 2112 551 2506 269 ----
NM_000965chr321285 200 1898 ----
NM_000983chr121275 488 1189 --11230
NM_000989chr8--123 ----
NM_001001132chr2151240 1080 1044 1029 937 --1926 --
NM_001001323chr1283061 2843 2683 2670 2121 2102 897 678 ------
NM_001001330chr1021054 826 11152 ----
NM_001001342chr10--31380 535 204 --11095
NM_001001344chrX72594 2567 2374 2353 1940 1925 1020 1759 ----
NM_001001389chr1152534 2152 691 176 110 32358 2079 844 ----
NM_001001390chr1152534 2152 691 176 110 32358 2079 844 ----
NM_001001391chr1152534 2152 691 176 110 32358 2079 844 ----
NM_001001392chr1152580 2198 737 222 156 32404 2125 890 ----
NM_001001394chr21490 ------
NM_001001395chr1242409 2389 1127 960 32759 679 487 ----
NM_001001396chr154267 3409 3107 3067 762 --11562 --
NM_001001419chr594771 4393 3872 3640 1683 968 839 401 298 24058 703 22028 1698 --
NM_001001420chr594771 4393 3872 3640 1683 968 839 401 298 24058 703 22028 1698 --
NM_001001481chr833215 2301 70 --2983 729 --
NM_001001484chr1082471 2415 1841 1639 1521 781 370 304 ------
NM_001001520chr191145 ------
NM_001001556chr15180 11342 --1505
NM_001001664chr243534 3143 3017 474 33929 3346 3226 ----
NM_001001665chr21156 12184 --1430
NM_001001668chr1954272 3745 3490 2598 1259 13254 ----
NM_001001890chr2173724 3577 3186 1373 1336 1133 149 33329 2917 1233 ----
NM_001001928chr2278197 7746 5538 5433 2301 1468 124 58323 6289 2175 1017 221 ----
NM_001001974chr1072030 1668 1620 1536 1509 545 181 21941 1545 ----
NM_001001994chrX3480 418 90 ------
NM_001001995chrX4730 691 575 174 ------
NM_001001996chrX3480 418 90 ------
NM_001002233chr852048 1936 1851 749 179 11843 11996 --
NM_001002243chr23932 364 337 1919 ----
NM_001002255chr6182 ------
NM_001002257chr263444 3217 1214 193 179 169 ------
NM_001002811chr141527 1453 371 178 2406 194 --1466
NM_001002812chr141527 1453 371 178 2406 194 --1466
NM_001002812chr141527 1453 371 178 2406 194 --1466
NM_001002838chrX51874 1604 1386 1369 609 ------
NM_001002860chr1443316 3185 2920 1172 13859 14046 11276
NM_001002909chr1731485 1413 213 ------
NM_001002919chr21440 ------
NM_001003407chr1064046 4021 3249 1225 1073 207 1399 14483 13964
NM_001003408chr1064046 4021 3249 1225 1073 207 1399 14483 13964
NM_001003652chr18138587 8045 7937 7552 6286 5923 5737 5374 1351 1033 922 914 438 45290 2249 888 696 16366 --
NM_001003674chr1876762 6032 5617 5452 5085 2172 2008 --22814 991 --
NM_001003675chr1876762 6032 5617 5452 5085 2172 2008 --22814 991 --
NM_001003681chr2251968 1564 1526 750 487 11722 ----
NM_001003712chr1254033 3976 3303 1267 402 --13354 1386
NM_001003760chr693570 3425 3263 3130 2772 2319 522 237 173 33647 1212 834 21019 481 --
NM_001003792chr35956 462 242 204 30 --11122 --
NM_001003793chr35956 462 242 204 30 --11122 --
NM_001003800chr931217 1060 569 13167 13617 189
NM_001003810chr43555 237 55 ------
NM_001003894chrY------1100
NM_001004065chr963776 3743 1558 1422 652 259 ------
NM_001004106chr511034 ------
NM_001004317chr652917 2829 1473 1346 603 33660 1755 520 23286 925 --
NM_001004330chr1251487 471 429 404 202 31660 1176 57 ----
NM_001004342chr166079 5786 5330 4674 1544 1193 14323 34556 1817 880 14943
NM_001004346chr431282 1061 980 ------
NM_001004360chr261854 1722 1362 518 414 367 1331 ----
NM_001004419chr12124579 4478 4209 3461 3257 1450 1425 1406 1370 1248 1010 100 44627 4570 3518 2903 ----
NM_001004441chr551657 1285 658 425 93 171 1251 --
NM_001005242chr1241516 1448 1437 1316 11061 ----
NM_001005366chr122636 382 ------
NM_001005375chrY51645 1507 1173 732 446 ------
NM_001005386chr242458 2237 2200 1660 --161 --
NM_001005404chr1764496 4030 3518 3332 1275 1150 32922 1609 1500 21115 732 --
NM_001005463chr1032646 2283 1940 ------
NM_001005473chr576561 4601 4086 1761 1268 1114 99 35393 5269 4016 45800 4919 4079 756 1699
NM_001005476chr2--1742 ----
NM_001005502chr12104877 4839 3293 3238 3195 2026 1944 253 193 115 --15035 --
NM_001005611chrX3495 176 56 ------
NM_001005739chr22850 545 ------
NM_001005743chr1421331 274 --1365 --
NM_001005744chr1421331 274 --1365 --
NM_001005745chr1421331 274 --1365 --
NM_001005746chr251133 358 313 273 38 --11069 --
NM_001005747chr251133 358 313 273 38 --11069 --
NM_001005845chr811242 41879 1732 1602 1281 11944 --
NM_001005849chr173504 463 79 ------
NM_001006117chrY--1196 ----
NM_001006118chrY--1196 ----
NM_001006120chrY--1196 ----
NM_001006600chr551991 1948 1578 1563 879 ------
NM_001006605chr1155 ------
NM_001006605chr1155 ------
NM_001006617chr941440 1388 352 22 ------
NM_001006619chr941440 1388 352 22 ------
NM_001006620chr941440 1388 352 22 ------
NM_001006621chr941440 1388 352 22 ------
NM_001006623chr222489 203 12269 21713 472 --
NM_001006636chr231034 342 177 1716 ----
NM_001007023chr14115121 4178 1641 1483 1420 1118 656 643 615 559 138 12011 34073 4050 1092 13664
NM_001007088chrX2174 53 ------
NM_001007094chr1044010 3909 1080 726 24491 1759 ----
NM_001007097chr974529 3421 3181 1953 1517 1284 457 23465 1604 13511 1824
NM_001007226chr173434 87 33 11253 11289 --
NM_001007227chr173434 87 33 11253 11289 --
NM_001007228chr173434 87 33 11253 11289 --
NM_001007229chr173434 87 33 11253 11289 --
NM_001007230chr173434 87 33 11253 11289 --
NM_001007256chr1--1109 ----
NM_001007257chr141309 1108 969 508 ------
NM_001007267chr21768 1598 ----
NM_001007464chr6--1165 ----
NM_001007466chr695151 4757 4527 4110 2081 1595 1302 1077 420 23630 3596 13288 --
NM_001007526chrY--1196 ----
NM_001007559chr1842026 1337 1311 258 11528 --11683
NM_001007794chr1--1174 1639 --
NM_001008222chrX1175 ------
NM_001008237chr2--1151 ----
NM_001008239chr1862968 2827 2750 784 353 207 1283 12350 --
NM_001008388chr451136 728 381 238 97 ------
NM_001008392chr353015 944 512 381 289 1199 ----
NM_001008393chr432416 2367 2182 11926 12213 --
NM_001008491chr272035 1988 1612 1508 675 614 316 ------
NM_001008492chr272035 1988 1612 1508 675 614 316 ------
NM_001008495chr822163 136 11974 --22093 791
NM_001008541chr102459 241 11570 291 65 --
NM_001008541chr102459 241 11570 291 65 --
NM_001008564chr1321624 394 11652 ----
NM_001008660chr112564 97 ------
NM_001008708chr23562 516 487 ------
NM_001008723chr102483 378 171 ----
NM_001008738chr542397 1001 405 277 ----11868
NM_001008860chr15125 --1111 --
NM_001008892chr15125 --1111 --
NM_001008894chr15125 --1111 --
NM_001008925chr453270 2565 2545 2445 1211 1166 ----
NM_001009554chr494623 3473 3278 3220 3084 1867 1776 264 172 34080 3603 1610 12942 --
NM_001009554chr494623 3473 3278 3220 3084 1867 1776 264 172 34080 3603 1610 12942 --
NM_001009555chr421161 586 41716 1545 1529 1223 11721 2439 433
NM_001009881chr11644 1441 ----
NM_001009882chr11644 1441 ----
NM_001009894chr1291566 1415 1259 639 461 326 284 187 38 41635 609 470 425 ----
NM_001009899chr376265 5732 5541 4923 4637 1550 956 24375 1393 ----
NM_001009909chr11113870 3694 3316 3084 2897 2443 2405 1520 1272 643 111 13476 12633 --
NM_001009931chr1238 22 ------
NM_001009955chr11165 ------
NM_001009955chr11165 ------
NM_001009959chr282606 1756 1702 1683 833 780 596 171 --11677 --
NM_001009993chr284485 4426 1437 462 329 265 227 167 24515 4178 11138 --
NM_001010000chr1842751 2356 904 257 12877 ----
NM_001010853chr633217 2140 57 191 21301 572 12036
NM_001010854chr14----1496 --
NM_001010861chr192640 2551 2542 1860 1714 818 658 399 339 21871 1727 ----
NM_001010867chr146270 5372 5032 2572 35167 4182 1925 12045 15843
NM_001010888chrX104401 3937 3467 2941 1628 1295 1260 1093 895 767 33992 2990 439 ----
NM_001010891chr5176953 6021 5945 5770 5206 5021 4797 2603 2047 1880 1627 1604 1479 1374 572 375 48 36947 6791 1263 25145 2562 16764
NM_001010932chr72402 319 ------
NM_001010934chr71810 1216 ----
NM_001010971chr12355 325 1112 1962 --
NM_001010984chr172391 2206 2171 2056 1859 728 591 32278 1774 1685 2986 253 --
NM_001011513chr483778 3714 3678 3422 3158 3033 2853 323 1971 1252 --
NM_001011515chr41285 --2743 135 --
NM_001011516chr41285 --2743 135 --
NM_001011666chr785251 4641 4633 4234 2345 1800 419 337 25831 1358 24464 2093 --
NM_001011708chr252559 790 288 112 69 11946 ----
NM_001011713chr1441642 1196 99 63 11080 ----
NM_001011885chr152361 247 2677 473 ----
NM_001012267chr931949 1453 55 ----1513
NM_001012337chr3186 ------
NM_001012393chr11124539 4438 4105 3679 3655 1982 1517 1490 994 919 900 58 --13524 24332 1096
NM_001012398chr1621109 942 1447 ----
NM_001012419chr921298 268 1197 ----
NM_001012420chr1582840 2461 2378 2311 2178 2107 219 67 2632 438 --1234
NM_001012423chr1582840 2461 2378 2311 2178 2107 219 67 2632 438 --1234
NM_001012755chrX105072 4643 4399 4179 3986 3360 1636 1165 1072 42 41952 1545 1248 875 1211 1399
NM_001012761chr552083 1796 1786 888 207 12431 ----
NM_001012977chrX2998 252 1245 --1351
NM_001013031chr1043125 1239 1230 811 12732 21300 1287 --
NM_001013399chr631070 404 188 ------
NM_001013620chr12117598 6441 5906 3206 2887 2849 1897 1361 813 801 90 27692 5298 48293 1729 993 981 --
NM_001013635chr122396 386 ------
NM_001013659chr1954578 3855 3449 1566 1506 45211 3333 370 64 33868 263 101 --
NM_001013843chr153757 149 45 ------
NM_001014380chr1385283 2310 1350 1088 255 190 65 23 25846 3755 ----
NM_001014446chr4--163 ----
NM_001014797chr10117151 6505 5345 3058 2833 2437 2367 2010 1263 1178 584 27546 1066 48043 3147 1519 1458 --
NM_001014812chr151450 ------
NM_001015045chr432212 858 810 22391 1793 ----
NM_001015508chr82768 170 ------
NM_001015877chrX22506 518 22846 2736 12078 --
NM_001015880chr1031409 1062 106 21442 204 ----
NM_001015881chrX--11267 ----
NM_001015882chr92204 195 ------
NM_001017395chr353330 519 306 284 209 21386 254 12966 --
NM_001017405chr41731 ------
NM_001017424chr151687 1575 1354 562 413 ------
NM_001017425chr151687 1575 1354 562 413 ------
NM_001017440chr7118217 8060 7336 6739 6315 5210 5067 2069 1599 1406 1338 --37046 5467 5130 --
NM_001017923chr1431654 548 496 ------
NM_001017926chr821727 242 1297 176 1563
NM_001017930chrX21067 297 1337 1537 1417
NM_001017977chr12341 89 ------
NM_001017979chr41726 ------
NM_001018004chr152579 81 ------
NM_001018006chr152579 81 ------
NM_001018007chr152579 81 ------
NM_001018009chr321128 825 194 ----
NM_001018020chr152579 81 ------
NM_001018054chr1----11030 --
NM_001018065chr954662 4455 4382 3871 1713 14911 1535 12186
NM_001018066chr954662 4455 4382 3871 1713 14911 1535 12186
NM_001018067chr195232 4447 4218 3991 3615 3560 1185 612 568 34031 3586 1594 --11499
NM_001018068chr195232 4447 4218 3991 3615 3560 1185 612 568 34031 3586 1594 --11499
NM_001018069chr195232 4447 4218 3991 3615 3560 1185 612 568 34031 3586 1594 --11499
NM_001018074chr593744 3385 2523 1573 1321 1192 1128 738 279 13129 22544 530 --
NM_001018075chr593744 3385 2523 1573 1321 1192 1128 738 279 13129 22544 530 --
NM_001018076chr593744 3385 2523 1573 1321 1192 1128 738 279 13129 22544 530 --
NM_001018077chr593744 3385 2523 1573 1321 1192 1128 738 279 13129 22544 530 --
NM_001018080chr1151423 930 377 286 236 31320 1210 278 11052 --
NM_001018115chr32643 568 --1192 --
NM_001020658chr111482 21229 1123 ----
NM_001020658chr111482 21229 1123 ----
NM_001024094chr593744 3385 2523 1573 1321 1192 1128 738 279 13129 22544 530 --
NM_001024649chr562455 2299 2235 512 351 318 ------
NM_001024808chr1211828 22872 1762 ----
NM_001024855chr31180 11738 ----
NM_001024948chr193406 3011 2739 2679 2573 2483 2388 612 574 1722 13521 --
NM_001025076chr1094998 4755 4263 2208 2077 1622 1517 1396 501 2926 893 35234 5213 1873 --
NM_001025077chr1096356 6113 5621 2980 2875 2754 1859 978 268 22284 2251 26592 6571 --
NM_001025079chr353865 3498 3031 998 565 23561 2883 23899 287 --
NM_001025100chr1831065 482 253 33709 3331 1382 --13539
NM_001025105chr53996 396 325 2370 141 11387 --
NM_001025108chr254024 3534 3506 1409 933 1409 ----
NM_001025233chr1232703 1964 420 22456 893 ----
NM_001025252chr893117 2561 2392 2084 2067 756 590 391 87 22330 2312 ----
NM_001025253chr893117 2561 2392 2084 2067 756 590 391 87 22330 2312 ----
NM_001025356chr1282977 2935 1905 1149 923 823 575 364 32750 744 109 ----
NM_001025389chr1161490 1251 1154 1076 674 520 ----2436 43
NM_001025390chr1161490 1251 1154 1076 674 520 ----2436 43
NM_001025579chr171464 11213 ----
NM_001025580chrX43203 1254 924 759 ------
NM_001025616chr451867 1623 1381 1255 326 ------
NM_001025780chr91421 31262 599 368 ----
NM_001029839chr331497 562 318 ------
NM_001029840chr331497 562 318 ------
NM_001029858chr642868 2408 1061 830 11219 22840 673 11257
NM_001029860chr82112 83 ------
NM_001029863chr632907 2093 886 32878 2058 582 ----
NM_001029875chr552703 2070 1196 694 466 2867 382 12118 --
NM_001029884chr652626 1856 698 518 99 12052 11886 1253
NM_001029989chr151701 ------
NM_001029998chr431002 987 387 ------
NM_001030007chr1631290 1182 806 22795 1323 12510 22688 1605
NM_001030055chr1474407 3638 3606 1514 1376 1171 974 64088 3888 3300 1306 799 487 1290 --
NM_001030287chr111138 ------
NM_001031679chr1233573 3347 355 12968 --12503
NM_001031695chr2254892 4870 2085 1255 198 --15188 1751
NM_001031709chr102152 52 1356 ----
NM_001031710chr73994 803 259 1273 ----
NM_001031712chr62435 278 ------
NM_001031732chr483583 2963 2627 2349 1391 599 549 44 23624 3119 13066 --
NM_001031738chr2183 ------
NM_001031746chr1061438 1416 1349 1258 1036 204 1349 ----
NM_001032282chr811288 1872 ----
NM_001032293chr171206 ------
NM_001032380chr1041857 555 525 45 11724 1725 --
NM_001032393chrX3774 712 637 ------
NM_001032730chr11676 ------
NM_001033047chr441817 1772 863 371 21673 735 ----
NM_001033057chr3--2771 150 21917 325 --
NM_001033059chr652056 2000 1954 1520 310 11674 1502 --
NM_001033087chr2072816 2392 2364 2191 572 258 134 --12527 --
NM_001033112chr51315 --139 --
NM_001033506chr111113 ------
NM_001033557chr211470 2404 160 ----
NM_001033566chr17--1775 ----
NM_001033568chr17--1775 ----
NM_001033578chr822165 232 ----1356
NM_001033602chr1312228 2400 285 ----
NM_001033659chr17--11403 11677 --
NM_001033910chr111754 --11686 --
NM_001033953chr11167 ------
NM_001034155chr9--195 ----
NM_001034845chr411276 2878 190 ----
NM_001034850chr551597 1351 1209 1200 542 149 ----
NM_001034954chr1082424 2403 2326 2155 2013 475 289 63 22982 2952 12667 --
NM_001034955chr1082424 2403 2326 2155 2013 475 289 63 22982 2952 12667 --
NM_001034956chr1082424 2403 2326 2155 2013 475 289 63 22982 2952 12667 --
NM_001034957chr1082424 2403 2326 2155 2013 475 289 63 22982 2952 12667 --
NM_001035chr11207 1918 162 --
NM_001035521chr22791 664 1704 ----
NM_001037165chr788846 8350 7723 7599 7005 6000 5737 5699 16719 27043 5895 --
NM_001037174chr222309 1820 31741 1523 165 ----
NM_001037277chr141602 1553 412 47 ----11082
NM_001037278chr141602 1553 412 47 ----11082
NM_001037290chr111351 21003 803 ----
NM_001037317chr192640 2551 2542 1860 1714 818 658 399 339 21871 1727 ----
NM_001037334chr1842378 1908 1678 683 --1838 --
NM_001037631chr21202 --175 --
NM_001037872chr22518 108 ------
NM_001037954chr1153040 2649 2569 1253 535 22256 922 ----
NM_001038707chr152204 2153 2012 1958 611 ------
NM_001038707chr152204 2153 2012 1958 611 ------
NM_001039111chr31117 190 --1107
NM_001039199chr20105051 5034 3394 3287 1935 1112 1087 252 238 89 --13864 --
NM_001039348chr22904 855 ----1355
NM_001039349chr22904 855 ----1355
NM_001039395chr952358 1993 1747 1536 147 12072 11970 --
NM_001039538chr242677 1029 887 142 1113 ----
NM_001039585chr1104163 4083 3424 3056 1607 1407 1350 945 509 122 33414 1479 74 23603 3461 --
NM_001039590chrX63219 2938 1131 1016 805 501 23943 2843 1857 11251
NM_001039591chrX63219 2938 1131 1016 805 501 23943 2843 1857 11251
NM_001039618chr1144582 3846 825 201 34808 1102 129 ----
NM_001039693chr2103892 3716 3325 3200 1632 1412 1303 1252 1195 971 --11288 --
NM_001039762chr1072087 793 541 511 478 294 22 21512 783 ----
NM_001039802chr131306 1285 391 ------
NM_001039840chrX135962 5664 5531 5257 5043 4833 4725 4629 2333 1717 866 642 208 34120 2007 748 15473 1930
NM_001039844chr1042450 2239 1179 708 1671 --12280
NM_001039884chr1921093 437 --195 --
NM_001039937chr1373899 3246 3185 3007 2599 683 253 11403 1285 11192
NM_001040057chr711395 21159 57 ----
NM_001040058chr42417 355 --121 --
NM_001040060chr42417 355 --121 --
NM_001040100chr32956 400 --1292 --
NM_001040110chr741681 1425 1384 88 ----1219
NM_001040142chr242353 2296 1920 283 11776 ----
NM_001040143chr242353 2296 1920 283 11776 ----
NM_001040152chr784308 4184 3179 1409 1382 1174 829 407 13199 1333 --
NM_001040153chr132883 341 ------
NM_001040157chr482504 2207 2133 2077 1796 748 111 77 ------
NM_001040159chr431528 299 229 11356 ----
NM_001040181chr321123 220 ------
NM_001040182chr321123 220 ------
NM_001040183chr321123 220 ------
NM_001040199chr321123 220 ------
NM_001040200chr321123 220 ------
NM_001040202chr432436 1858 317 11000 ----
NM_001040214chr641742 1463 892 875 ------
NM_001040280chr631540 541 504 ------
NM_001040284chr16125941 5389 5383 5254 5219 4747 3619 1758 941 842 682 626 35751 2278 43 15675 --
NM_001040402chr433025 2314 2286 --12807 --
NM_001040429chr1383536 3491 2864 2647 2399 1288 1246 316 13182 --13345
NM_001040441chr154357 3615 2162 739 39 22089 428 --22201 388
NM_001040450chr1531894 1876 990 ------
NM_001040453chr1531894 1876 990 ------
NM_001040619chr111588 ------
NM_001040665chr7144896 4424 4219 4119 3943 3700 3469 3380 3323 1669 1434 1186 841 330 13928 11995 --
NM_001040712chr952736 1144 736 191 57 12641 1750 --
NM_001040876chr451705 1373 590 494 351 21854 1310 ----
NM_001042355chr1663785 2081 1929 1294 536 307 13826 24780 876 --
NM_001042361chr1071563 1464 1308 1301 1292 1039 136 11476 ----
NM_001042364chr1071563 1464 1308 1301 1292 1039 136 11476 ----
NM_001042365chr1071563 1464 1308 1301 1292 1039 136 11476 ----
NM_001042387chr1071563 1464 1308 1301 1292 1039 136 11476 ----
NM_001042388chr183935 807 226 ------
NM_001042393chr1071563 1464 1308 1301 1292 1039 136 11476 ----
NM_001042396chr1071563 1464 1308 1301 1292 1039 136 11476 ----
NM_001042397chr1071563 1464 1308 1301 1292 1039 136 11476 ----
NM_001042399chr121436 ------
NM_001042403chr122833 132 --1286 --
NM_001042406chr62802 493 1444 --142
NM_001042412chr1663785 2081 1929 1294 536 307 13826 24780 876 --
NM_001042453chrX21718 679 11779 ----
NM_001042473chr1051972 1880 1653 1597 549 31430 443 85 1218 --
NM_001042486chr201152 ------
NM_001042490chr52325 104 ------
NM_001042492chr1793513 3024 2645 2482 1388 1118 1084 1051 484 2606 295 11318 --
NM_001042494chr1553156 2988 1329 1266 1180 2964 374 12570 --
NM_001042495chr1553156 2988 1329 1266 1180 2964 374 12570 --
NM_001042496chr1553156 2988 1329 1266 1180 2964 374 12570 --
NM_001042497chr1553156 2988 1329 1266 1180 2964 374 12570 --
NM_001042506chrX1252 1245 --1351
NM_001042517chr131794 --1844 --
NM_001042533chr321050 722 23045 364 12805 --
NM_001042555chr1253946 3125 1449 1124 904 1190 32952 1490 764 1720
NM_001042599chr2157805 6482 5853 5805 5668 5582 5158 2546 2508 2113 1686 1558 1386 710 599 45199 5179 2563 2229 2807 47 15341
NM_001042601chr363309 3251 2996 2836 1146 912 13139 1579 --
NM_001042603chr1244213 3563 556 416 35318 4531 1897 21933 1805 --
NM_001042604chr374069 3873 3023 787 737 703 28 11893 23506 1264 --
NM_001042635chr14--155 ----
NM_001042646chr311990 ------
NM_001042669chr451867 1623 1381 1255 326 ------
NM_001042749chrX3577 315 196 ----1680
NM_001042750chrX3577 315 196 ----1680
NM_001042751chrX3577 315 196 ----1680
NM_001043318chr1454084 3834 3749 2770 788 12632 11012 --
NM_001044305chr661342 1330 1088 1081 636 161 ------
NM_001044385chr2113803 3080 2972 2960 2803 2690 1328 1294 1161 913 619 11605 13071 --
NM_001044387chr1964145 1441 1432 993 980 654 23681 829 22844 1497 --
NM_001044388chr1964145 1441 1432 993 980 654 23681 829 22844 1497 --
NM_001046chr552127 1977 847 426 66 2954 356 --1205
NM_001048183chr183768 3733 3578 3513 3289 3052 661 482 --12999 12656
NM_001050chr172530 343 --11492 11013
NM_001078chr11751 1481 ----
NM_001083620chr472521 2515 994 954 457 162 94 --1740 --
NM_001083621chr154266 3908 1787 1079 828 24477 1041 --1132
NM_001099678chr3146377 6290 5267 5047 4728 4177 3959 2536 2442 2407 2037 1777 922 669 22165 89 1913 1827
NM_001100108chr187884 7534 5982 5291 2507 1719 712 406 36830 6556 680 17490 --
NM_001106chr3108208 7316 6876 6651 6154 3446 3036 2507 2059 1700 ------
NM_001113490chrX52874 2777 2595 1010 174 12640 13228 23343 947
NM_001116chr1642921 2699 2390 281 23074 359 ----
NM_001117chr1832308 1646 557 11725 32021 2002 1715 --
NM_001121chr1041596 1300 1192 562 11568 ----
NM_001123chr104759 537 183 166 1125 ----
NM_001128chr1631290 1182 806 22795 1323 12510 22688 1605
NM_001148chr441827 1795 1488 1478 --1115 --
NM_001149chr102953 199 ------
NM_001160chr1222206 189 12591 2792 637 1453
NM_001166chr111143 1179 ----
NM_001167chrX106717 5701 4658 4471 2406 1916 397 298 166 157 15834 15572 15535
NM_001173chr1474407 3638 3606 1514 1376 1171 974 64088 3888 3300 1306 799 487 1290 --
NM_001186chr2182749 2229 2157 2045 1202 436 334 132 1545 21087 725 --
NM_001191chr201229 ------
NM_001198chr682000 1932 1888 956 763 718 488 380 1169 ----
NM_001201chr483668 3506 3098 2869 2740 2629 1334 1025 13152 1397 --
NM_001204chr2137105 6727 6126 3108 2436 2210 2027 2016 1802 1795 1711 1485 223 27478 5337 16916 --
NM_001206chr932341 2021 881 --12250 --
NM_001219chr752061 1879 1715 740 459 ------
NM_001221chr4--139 ----
NM_001227chr1021095 1035 1107 ----
NM_001233chr7--21693 1595 ----
NM_001241chr262295 1881 1548 1524 695 120 11701 ----
NM_001241chr262295 1881 1548 1524 695 120 11701 ----
NM_001256chr1732751 270 224 12283 ----
NM_001257chr1631379 579 211 ----1150
NM_001259chr776181 5173 4927 4679 4547 507 362 26013 2177 --11243
NM_001262chr1--1143 --1286
NM_001273chr121556 ------
NM_001278chr103933 910 296 11073 1782 --
NM_001289chrX21136 159 41331 1299 1267 395 1259 1348
NM_001304chr1753774 3685 3632 3298 1158 1150 ----
NM_001310chr1262982 2668 2636 2177 1075 821 2484 160 1133 --
NM_001315chr611749 11653 ----
NM_001319chr192210 29 ------
NM_001321chr12365 50 40 ------
NM_001329chr1011486 --11274 --
NM_001332chr5------1602
NM_001343chr52508 479 --1615 11116
NM_001346chr342576 2021 1757 70 ----12714
NM_001358chr4----1401 --
NM_001364chr1164266 3864 3326 3272 1821 744 1572 ----
NM_001365chr171768 ------
NM_001389chr212531 469 ------
NM_001390chr1843639 3419 1374 676 --12534 --
NM_001391chr1821142 273 1890 --1998
NM_001396chr2152709 1995 1906 1809 1766 --12817 --
NM_001412chrX113639 3530 3412 3021 1434 1417 1408 865 435 105 52 32554 912 87 ----
NM_001419chr1953798 1962 831 397 93 ----1201
NM_001422chr1121355 127 ------
NM_001429chr223105 84 73 ------
NM_001432chr493945 3785 3732 3187 2422 1407 716 706 235 23569 1154 12605 --
NM_001438chr153338 2853 1170 1153 951 --11189 --
NM_001453chr621340 280 21782 641 ----
NM_001480chr1851175 896 377 359 201 11153 ----
NM_001483chr731103 937 406 11027 ----
NM_001491chr652561 1727 401 217 199 --1478 --
NM_001494chr102300 214 ------
NM_001497chr951838 855 821 99 67 1460 ----
NM_001521chr22791 664 1704 ----
NM_001527chr673903 3223 1731 1473 1065 590 194 34612 4080 3916 24521 2962 123
NM_001543chr543868 3444 1489 598 --14844 11111
NM_001546chr631325 403 380 --11435 --
NM_001557chr221227 1202 ------
NM_001584chr111481 --21060 492 --
NM_001604chr112655 217 1729 ----
NM_001608chr24310 254 171 39 2924 709 ----
NM_001609chr1053318 3068 2916 1190 722 31744 1220 678 11083 22740 331
NM_001612chr11--1246 ----
NM_001616chr232960 2638 2264 ----13294
NM_001620chr111761 ------
NM_001621chr742382 2270 1968 1138 1514 ----
NM_001621chr742382 2270 1968 1138 1514 ----
NM_001634chr652056 2000 1954 1520 310 11674 1502 --
NM_001642chr11----1164 --
NM_001650chr1873876 3089 1105 862 734 278 133 12838 21233 1069 11435
NM_001663chr1442693 2654 2038 371 22207 576 ----
NM_001668chr161931 1630 1539 681 200 67 12064 ----
NM_001674chr111138 ------
NM_001677chr13994 925 113 ------
NM_001681chr122669 215 ------
NM_001682chr1292775 2557 2397 2384 1835 1816 1048 611 392 ------
NM_001684chr153984 3126 2824 2784 479 --11279 --
NM_001690chr332496 2291 71 12474 21737 431 --
NM_001695chr853373 3343 3039 2678 1120 31158 947 480 23406 1212 13264
NM_001699chr1921415 359 21504 439 21747 476 11595
NM_001701chr951380 1250 1140 63 39 11540 ----
NM_001706chr31718 ------
NM_001713chr53444 216 30 ------
NM_001718chr611075 1367 --11042
NM_001726chr1------1100
NM_001730chr1341621 1346 1100 1027 1240 ----
NM_001730chr1341621 1346 1100 1027 1240 ----
NM_001742chr751523 1359 632 199 185 1452 --11367
NM_001743chr23606 550 28 ------
NM_001746chr562455 2299 2235 512 351 318 ------
NM_001752chr113614 582 155 ------
NM_001753chr761831 1711 1515 553 195 96 11348 --166
NM_001754chr2173724 3577 3186 1373 1336 1133 149 33329 2917 1233 ----
NM_001755chr1632172 2154 1813 ------
NM_001759chr1284925 4433 4006 3339 1634 1074 589 42 1399 1506 --
NM_001769chr121404 ------
NM_001777chr353865 3498 3031 998 565 23561 2883 23899 287 --
NM_001786chr10--1131 ----
NM_001791chr131306 1285 391 ------
NM_001792chr182885 143 ----144
NM_001794chr201253 ------
NM_001797chr162665 556 --2797 531 --
NM_001827chr9294 26 ------
NM_001833chr91271 ------
NM_001839chr1------1315
NM_001842chr92449 129 ------
NM_001843chr12----182 --
NM_001845chr1331246 1205 538 ------
NM_001854chr141465 1269 529 271 --11065 --
NM_001858chr684503 4010 3823 3420 3355 1439 1247 580 24398 274 1802 --
NM_001859chr963243 3117 2796 1029 882 597 23281 2816 1171 --
NM_001874chr12104877 4839 3293 3238 3195 2026 1944 253 193 115 --15035 --
NM_001892chr53996 396 325 2370 141 11387 --
NM_001904chr32799 692 --1733 --
NM_001918chr1138469 8271 7910 7904 7691 7258 6572 6150 2874 2779 1316 911 87 56924 6499 5783 2178 2129 26961 5668 17315
NM_001920chr124763 577 144 41 ------
NM_001935chr23999 870 323 2844 145 ----
NM_001938chr141435 1377 327 219 ------
NM_001942chr1842007 1735 1535 689 ------
NM_001949chr643000 2701 866 245 --1397 --
NM_001955chr62972 742 ------
NM_001957chr451619 1491 849 685 82 --12226 --
NM_001977chr451504 1239 438 371 325 ----11133
NM_001981chr132295 611 502 11902 ----
NM_001987chr1284185 4150 4069 3599 3546 2905 2742 259 1439 23306 1541 11269
NM_001995chr421482 312 1477 145 --
NM_002006chr4125581 5481 5185 5098 4754 4403 3977 3751 616 541 315 122 45673 5635 3509 24 1800 --
NM_002009chr1572642 2053 819 793 692 639 517 ------
NM_002015chr1342165 734 601 516 42285 1132 992 253 13239 --
NM_002024chrX32021 878 173 22201 1906 1397 --
NM_002025chrX99330 8652 7387 6564 6160 3252 2674 1974 1243 58971 6141 6052 3121 2847 28986 488 11922
NM_002031chr63692 330 209 ------
NM_002033chr1173843 2859 2686 1556 1486 919 336 22872 385 11331 --
NM_002035chr1893985 3838 3792 3439 3116 931 422 385 71 12906 ----
NM_002040chr21122712 2266 2157 1945 1023 763 654 445 360 209 112 87 --13013 --
NM_002044chr15180 11342 --1505
NM_002056chr22679 306 ------
NM_002061chr131213 409 32 11387 ----
NM_002063chrX1242 ----11291
NM_002069chr721192 60 1750 ----
NM_002077chr961933 1716 1632 1598 1458 72 ------
NM_002082chr51997 ------
NM_002092chr454629 3977 3479 3370 603 21976 778 1877 14059
NM_002094chr161436 ------
NM_002106chr41101 ------
NM_002107chr12354 53 ------
NM_002126chr1711370 2805 432 13610 --
NM_002128chr1372432 2175 2089 1866 736 676 453 32376 971 695 ----
NM_002138chr43555 237 55 ------
NM_002140chr94985 958 790 172 ------
NM_002146chr1721462 421 ------
NM_002158chr283757 3095 1373 1240 1065 873 626 374 31093 1047 912 13708 --
NM_002193chr231860 1345 1261 ------
NM_002194chr2--1159 ----
NM_002203chr5113641 3583 3399 3150 1442 1210 912 894 820 510 250 23713 3507 ----
NM_002205chr121768 ------
NM_002210chr243150 3111 2259 1047 33213 766 236 11203 --
NM_002211chr103935 880 857 --148 --
NM_002214chr755049 4064 1746 1621 424 21378 550 ----
NM_002223chr1241432 1112 392 156 12734 22978 544 --
NM_002227chr141131 931 876 82 1467 ----
NM_002240chr211139 --146 --
NM_002242chr221306 352 11580 ----
NM_002264chr364789 4406 1322 1097 898 398 23664 3200 ----
NM_002266chr172203 190 ------
NM_002267chr1332240 2020 950 --21783 290 1237
NM_002268chr331430 1397 1376 ------
NM_002270chr5115514 4950 4243 3882 3465 1878 1196 828 606 298 47 33716 2199 2080 --14632
NM_002271chr1332321 911 626 21726 903 ----
NM_002285chr254024 3534 3506 1409 933 1409 ----
NM_002290chr651070 558 451 395 382 ------
NM_002310chr596584 6484 6280 5400 5296 5159 4037 2071 1663 16424 ----
NM_002312chr133681 657 250 ------
NM_002313chr1064046 4021 3249 1225 1073 207 1399 14483 13964
NM_002317chr51290 ------
NM_002336chr1294834 4381 3691 3220 3174 3090 1196 885 670 11038 ----
NM_002350chr82874 236 --21027 820 --
NM_002356chr651927 1111 1040 829 356 12135 ----
NM_002372chr51688 ------
NM_002374chr242677 1029 887 142 1113 ----
NM_002381chr211031 ----1399
NM_002387chr5104735 4566 4220 3611 1605 917 799 664 560 407 34972 4071 1159 1697 11227
NM_002395chr63179 122 73 ------
NM_002398chr221267 484 ------
NM_002399chr15------11057
NM_002408chr145291 217 145 116 27 ------
NM_002440chr1--194 ----
NM_002449chr521228 205 ------
NM_002451chr993875 3749 3485 2978 2513 853 582 417 316 13092 23766 487 --
NM_002481chr187839 6423 6307 6099 5276 4955 1613 601 12952 25500 2157 12888
NM_002499chr1522221 381 ------
NM_002500chr251280 1229 900 519 345 ------
NM_002505chr61546 1438 11143 --
NM_002514chr81263 ------
NM_002515chr1431695 1592 1392 ------
NM_002519chr112288 236 1608 ----
NM_002522chr1733652 3592 2718 33472 1560 412 ----
NM_002524chr12907 161 1885 --1109
NM_002545chr11124539 4438 4105 3679 3655 1982 1517 1490 994 919 900 58 --13524 24332 1096
NM_002556chr1132059 1837 1404 ------
NM_002563chr32878 339 --1191 --
NM_002576chr1161224 944 923 492 380 222 ------
NM_002577chr383366 3157 2725 945 928 915 720 668 32680 2551 2513 ----
NM_002581chr9135395 5281 5023 4703 4694 1851 1552 1312 1226 1149 925 714 588 25608 5590 1425 --
NM_002586chr611636 --11296 --
NM_002594chr203932 794 122 12455 1173 --
NM_002595chr1281843 1676 1331 1271 547 268 188 98 31787 1200 664 ----
NM_002613chr1665123 3708 3332 2016 1928 1906 11146 13618 --
NM_002623chr201305 --1264 --
NM_002628chr331172 1117 875 --1332 --
NM_002641chrX31504 1440 244 11814 ----
NM_002645chr1122393 2165 23019 898 ----
NM_002651chr11678 ------
NM_002655chr884640 3817 1785 1514 915 880 824 99 1541 ----
NM_002709chr253469 3421 2434 1249 267 23219 540 ----
NM_002710chr122863 238 --1837 --
NM_002711chr71810 ------
NM_002715chr531159 879 331 ------
NM_002716chr1153623 3428 2429 599 49 33550 532 104 ----
NM_002718chr352210 1911 1807 278 187 2676 557 ----
NM_002721chr92195 53 1409 ----
NM_002730chr191549 2558 117 ----
NM_002731chr163098 2957 2363 2086 2072 1261 32697 2560 2533 12294 1289
NM_002734chr1772225 2061 1699 1688 911 615 161 1482 ----
NM_002737chr1776626 5574 4645 2023 1699 800 311 11488 35961 4742 4347 --
NM_002740chr352788 2521 2436 2301 2278 11734 ----
NM_002767chr171190 ------
NM_002788chr14287 34 ------
NM_002790chr1------138
NM_002812chr191425 ------
NM_002823chr2------1468
NM_002828chr18--2948 879 1670 --
NM_002839chr952736 1144 736 191 57 12641 1750 --
NM_002841chr31211 1256 ----
NM_002843chr1142775 2149 1069 837 1585 1316 --
NM_002844chr61473 1396 --1931
NM_002847chr721574 234 ------
NM_002849chr122911 869 --2982 31 --
NM_002858chr121319 1024 ------
NM_002869chr1132220 1530 1373 1323 11431 --
NM_002874chr952409 2348 2281 1878 626 1381 1403 --
NM_002886chr3115151 5042 5029 4964 4746 4377 4190 1227 1195 1150 672 11416 13452 --
NM_002892chr14--11567 ----
NM_002894chr181235 ------
NM_002897chr21606 ------
NM_002906chr1151773 1516 1491 621 528 ------
NM_002922chr1----1625 --
NM_002940chr451705 1373 590 494 351 21854 1310 ----
NM_002942chr351034 468 444 286 91 ------
NM_002948chr361254 1158 1108 1070 813 41 ------
NM_002956chr1241314 1008 932 164 --11016 --
NM_002959chr164359 3848 1195 951 890 88 ------
NM_002968chr162410 333 1797 11042 --
NM_002971chr351155 1063 1038 918 115 ------
NM_002973chr12--186 ----
NM_002977chr263461 3236 2925 1222 899 578 23365 2826 12244 --
NM_002994chr451624 616 516 319 39 ------
NM_002998chr852146 1809 819 810 473 ------
NM_003002chr115747 690 543 297 154 --1306 --
NM_003010chr1732077 2036 589 ------
NM_003011chr971698 1646 1542 1076 204 157 71 ------
NM_003014chr711146 11104 ----
NM_003016chr1741571 1489 719 685 11268 ----
NM_003022chrX31004 502 42 1881 ----
NM_003034chr12147708 7541 7486 7399 7328 7306 6420 5797 5463 5033 2900 2295 909 751 38094 5833 1406 28099 1670 --
NM_003048chr262753 2285 2278 2261 1923 1720 22689 2105 ----
NM_003051chr131695 422 75 1246 ----
NM_003068chr821043 1002 ------
NM_003071chr352041 1685 1433 1358 746 22087 507 1149 --
NM_003076chr1211637 --1469 --
NM_003081chr2031017 411 299 --1917 --
NM_003089chr191154 ------
NM_003095chr12--1271 ----
NM_003108chr2107189 6550 5286 5190 5076 4469 1612 1565 1438 940 15803 17336 14954
NM_003112chr763068 3028 2965 2604 569 273 42660 2062 849 687 ----
NM_003114chr82608 168 1875 1880 --
NM_003128chr232067 661 278 32169 670 255 ----
NM_003137chr63699 655 649 ----12145
NM_003144chr642292 646 615 424 1444 ----
NM_003156chr113993 986 512 ------
NM_003157chr31735 1717 ----
NM_003161chr1733218 1077 509 ------
NM_003162chr23833 421 235 1905 ----
NM_003184chr841089 1040 908 799 ------
NM_003188chr62775 181 ------
NM_003199chr1845600 5289 1623 928 12038 1303 13548
NM_003221chr684187 3929 3815 3230 1057 719 624 545 1854 ----
NM_003222chr204983 950 799 313 ------
NM_003223chr161750 ------
NM_003246chr15----11695 --
NM_003257chr1551419 1411 1382 1304 51 11405 ----
NM_003262chr365196 4257 1330 1066 1004 302 64472 4434 4299 4192 3945 1957 ----
NM_003298chr366104 5388 4955 4293 1742 248 14782 65708 5339 4605 1386 1204 236 --
NM_003300chr141469 ------
NM_003304chr331388 574 370 1523 ----
NM_003317chr143782 666 260 ----1251
NM_003319chr22918 68 --2346 154 --
NM_003337chr541192 580 477 22 11498 --1515
NM_003338chr1021276 1247 ------
NM_003342chr1742831 2283 823 482 11202 ----
NM_003344chr7187 --11708 --
NM_003347chr224798 293 280 243 ------
NM_003350chr82918 200 1339 ----
NM_003359chr431002 946 842 21053 129 2322 164 --
NM_003363chr32543 226 ------
NM_003369chr11--1924 --11062
NM_003370chr19--1315 ----
NM_003374chr51736 ------
NM_003387chr231981 673 556 12384 1486 --
NM_003400chr22336 90 ------
NM_003403chr143750 683 216 ------
NM_003404chr202733 365 ----11610
NM_003406chr841647 1436 1407 129 ------
NM_003410chrX42777 2413 2340 794 ----21173 74
NM_003412chr341072 1031 1010 185 13126 32270 1103 607 --
NM_003413chrX91939 1678 1423 1292 1280 771 764 414 229 --11823 --
NM_003421chr1044010 3909 1080 726 24491 1759 ----
NM_003427chr61735 ------
NM_003430chr191229 1455 ----
NM_003432chr51577 ------
NM_003435chr191530 147 ----
NM_003442chr112900 698 ------
NM_003453chr132644 149 ------
NM_003454chr1611383 1109 --1604
NM_003457chr171206 ------
NM_003462chr12254 22 --11750 --
NM_003463chr623266 1096 22797 316 12802 --
NM_003468chr294026 2938 2929 2775 2646 1573 1475 1043 296 14183 ----
NM_003471chr32632 79 --1778 11858
NM_003478chr11103256 3187 2975 2796 2743 1216 969 962 932 119 12315 ----
NM_003483chr123989 964 554 --11023 --
NM_003489chr2173427 3363 3320 2837 2419 1049 1027 --12551 --
NM_003498chr1642781 2651 588 547 12799 ----
NM_003503chr141208 945 467 445 11268 ----
NM_003505chr711603 11864 ----
NM_003506chr831182 507 262 1377 ----
NM_003507chr251941 1794 1343 543 501 11543 11660 --
NM_003557chr12471 393 ----1573
NM_003563chr173434 87 33 11253 11289 --
NM_003566chr1233030 2237 680 32143 790 315 13343 --
NM_003574chr1895571 5040 3993 3849 3606 2141 1307 1061 148 13521 --15188
NM_003583chr1243762 3256 1453 465 23925 1373 --22678 1417
NM_003590chr261559 1244 1066 1020 921 533 14004 13016 24092 3604
NM_003592chr71490 ------
NM_003603chr41668 11762 ----
NM_003607chr133845 3698 3430 34008 2684 363 23654 1065 --
NM_003615chr373817 2778 2671 1558 1316 300 284 23800 614 13445 --
NM_003617chr1134720 4157 4092 3970 3096 1992 1879 1301 1108 887 839 633 72 1414 ----
NM_003618chr23960 501 219 ------
NM_003626chr1141330 1289 98 92 1532 ----
NM_003628chr2--1742 ----
NM_003630chr61150 1758 ----
NM_003659chr231047 193 34 ------
NM_003663chr372915 1381 1141 763 725 705 650 33444 2556 1273 --23165 2383
NM_003668chr12133 192 ----
NM_003671chr943557 2335 2244 70 21018 250 --1991
NM_003672chr131996 1735 708 --147 --
NM_003686chr11175 ------
NM_003690chr22107 24 1452 ----
NM_003701chr1311001 ------
NM_003713chr121473 1159 1650 --2667 72
NM_003714chr592703 2600 2420 1894 1202 1000 712 624 26 12995 ----
NM_003722chr332707 1916 70 1949 12715 --
NM_003725chr122345 285 ------
NM_003743chr23746 251 93 1881 ----
NM_003744chr1421331 274 --1365 --
NM_003749chr1341661 921 831 333 ----11749
NM_003750chr102888 84 ------
NM_003758chr1541641 1355 1262 633 11028 ----
NM_003758chr1541641 1355 1262 633 11028 ----
NM_003759chr443326 1630 1383 872 1655 23797 1040 --
NM_003760chr14708 538 260 38 ------
NM_003774chr1243287 3187 2754 492 --42620 2162 1291 1054 --
NM_003783chr14422 200 138 31 1830 ----
NM_003794chr32409 309 1985 ----
NM_003796chr192574 526 1394 ----
NM_003816chr82507 417 31493 1346 1216 11558 --
NM_003822chr151167 1028 912 880 347 22491 377 12995 12176
NM_003825chr1521139 513 ------
NM_003829chr97827 502 444 436 408 244 78 1909 ----
NM_003831chr1821726 1257 11704 ----
NM_003850chr134706 689 266 231 ------
NM_003861chr1432826 589 294 22241 724 12567 --
NM_003870chr153294 276 116 1636 ----
NM_003883chr5134 ------
NM_003885chr1742607 722 713 509 22231 1799 22497 123 --
NM_003887chr261850 1843 1796 1604 229 150 ------
NM_003895chr2142045 1575 541 300 2677 314 ----
NM_003901chr1052676 1769 1087 657 527 42739 2727 549 22 ----
NM_003902chr11666 ------
NM_003909chr872810 2764 2623 2590 1099 217 112 --22695 2317 --
NM_003913chr673810 3458 3140 3042 2962 1727 171 2196 55 1690 --
NM_003916chrX31325 268 147 ------
NM_003919chr71201 ------
NM_003927chr184686 676 365 283 ------
NM_003932chr2221486 247 1636 1586 --
NM_003934chr921305 475 ------
NM_003939chr1073359 3269 3112 2980 2877 2673 368 22614 1351 11005 --
NM_003941chr792049 1934 1926 1896 1755 974 163 142 102 ----12401
NM_003947chr34854 475 452 163 ----11157
NM_003953chr12550 389 22779 988 32898 922 660 --
NM_003955chr1741436 1236 359 216 ------
NM_003958chr653374 3215 2757 2432 1541 --13862 2964 537
NM_003972chr103892 483 67 ------
NM_003983chr1643953 3480 3432 913 13383 21597 683 11263
NM_003986chr113305 241 101 ------
NM_003994chr12124017 3586 3503 3320 3108 3060 1721 1569 1448 1317 770 459 12954 2946 604 --
NM_004006chrX32290 736 316 ------
NM_004007chrX32290 736 316 ------
NM_004009chrX32290 736 316 ------
NM_004010chrX32290 736 316 ------
NM_004011chrX32290 736 316 ------
NM_004012chrX32290 736 316 ------
NM_004013chrX32290 736 316 ------
NM_004014chrX32290 736 316 ------
NM_004015chrX32290 736 316 ------
NM_004016chrX32204 650 230 ------
NM_004017chrX32290 736 316 ------
NM_004018chrX32204 650 230 ------
NM_004020chrX32290 736 316 ------
NM_004021chrX32204 650 230 ------
NM_004022chrX32204 650 230 ------
NM_004023chrX32204 650 230 ------
NM_004028chr1873876 3089 1105 862 734 278 133 12838 21233 1069 11435
NM_004035chr1764369 3544 1205 1057 69 25 23146 1448 33589 3572 537 --
NM_004050chr1442376 2237 1852 1006 --1910 --
NM_004060chr541110 886 373 271 21235 943 ----
NM_004073chr11305 ------
NM_004081chrY51645 1507 1173 732 446 ------
NM_004087chr351767 1461 1446 787 660 21922 351 ----
NM_004089chrX--11267 ----
NM_004093chr1343091 3079 2630 476 ------
NM_004094chr14122800 2654 2034 2027 1869 1862 1048 833 538 408 245 25 --1368 12068
NM_004100chr642581 1913 706 551 22060 991 ----
NM_004105chr22904 855 ----1355
NM_004109chr1172412 2203 2127 1513 763 657 173 22134 300 ----
NM_004113chr341823 1436 657 148 ------
NM_004117chr642089 1693 1650 407 22081 1364 --11748
NM_004124chr1463550 3170 2803 2693 1161 264 23402 3140 13514 --
NM_004136chr1543059 2162 2131 164 2852 450 --12478
NM_004161chr231594 1314 43 11613 ----
NM_004162chr341227 915 877 263 --11114 --
NM_004170chr931323 494 211 ----21888 518
NM_004171chr11149688 9427 7216 7156 7049 6872 2635 1314 1176 1163 945 664 549 121 48100 3677 3368 688 35896 2704 2162 12001
NM_004209chr1611090 ------
NM_004225chr821155 21 21525 1428 ----
NM_004229chrX31730 1681 1626 ------
NM_004232chr18113913 3837 2940 2609 2359 1547 1173 740 547 502 88 33659 3345 3311 ----
NM_004233chr631540 541 504 ------
NM_004272chr551560 1513 653 469 459 --1291 --
NM_004274chr1472467 1169 1023 846 604 440 156 13234 12757 1429
NM_004280chr61183 1295 ----
NM_004293chr963013 2980 1301 1061 1005 725 22594 207 --23345 2369
NM_004301chr3----1121 --
NM_004302chr1242902 2341 2325 1072 --12936 --
NM_004330chr152806 184 ------
NM_004331chr852361 1827 934 744 220 --11941 --
NM_004338chr1876762 6032 5617 5452 5085 2172 2008 --22814 991 --
NM_004343chr191553 ------
NM_004354chr42719 289 ------
NM_004360chr1632031 1719 1399 21742 1475 ----
NM_004370chr631540 617 517 22156 109 ----
NM_004374chr8121 ------
NM_004379chr251498 1337 1094 1081 322 1141 ----
NM_004385chr52555 240 ------
NM_004389chr22905 573 --1712 --
NM_004392chr1322689 1907 --12666 1531
NM_004393chr31503 ----12295
NM_004397chr1154297 1412 812 759 595 24135 330 ----
NM_004404chr272035 1988 1612 1508 675 614 316 ------
NM_004412chr10115669 5208 5063 4525 3844 3806 2379 1682 441 278 113 55537 4569 4321 1806 1797 13860 --
NM_004415chr6150 --1591 --
NM_004419chr10----1405 --
NM_004423chr342476 2178 822 793 11864 12055 --
NM_004426chr1241609 672 278 223 21783 1761 21713 261 --
NM_004427chr121049 1035 ------
NM_004430chr842765 2064 1975 995 --11063 --
NM_004432chr921565 740 ------
NM_004437chr153264 3100 2962 2919 2633 53627 2933 821 178 135 11364 --
NM_004438chr242836 2226 763 254 --12645 22732 2057
NM_004440chr621969 1912 41877 1314 541 534 ----
NM_004456chr7174 ------
NM_004459chr172711 162 1370 ----
NM_004481chr12975 416 ------
NM_004482chr23796 594 343 1821 ----
NM_004491chr1924376 4150 ------
NM_004496chr141233 ------
NM_004497chr191662 ------
NM_004499chr51130 ------
NM_004500chr1451964 1940 1723 1279 308 126 11671 1387
NM_004503chr12------1680
NM_004504chr242639 2042 1893 853 ------
NM_004505chr1741716 1680 634 521 1179 ----
NM_004516chr192373 233 --147 --
NM_004520chr52505 142 ------
NM_004523chr1031506 1470 22 11246 ----
NM_004540chr213695 259 90 1218 ----
NM_004571chr213987 699 657 1370 23368 3329 --
NM_004576chr51101 128 ----
NM_004586chrX75442 5364 5328 4474 4162 3876 1945 1883 ----
NM_004593chr32625 245 ----1921
NM_004598chr541142 864 787 757 12081 12782 --
NM_004606chrX2375 70 ------
NM_004612chr974775 4644 4611 4136 4094 1581 698 --13630 11888
NM_004619chr111754 --11686 --
NM_004630chr1121128 743 ------
NM_004631chr1----11030 --
NM_004650chrX51458 1391 1297 696 546 21829 1612 ----
NM_004654chrY2225 158 ------
NM_004660chrY----1749 11581
NM_004663chr1541381 1051 1009 511 ------
NM_004666chr631075 387 257 11485 ----
NM_004670chr1031409 1062 106 21442 204 ----
NM_004673chr12337 93 51561 1092 1063 393 290 11153 --
NM_004685chr1372571 2476 2435 2138 330 251 100 ------
NM_004687chr1732117 167 26 --11341 --
NM_004690chr64747 650 641 520 ------
NM_004696chr14863 206 153 124 --1191 --
NM_004719chr1222063 1042 22254 1969 --153
NM_004723chr131040 900 74 ------
NM_004725chr101456 ----1583
NM_004726chrX115724 4753 4627 4551 3482 2220 2044 1357 994 811 291 25575 3902 34432 1893 976 13755
NM_004727chr1532179 695 453 11757 ----
NM_004730chr522158 856 ------
NM_004734chr1372866 2778 2557 1273 1085 353 346 11009 12582 --
NM_004736chr112076 21583 906 ----
NM_004745chr846553 5547 4791 1990 16868 26958 6590 --
NM_004748chr1574094 3237 1663 1233 628 586 307 54077 3993 3707 3685 943 --31702 1294 1255
NM_004772chr521230 1124 1210 ----
NM_004774chr1713032 22058 889 --22834 1221
NM_004779chr521245 381 ----11145
NM_004781chr12267 131 ------
NM_004781chr12267 131 ------
NM_004791chr133756 287 247 ------
NM_004796chr1442277 2221 1963 62 2851 79 11837 --
NM_004797chr333733 3696 1339 22764 782 21244 1202 12800
NM_004798chr2051438 623 560 173 149 --22562 633 --
NM_004804chr222745 1770 ------
NM_004805chr21192 1346 ----
NM_004815chr1114902 4833 4584 4353 4347 4012 3629 3339 2987 472 348 21745 331 ----
NM_004820chr84449 408 119 77 ------
NM_004827chr461661 587 515 368 262 214 ------
NM_004837chr141602 1553 412 47 ----11082
NM_004844chr321128 825 194 ----
NM_004849chr62536 521 --1556 11480
NM_004859chr1762400 2309 2241 1149 355 288 12463 1744 --
NM_004863chr1485194 4743 3961 3575 3542 1242 687 597 2537 202 1968 --
NM_004866chr5114928 4580 4334 4047 1987 1712 1278 1129 830 706 355 13129 1584 --
NM_004879chr111962 ------
NM_004898chr422683 1126 11021 --11149
NM_004902chr203860 718 666 --2833 120 --
NM_004904chr785251 4641 4633 4234 2345 1800 419 337 25831 1358 24464 2093 --
NM_004906chr6187 ------
NM_004921chr121944 370 21006 699 ----
NM_004929chr83331 315 240 ----1528
NM_004930chr1----1615 --
NM_004949chr1851476 498 396 336 227 ----1753
NM_004956chr783142 1594 824 675 486 459 201 74 34206 3508 393 23210 3101 --
NM_004965chr211718 1785 ----
NM_004969chr101553 1176 ----
NM_004985chr1253592 1734 1692 890 849 1402 24218 1320 11145
NM_004992chrX78429 7158 5164 2300 2132 1189 879 12419 13416 13291
NM_004992chrX78429 7158 5164 2300 2132 1189 879 12419 13416 13291
NM_004999chr674525 4280 3791 3429 3219 872 502 ------
NM_005011chr741681 1425 1384 88 ----1219
NM_005023chr561537 1254 373 184 159 117 ------
NM_005036chr2278197 7746 5538 5433 2301 1468 124 58323 6289 2175 1017 221 ----
NM_005037chr31166 ------
NM_005040chr11----125 --
NM_005056chr1244457 3807 800 660 35562 4775 2141 22177 2049 --
NM_005058chrY--1196 ----
NM_005063chr1053853 3817 1527 441 300 --11195 --
NM_005065chr1495337 5271 4984 4274 4170 4115 3533 3448 2111 34659 4651 3376 ----
NM_005066chr13614 292 276 1797 159 --
NM_005079chr893117 2561 2392 2084 2067 756 590 391 87 22330 2312 ----
NM_005095chr121441 243 21600 264 ----
NM_005110chr52840 686 1618 ----
NM_005113chr144468 390 160 79 --1168 --
NM_005116chr2063456 3440 3072 2863 1152 518 13580 14253 --
NM_005119chr121282 905 1352 1396 --
NM_005121chr1712791 23350 361 ----
NM_005124chr63824 674 27 ------
NM_005126chr351887 1695 638 461 308 1403 ----
NM_005128chr211518 1162 ----
NM_005134chr183935 807 226 ------
NM_005135chr1553156 2988 1329 1266 1180 2964 374 12570 --
NM_005151chr1842378 1908 1678 683 --1838 --
NM_005154chr152601 563 2675 652 ----
NM_005156chr9125346 5153 4305 3952 3872 1342 1189 1095 1043 1003 887 85 74227 4019 1956 978 777 274 42 34784 3449 1961 11364
NM_005159chr1552236 1409 796 593 124 12183 1777 --
NM_005168chr26706 577 493 398 366 353 --1631 --
NM_005171chr1261248 966 914 418 286 254 ------
NM_005180chr1051462 1323 1095 594 106 21671 339 ----
NM_005181chr82649 216 2723 351 ----
NM_005188chr11138008 7149 6536 6015 5469 3117 2640 2576 2256 2199 1884 1759 476 11158 12299 12823
NM_005190chr631070 404 188 ------
NM_005194chr202543 501 ------
NM_005197chr1445904 2218 1237 90 --13956 --
NM_005206chr172228 204 --1170 11462
NM_005214chr21165 --138 --
NM_005224chr191243 ------
NM_005227chr1--1490 ----
NM_005229chrX2927 832 --11010 --
NM_005230chr12--1491 ----
NM_005235chr2157805 6482 5853 5805 5668 5582 5158 2546 2508 2113 1686 1558 1386 710 599 45199 5179 2563 2229 2807 47 15341
NM_005241chr311064 21281 890 ----
NM_005254chr152464 326 --154 1540
NM_005259chr2159 21271 1241 1517 --
NM_005261chr82793 65 --1650 --
NM_005271chr1021195 487 ------
NM_005277chr461858 1747 560 238 175 168 --21464 573 --
NM_005278chrX3480 418 90 ------
NM_005279chr22818 806 ------
NM_005296chrX--1234 ----
NM_005297chr221878 --1543 --
NM_005308chr102344 172 ------
NM_005313chr1541248 1157 418 127 ------
NM_005316chr11--2906 879 ----
NM_005328chr8------1532
NM_005339chr464090 4075 2870 1526 804 661 13378 ----
NM_005358chr1311209 1466 ----
NM_005359chr185821 646 541 173 71 22144 1305 --11377
NM_005378chr22824 555 ------
NM_005382chr81167 ----2426 43
NM_005385chr332708 595 73 2234 106 ----
NM_005388chr941609 1424 1391 674 ------
NM_005391chrX2305 131 ------
NM_005398chr102193 73 ------
NM_005402chr731838 1689 275 11333 11668 --
NM_005410chr5130 ----148
NM_005433chr182741 88 21803 578 --1514
NM_005436chr103725 297 226 124 14024 --
NM_005437chr103555 546 79 --11039 --
NM_005439chr123493 192 93 ------
NM_005455chr131630 1349 703 ------
NM_005458chr942415 2229 1664 766 11740 ----
NM_005465chr13774 219 39 --11689 --
NM_005475chr1263319 2928 2872 1259 708 589 --11227 --
NM_005487chr2251968 1564 1526 750 487 11722 ----
NM_005493chr62767 747 1239 ----
NM_005494chr71229 1415 ----
NM_005497chr1795984 5868 5855 2431 1980 1271 1075 660 623 32066 1676 632 15661 14760
NM_005499chr191567 ------
NM_005502chr952551 2483 2360 2137 990 21269 1218 ----
NM_005504chr12145876 5865 5503 5115 4924 4864 2599 2120 1933 1763 1606 1403 1259 366 26241 403 ----
NM_005509chr541705 1517 320 26 ------
NM_005524chr31134 ------
NM_005536chr81285 ------
NM_005537chr132917 376 1254 ----
NM_005542chr751669 1604 1428 1279 95 ----1665
NM_005570chr1831159 316 218 1209 ----
NM_005573chr53715 141 43 ------
NM_005578chr3105131 4963 3124 1455 1443 1283 1270 531 407 95 14251 ----
NM_005591chr1162031 1835 601 389 353 124 1945 ----
NM_005595chr11175 ----2808 698
NM_005596chr9126174 5760 5425 5175 5154 4491 2498 1594 1358 884 656 618 1704 36121 5703 4144 15696
NM_005599chr131513 1035 480 1360 ----
NM_005603chr1842032 1952 1938 125 ----1815
NM_005607chr82297 144 ------
NM_005614chr71217 11037 ----
NM_005627chr6------1133
NM_005637chr1842026 1337 1311 258 11528 --11683
NM_005639chr1251904 1804 1514 591 341 ------
NM_005642chr5--122 ----
NM_005647chrX51197 1038 542 442 162 11048 22477 747 --
NM_005655chr811288 1872 ----
NM_005665chr1124713 3610 3249 3114 1434 1411 1267 598 526 420 184 155 13181 14203 --
NM_005668chr583605 3579 3226 1843 1784 1443 1120 542 24267 1504 1879 1722
NM_005669chr542002 1952 403 372 ------
NM_005704chr12802 755 --11027 --
NM_005711chr53894 809 212 1337 ----
NM_005715chr672866 2762 2216 1770 1103 1041 652 ----12210
NM_005721chr251019 981 826 795 49 1220 ----
NM_005722chr242458 2237 2200 1660 --161 --
NM_005734chr111122 1520 ----
NM_005739chr1582323 2252 2192 1932 1868 341 263 24 146 1580 --
NM_005746chr782549 2333 2326 823 747 555 422 247 22090 161 ----
NM_005748chr121845 11205 ----
NM_005752chr1651108 986 258 149 59 --1923 --
NM_005754chr551233 825 266 205 96 1965 ----
NM_005759chr284679 4583 4125 3854 3798 3244 998 658 24334 2913 --14108
NM_005779chr583531 2231 1465 1258 921 702 294 39 33251 3003 2577 1767 --
NM_005785chr1261245 681 611 456 354 235 --1323 --
NM_005786chr1851053 1026 950 167 86 ------
NM_005795chr262987 2927 2823 2757 2600 2496 21961 958 ----
NM_005801chr17156 1648 ----
NM_005807chr1--2605 164 ----
NM_005808chr353015 944 512 381 289 1199 ----
NM_005822chr622279 1894 ------
NM_005826chr11592 --1622 --
NM_005839chr12969 755 ----156
NM_005840chrX127637 7542 7145 7031 6635 5342 2763 2756 2327 2095 1178 209 57338 4824 2347 1659 1167 37073 5402 2611 --
NM_005843chr231924 1829 679 --1205 --
NM_005857chr12915 562 11468 ----
NM_005859chr5--1542 11047 --
NM_005862chr31402 ------
NM_005871chr1041108 880 868 845 ------
NM_005875chr32352 27 ------
NM_005880chr1621314 366 1429 ----
NM_005882chr41731 ------
NM_005896chr23724 212 100 ------
NM_005898chr1132379 913 301 22363 2039 ----
NM_005899chr173627 444 96 ------
NM_005901chr18138587 8045 7937 7552 6286 5923 5737 5374 1351 1033 922 914 438 45290 2249 888 696 16366 --
NM_005902chr1554657 4029 3376 2925 109 1788 ----
NM_005903chr594771 4393 3872 3640 1683 968 839 401 298 24058 703 22028 1698 --
NM_005906chr621674 274 1569 1574 --
NM_005907chr641423 1073 459 133 ----1450
NM_005909chr594120 3453 3289 3232 2677 937 579 159 58 43544 3510 1331 1249 --12602
NM_005923chr63438 266 167 1459 ----
NM_005927chr53911 520 443 1972 ----
NM_005930chr143264 213 184 2164 42 ----
NM_005935chr475329 4837 4689 4257 3801 879 259 23224 375 1648 --
NM_005941chr8104134 4083 3759 3433 2976 1373 1340 1067 856 574 23352 284 ----
NM_005955chr165153 5022 4685 3858 3367 344 11794 43622 2095 1910 1813 --
NM_005962chr102459 241 11570 291 65 --
NM_005962chr102459 241 11570 291 65 --
NM_005966chr262325 1973 1955 1883 1492 205 22108 1548 ----
NM_005968chr191193 ------
NM_005977chr132950 701 --1318 --
NM_005985chr201576 ------
NM_006007chr9104246 4163 3567 3391 2773 1714 1360 423 361 310 1461 13868 --
NM_006010chr31247 ------
NM_006015chr141343 1297 988 143 --1498 --
NM_006016chr642286 1948 1674 116 ------
NM_006022chr132852 187 ------
NM_006033chr1811640 ----12336
NM_006036chr232514 458 389 ------
NM_006037chr244506 1640 1613 1200 --1447 --
NM_006047chr2073333 3319 3263 3085 2659 2149 491 23256 3052 1916 --
NM_006048chr121112 414 ------
NM_006054chr1121631 1026 11649 ----
NM_006080chr772532 2374 2251 1867 1856 1175 854 ------
NM_006085chr14976 876 514 211 1990 ----
NM_006090chr1--1174 1639 --
NM_006095chr483972 3906 3763 3014 1623 486 86 68 13343 ----
NM_006100chr32147 58 ------
NM_006106chr1182794 2786 2098 1266 1099 902 865 66 --1629 --
NM_006108chr1162257 2038 877 858 490 81 ------
NM_006136chr721336 992 11073 ----
NM_006153chr33629 444 427 ------
NM_006154chr1542933 2849 982 56 --12681 --
NM_006155chr272035 1988 1612 1508 675 614 316 ------
NM_006158chr83624 523 168 21717 1435 11462 --
NM_006160chr1721566 604 --1533 --
NM_006166chr1242364 1720 286 172 ------
NM_006195chr931019 538 512 1882 ----
NM_006196chr2164 1295 ----
NM_006197chr842032 1951 837 453 ------
NM_006203chr545576 5379 4990 1092 24133 496 24609 3811 --
NM_006204chr101224 ------
NM_006206chr462573 2447 1793 732 649 324 12066 12469 --
NM_006207chr81266 ------
NM_006218chr3------1235
NM_006224chr1782553 1909 1629 742 732 670 450 340 --22520 617 --
NM_006243chr11111 --1996 --
NM_006246chr141353 ----1372
NM_006251chr552671 2603 2094 470 125 33342 2927 858 --11025
NM_006252chr1127604 6873 5507 5055 4947 2457 2398 1726 1702 1056 607 426 67374 5968 5767 5235 495 393 ----
NM_006256chr131913 1807 673 22438 1752 ----
NM_006264chr41479 --1456 --
NM_006265chr81964 --1465 1166
NM_006267chr251418 529 315 263 68 2432 27 ----
NM_006275chr2032156 424 98 32520 1681 1009 ----
NM_006281chr8--11194 --1882
NM_006281chr8--11194 --1882
NM_006282chr2074428 4316 4065 1776 1287 1073 819 33338 3061 3012 ----
NM_006283chr8104889 4464 4026 3972 3010 1951 971 690 463 398 34647 1433 1357 11614 --
NM_006287chr231057 467 169 --11657 --
NM_006306chrX95769 4518 4385 3738 2376 1655 1401 1224 633 11497 25084 57 --
NM_006315chr444501 3903 1486 573 14541 23359 204 --
NM_006323chr42728 54 ------
NM_006328chr112663 204 ------
NM_006330chr841218 381 85 76 ------
NM_006364chr14--153 ----
NM_006379chr762258 1843 1716 1507 1457 783 ------
NM_006380chr1784209 3640 3115 2957 2896 2763 457 260 13677 14171 1889
NM_006393chr1094093 3949 3840 3217 745 570 506 209 52 21421 414 1448 --
NM_006404chr201535 ------
NM_006416chr61683 1755 1565 171
NM_006420chr2073150 2576 2351 1133 801 739 687 1112 1159 --
NM_006434chr1082424 2403 2326 2155 2013 475 289 63 22982 2952 12667 --
NM_006439chr41445 ------
NM_006449chr252159 2103 2057 2038 168 11854 ----
NM_006457chr483778 3714 3678 3422 3158 3033 2853 323 1971 1252 --
NM_006459chr1041965 1682 1439 199 ----11464
NM_006479chr122920 740 2901 408 ----
NM_006482chr1243762 3256 1453 465 23925 1373 --22678 1417
NM_006489chr1431695 1592 1392 ------
NM_006495chr172187 96 ------
NM_006496chr121999 426 2257 125 11581 1446
NM_006504chr1062974 2776 2354 2297 1140 101 42983 311 279 158 ----
NM_006517chrX32149 567 399 22296 885 1133 --
NM_006520chrX31267 641 578 1590 --1270
NM_006526chr2031627 1536 257 11763 11707 --
NM_006534chr2072667 2527 2249 1379 1221 939 342 --11214 --
NM_006537chr151234 2479 85 1104 --
NM_006538chr263120 2897 863 758 365 191 23907 708 14176 --
NM_006540chr881483 1233 630 417 264 229 199 63 2976 298 ----
NM_006544chr1475708 5321 5189 4550 3918 1742 1692 55877 5263 5101 1772 253 ----
NM_006546chr17156532 6215 6055 5883 5777 5369 4770 4577 2445 2009 1842 971 745 330 170 16160 1416 16671
NM_006547chr711605 2751 290 ----
NM_006557chr951599 1537 1121 412 292 --1429 --
NM_006561chr1094998 4755 4263 2208 2077 1622 1517 1396 501 2926 893 35234 5213 1873 --
NM_006572chr1763465 2992 2852 2841 2545 2310 22468 133 12491 1104
NM_006575chr1441402 988 483 264 ------
NM_006577chr23876 147 80 1499 ----
NM_006595chr1162061 1696 1600 1348 385 322 1687 1275 1486
NM_006599chr16147810 7177 7139 7052 6703 6468 6308 3199 2960 2374 1135 951 827 505 68164 7951 7695 5354 5057 2703 23265 291 --
NM_006601chr1241134 816 313 194 ------
NM_006603chrX3577 315 196 ----1680
NM_006609chr262921 2282 1925 1825 593 190 --12505 --
NM_006618chr141621 1473 1149 279 172 ----
NM_006620chr644519 4455 3154 1926 14715 --1800
NM_006621chr12478 347 1117 1783 --
NM_006624chr1031458 675 155 ------
NM_006626chr962490 2424 1788 1662 834 321 21033 225 198 --
NM_006628chr15134694 4300 4216 4121 3599 3497 3284 3190 2968 1661 1286 913 368 43463 904 769 36 1874 --
NM_006629chr1832404 638 186 1809 ----
NM_006633chr52726 695 ------
NM_006646chr1353011 2335 2297 2220 1866 1585 1786 --
NM_006654chr1253946 3125 1449 1124 904 1190 32952 1490 764 1720
NM_006693chr71843 ------
NM_006699chr141888 778 633 617 31781 918 670 ----
NM_006704chr132449 290 ------
NM_006706chr53616 237 55 1230 ----
NM_006713chr5149 ----1248
NM_006717chr972466 1198 929 765 753 678 494 12619 22965 119 --
NM_006720chr1064046 4021 3249 1225 1073 207 1399 14483 13964
NM_006721chr104759 537 183 166 1125 ----
NM_006722chr322984 676 --22453 2410 11127
NM_006727chr51108 ----1481
NM_006729chrX165631 4913 4654 4570 4531 4461 4395 4333 3814 3600 1905 1863 1703 1404 1355 187 21687 342 13522 23515 1060
NM_006731chr9215849 5669 5320 4818 4658 4302 4275 3952 3720 2024 1644 1194 1099 1046 923 908 851 711 645 273 27 75611 4730 4107 3729 1507 1427 549 14155 14150
NM_006734chr631525 1353 341 --11108 --
NM_006750chr16157684 6048 5728 5398 5011 4982 4929 3150 2280 2024 1986 764 576 405 174 67882 6921 6088 5255 2318 1439 12347 --
NM_006754chr731280 1133 969 ------
NM_006756chr81614 11487 11312 --
NM_006761chr171197 ------
NM_006766chr842415 2261 695 276 2807 789 1211 --
NM_006775chr642876 2507 719 402 11948 ----
NM_006777chrX61791 1001 576 508 391 293 --32869 2588 720 --
NM_006801chr193686 474 229 ------
NM_006810chr3167 ------
NM_006815chr124990 460 396 202 ------
NM_006818chr13641 380 86 1741 1790 --
NM_006825chr12----295 41 --
NM_006826chr23398 368 299 ----11234
NM_006827chr1422810 130 22186 889 1442 --
NM_006828chr62512 258 ------
NM_006832chr142958 172 --1803 --
NM_006851chr1262052 1969 1158 958 749 150 --1884 --
NM_006852chr1752523 2145 2011 851 821 1565 11993 --
NM_006857chr2--3588 131 99 --1655
NM_006873chr252314 1244 1127 207 163 ----13292
NM_006874chr41383 1364 ----
NM_006885chr1644082 3473 1124 431 21534 1199 12807 2705 65
NM_006888chr1463423 3168 3027 2753 414 53 --21352 1307 12170
NM_006898chr22818 272 ------
NM_006915chrX42174 1606 411 330 --11774 --
NM_006916chr241178 1093 202 38 ------
NM_006920chr221645 121 31255 746 631 ----
NM_006922chr232569 777 658 11998 --12296
NM_006924chr1753836 3753 3047 1219 958 54129 3663 3147 2701 982 34404 1728 66 --
NM_006930chr511907 1466 ----
NM_006937chr173504 463 79 ------
NM_006940chr122540 418 ------
NM_006947chr441552 1419 429 122 ------
NM_006948chr2182190 2132 1870 1826 1813 588 86 45 11589 11900 --
NM_006951chr101188 ------
NM_006954chr1043046 2309 1011 227 ------
NM_006962chrX2174 53 ------
NM_006963chr1031170 945 71 1911 ----
NM_006974chr1043046 2309 1011 227 ------
NM_006981chr952550 1111 1092 613 510 ------
NM_006997chr101177 ------
NM_006999chr531796 1537 529 1457 ----
NM_007005chr931223 259 203 11331 ----
NM_007007chr1284701 4401 3100 2974 1531 773 578 41 24051 3783 ----
NM_007008chr2------1743
NM_007010chr1721467 173 ------
NM_007011chr15116734 6268 6006 5985 5357 5295 5155 4748 2412 1854 1117 --1979 --
NM_007013chr8------1848
NM_007017chr51684 ------
NM_007023chr2----147 --
NM_007034chr13881 836 324 ------
NM_007038chr21135845 5800 5427 4478 4327 4313 4286 4226 4028 3766 1553 1232 886 65905 3999 2351 769 669 607 13812 --
NM_007050chr20178002 7756 7478 7281 6720 6562 6068 5619 2527 2149 2005 1782 1707 1312 991 513 327 45016 3070 1650 929 --11698
NM_007052chrX3579 379 25 ------
NM_007054chr563995 3084 1008 893 586 61 2351 95 23699 2704 --
NM_007067chr1721216 530 ------
NM_007068chr221996 21011 141 166 174
NM_007096chr91271 ------
NM_007106chr1382781 2173 1982 1852 1114 837 358 98 --1256 --
NM_007114chr343190 2475 2326 424 21022 441 12368 --
NM_007124chr631989 1657 809 1589 ----
NM_007125chrY2404 51 ------
NM_007145chr1921419 1255 ------
NM_007146chr1721094 146 1546 ----
NM_007150chrX42019 762 707 498 11894 ----
NM_007156chrX2220 52 ------
NM_007157chrX102164 2113 1999 1979 1902 1010 847 742 220 52 11882 1476 1450
NM_007159chr321706 225 ------
NM_007166chr112564 97 ------
NM_007172chr2231206 310 232 13277 --12730
NM_007173chr1141710 1504 296 131 ------
NM_007192chr1421142 151 ------
NM_007195chr1843338 2504 1073 511 32422 2309 1192 ----
NM_007203chr963776 3743 1558 1422 652 259 ------
NM_007212chr172040 1560 1488 1450 643 148 110 1673 ----
NM_007214chr651258 448 341 302 45 ------
NM_007222chr821727 242 1297 176 1563
NM_007231chrX62119 765 395 321 247 166 21684 827 1720 --
NM_007246chr43789 413 251 21026 112 ----
NM_007249chr13209196 8969 8897 8527 7546 7389 6462 6120 2501 2132 1944 1849 1143 1064 722 639 470 443 393 40 37895 6315 1900 12077 --
NM_007269chr11559 ------
NM_007271chr661702 1638 1454 1304 254 124 ----1473
NM_007275chr31793 ----11188
NM_007287chr32671 241 --1684 13210
NM_007288chr32671 241 --1684 13210
NM_007289chr32671 241 --1684 13210
NM_007292chr1764369 3544 1205 1057 69 25 23146 1448 33589 3572 537 --
NM_007325chrX31973 1365 220 31652 857 304 ----
NM_007345chr1862212 2088 2070 722 536 73 --1258 --
NM_007347chr1521167 574 41092 617 408 363 12290 --
NM_007349chr71181 ------
NM_007350chr1264093 3840 1260 1056 1037 425 13471 199 --
NM_007358chr11297 1227 ----
NM_007361chr142636 550 --1176 --
NM_007363chrX4793 409 299 234 --2902 425 --
NM_007373chr1031380 665 235 21398 1211 ----
NM_007375chr142776 1761 532 427 12612 ----
NM_012062chr122808 336 172 ----
NM_012069chrX102731 2560 2499 2458 2314 2124 1885 339 270 223 ------
NM_012081chr533564 2564 758 ----13747
NM_012082chr84940 808 693 639 1147 ----
NM_012084chrX1476 ------
NM_012090chr1--1807 ----
NM_012092chr231878 613 136 ------
NM_012095chr1073544 3367 3268 2258 1002 991 690 ----11288
NM_012096chr332707 1136 964 32682 975 574 23421 3139 --
NM_012097chr222309 1820 31741 1523 165 ----
NM_012108chr41410 ----1159
NM_012111chr14----1179 --
NM_012120chr642923 2338 2160 364 32818 2274 670 12997 --
NM_012124chr112662 79 1703 ----
NM_012129chr732110 2024 463 21926 353 2787 340 --
NM_012137chr172904 2714 2504 2104 1981 985 88 ----12921
NM_012141chr1373899 3246 3185 3007 2599 683 253 11403 1285 11192
NM_012154chr84732 341 292 279 ------
NM_012161chr441148 999 445 237 2751 145 ----
NM_012164chr9137549 7325 6852 6322 6250 6189 6080 5997 2759 2269 2067 1165 333 47542 5618 1973 1644 16123 --
NM_012175chr111211 1610 ----
NM_012177chr63223 180 92 ------
NM_012193chr11135389 5240 5124 4992 4738 4726 3989 3481 2016 1345 957 588 445 45320 3552 696 93 --13778
NM_012207chr10172 ------
NM_012214chr2136156 4880 4504 4447 4044 3900 2386 2126 2000 1581 898 786 151 35312 4618 2029 14298 --
NM_012223chr22147 53 11325 ----
NM_012234chr3103512 3124 3038 1375 1017 632 300 167 132 90 1735 12911 13395
NM_012238chr1021494 401 2651 553 ----
NM_012243chr14750 335 60 49 1357 ----
NM_012248chr164713 476 158 84 ------
NM_012249chr253350 2261 1282 819 204 13388 1242 --
NM_012252chr7105330 5184 5123 4357 4211 3537 1815 1753 896 417 25097 5034 2695 373 --
NM_012259chr621213 1052 ------
NM_012262chr184806 3329 1501 1129 1031 602 107 75 34898 4715 3990 11283 1307
NM_012281chr722361 570 2508 55 --1145
NM_012286chrX1656 ------
NM_012287chr393585 3168 2989 2766 1400 953 868 252 70 24572 3888 13966 22861 1299
NM_012288chr644042 533 379 214 25560 1043 24796 4233 --
NM_012290chr231276 553 478 ------
NM_012294chr774056 3690 2701 2673 760 732 480 33456 2693 1205 ----
NM_012297chr462252 2139 922 406 388 319 1540 --1173
NM_012300chr532506 1018 1000 11859 1604 --
NM_012301chr732243 2187 843 11757 21681 1374 --
NM_012307chr182959 190 2784 120 1396 --
NM_012308chr1192420 2149 1858 1807 1780 1770 674 545 36 ------
NM_012309chr11134660 4584 4475 3641 3611 3572 3509 3385 3220 1673 1665 1436 324 14507 23814 1945 --
NM_012316chr155128 2229 1853 533 323 15097 34167 3791 2204 21524 1198
NM_012328chr731208 114 68 ------
NM_012329chr1721252 645 ------
NM_012333chr151550 669 599 464 72 ------
NM_012334chr594699 4161 3295 3272 1540 1231 1106 687 204 21503 719 --13767
NM_012343chr54935 742 733 182 ------
NM_012382chr584482 3705 3387 2882 1175 971 520 254 ----11092
NM_012395chr763450 2898 1128 930 283 183 --13101 --
NM_012399chr2241488 746 566 514 1780 21964 305 --
NM_012412chr71848 1345 ----
NM_012413chr22451 72 ------
NM_012416chr941168 1077 891 381 ------
NM_012419chr62477 456 ------
NM_012420chr1041566 486 307 170 21661 703 ----
NM_012421chr11466 ------
NM_012465chr1032743 2230 361 12091 12866 --
NM_012482chr11439 ------
NM_013229chr1222206 189 12591 2792 637 1453
NM_013230chrY31571 1469 1218 ------
NM_013231chr1453536 3335 1630 1239 765 1234 13259 11480
NM_013233chr231382 1209 302 11394 ----
NM_013236chr221123 --2458 290 1814
NM_013252chr752303 2145 1852 834 483 --12646 --
NM_013254chr123724 717 467 1546 ----
NM_013255chr7148696 8674 8598 8122 6917 6615 6243 5691 3086 2701 2375 1810 1613 855 38099 6276 2112 18653 23555 3287
NM_013257chr822165 232 ----1356
NM_013261chr483261 3168 2759 2598 2299 1383 276 97 23093 929 ----
NM_013269chr12124506 4405 4136 3388 3184 1377 1352 1333 1297 1175 937 27 44554 4497 3445 2830 ----
NM_013280chr112545 180 ------
NM_013281chr2031308 1147 1103 1176 ----
NM_013309chr1562429 925 896 670 415 159 42441 2112 658 627 1124 --
NM_013313chr2273225 3065 2262 2194 1006 831 803 2873 522 ----
NM_013316chr75900 813 358 332 124 11063 --1282
NM_013336chr33355 160 114 ------
NM_013341chr252559 790 288 112 69 11946 ----
NM_013354chr831325 1150 936 ------
NM_013357chr81818 1613 ----
NM_013372chr15102939 2897 2699 2277 2237 2211 2138 846 522 358 13304 22175 209 --
NM_013374chr372770 2594 2503 2361 1115 413 130 32678 548 453 12460 --
NM_013377chr12----1602 --
NM_013381chr1262412 2031 966 850 520 322 11527 --12184
NM_013386chr181303 1290 693 560 429 384 335 256 11623 148 --
NM_013396chr2121190 327 --1541 --
NM_013400chr711001 ------
NM_013436chr22296 112 ----1697
NM_013438chr921808 1781 1617 ----
NM_013444chrX4925 745 430 60 1757 ----
NM_013448chr141132 ------
NM_013449chr1242386 2088 2001 652 12034 11183 12555
NM_013450chr24871 826 503 459 --11011 --
NM_013943chr173210 2866 2772 2749 2464 1100 511 33158 2991 1203 13014 --
NM_013989chr14115121 4178 1641 1483 1420 1118 656 643 615 559 138 12011 34073 4050 1092 13664
NM_013995chrX3682 333 21 1671 1713 --
NM_014011chr252635 2451 1989 773 501 21002 629 ----
NM_014021chr143157 2976 2480 850 32273 2152 157 11118 --
NM_014023chr1032417 2048 521 22539 2481 1653 --
NM_014034chr641051 524 342 230 11485 11065 --
NM_014043chr33333 311 158 21646 581 ----
NM_014048chr1675291 4992 4538 4251 3790 361 189 14712 24366 4117 --
NM_014055chr122377 350 158 ----
NM_014071chr20159 --2382 87 --
NM_014089chr1321624 394 11652 ----
NM_014106chr1512085 31091 906 597 1790 --
NM_014112chr845311 3730 1028 520 23830 874 15464 --
NM_014117chr1632125 1989 1727 22032 1080 1549 --
NM_014141chr784977 3630 1387 1292 1284 996 948 572 25228 4996 13882 --
NM_014154chr341567 1522 421 335 ------
NM_014155chr11107426 7386 6499 6357 5849 5815 5627 5522 5093 401 12478 ----
NM_014170chr3--181 ----
NM_014181chr262649 2513 2242 947 712 666 12359 ----
NM_014212chr122823 625 1996 ----
NM_014217chr151687 1575 1354 562 413 ------
NM_014240chr374174 4040 3604 3562 2757 1154 988 24062 858 --13323
NM_014250chr2251968 1564 1526 750 487 11722 ----
NM_014253chrX3810 740 282 ------
NM_014263chr101420 11304 21516 453 --
NM_014267chr111658 ------
NM_014278chr41467 ------
NM_014282chr9--1235 ----
NM_014283chr151544 1364 962 521 59 --1164 --
NM_014294chr82345 96 --1329 --
NM_014296chr331626 110 70 ------
NM_014309chr2254882 4860 2075 1245 188 --15178 1741
NM_014319chr1261946 1638 1266 671 449 362 ------
NM_014322chr12989 829 ------
NM_014325chr1231916 826 169 ----11777
NM_014331chr4196730 6167 6157 6079 6069 5939 5852 5036 4904 2501 2440 2421 2206 1217 1185 517 239 158 28 47129 5018 1998 1507 ----
NM_014333chr1122057 393 1766 1374 --
NM_014335chr1521186 1053 ------
NM_014344chr112694 605 ------
NM_014345chr62875 265 21088 964 1424 --
NM_014363chr13----1848 --
NM_014372chr142080 1733 1626 659 ------
NM_014374chr711001 ------
NM_014380chrX1237 ------
NM_014393chr832324 1948 428 ------
NM_014400chr19121 ------
NM_014415chr341712 1504 1467 1177 ------
NM_014421chr431938 1504 1385 11748 --11690
NM_014423chr585556 5202 4959 4705 2234 1547 1131 556 65262 4015 1994 1430 1221 546 --15307
NM_014456chr102754 21 3761 724 703 ----
NM_014458chr121230 907 21158 501 ----
NM_014461chr31170 ------
NM_014470chr122785 83 ------
NM_014494chr1621614 622 ----11801
NM_014495chr13259 243 70 1460 ----
NM_014498chr31259 ------
NM_014522chrX1199 ------
NM_014547chr152247 211 1278 1324 --
NM_014547chr152247 211 1278 1324 --
NM_014548chr1521122 498 --1470 --
NM_014554chr1231527 485 345 1917 --11812
NM_014572chr1321811 420 11212 ----
NM_014584chr1431115 299 87 2491 59 ----
NM_014585chr241261 1248 792 176 11287 --1287
NM_014606chr441470 1390 1073 330 ------
NM_014607chr252138 2075 1961 1727 474 21529 490 12087 --
NM_014615chr1653652 3626 2884 2361 285 33140 3121 2945 23280 2616 1439
NM_014616chr373056 3027 2299 843 289 106 97 21110 343 ----
NM_014629chr82504 236 1482 ----
NM_014636chr974279 3981 3969 3897 2834 1432 1105 13711 14046 --
NM_014669chr161145 ------
NM_014674chr3123894 3778 3366 3147 2920 1233 781 715 551 326 122 72 11595 ----
NM_014676chr111482 21229 1123 ----
NM_014677chr831163 946 255 2973 275 ----
NM_014678chr22----178 --
NM_014679chr114411 230 65 36 31407 911 399 ----
NM_014682chr822002 114 ------
NM_014683chr175714 585 574 547 541 22071 1827 ----
NM_014689chr22517 57 ------
NM_014699chr163362 326 63 ------
NM_014700chr1611368 ------
NM_014701chr1533387 3301 2126 1282 --13039
NM_014705chr721630 692 32163 301 209 ----
NM_014707chr782284 2222 1639 1421 874 351 344 146 12151 --11899
NM_014711chr1631666 1507 1405 --1705 --
NM_014717chr191170 1578 ----
NM_014719chr751147 1123 1078 408 320 186 1294 --
NM_014721chr6116245 5761 4856 2989 2967 2200 2169 2066 1528 1298 870 --14705 16554
NM_014729chr81903 12106 ----
NM_014730chr12145305 4554 4430 4313 4195 4153 3897 3414 1454 1433 1059 935 807 790 44843 4044 3478 1620 ----
NM_014730chr12145305 4554 4430 4313 4195 4153 3897 3414 1454 1433 1059 935 807 790 44843 4044 3478 1620 ----
NM_014733chr572053 1883 1707 1639 1586 1440 744 12294 ----
NM_014739chr654042 3874 3344 3180 2845 34202 3792 1247 13420 --
NM_014743chr432739 927 77 1526 12707 1981
NM_014746chr254097 3176 2877 1407 924 14316 1237 11529
NM_014751chr861913 845 672 489 213 182 21505 236 11730 --
NM_014755chr264262 4220 3533 2829 1235 750 2856 420 ----
NM_014757chr542354 2125 1726 435 11702 ----
NM_014761chr16187 1942 167 --
NM_014764chr122397 272 21145 1056 1525 --
NM_014765chr152645 2342 678 560 488 22203 29 ----
NM_014774chr133289 3184 2536 ------
NM_014776chr124826 465 446 164 --1540 154
NM_014779chr331055 1017 42 ------
NM_014781chr821200 867 ------
NM_014782chrX--137 ----
NM_014783chr1541649 671 234 208 21507 709 1453 1303
NM_014787chr142758 2384 698 141 22638 1988 ----
NM_014791chr91316 ------
NM_014795chr271392 1384 1342 1235 1168 550 537 --1501 --
NM_014803chr1042978 2649 1918 294 ------
NM_014810chr1133718 3606 3566 3096 3014 2760 2595 2369 2259 1427 1256 778 432 ------
NM_014819chr511523 21615 63 ----
NM_014822chr44690 627 206 46 ------
NM_014824chr1161806 1730 1690 1526 1361 61 11408 ----
NM_014826chr133845 3698 3430 34008 2684 363 23654 1065 --
NM_014835chr20----1565 --
NM_014836chr1041857 555 525 45 11724 1725 --
NM_014839chr121976 839 2164 88 21781 1654 --
NM_014841chr6------11323
NM_014848chr1552462 1927 901 731 36 32665 2262 1745 1842 --
NM_014862chr1541313 1269 315 300 14205 --13997
NM_014864chr194359 3618 3572 2683 1575 1239 968 822 267 42739 1690 1642 1203 23939 407 --
NM_014870chr154266 3908 1787 1079 828 24477 1041 --1132
NM_014872chr972292 2067 1564 907 354 326 50 11598 ----
NM_014873chr194311 3532 3314 2961 1752 1581 525 502 338 11266 21281 1183 --
NM_014877chr17117471 5967 5929 5694 5486 4807 2220 2125 2015 599 39 25419 3013 25734 1437 --
NM_014883chr432212 858 810 22391 1793 ----
NM_014887chr131729 ------
NM_014893chrY22293 81 --22119 194 --
NM_014897chr1723059 228 1293 12309 --
NM_014899chr553013 2981 2573 2269 602 ------
NM_014901chr5----2853 745 --
NM_014902chr201152 ------
NM_014903chr1242159 2107 885 590 ------
NM_014904chr1054011 3623 3327 1334 282 1770 21454 589 --
NM_014905chr251997 1549 364 311 161 --1191 --
NM_014906chr17104140 4006 3983 2761 2741 1632 1529 779 171 140 1368 ----
NM_014912chr1023018 2201 --11321 --
NM_014917chr13780 763 194 ------
NM_014920chr683814 3532 1477 1406 1089 1017 415 24 43604 1441 712 480 13546 21317 1229
NM_014923chr13102317 1995 1983 1688 1515 1504 1466 452 298 200 22124 773 ----
NM_014924chr1493219 3112 3060 2771 2306 2190 1097 516 508 12358 ----
NM_014932chr321729 1541 21972 193 --11218
NM_014934chr1363587 3110 2976 1475 1251 1075 ------
NM_014936chr641854 1772 426 416 42324 1044 954 880 ----
NM_014937chr1021328 1077 ------
NM_014947chr142395 2313 1150 537 12845 1976 12334
NM_014950chr1431773 1426 54 --2632 41 --
NM_014951chr1032457 1677 291 1170 2549 282 1248
NM_014959chr19112942 2739 2349 2322 1345 1331 1270 1179 977 895 476 23067 2778 --12466
NM_014962chr2072669 2564 2435 935 442 338 136 1695 ----
NM_014964chr1721703 560 ------
NM_014970chr1--2321 29 ----
NM_014978chr1021415 1249 ------
NM_014982chr1494782 4558 4189 3304 2106 2074 1322 943 359 43864 1680 774 344 ----
NM_014988chr452371 2219 812 425 110 ------
NM_014992chr146725 675 619 584 559 99 ------
NM_015000chr1232988 2911 2690 22212 428 32586 2248 526 --
NM_015002chr122412 216 ------
NM_015008chr353330 519 306 284 209 21386 254 12966 --
NM_015009chr3--1285 ----
NM_015020chr1673552 3442 2907 2822 2586 2543 715 13691 1930 --
NM_015026chr1273938 3799 3723 3335 3207 1645 1023 11477 ----
NM_015027chr1621546 669 31572 1438 276 ----
NM_015032chr13112918 2650 2632 2365 1962 1816 822 561 433 401 47 22582 2149 ----
NM_015035chr2096675 6550 6239 4457 2508 1958 860 580 35 14174 24854 1386 --
NM_015039chr194326 4222 3997 3849 3461 2859 1426 1261 203 --11642 --
NM_015040chr272763 2340 2293 2153 993 965 467 33418 2613 2515 ----
NM_015042chr1563649 3562 3223 2976 2872 1152 33424 1289 540 11358 --
NM_015046chr962618 1802 743 584 349 248 ------
NM_015049chr232559 2488 458 12789 12652 --
NM_015052chr71443 ------
NM_015054chr12----1186 --
NM_015055chr1132890 2212 2173 12694 ----
NM_015057chr13------1579
NM_015064chr1222835 607 --11095 1844
NM_015071chr576446 6339 5104 4232 1932 1275 617 25442 916 1563 --
NM_015076chr664187 2799 1796 1213 1049 762 11693 1820 --
NM_015087chr1312468 ------
NM_015091chr142302 246 ------
NM_015092chr16114466 4358 4198 3940 3799 3764 3489 1321 1045 690 138 21502 553 13473 24704 2928
NM_015097chr342147 1539 381 172 12157 ----
NM_015110chr982335 2310 1963 1754 1706 893 879 204 42455 1926 1864 859 ----
NM_015115chr433025 2314 2286 --12807 --
NM_015116chr1341665 1320 1270 596 11375 ----
NM_015124chr2212291 ------
NM_015132chr73716 663 100 1779 ----
NM_015138chr1531068 663 344 ----12469
NM_015141chr342478 2459 2032 291 1104 150 1327
NM_015143chr41352 11236 ----
NM_015144chr1692687 1544 1395 1307 1249 762 527 475 95 11258 ----
NM_015153chr63787 739 548 ------
NM_015161chr1641583 1190 604 417 ------
NM_015170chr832133 2114 1788 1637 --11763
NM_015172chr121258 148 11022 ----
NM_015185chrX62605 1935 1063 876 653 370 ------
NM_015186chr91477 ------
NM_015192chr2053042 2968 2624 1980 1100 ------
NM_015199chr382954 2702 2267 1099 856 698 692 192 12007 12040 --
NM_015200chr452161 971 903 621 345 ------
NM_015202chr1631694 1646 1170 ------
NM_015206chr1593003 2835 2718 2465 1519 1493 799 86 65 11277 ----
NM_015208chr1873073 2562 1467 840 549 445 348 12784 11209 --
NM_015215chr163209 2787 2318 590 522 478 22841 2740 1254 --
NM_015216chr531157 1068 557 11170 ----
NM_015225chr963016 1931 1035 889 551 126 ----12254
NM_015230chr441590 1433 1362 1211 21637 319 153 --
NM_015231chr112881 384 1740 1196 --
NM_015233chr1312228 2400 285 ----
NM_015245chr672660 2607 2540 2432 2057 913 290 --1347 --
NM_015247chr1663785 2081 1929 1294 536 307 13826 24780 876 --
NM_015250chr9--11469 11919 --
NM_015265chr222125 856 22323 793 12495 --
NM_015269chr11644 1441 ----
NM_015271chr4103431 3358 3330 3067 2857 1506 1196 718 607 445 14322 2172 148 --
NM_015272chr1641663 1638 511 96 1363 ----
NM_015278chr653476 3007 2337 1319 303 22327 1191 11342 --
NM_015282chr2102676 2215 2161 2096 1949 1224 1077 982 543 203 1161 22169 650 --
NM_015286chr1562336 773 450 279 206 101 1867 1146 --
NM_015291chr193082 2877 2169 2139 1026 964 866 207 140 --12835 1520
NM_015308chr113607 274 117 ------
NM_015310chr8125119 5074 3324 2865 2849 2142 1998 1461 1147 809 449 300 58436 5782 5411 3160 2433 27567 1193 --
NM_015314chr761858 981 918 537 296 225 22296 1813 ----
NM_015317chr272600 2574 2414 1063 384 98 92 --22515 1940 --
NM_015319chr121479 ------
NM_015323chr631686 1190 704 21104 164 11391 --
NM_015335chr1262492 2428 2204 1819 445 378 12118 ----
NM_015349chr622729 236 3778 726 152 ----
NM_015358chr2161288 981 915 837 343 115 ------
NM_015361chr2----1899 --
NM_015365chrX43203 1254 924 759 ------
NM_015367chr2211661 2549 229 ----
NM_015382chr142769 316 ------
NM_015385chr1082424 2403 2326 2155 2013 475 289 63 22982 2952 12667 --
NM_015393chr42632 492 23148 653 --1101
NM_015396chr351326 1275 441 283 187 21195 149 ----
NM_015423chr1111155 21535 236 ----
NM_015429chr33945 414 112 ----11091
NM_015435chr831433 1323 1176 1491 ----
NM_015436chr463089 2384 2364 2264 1249 1030 ------
NM_015442chr3--1195 ----
NM_015443chr1721168 60 ------
NM_015446chr141525 560 368 180 11314 ----
NM_015455chr564007 3864 2582 1653 853 122 13112 12799 --
NM_015458chr895307 5133 5052 4495 3488 3338 1559 1310 365 14748 ----
NM_015460chr351602 1530 526 455 373 ------
NM_015462chr172289 223 ------
NM_015464chr74932 826 416 219 ------
NM_015477chr153812 772 321 ------
NM_015484chr13299 234 48 1842 ----
NM_015485chr1191 ------
NM_015496chr82237 78 ------
NM_015509chr1241247 556 342 64 --21536 120 1411
NM_015520chr331917 1796 58 1848 22615 1023 11772
NM_015525chr64785 262 174 125 ------
NM_015530chr2--180 ----
NM_015534chr11883 ------
NM_015541chr32304 268 11279 135 --
NM_015542chr1051014 1005 501 246 232 --11221 --
NM_015548chr62834 724 ------
NM_015550chr783507 3390 3315 3124 2470 2385 1188 767 --12605 1173
NM_015553chr644623 4457 4420 1194 24977 3374 24474 3603 --
NM_015554chr152554 516 ------
NM_015564chr5103214 3192 2951 2419 1411 1182 934 906 479 333 21260 512 1486 --
NM_015567chr1331194 892 268 --1165 11286
NM_015569chr194660 4375 3870 3605 1874 1490 1025 945 778 24784 3650 11199 --
NM_015570chr711802 ----11298
NM_015571chr682567 2034 1990 1017 828 793 193 140 22640 743 ----
NM_015576chr352599 2332 2125 708 634 ----12518
NM_015577chr541336 1190 1166 452 ----11567
NM_015578chr1941970 247 69 34 1155 --11706
NM_015599chr6--2318 212 --1218
NM_015605chr1071563 1464 1308 1301 1292 1039 136 11476 ----
NM_015630chr21954 ------
NM_015633chr1221060 352 2861 409 --1954
NM_015640chr195232 4447 4218 3991 3615 3560 1185 612 568 34031 3586 1594 --11499
NM_015641chr72159 72 1274 ----
NM_015660chr7159 1264 ----
NM_015670chr17----1139 --
NM_015675chr192647 546 ------
NM_015704chr221126 ------
NM_015855chr113801 676 633 1295 ----
NM_015866chr141309 1108 969 508 ------
NM_015869chr31166 ------
NM_015878chr862040 1558 1541 1396 898 804 22098 1614 --190
NM_015879chr18126786 6704 6108 5879 5384 5318 2536 2305 2295 2225 2190 1749 25249 1554 15729 15763
NM_015886chr8125358 5235 4986 4974 4252 4139 3714 2140 2069 1526 1275 107 2683 595 1194 14765
NM_015888chr162697 2351 1316 1162 431 395 3646 369 280 22296 1190 --
NM_015891chr642043 784 560 491 21713 157 ----
NM_015892chr1041902 576 155 66 ------
NM_015902chr8--1379 --1721
NM_015906chr184407 3768 3657 3543 1887 1166 879 826 24292 3411 --14298
NM_015912chr832003 429 342 ------
NM_015913chr11552 ------
NM_015941chr82134 101 ------
NM_015946chr52714 195 --129 --
NM_015949chr7--1965 ----
NM_015952chr6--1165 ----
NM_015955chr21457 1167 ----
NM_015957chr113350 273 143 ------
NM_015960chr102385 54 --1111 --
NM_015984chr12580 532 ------
NM_015986chr1741042 930 530 198 1583 ----
NM_016002chr12704 304 1169 ----
NM_016009chr194908 4124 3807 1932 1556 1544 1376 960 752 23862 3278 ----
NM_016018chr842877 2480 2248 1103 22759 577 ----
NM_016021chr652682 2495 2210 708 67 32642 2618 2175 ----
NM_016032chrX1175 ------
NM_016040chr142246 2051 462 335 12300 ----
NM_016072chr1241987 1895 1479 499 31947 696 567 11505 --
NM_016073chr151417 1212 ----
NM_016075chr1373010 2936 2814 2794 2611 138 128 12686 ----
NM_016076chr1133158 3095 3074 2838 2414 2383 2355 2193 1282 1225 371 342 306 22241 1074 ----
NM_016083chr663751 3290 3194 1225 1012 883 31265 907 247 ----
NM_016087chr751687 1639 1332 588 277 1451 ----
NM_016090chr113961 372 334 1930 ----
NM_016104chr6--1165 ----
NM_016118chr721161 734 ------
NM_016120chrX1280 ------
NM_016121chr131104 966 359 165 ----
NM_016122chr121436 ------
NM_016127chr81278 1732 --1763
NM_016131chr272369 2268 2208 2197 1785 419 360 ------
NM_016132chr1552622 2367 2314 940 47 1174 21382 1341 --
NM_016133chr261620 1427 1063 1038 383 174 ----11500
NM_016152chr321285 200 1898 ----
NM_016156chr1162141 2108 2046 1788 216 131 2956 855 ----
NM_016179chr131206 ------
NM_016200chr74769 743 640 34 ------
NM_016201chr331485 821 390 --11916 --
NM_016205chr421348 959 193 ----
NM_016206chr3198655 8150 8013 7341 7170 6855 6540 6363 5927 5772 5555 5450 3062 2604 1591 1343 1313 1207 1009 1671 27450 5581 --
NM_016217chr673267 2761 2721 852 252 181 90 43148 2782 2583 1291 12884 --
NM_016227chr151544 1364 962 521 59 --1164 --
NM_016231chr171176 ----11649
NM_016235chr16131 ------
NM_016248chr1361424 1148 887 568 465 184 13923 13246 --
NM_016252chr21753 ------
NM_016255chr653342 2284 2158 1086 324 22533 1027 ----
NM_016257chr133274 2327 1409 11341 --13018
NM_016258chr1--2146 97 ----
NM_016260chr2137234 6524 6474 6456 5769 4946 4607 2324 2267 2249 1168 832 467 87548 6430 5733 4727 3039 2899 1539 1471 ----
NM_016269chr41146 ------
NM_016271chr1832115 2086 657 22266 685 ----
NM_016275chr352115 842 769 684 354 ------
NM_016287chr152060 1782 1423 328 212 3573 486 44 32044 1343 628 1780
NM_016289chr272310 1787 1770 1764 1702 365 101 ------
NM_016297chr273531 2469 1467 1094 1013 559 205 31272 757 616 --1306
NM_016304chr153623 591 188 ------
NM_016306chr3------1331
NM_016308chr141993 678 392 88 32067 1261 424 ----
NM_016312chr12--1115 ----
NM_016315chr241744 1236 545 143 1723 ----
NM_016316chr22518 108 ------
NM_016322chr942160 2063 498 210 --12745 --
NM_016340chr52929 179 11225 1231 --
NM_016352chr76910 506 471 462 452 206 21433 1161 ----
NM_016376chr1783061 2824 2685 1730 1192 920 830 576 12986 --24383 1401
NM_016396chr1582476 2178 1916 1069 1051 896 732 568 1514 ----
NM_016422chr1152972 2263 2015 923 348 23023 1107 ----
NM_016436chr2041937 1685 356 188 32311 822 679 --11837
NM_016441chr232296 1883 1474 ------
NM_016442chr552152 1882 1517 927 663 12253 1690 --
NM_016448chr151530 740 488 168 143 1228 1585 --
NM_016470chr202530 153 ------
NM_016480chr51315 --139 --
NM_016500chrX1277 ------
NM_016513chr683814 3532 1477 1406 1089 1017 415 24 43604 1441 712 480 13546 21317 1229
NM_016516chr22850 545 ------
NM_016522chr1131526 1515 1419 1656 ----
NM_016526chr111294 12489 ----
NM_016530chr1564026 3803 3548 2853 2787 677 23532 711 33312 1650 576 1332
NM_016531chr493993 3591 3396 3129 1024 985 650 538 123 --21367 826 --
NM_016542chrX21718 679 11779 ----
NM_016544chr253186 2667 1382 1354 507 42507 1517 1331 96 11439 --
NM_016557chr3--192 2934 374 1369
NM_016559chr331108 606 517 21169 82 1160 --
NM_016578chr111475 3260 241 128 ----
NM_016586chr142474 152 ------
NM_016603chr531771 1403 390 1112 11781 --
NM_016604chr5--11255 ----
NM_016605chr552176 2133 1896 736 138 1323 11911 --
NM_016617chr1342130 591 401 320 1556 1722 --
NM_016618chr23577 411 224 1488 ----
NM_016620chr131469 1241 1043 ------
NM_016626chr1821644 1407 ------
NM_016628chr10------161
NM_016631chr211866 1666 ----
NM_016649chr202401 114 ------
NM_016654chr152464 326 --154 1540
NM_016823chr17298 74 --140 11332
NM_016824chr1041596 1300 1192 562 11568 ----
NM_016836chr21606 ------
NM_016839chr21606 ------
NM_016931chr111325 --149 --
NM_016950chr431528 299 229 11356 ----
NM_016953chr2105925 4960 4651 4314 4053 3909 2111 1612 1305 993 55861 5768 5443 4029 1764 25265 5065 --
NM_016954chrX2597 205 2519 72 --1404
NM_017409chr122814 560 1641 ----
NM_017412chr821188 26 ----1394
NM_017420chr1473190 2984 2785 2708 1519 213 45 11080 ----
NM_017423chr421658 1359 1529 ----
NM_017440chr121121 ------
NM_017447chr2184210 4089 3898 3800 3739 765 748 630 ------
NM_017489chr821149 367 ----1428
NM_017516chr1111102 --2761 216 1438
NM_017519chr651363 1322 1066 504 107 1394 ----
NM_017522chr1----11030 --
NM_017551chr1022125 196 ------
NM_017563chr3106384 5352 5185 4008 3855 2376 976 596 453 190 25560 5506 25581 4014 14097
NM_017569chr131377 ------
NM_017577chr331693 264 226 ------
NM_017578chr3188 ------
NM_017580chr1071879 1749 1607 1562 935 564 538 1468 ----
NM_017590chr2232641 2528 371 ------
NM_017599chr1281755 1747 1741 1655 1555 1424 735 459 11410 1258 --
NM_017628chr4114815 3882 3760 3503 1552 983 773 389 297 263 22 21667 513 1873 --
NM_017629chr161666 1200 622 580 428 29 11748 ----
NM_017632chr41320 ------
NM_017633chr653586 3549 3535 1445 186 13508 ----
NM_017634chr831608 1222 753 1764 ----
NM_017637chr9149459 8205 8144 7593 6774 6574 5837 5803 1970 1778 1547 1057 497 384 48501 8259 7304 2208 29098 6226 15915
NM_017640chr61775 ------
NM_017643chr1792918 2825 2288 2214 2135 1971 1920 207 190 1740 ----
NM_017644chr364987 4830 4523 3262 1852 1148 --1151 13730
NM_017650chr786042 5996 5069 4606 1973 1489 1157 519 24322 1323 ----
NM_017657chr23932 364 337 1919 ----
NM_017658chr1453627 3152 2845 1735 1581 14666 11568 --
NM_017660chr1953311 3208 2326 486 462 12743 --1968
NM_017664chr13------1259
NM_017666chrX52244 2144 1364 899 346 11860 21530 1419 --
NM_017680chr91689 2252 156 ----
NM_017693chr1331320 1055 235 21245 250 1450 --
NM_017709chr183848 3622 2930 2735 1375 1132 467 449 33641 2983 2944 12751 --
NM_017719chr332379 2287 2062 --12368 1725
NM_017734chr1161 ------
NM_017737chr152115 1720 1448 1388 763 --12230 --
NM_017741chr451879 1089 909 772 542 ----1449
NM_017742chr1821207 320 11516 ----
NM_017752chrX3727 600 561 22071 553 ----
NM_017768chr11879 1634 1700 --
NM_017769chr1462613 2361 2202 950 390 213 1649 1372 --
NM_017770chr6102597 2530 2494 2283 1955 1817 424 342 162 101 22369 1937 11162 --
NM_017780chr81314 ------
NM_017784chr31884 11004 1852 --
NM_017791chr1421128 393 ------
NM_017794chr91324 ------
NM_017813chr8135748 5154 4948 4676 4482 3867 3848 3669 2237 2004 1120 638 330 34184 3533 1881 25550 1580 --
NM_017826chr132306 57 ------
NM_017831chr1873490 1388 1340 480 456 367 287 14550 21725 999 --
NM_017832chr9--11173 --11017
NM_017848chrX74117 3214 1784 1474 1462 1320 1187 1242 11129 --
NM_017851chr152798 126 --1348 --
NM_017905chr131204 1562 1572 --
NM_017906chr6198 ------
NM_017915chr12----1739 --
NM_017919chr995761 5323 4865 3736 2308 1027 893 595 516 44145 1606 1244 649 15434 --
NM_017925chr951796 1775 1719 1697 1241 11461 ----
NM_017935chr44658 637 628 278 ------
NM_017938chrX31382 887 870 1799 1444 --
NM_017944chr1162377 2261 1046 1003 953 855 12247 ----
NM_017948chr9--194 ----
NM_017964chr23960 836 51 ------
NM_017987chr1062057 1607 709 659 542 326 11854 ----
NM_017998chr921425 1084 1546 ----
NM_018000chr241950 1870 312 151 1206 ----
NM_018013chr663037 2724 2587 1921 414 404 1930 1975 --
NM_018015chrX21087 386 178 ----
NM_018025chr19--1188 ----
NM_018027chr1042935 2017 771 123 ------
NM_018030chr1821095 32 1978 ----
NM_018037chr11257 ------
NM_018047chr52955 62 1659 ----
NM_018048chr1251916 1857 1780 1270 578 1762 ----
NM_018064chr61251 ------
NM_018070chr11165 ------
NM_018084chr261230 1138 1120 676 352 128 12205 ----
NM_018085chr1106090 5737 3258 3228 2941 2835 1958 1915 897 684 ----26914 5453
NM_018086chr261617 1569 1356 1177 584 571 ------
NM_018087chr12248 238 ------
NM_018094chrX--1121 ----
NM_018098chr33871 750 405 11088 ----
NM_018115chr41142 ------
NM_018119chr161240 ------
NM_018120chr831329 1227 81 ------
NM_018121chr1042712 1983 776 515 1769 ----
NM_018126chr42298 105 1476 --11095
NM_018131chr101867 1617 ----
NM_018139chr142141 121 ------
NM_018151chr21161 1737 --187
NM_018155chr353158 2997 2329 866 306 22567 2244 ----
NM_018157chr1252071 1272 518 380 69 --12995 --
NM_018179chr124609 182 62 37 ------
NM_018184chr332046 1594 870 ------
NM_018195chr1152145 2060 1624 1567 610 12169 ----
NM_018196chrX31313 408 294 155 1277 --
NM_018206chr161241 ------
NM_018211chr141743 1475 1365 400 32222 1670 1530 ----
NM_018214chr621101 851 1223 ----
NM_018221chr22420 382 ------
NM_018227chr482811 2705 2691 2570 1229 385 279 267 ------
NM_018241chr44943 855 260 185 --1361 --
NM_018243chr4104041 3857 3190 1535 1306 1109 1026 947 836 780 23043 1161 ----
NM_018246chr882520 2444 2022 1126 1111 739 569 391 12642 ----
NM_018247chr672144 2076 2024 1126 996 319 133 22290 1947 ----
NM_018254chr152369 2356 1989 805 615 32381 2278 246 ----
NM_018257chr2062330 1631 668 528 443 252 22488 596 ----
NM_018263chr252573 867 686 560 474 --12515 --
NM_018266chr3--1980 1850 --
NM_018272chr12--1200 ----
NM_018287chr1031195 888 495 2842 258 ----
NM_018293chr352534 2449 2423 2403 2041 ------
NM_018299chr833215 2301 70 --2983 729 --
NM_018307chr17--1775 ----
NM_018312chr1122116 1404 ------
NM_018313chr352581 1735 864 812 171 1880 ----
NM_018314chr112773 168 --1131 --
NM_018323chr441457 637 176 107 1472 ----
NM_018334chr71548 ------
NM_018340chr1675071 3784 3722 3702 1069 683 361 24813 3356 1731 --
NM_018348chr1681238 1118 954 943 802 414 311 160 2848 129 ----
NM_018351chr1283941 3919 3101 1884 1869 1235 408 156 34418 561 47 24603 744 21301 358
NM_018361chr883931 3618 2675 2590 2475 728 611 370 12534 ----
NM_018362chr11104029 3792 3385 3227 2881 2828 2603 992 436 331 11464 13391 1473
NM_018364chr183425 3184 2561 2510 1292 702 467 98 32787 1471 540 2430 263 1900
NM_018369chr5--1664 ----
NM_018370chr1232162 1806 482 1132 ----
NM_018373chr14126490 6386 6099 6082 5309 4995 4877 4761 3965 1954 1756 429 24774 887 35496 1010 145 25481 699
NM_018374chr784335 4202 3197 1373 1002 689 605 367 25257 4255 --14564
NM_018375chr1441789 1397 1200 534 --186 --
NM_018398chr31310 ------
NM_018403chr343572 886 755 587 14129 ----
NM_018409chr463289 3262 2859 720 705 312 42539 1991 1315 509 ----
NM_018420chr162062 1090 1008 776 463 368 11040 ----
NM_018424chr931441 517 483 31562 732 681 ----
NM_018433chr2----1499 --
NM_018440chr8178100 7703 7099 5991 2908 2807 2450 2435 2363 2138 1816 1555 1100 1029 880 796 654 33284 3204 2770 12200 --
NM_018442chr12341 89 ------
NM_018448chr124842 817 396 356 ------
NM_018452chr6_random93420 3299 3284 3171 1379 1282 1129 736 720 32722 2413 301 21066 918 --
NM_018456chr31137 ------
NM_018466chrX4739 691 508 215 1258 ----
NM_018471chr22390 66 ------
NM_018482chr832569 2268 1757 21960 754 ----
NM_018486chrX2528 131 ------
NM_018490chr1131837 1584 577 1444 ----
NM_018557chr241576 358 310 224 ------
NM_018566chr164541 3811 1892 739 667 613 21122 685 11160 13682
NM_018569chr451459 1055 604 306 218 ----1187
NM_018593chr6--184 ----
NM_018638chr12135344 5078 4989 4876 4211 3602 3562 2203 1487 824 697 256 49 45246 4687 1638 409 ----
NM_018640chr1242409 2389 1127 960 32759 679 487 ----
NM_018650chr162093 1925 1689 862 410 99 1495 ----
NM_018660chr822779 153 12789 ----
NM_018667chr1632648 2576 920 12394 --12486
NM_018682chr71667 ------
NM_018683chr2051742 1495 1241 622 294 11731 ----
NM_018685chr71782 1231 --1389
NM_018695chr551991 1948 1578 1563 879 ------
NM_018712chr1131475 1224 60 1361 ----
NM_018841chr1113364 3090 2969 2661 2557 1582 1376 1342 894 688 143 13290 --1208
NM_018846chr73994 803 259 1273 ----
NM_018898chr561936 1811 1754 1631 938 55 1572 ----
NM_018899chr561936 1811 1754 1631 938 55 1572 ----
NM_018900chr561936 1811 1754 1631 938 55 1572 ----
NM_018901chr561936 1811 1754 1631 938 55 1572 ----
NM_018902chr561936 1811 1754 1631 938 55 1572 ----
NM_018903chr561936 1811 1754 1631 938 55 1572 ----
NM_018904chr561936 1811 1754 1631 938 55 1572 ----
NM_018905chr561936 1811 1754 1631 938 55 1572 ----
NM_018906chr561936 1811 1754 1631 938 55 1572 ----
NM_018907chr561936 1811 1754 1631 938 55 1572 ----
NM_018908chr561936 1811 1754 1631 938 55 1572 ----
NM_018909chr561936 1811 1754 1631 938 55 1572 ----
NM_018910chr561936 1811 1754 1631 938 55 1572 ----
NM_018911chr561936 1811 1754 1631 938 55 1572 ----
NM_018933chr54681 344 327 75 ------
NM_018940chr54763 430 232 127 1346 1289 --
NM_018945chr663722 3481 2302 1153 743 519 11486 13112 --
NM_018948chr1154 --1539 --
NM_018951chr7--11208 11141 --
NM_018953chr121767 ------
NM_018970chr773071 2928 2679 2089 1153 1121 136 32270 1272 173 ----
NM_018976chr1272654 2636 2370 2231 792 248 226 173 ----
NM_018993chr2031204 1018 605 ------
NM_018999chr1094924 4710 4672 4626 4412 3279 749 660 490 23862 842 41967 1869 768 305 --
NM_019000chr551597 1351 1209 1200 542 149 ----
NM_019001chr374069 3873 3023 787 737 703 28 11893 23506 1264 --
NM_019004chr762281 2157 923 517 367 185 --1460 --
NM_019027chr431678 634 527 ------
NM_019035chr41184 11887 ----
NM_019036chr62802 493 1444 --142
NM_019040chr112255 89 ------
NM_019050chr42681 37 --12263 11916
NM_019072chr5114282 4233 4179 3936 3507 2668 1519 1100 1067 1036 704 24148 583 43279 1713 834 372 --
NM_019083chr161644 1418 1235 1133 556 421 11155 11252 --
NM_019084chr1072189 2151 1959 532 463 405 305 ------
NM_019094chr1293288 2740 2414 1099 498 484 316 157 129 ----33275 1300 39
NM_019095chr201189 ------
NM_019098chr861782 1690 1628 1169 739 374 1424 ----
NM_019106chr2253369 2987 2618 871 626 ----13346
NM_019114chr951832 1796 1019 760 565 11593 1141 1342
NM_019116chr1672760 2558 2466 1303 703 568 123 --43549 2569 2445 2286 --
NM_019117chrX73315 2902 1252 1226 892 726 251 2714 43 ----
NM_019555chr341493 1334 694 170 1306 1128 11117
NM_019597chrX3774 712 637 ------
NM_019842chr6--1350 ----
NM_019885chr242875 962 788 569 11830 ----
NM_019891chr161253 1222 1202 992 365 87 1239 ----
NM_019895chr321123 220 ------
NM_019903chr1041596 1300 1192 562 11568 ----
NM_020062chr201701 --2977 694 --
NM_020066chr12970 123 ------
NM_020069chr11--1246 ----
NM_020116chr451696 1142 681 585 540 1314 ----
NM_020122chr254067 1850 1408 297 222 42335 909 849 95 ----
NM_020123chr1051414 1310 1269 393 255 --135 --
NM_020141chr132381 2264 708 11726 ----
NM_020144chr731567 1401 378 21484 697 ----
NM_020147chr155962 871 860 82 46 ------
NM_020148chr1842096 960 359 313 ----12709
NM_020150chr1072237 1830 1433 812 781 398 130 ------
NM_020151chr261753 1256 1205 661 424 260 ------
NM_020157chr205840 661 645 283 180 ------
NM_020159chr451440 1178 1165 1153 113 21582 189 ----
NM_020177chr582951 2780 2328 2110 1120 867 666 233 ------
NM_020178chr171356 41167 816 491 307 ----
NM_020182chr2043319 1227 521 267 2706 340 ----
NM_020184chr252045 1641 659 406 260 ------
NM_020189chr8----172 --
NM_020194chr22658 549 ------
NM_020198chr1731630 1092 104 2546 96 ----
NM_020228chr111833 ------
NM_020239chr152204 2153 2012 1958 611 ------
NM_020245chr695057 4663 4433 4016 1987 1501 1208 983 326 23536 3502 13194 --
NM_020336chr202990 265 33636 422 414 ----
NM_020337chr452481 1997 712 497 117 22939 203 --1757
NM_020341chr2031847 1750 644 ------
NM_020342chr252240 2187 2105 1058 295 ------
NM_020346chr1121341 167 --21218 1163 --
NM_020357chr321532 1270 11128 ----
NM_020361chr81265 1319 ----
NM_020381chr641973 1325 745 452 ----11252
NM_020390chr373942 3933 3471 3072 3054 1923 1879 23309 945 1982 13512
NM_020403chr1361573 1517 1252 227 191 83 11366 --1727
NM_020420chrY51645 1507 1173 732 446 ------
NM_020432chr7--31918 1458 98 --12123
NM_020440chr132425 1289 703 1116 ----
NM_020443chr186946 6156 5760 2468 2075 1831 550 398 15119 36503 6430 5798 --
NM_020452chr11345 12178 12183 --
NM_020456chr1321693 489 11657 --2640 476
NM_020463chr251304 1202 1187 363 352 --11250 --
NM_020466chr6104811 4562 4552 4382 4149 1891 1860 1663 86 34 13766 23697 573 --
NM_020473chrX31504 1440 244 11814 ----
NM_020474chr1851459 1410 738 586 563 31859 1426 1308 ----
NM_020478chr812373 1523 --1773
NM_020482chr64864 818 652 563 ------
NM_020532chr2------1743
NM_020638chr121258 11689 11752 --
NM_020640chr331758 1705 402 --171 --
NM_020647chr841467 1457 850 564 21940 1753 ----
NM_020651chr241305 574 205 190 --1153 --
NM_020653chr17146 ------
NM_020666chr53913 836 337 ------
NM_020673chr20147511 6528 6340 5989 2680 2417 1307 989 978 821 395 206 179 98 35065 1532 742 37251 6027 1080 15103
NM_020686chr1633007 2712 319 12580 ----
NM_020689chr2021648 1104 ------
NM_020693chr113481 393 362 ------
NM_020699chr164956 4437 4368 978 663 207 14219 34979 862 426 --
NM_020706chr211132 ------
NM_020711chr282606 1756 1702 1683 833 780 596 171 --11677 --
NM_020715chr1441986 854 697 136 12045 12143 --
NM_020717chrX54414 3799 3264 1763 1195 33847 3721 3382 23935 60 13985
NM_020718chr16136243 6022 5895 5845 5805 5555 5315 4815 4750 2180 2167 1366 534 34863 2537 2156 11134 --
NM_020726chr5--1219 ----
NM_020727chr2183687 3655 3318 3201 2663 1443 799 702 2495 402 11132 11564
NM_020732chr651363 1322 1066 504 107 1394 ----
NM_020734chr1253338 3191 2961 2675 517 ------
NM_020739chr1574094 3237 1663 1233 628 586 307 54077 3993 3707 3685 943 --31702 1294 1255
NM_020748chr172648 337 2767 493 ----
NM_020752chr1052824 2131 1973 614 235 ----12584
NM_020760chr22708 334 --1389 11719
NM_020766chrX33113 3106 3075 13813 14339 --
NM_020768chr521127 218 12198 ----
NM_020771chr62364 123 ------
NM_020772chr17168313 8267 8237 7770 7368 5566 5296 3060 2807 2656 2517 1990 1017 830 412 248 35960 2905 2604 12850 --
NM_020774chr1875845 4656 4218 1521 1103 991 94 66227 5594 4665 1619 1306 330 ----
NM_020775chr1--1137 ----
NM_020781chr722720 741 2810 168 ----
NM_020782chr1264664 4229 4048 4002 1843 1782 31861 1682 965 --14738
NM_020783chr184861 557 424 180 12127 --22252 318
NM_020792chr342503 2314 979 125 --1228 --
NM_020794chr151368 1356 1081 555 303 11115 ----
NM_020796chr532908 2160 1038 ------
NM_020802chr1163082 2658 2632 1150 376 338 32757 2290 593 --13375
NM_020805chr1821744 695 31663 1220 280 11499 --
NM_020809chr1142106 1932 501 317 ------
NM_020818chr14167 ------
NM_020825chr1663807 3743 2974 1180 820 395 ------
NM_020834chr1431771 1737 1299 ----2721 562
NM_020841chr1254033 3976 3303 1267 402 --13354 1386
NM_020844chr8166225 6212 5935 5650 5550 5361 5125 4889 4724 3043 2806 2030 1656 1416 397 359 11702 22226 2068 56601 5823 5510 1582 1046
NM_020858chr1552196 2177 1934 1910 862 --1497 --
NM_020860chr421101 369 ------
NM_020861chr621196 323 ------
NM_020865chr32327 98 1503 ----
NM_020868chr261854 1722 1362 518 414 367 1331 ----
NM_020870chr41700 12061 ----
NM_020871chrX82023 1851 1837 1682 631 388 307 253 --2457 448 --
NM_020872chr341531 1181 416 327 ----11312
NM_020892chr71362 ------
NM_020899chr1751852 1779 1753 306 212 ------
NM_020917chr1953549 2784 737 702 209 43533 3385 1174 1156 ----
NM_020919chr221273 392 ------
NM_020922chrX51874 1604 1386 1369 609 ------
NM_020925chr131467 1310 523 ------
NM_020927chr1632245 762 457 1860 12129 --
NM_020935chr254082 3598 2896 1624 836 1653 --13985
NM_020940chr1042152 986 743 592 12318 ----
NM_020948chr173657 2883 2483 1282 1130 944 414 33468 2656 356 1431 --
NM_020961chr41115 161 ----
NM_020964chr1881761 1622 1488 1414 1339 686 465 454 24085 3398 1622 --
NM_020977chr441827 1795 1488 1478 --1115 --
NM_020980chr1551694 1474 1338 1190 678 11080 11179 11263
NM_020981chr21154 1777 ----
NM_020987chr102953 199 ------
NM_020989chr2----123 --
NM_020993chr1211828 22872 1762 ----
NM_021003chr141254 1672 1677 --
NM_021005chr15171 1154 ----
NM_021007chr242353 2296 1920 283 11776 ----
NM_021032chr341823 1436 657 148 ------
NM_021033chr1353279 3170 1208 250 102 2442 264 1210 --
NM_021038chr343319 2928 2409 820 13078 --12901
NM_021061chr854528 4516 4035 3466 79 1337 43566 1516 756 714 11501
NM_021069chr41668 11762 ----
NM_021072chr542490 2268 2094 2004 11883 --1531
NM_021076chr222151 80 ------
NM_021083chrX83435 3200 2756 1283 1235 1081 1043 884 32743 2319 1458 13660 --
NM_021101chr342448 1554 750 101 2605 182 11921 --
NM_021109chrX1383 ------
NM_021109chrX1383 ------
NM_021116chr778931 7949 7445 5549 5533 2234 1264 39084 8136 7430 16756 --
NM_021132chr10--194 2243 101 --
NM_021136chr141660 1119 ----
NM_021137chr1772386 1990 1928 1603 672 620 456 ------
NM_021140chrX3988 416 226 1752 ----
NM_021144chr92205 114 1471 ----
NM_021145chr71104 1270 ----
NM_021148chr722290 1622 22071 898 12364 --
NM_021151chr721068 446 ------
NM_021159chr451544 1474 1163 205 39 --11283 --
NM_021183chrX21603 485 22448 751 ----
NM_021190chr111100 1244 ----
NM_021191chr1252329 2298 1882 1622 295 --1455 --
NM_021202chr2072640 2480 1965 1212 1119 575 167 --32264 2144 145 --
NM_021205chr141813 1790 304 138 ----11961
NM_021215chr2061964 1852 1730 635 532 348 12127 12324 --
NM_021228chr19------1221
NM_021238chr1251953 1790 1692 1541 836 1544 1347 --
NM_021239chr1431046 383 276 11239 ----
NM_021245chr10149 ------
NM_021252chr1061999 1637 551 538 249 195 --12105 --
NM_021253chr621289 1264 ------
NM_021255chr1464108 3707 3547 2532 679 316 23062 1199 13613 --
NM_021614chr51310 1235 ----
NM_021620chr6----1777 --
NM_021622chr1072030 1668 1620 1536 1509 545 181 21941 1545 ----
NM_021627chr331090 934 846 ------
NM_021629chr364527 4111 3739 1750 1065 630 24647 3787 ----
NM_021644chr10172 ------
NM_021647chr494623 3473 3278 3220 3084 1867 1776 264 172 34080 3603 1610 12942 --
NM_021648chr682683 2181 2000 1779 372 345 136 81 ------
NM_021649chr571800 1512 1235 694 234 145 55 1362 11152 --
NM_021705chr61546 1438 11143 --
NM_021813chr685309 5293 5285 5045 1055 636 371 354 24575 4197 24364 1013 1261
NM_021814chr631155 549 313 ------
NM_021815chr262806 2600 2303 2198 1215 540 --22611 2322 --
NM_021911chr575483 5056 4307 4240 2029 1399 1081 14493 ----
NM_021912chr1563767 3593 3067 2796 464 278 13263 --11168
NM_021913chr1921415 359 21504 439 21747 476 11595
NM_021914chr1421840 936 12098 1758 --
NM_021940chr661342 1330 1088 1081 636 161 ------
NM_021942chr41697 1209 ----
NM_021943chr612179 12090 ----
NM_021949chrX62889 2862 2669 2648 2235 2220 11054 ----
NM_021950chr1132223 1895 787 1752 ----
NM_021951chr93768 740 645 1363 ----
NM_021954chr1353433 3223 2664 2339 1134 32617 975 483 ----
NM_021961chr11115616 5332 4981 2667 2369 1482 684 496 455 308 151 11052 36525 5388 2705 --
NM_021964chr3126418 6083 5651 5237 4816 4467 2554 2164 1658 1619 1085 1024 --16630 --
NM_021965chr9--11399 ----
NM_021973chr41679 --1146 --
NM_021998chrX31025 924 398 ------
NM_021999chr13--1710 1270 --
NM_022037chr23907 716 202 1849 ----
NM_022048chr15116271 6243 5999 5278 5015 4753 4726 3889 1744 640 633 16061 --15942
NM_022049chr121810 1194 1635 --11699
NM_022058chr251790 1470 619 108 101 21968 449 ----
NM_022073chr1441404 1279 1072 563 11037 31659 463 103 --
NM_022085chr621579 1433 21351 1065 ----
NM_022090chr5--2494 30 --136
NM_022114chr134747 4615 1407 1194 --11368
NM_022123chr141603 ------
NM_022130chr51933 --1967 --
NM_022131chr331381 1263 1238 ------
NM_022133chr831750 716 230 --11319 --
NM_022138chr651487 1226 277 161 45 ------
NM_022166chr1655245 4441 3968 3961 2283 46102 2251 1153 36 ----
NM_022173chr23907 716 202 1849 ----
NM_022343chr921371 407 11337 --11318
NM_022351chr863292 3243 2642 577 184 92 2964 905 12880 --
NM_022373chr7--1824 --171
NM_022454chr81796 1608 1351 --
NM_022459chr13116275 5867 5818 5291 5133 2446 1869 1686 1276 406 204 56068 5743 2209 2182 1237 11972 --
NM_022473chr1554249 3296 690 458 364 ------
NM_022474chr1441865 850 683 135 11805 ----
NM_022475chr43521 489 131 1608 1666 --
NM_022476chr1621109 942 1447 ----
NM_022482chr2031824 934 373 2652 206 ----
NM_022484chr721218 1027 ------
NM_022491chr12103478 3101 3078 3034 2689 2453 1274 854 361 186 --13578 --
NM_022550chr51111 177 ----
NM_022571chr14136 ----1213
NM_022658chr122891 857 ------
NM_022659chr82537 422 ------
NM_022716chr152811 2137 2122 1993 863 13107 23003 1023 --
NM_022726chr651706 1297 697 571 511 2583 63 ----
NM_022728chr72531 164 1673 ----
NM_022735chr14518 288 153 64 21278 607 ----
NM_022739chr175951 369 350 339 166 1839 ----
NM_022763chr373118 2661 2307 933 819 602 584 11013 ----
NM_022771chr122938 81 ------
NM_022776chr351544 1300 1151 383 262 ------
NM_022781chr993304 2407 2400 2367 2085 844 560 365 76 22813 1075 ----
NM_022782chr122341 252 ------
NM_022784chr155404 196 177 165 21 11127 ----
NM_022787chr152748 2697 1932 486 53 11836 12496 --
NM_022802chr1011486 --11274 --
NM_022825chrX1300 ------
NM_022826chr211146 ----2776 463
NM_022828chr541668 1374 1151 271 11097 ----
NM_022838chrX1120 ------
NM_022841chr1551873 1106 513 353 285 12145 ----
NM_022843chr1331389 1269 1170 1488 ----
NM_022845chr1632126 2108 1767 ------
NM_022898chr1474860 3597 1630 1589 1223 471 225 11085 1647 --
NM_022912chr222100 869 --1909 --
NM_022918chr1162185 2001 1881 758 534 286 11614 --11385
NM_022970chr102544 179 ------
NM_023000chr14--11567 ----
NM_023001chr14--11567 ----
NM_023018chr121593 68 --1287 --
NM_023037chr131342 ------
NM_023071chr1231129 1095 352 1857 --1972
NM_023074chr1941272 477 456 344 11378 ----
NM_023112chr1432222 89 77 ------
NM_023923chr183768 3733 3578 3513 3289 3052 661 482 --12999 12656
NM_023929chr852569 2486 799 564 58 12687 ----
NM_024067chr71529 ------
NM_024071chr141608 ------
NM_024094chr81628 ------
NM_024117chr941440 1388 352 22 ------
NM_024315chr73394 305 90 1401 ----
NM_024332chrX31239 607 435 1673 --21539 67
NM_024334chr361876 1653 1317 672 654 102 ----11644
NM_024341chr1964145 1441 1432 993 980 654 23681 829 22844 1497 --
NM_024345chr9105572 5237 5139 4446 3967 2050 1927 1467 373 60 45906 5618 2239 485 22076 1223 --
NM_024348chr91296 ------
NM_024408chr142885 2494 207 94 1612 21303 1262 --
NM_024411chr2031526 1485 534 1525 ----
NM_024423chr1893807 3716 2697 1079 981 760 347 324 101 33917 1442 422 12589 1290
NM_024511chr473115 2731 2341 1217 1128 378 22 42676 2156 944 343 1537 --
NM_024524chr352946 2856 1156 740 604 23190 2260 ----
NM_024525chr11113 ------
NM_024539chrX21231 292 ------
NM_024546chr1321107 108 ------
NM_024551chr1222179 399 --11734 --
NM_024551chr1222179 399 --11734 --
NM_024561chr1341337 925 245 163 ------
NM_024563chr541383 1189 324 95 ------
NM_024569chr12627 466 22856 1065 32975 999 737 --
NM_024586chr1--1544 298 67 --
NM_024596chr854941 3403 1596 639 487 11732 23721 284 14367
NM_024612chr172395 273 ------
NM_024613chr871591 1448 1413 1388 1252 1199 1175 ------
NM_024615chr5--1220 ----
NM_024617chr9--2936 859 ----
NM_024628chr341112 958 759 181 1884 21078 219 --
NM_024631chr112470 270 ------
NM_024635chr91323 ------
NM_024636chr742057 1991 949 46 ------
NM_024639chr631928 1874 600 177 ----
NM_024641chr672852 2636 2379 1844 1177 894 557 12212 12534 --
NM_024646chr163991 3310 2674 1296 997 349 1329 1159 --
NM_024659chr231034 342 177 1716 ----
NM_024665chr384161 3609 3128 1130 916 710 479 227 23591 1887 --11225
NM_024670chr1041372 683 666 609 21188 582 ----
NM_024674chr162995 2777 756 424 282 267 12116 --1804
NM_024675chr162223 26 ------
NM_024713chr1531311 168 77 31531 1387 1200 --1217
NM_024721chr832092 725 376 32537 2504 247 21849 499 --
NM_024740chr1194024 3813 3370 3339 2727 2582 1568 1429 858 ------
NM_024749chr172268 2138 1898 1725 687 544 348 ----11427
NM_024751chr442024 1602 821 145 1239 1291 --
NM_024755chr153757 149 45 ------
NM_024766chr21325 ------
NM_024814chr71151 1391 158 --
NM_024830chr531928 682 321 ----11676
NM_024834chr103747 678 96 ------
NM_024837chr1551729 1695 1583 690 611 1301 ----
NM_024857chr171119 ------
NM_024871chr341029 538 485 276 1419 --11413
NM_024893chr20--1165 ----
NM_024911chr11644 1573 ----
NM_024920chr41131 1546 1286 --
NM_024941chr511281 1226 ----
NM_024945chr941144 832 183 67 1108 ----
NM_024947chr3158943 8464 8414 7515 6877 6665 6341 6274 3682 2470 2302 2173 1799 376 125 78079 7631 6952 5920 2603 2453 2099 --17365
NM_024949chr474786 4155 3681 3633 1935 1636 1360 11228 1573 15041
NM_024953chr1242643 2578 2156 1889 1676 11966 --
NM_024960chr203403 392 165 ----183
NM_024979chr131519 ------
NM_024989chr2188189 8179 7919 7699 7133 7097 6807 6303 5904 5811 5598 5038 5005 2958 2860 1358 1092 654 46172 2586 2205 683 48131 6144 5935 2141 27508 350
NM_024991chr1082424 2403 2326 2155 2013 475 289 63 22982 2952 12667 --
NM_024993chr261495 1478 1410 449 327 265 21142 511 ----
NM_025054chr894018 2898 1375 1046 864 756 616 200 93 13301 11255 --
NM_025074chr453136 3080 2924 2113 76 1356 12676 12941
NM_025076chr21208 1123 ----
NM_025099chr171134 ------
NM_025109chr171398 1467 ----
NM_025133chr251141 852 337 324 260 1190 1940 --
NM_025146chr312721 21679 301 ----
NM_025151chr852048 1936 1851 749 179 11843 11996 --
NM_025154chr721369 523 1400 ----
NM_025160chr1103944 3567 3553 3223 3180 1442 919 668 477 454 24221 1361 ----
NM_025179chr144993 4939 3880 3055 23363 62 34202 1908 918 --
NM_025187chr1611032 ------
NM_025191chr143324 2253 943 533 ------
NM_025222chr343047 2997 2913 312 12415 12566 --
NM_025235chr1031522 865 648 --21404 781 1389
NM_025239chr92379 137 ------
NM_025248chr1732629 1287 1088 --13124 --
NM_030621chr14124248 4183 4016 3935 3699 2808 1544 1503 1118 1104 823 697 ----1224
NM_030627chr573885 3333 2881 1445 742 555 108 1651 23543 1572 --
NM_030634chr142200 924 309 47 ------
NM_030647chr765440 4920 4266 4232 2100 43 24528 1829 16193 --
NM_030648chr454215 3657 3504 2181 881 23606 1118 24631 4455 --
NM_030650chr273878 3857 3203 2988 1480 1469 840 32982 1538 921 ----
NM_030661chr731712 562 34 --1199 --
NM_030664chr1082471 2415 1841 1639 1521 781 370 304 ------
NM_030674chr1295617 5031 4502 4485 3865 2177 740 430 200 35733 4780 231 166 --
NM_030751chr1061810 1213 755 592 576 45 ------
NM_030751chr1061810 1213 755 592 576 45 ------
NM_030758chr2231037 388 69 ------
NM_030759chr102583 285 ------
NM_030763chrX3891 275 247 2315 123 1836 --
NM_030771chr112301 118 ------
NM_030786chr131721 1414 1215 21942 241 2448 426 --
NM_030799chr531917 1702 891 ------
NM_030806chr1107914 7668 6528 6094 5802 3246 1548 1245 455 67 13722 --1293
NM_030808chr171378 11127 ----
NM_030809chr1252330 1970 1898 1604 520 1283 12382 1996
NM_030810chr621579 1433 21351 1065 ----
NM_030815chr201553 ------
NM_030816chr143323 2441 730 562 43364 3172 843 167 ----
NM_030885chr331483 715 481 32257 872 539 ----
NM_030917chr42176 55 ------
NM_030918chr175087 4187 3671 1795 1635 395 262 21262 978 ----
NM_030920chr152069 1450 445 399 236 ------
NM_030922chr15125 --1111 --
NM_030934chr131352 1282 676 21696 243 --21820 1566
NM_030938chr1751168 775 462 438 107 ------
NM_030945chr532595 2451 63 11755 12290 --
NM_030949chr61419 ------
NM_030953chr5172 --1319 --
NM_030958chr81461 ------
NM_030962chr111371 11309 ----
NM_030963chr6154 ------
NM_030964chr513423 --11056 --
NM_030979chr131460 ------
NM_030981chr1111216 ------
NM_031203chr191193 ------
NM_031208chr163786 772 732 ------
NM_031216chr182667 265 --11409 --
NM_031217chr11187 1193 ----
NM_031262chr94928 901 733 115 ------
NM_031263chr94985 958 790 172 ------
NM_031266chr51130 ------
NM_031268chr1665123 3708 3332 2016 1928 1906 11146 13618 --
NM_031275chr111137 ------
NM_031283chr23868 774 215 ------
NM_031296chr432347 1805 810 185 21004 305 --
NM_031305chr451867 1623 1381 1255 326 ------
NM_031314chr1451964 1940 1723 1279 308 126 11671 1387
NM_031362chr231869 119 59 22520 1065 ----
NM_031365chr232005 255 195 12656 ----
NM_031366chr232005 255 195 12656 ----
NM_031369chr43555 237 55 ------
NM_031370chr43555 237 55 ------
NM_031411chr561936 1811 1754 1631 938 55 1572 ----
NM_031418chr1152785 2588 732 697 390 ----1256
NM_031427chr14105871 5805 5208 4585 4533 4404 4020 3987 2320 1879 1689 --1250
NM_031442chrX62463 2112 1987 1081 694 128 12959 1327 12421
NM_031445chr251260 1166 1145 710 418 1630 12849 13230
NM_031453chr1032449 459 148 22386 2064 --167
NM_031468chr7118217 8060 7336 6739 6315 5210 5067 2069 1599 1406 1338 --37046 5467 5130 --
NM_031469chr653589 3300 1638 830 428 33867 3457 936 ----
NM_031845chr242677 1029 887 142 1113 ----
NM_031847chr242677 1029 887 142 1113 ----
NM_031849chr561936 1811 1754 1631 938 55 1572 ----
NM_031857chr561936 1811 1754 1631 938 55 1572 ----
NM_031858chr173627 444 96 ------
NM_031860chr561936 1811 1754 1631 938 55 1572 ----
NM_031862chr173627 444 96 ------
NM_031911chr452747 2714 1769 382 328 12838 ----
NM_031922chr63409 170 62 ------
NM_031935chr11803 1846 196 --
NM_031938chr111351 21003 803 ----
NM_031953chr41340 ------
NM_032012chr945060 4467 1935 497 21876 796 13574 --
NM_032018chr13636 301 104 ------
NM_032042chr572909 2271 2001 1139 921 817 729 11877 ----
NM_032047chr311550 22039 961 1500 --
NM_032048chr181622 ------
NM_032102chr1142892 2360 557 65 ------
NM_032105chr187972 6556 6440 6232 5409 5088 1746 734 13085 25633 2290 13021
NM_032116chr1385283 2310 1350 1088 255 190 65 23 25846 3755 ----
NM_032121chrX52853 2548 2501 2008 1938 12143 1894 --
NM_032132chr12487 161 ------
NM_032145chr651778 1542 511 328 48 --11574 --
NM_032146chr32443 30 ------
NM_032147chr122833 132 --1286 --
NM_032153chr372528 2077 2058 1108 1059 301 29 ------
NM_032160chr1883674 3442 2830 1284 1267 683 490 343 43637 1746 1620 1550 13831 --
NM_032186chr131469 1241 1043 ------
NM_032189chr1344926 4613 4518 1489 11877 24856 4474 --
NM_032199chr1093772 3550 3396 3255 2660 2434 1345 341 104 11131 ----
NM_032217chr431257 1216 1109 21063 431 ----
NM_032221chr2021405 611 ------
NM_032228chr1162646 2557 2374 799 663 363 ------
NM_032229chr131194 ------
NM_032231chr151326 ------
NM_032239chr42393 316 ----11143
NM_032266chr21166 ------
NM_032291chr151791 1731 1619 1516 1280 31483 1329 667 11412 --
NM_032303chr971711 1390 1341 1295 1156 337 215 31514 452 408 ----
NM_032312chr24891 793 373 148 1591 ----
NM_032321chr262846 2814 2453 486 419 363 1757 1186 --
NM_032328chr12437 37 165 ----
NM_032352chr1431140 973 343 1147 1532 --
NM_032373chr10105875 5165 4161 4084 2076 1436 1393 1309 774 354 42114 1597 1532 1002 ----
NM_032379chr112251 140 ------
NM_032410chr841048 432 413 349 ------
NM_032427chr115610 578 435 247 21 1182 ----
NM_032429chr101617 ------
NM_032434chr211573 1144 ----
NM_032435chr162209 2191 1655 1556 1481 797 22109 1685 --12155
NM_032436chr131206 1353 ----
NM_032437chr11113 ------
NM_032439chr1051675 1612 1472 438 371 21412 148 11078 --
NM_032440chr101972 32959 739 86 ----
NM_032445chr1542626 962 696 503 ----12331
NM_032446chr593714 2789 2640 2581 2501 1057 984 115 73 1611 --13146
NM_032449chr132009 1076 242 12863 --22282 1926
NM_032457chr473767 3699 3571 3216 3190 2840 733 13456 --1754
NM_032458chrX22836 848 23176 3066 12408 --
NM_032471chr63336 80 32 ------
NM_032499chr1561154 1094 666 485 276 55 --1605 --
NM_032505chr372768 2147 2129 2024 1888 1736 393 1563 11965 1909
NM_032518chr41183 ------
NM_032547chr411156 21295 1223 ----
NM_032558chr951304 1018 552 435 424 --1347 --
NM_032560chr1411045 1874 ----
NM_032569chr1611699 ------
NM_032574chr21215 ------
NM_032576chrY188 ------
NM_032594chr142920 61 ------
NM_032631chr191145 ------
NM_032632chr1431491 1300 764 ------
NM_032663chr1231931 585 441 ------
NM_032689chr1931570 133 73 11522 ----
NM_032737chr1922160 103 ------
NM_032778chr321050 722 23045 364 12805 --
NM_032784chr62919 717 ------
NM_032801chr112794 260 ------
NM_032810chr1011314 --11232 --
NM_032811chr112236 190 ------
NM_032813chr1321030 399 --11021 --
NM_032829chr1241158 1098 888 778 ----1857
NM_032833chr172671 2367 921 886 735 374 71 12354 11658 --
NM_032846chr1431009 300 230 1420 ----
NM_032858chr1----122 --
NM_032859chr1353945 3024 1510 712 299 22530 1288 ----
NM_032873chr1143944 3392 3281 2771 13547 ----
NM_032880chr11151 ------
NM_032892chr151265 ------
NM_032918chr1211080 --2346 188 1174
NM_032943chr112251 140 ------
NM_032968chrX43791 522 223 176 21674 1293 ----
NM_032969chrX43791 522 223 176 21674 1293 ----
NM_032973chrY43783 522 223 176 21668 1293 ----
NM_032975chr1843639 3419 1374 676 --12534 --
NM_032978chr1821142 273 1890 --1998
NM_032979chr1821142 273 1890 --1998
NM_032980chr1843639 3419 1374 676 --12534 --
NM_032981chr1821142 273 1890 --1998
NM_033012chr1311001 ------
NM_033020chr184407 3768 3657 3543 1887 1166 879 826 24292 3411 --14298
NM_033030chr221112 1102 21497 1435 ----
NM_033044chr1--1807 ----
NM_033055chr13942 762 442 --2227 192 --
NM_033056chr102749 262 2670 552 ----
NM_033083chr333318 3282 1319 1700 22119 653 1201
NM_033121chr1241710 1508 484 473 ------
NM_033161chr93468 195 177 11942 21900 385 --
NM_033181chr663751 3290 3194 1225 1012 883 31265 907 247 ----
NM_033210chr321315 1130 ------
NM_033211chr561777 1278 631 561 398 28 1287 11358 --
NM_033224chr7208058 7860 7609 7334 7215 6904 6357 6317 5560 5541 3131 2753 2740 2444 1783 1169 973 918 423 408 47824 6658 6055 1411 37428 2891 1793 11686
NM_033225chr851170 1027 649 151 113 12556 23186 608 --
NM_033227chr51455 ------
NM_033228chr51495 ------
NM_033272chr2----1287 --
NM_033274chr553236 3177 2832 2801 144 --23164 2951 --
NM_033285chr864478 4251 2996 1139 436 370 13695 ----
NM_033290chrX72655 1324 938 889 628 346 197 1101 ----
NM_033300chr1----11030 --
NM_033326chr112919 531 1589 1637 --
NM_033331chr943557 2335 2244 70 21018 250 --1991
NM_033338chr1021095 1035 1107 ----
NM_033339chr1021095 1035 1107 ----
NM_033340chr1021211 1151 2223 31 ----
NM_033343chr11106 ------
NM_033360chr1263713 1855 1813 1011 970 130 1523 24339 1441 11266
NM_033364chr321818 651 --11951 --
NM_033379chr10--1131 ----
NM_033425chr1153040 2649 2569 1253 535 22256 922 ----
NM_033427chr72575 137 ------
NM_033429chr1573198 3143 2625 2454 1316 713 419 22964 2030 ----
NM_033430chr473406 3246 3088 3076 1470 826 389 ------
NM_033437chr473406 3246 3088 3076 1470 826 389 ------
NM_033449chr51266 --12142 --
NM_033505chr286217 6107 5537 4853 4275 1866 1103 142 31430 868 104 ----
NM_033515chr621015 211 1492 ----
NM_033535chr441148 999 445 237 2751 145 ----
NM_033624chr122412 216 ------
NM_033637chr1073359 3269 3112 2980 2877 2673 368 22614 1351 11005 --
NM_033644chr532506 1018 1000 11859 1604 --
NM_033645chr532506 1018 1000 11859 1604 --
NM_033656chr21105893 4946 4765 4263 4133 3784 1939 831 796 777 21007 848 --1410
NM_052832chr853017 2814 2631 2171 400 22528 1126 ----
NM_052849chr151156 ------
NM_052851chr1341990 1819 399 165 32028 1627 772 ----
NM_052867chr1361379 1293 1014 983 78 25 ------
NM_052879chr12103766 3546 3423 3370 3309 1446 1346 964 439 310 2995 763 ----
NM_052885chr12134927 4681 4589 4219 3958 3930 1997 1771 1525 664 356 220 87 23455 3275 34908 3896 1648 --
NM_052900chr861550 1504 1411 1165 595 588 ------
NM_052904chr641459 336 237 142 --11119 --
NM_052905chr241771 1679 1451 449 ------
NM_052918chr1063324 2273 1438 1429 1010 49 12931 21499 1486 --
NM_052939chr12381 149 ------
NM_052940chr11171 ------
NM_052954chr2131735 684 39 ------
NM_053016chr9187431 7314 6701 6538 6425 6362 3011 2194 2158 1695 1574 1397 958 895 794 745 521 137 56825 6573 5627 1956 1211 12339 --
NM_053023chr1153260 3106 2995 2317 480 22643 2249 1733 --
NM_053025chr341771 1363 1319 188 ------
NM_053026chr341771 1363 1319 188 ------
NM_053027chr341771 1363 1319 188 ------
NM_053028chr341771 1363 1319 188 ------
NM_053031chr341771 1363 1319 188 ------
NM_053032chr341771 1363 1319 188 ------
NM_053042chr432859 827 497 11984 ----
NM_053056chr1122613 2164 12690 ----
NM_053064chr1432410 2325 756 22687 876 12245 --
NM_054016chr131606 1424 213 21518 649 11592 11482
NM_054016chr131606 1424 213 21518 649 11592 11482
NM_054016chr131606 1424 213 21518 649 11592 11482
NM_057157chr10186 --1136 --
NM_057168chr751687 1639 1332 588 277 1451 ----
NM_057169chr124826 465 446 164 --1540 154
NM_057170chr124826 465 446 164 --1540 154
NM_057175chr452696 2438 2202 2178 1763 12371 --1694
NM_057749chr841191 557 450 268 ------
NM_058170chr121433 545 --11660 --
NM_058172chr441203 1189 582 466 11659 ----
NM_058241chr252195 1781 1448 1424 595 11601 ----
NM_058241chr252195 1781 1448 1424 595 11601 ----
NM_078470chr1042290 2142 376 135 42407 2307 2217 668 ----
NM_078483chr563943 3581 2623 562 500 357 23351 3217 12822 --
NM_078626chr1--1143 --1286
NM_080546chr942075 1432 701 404 ----12198
NM_080552chr201596 --1508 --
NM_080597chr1821095 32 1978 ----
NM_080599chr1051014 1005 501 246 232 --11221 --
NM_080617chr20--3783 275 161 ----
NM_080629chr141465 1269 529 271 --11065 --
NM_080630chr141465 1269 529 271 --11065 --
NM_080645chr631540 617 517 22156 109 ----
NM_080664chr1481876 1635 1589 1520 1377 120 94 79 1189 2518 359 --
NM_080676chr2072816 2392 2364 2191 572 258 134 --12527 --
NM_080682chr11751 1481 ----
NM_080683chr41479 --1456 --
NM_080684chr41479 --1456 --
NM_080685chr41479 --1456 --
NM_080717chr123451 306 184 ------
NM_080759chr1322689 1907 --12666 1531
NM_080760chr1322689 1907 --12666 1531
NM_080821chr2071767 1532 602 507 345 228 167 22109 645 32014 1781 799 1780
NM_080832chrX41678 1448 1180 173 1451 11850 --
NM_080836chr2054609 4430 4037 3643 3125 23563 345 2302 125 164
NM_080867chr14114648 4406 3586 3564 1644 1363 976 785 646 420 116 63962 3248 1840 1706 1689 385 13626 --
NM_080872chr864098 3922 3768 3591 2971 1048 23574 3207 13637 12664
NM_080874chr43745 139 41 ----11806
NM_080928chr73786 280 61 ----1655
NM_100264chr10------161
NM_100486chr10------161
NM_130391chr952736 1144 736 191 57 12641 1750 --
NM_130392chr952736 1144 736 191 57 12641 1750 --
NM_130393chr952736 1144 736 191 57 12641 1750 --
NM_130398chr1148 ------
NM_130434chr152419 172 11201 ----
NM_130435chr1062974 2776 2354 2297 1140 101 42983 311 279 158 ----
NM_130436chr2152709 1995 1906 1809 1766 --12817 --
NM_130438chr2163286 2572 2483 2386 2343 451 --13394 --
NM_130439chr102459 241 11570 291 65 --
NM_130439chr102459 241 11570 291 65 --
NM_130798chr1521139 513 ------
NM_130808chr32325 151 ------
NM_130809chr572720 1023 632 608 426 262 133 --11260 22276 457
NM_130811chr2031017 411 299 --1917 --
NM_130830chr312839 21571 57 13496 12560
NM_130838chr1521324 599 ------
NM_130839chr1521324 599 ------
NM_130846chr122911 869 --2982 31 --
NM_130847chr11105686 4957 4641 4519 4497 2090 1087 697 644 427 44868 1910 1121 22 ----
NM_133170chr20178002 7756 7478 7281 6720 6562 6068 5619 2527 2149 2005 1782 1707 1312 991 513 327 45016 3070 1650 929 --11698
NM_133177chr12802 755 --11027 --
NM_133178chr12802 755 --11027 --
NM_133265chrX52874 2777 2595 1010 174 12640 13228 23343 947
NM_133329chr251661 1558 1531 1154 421 ------
NM_133334chr476353 6188 6180 5253 1270 491 101 13894 13935 --
NM_133370chr483583 2963 2627 2349 1391 599 549 44 23624 3119 13066 --
NM_133372chr542397 1001 405 277 ----11868
NM_133378chr22918 68 --2346 154 --
NM_133432chr22918 68 --2346 154 --
NM_133433chr53682 636 568 ------
NM_133437chr22918 68 --2346 154 --
NM_133443chr1622266 1787 1773 --11547
NM_133445chr973177 3057 2731 2672 760 606 453 1222 ----
NM_133462chr33562 504 89 1392 ----
NM_133478chr252483 2407 1884 1874 540 11803 1695 --
NM_133493chr684488 3452 3263 3067 1702 1682 1278 243 14476 24445 1102 --
NM_133496chr174263 4072 1278 896 702 394 239 44532 2927 740 376 --12966
NM_133503chr124763 577 144 41 ------
NM_133504chr124763 577 144 41 ------
NM_133505chr124763 577 144 41 ------
NM_133506chr124763 577 144 41 ------
NM_133507chr124941 755 322 219 ------
NM_133509chr141386 21157 46 11011 1151
NM_133647chr1553156 2988 1329 1266 1180 2964 374 12570 --
NM_134442chr251498 1337 1094 1081 322 1141 ----
NM_134447chr192574 526 1394 ----
NM_138270chrX43368 2823 1312 204 1758 1121 13285
NM_138285chr21398 1345 ----
NM_138286chr1964376 3808 3757 3655 1626 273 43530 2801 374 165 ----
NM_138288chr1422046 1939 ------
NM_138292chr1192553 2443 2256 2201 1143 1077 864 788 437 1619 12231 13468
NM_138316chr1031337 1302 887 ----11105
NM_138328chr1733147 2981 2822 ------
NM_138333chr992074 2051 2017 1960 1808 996 792 602 49 11954 ----
NM_138347chr193591 163 157 --1202 --
NM_138353chr191445 ------
NM_138357chr1031867 1714 508 11182 1487 --
NM_138390chr222155 1518 21869 1370 ----
NM_138394chr2------148
NM_138423chr1572197 2172 2107 2083 730 512 240 11518 1473 --
NM_138426chr722311 1528 42175 1956 1762 956 11921 12134
NM_138455chr81336 --1326 --
NM_138458chr21366 ------
NM_138459chr653444 3081 2575 849 532 22966 1413 ----
NM_138468chr275602 2113 2044 1950 915 664 43 16283 21286 1243 --
NM_138473chr1285023 4322 3691 3189 1732 1450 1014 796 24899 3787 14807 --
NM_138485chr3--181 ----
NM_138571chr64490 133 82 31 1543 ----
NM_138572chr633247 2896 858 23326 280 --1296
NM_138576chr1474860 3597 1630 1589 1223 471 225 11085 1647 --
NM_138578chr201229 ------
NM_138621chr263120 2897 863 758 365 191 23907 708 14176 --
NM_138635chr763142 2884 1109 594 340 149 2557 201 1506 --
NM_138638chr1421840 936 12098 1758 --
NM_138690chr19191 ------
NM_138694chr6103574 3355 3324 3187 3005 2772 2710 2627 2310 2266 --11210 11006
NM_138711chr31166 ------
NM_138712chr31166 ------
NM_138713chr16147810 7177 7139 7052 6703 6468 6308 3199 2960 2374 1135 951 827 505 68164 7951 7695 5354 5057 2703 23265 291 --
NM_138714chr16147810 7177 7139 7052 6703 6468 6308 3199 2960 2374 1135 951 827 505 68164 7951 7695 5354 5057 2703 23265 291 --
NM_138771chr761520 1431 1208 1163 629 283 ------
NM_138773chr53795 621 41 ------
NM_138782chr592096 2064 1844 1814 1463 898 847 840 804 31524 862 406 ----
NM_138792chr151123 ------
NM_138799chr261794 1711 1270 699 339 134 ----156
NM_138812chr10--149 ----
NM_138923chrX2375 70 ------
NM_138927chr213410 261 237 1829 ----
NM_138931chr31718 ------
NM_138970chr1442277 2221 1963 62 2851 79 11837 --
NM_139012chr611749 11653 ----
NM_139014chr611829 11733 ----
NM_139048chr331204 848 76 11250 ----
NM_139057chr1552164 1874 607 578 347 12636 22360 242 12203
NM_139071chr1211637 --1469 --
NM_139072chr22877 288 ------
NM_139078chr12133 192 ----
NM_139135chr141343 1297 988 143 --1498 --
NM_139167chr82572 432 ------
NM_139168chr521496 575 ------
NM_139182chr441590 1433 1362 1211 21637 319 153 --
NM_139207chr124836 503 455 151 21590 826 ----
NM_139280chr1721424 134 ------
NM_139283chr1241859 1746 730 44 1101 22202 1952 --
NM_139312chr101420 11304 21516 453 --
NM_139319chr1261899 1682 1657 1598 1529 461 ------
NM_139323chr202733 365 ----11610
NM_144498chr20----1565 --
NM_144567chr152705 2589 1071 168 36 1323 1811 12598
NM_144571chr4176841 6705 6147 6130 5769 5453 5229 4580 4555 1682 1599 1225 1141 762 628 381 291 32662 2624 1456 25563 5282 --
NM_144574chr141454 1111 ----
NM_144576chr12186 1629 1129 --
NM_144584chr1--125 ----
NM_144586chr211076 ------
NM_144590chr1062856 2096 879 507 420 233 21147 667 ----
NM_144595chr132883 341 ------
NM_144609chr1711109 11406 21237 1034 --
NM_144610chr171381 ------
NM_144618chr11225 1530 1615 --
NM_144632chr272368 2329 2118 1515 349 327 169 11945 ----
NM_144633chr341511 1431 1314 1043 21270 32 1174 --
NM_144642chr34468 404 391 309 ------
NM_144643chr41319 ------
NM_144658chrX1262 ------
NM_144660chr101156 ------
NM_144664chr1152274 2115 1739 1603 402 1383 ----
NM_144718chr382499 2241 2190 2058 2005 1607 1009 858 21777 598 1880 --
NM_144721chr442630 2469 2131 588 51089 612 271 260 61 ----
NM_144775chr1734973 4233 3224 --13872 24066 3618
NM_144777chr132149 80 ------
NM_144949chr252635 2451 1989 773 501 21002 629 ----
NM_144963chr872685 2581 2112 1682 944 357 234 32236 2123 1672 --12379
NM_144966chr91199 ------
NM_144973chr1285020 4487 4406 4326 3795 1226 849 582 2809 599 15000 --
NM_144982chr121688 ------
NM_145000chr51406 ------
NM_145011chr1032213 2075 412 31827 897 851 1115 1517
NM_145012chr101993 ------
NM_145036chr17----131 --
NM_145037chr3--1112 1593 --
NM_145044chr341479 1275 480 85 21209 508 ----
NM_145055chr1862968 2827 2750 784 353 207 1283 12350 --
NM_145115chr71203 22322 943 22387 232 --
NM_145175chr221388 1041 21163 180 ----
NM_145176chr663419 2657 1183 814 725 212 32455 2393 631 13294 12934
NM_145203chr133918 910 324 1599 ----
NM_145206chr1022618 2606 1951 ----
NM_145251chr1441035 600 480 32 ------
NM_145259chr2156799 6012 5986 5700 5598 5235 4683 4305 2258 2235 2162 1743 736 438 29 56754 6377 4926 2470 887 1192 --
NM_145263chr431898 688 465 2497 224 ----
NM_145274chr172162 139 1233 ----
NM_145284chrX41799 441 266 165 2234 209 ----
NM_145290chr41256 ------
NM_145307chr10114609 4231 4160 3258 1492 1281 1158 1003 744 723 321 11207 ----
NM_145313chr1011580 ------
NM_145320chr783507 3390 3315 3124 2470 2385 1188 767 --12605 1173
NM_145321chr783507 3390 3315 3124 2470 2385 1188 767 --12605 1173
NM_145322chr783507 3390 3315 3124 2470 2385 1188 767 --12605 1173
NM_145331chr62775 181 ------
NM_145332chr62923 329 ------
NM_145333chr62923 329 ------
NM_145341chr102754 21 3761 724 703 ----
NM_145644chr21382 1322 ----
NM_145649chr652561 1727 401 217 199 --1478 --
NM_145655chr652561 1727 401 217 199 --1478 --
NM_145690chr841647 1436 1407 129 ------
NM_145698chr1051972 1880 1653 1597 549 31430 443 85 1218 --
NM_145716chr11165 ------
NM_145725chr141469 ------
NM_145726chr141469 ------
NM_145728chr1562336 773 450 279 206 101 1867 1146 --
NM_145733chr2231158 776 407 ----11135
NM_145759chr111754 --11686 --
NM_145800chrX21034 54 --1149 --
NM_145802chrX1983 --198 --
NM_145913chr12142 ------
NM_147150chr963776 3743 1558 1422 652 259 ------
NM_147156chr1041439 1131 1016 480 ------
NM_147164chr92449 129 ------
NM_147175chrX51879 1747 1610 873 753 3781 532 189 1396 --
NM_147223chr23929 434 276 ------
NM_147233chr23746 251 93 1881 ----
NM_148174chr862040 1558 1541 1396 898 804 22098 1614 --190
NM_148904chr1--1544 298 67 --
NM_148905chr1--1544 298 67 --
NM_148906chr1--1544 298 67 --
NM_148907chr1--1544 298 67 --
NM_148908chr1--1544 298 67 --
NM_148909chr1--1544 298 67 --
NM_148921chr1721703 560 ------
NM_148957chr1352599 2253 1012 576 82 2690 424 ----
NM_148977chr1031337 1302 887 ----11105
NM_148978chr1031337 1302 887 ----11105
NM_152132chr14287 34 ------
NM_152261chr1222099 2002 1710 ----
NM_152265chr121551 393 ------
NM_152272chr821295 163 ------
NM_152280chr172463 2420 2236 1003 759 216 114 1290 ----
NM_152291chr441118 724 139 131 ------
NM_152296chr19175 ------
NM_152300chr1721467 173 ------
NM_152309chr1041995 1761 814 49 ----11680
NM_152310chr102293 279 ------
NM_152332chr1472767 1969 1928 1123 372 105 64 21076 991 12291 --
NM_152342chr161451 --1495 1442
NM_152348chr171857 ------
NM_152352chr1812073 12679 32104 1151 954 --
NM_152366chr1--1109 ----
NM_152387chr25853 299 245 232 24 ------
NM_152388chr2113803 3080 2972 2960 2803 2690 1328 1294 1161 913 619 11605 13071 --
NM_152398chr4--1110 ----
NM_152400chr42702 241 41297 739 458 280 --11396
NM_152414chr851670 1465 1097 308 186 ------
NM_152417chr841194 330 248 162 ------
NM_152437chr1242474 2248 1583 932 128 1918 --
NM_152441chr122293 256 ----1595
NM_152446chr144881 795 666 72 ------
NM_152450chr1571628 1574 1494 778 524 467 299 ------
NM_152457chr161284 ------
NM_152470chr1842709 2599 1597 667 --1566 --
NM_152487chr131353 1173 574 1535 ----
NM_152499chr1--1346 ----
NM_152519chr252122 1490 1467 842 114 ------
NM_152520chr231044 257 71 ------
NM_152542chr462182 1930 1702 1633 1438 411 11743 11560 --
NM_152551chr652229 2202 2054 542 460 32753 2515 1941 13011 --
NM_152556chr732098 1020 154 21573 986 ----
NM_152588chr12--1333 1511 --
NM_152594chr1572351 2291 739 706 402 94 33 ------
NM_152605chr1941367 1282 1126 1071 ------
NM_152608chr1122583 2421 2378 2001 1891 1666 1001 874 840 504 414 388 --32528 701 543 --
NM_152622chr563524 3077 2222 1310 911 335 1846 ----
NM_152624chr5177371 6586 5593 5552 5097 5058 4844 4838 4586 2907 2597 1916 1373 1248 823 796 524 37358 5463 5414 ----
NM_152625chr51342 --1106 --
NM_152638chr1231260 1163 64 ------
NM_152641chr1252430 2192 1833 601 156 ----22418 482
NM_152643chr10----11499 --
NM_152653chr31660 ------
NM_152673chr343416 3259 1467 1336 44369 1591 602 397 ----
NM_152678chr322249 83 12471 12026 --
NM_152682chr42110 62 11325 ----
NM_152737chr651993 1539 1448 1299 719 --22029 1753 --
NM_152742chr7----1490 --
NM_152745chr741117 449 414 165 ------
NM_152753chr6126 11337 11511 --
NM_152754chr793759 3521 3233 2782 1505 1376 974 200 126 33042 2770 2424 ----
NM_152756chr593848 3613 3474 2855 2801 2666 1479 934 904 54340 4023 3808 3546 3520 ----
NM_152758chr863050 2636 2428 2165 786 573 22125 759 ----
NM_152787chrX93815 3676 3210 3104 1444 1258 984 921 564 ------
NM_152789chr711395 21159 57 ----
NM_152793chr7105030 4859 4820 4670 4230 4210 3369 1650 1075 414 21635 197 ----
NM_152829chr72159 72 1274 ----
NM_152835chr12872 342 ------
NM_152836chr831750 716 230 --11319 --
NM_152837chr831750 716 230 --11319 --
NM_152838chr2073333 3319 3263 3085 2659 2149 491 23256 3052 1916 --
NM_152866chr1132223 1895 787 1752 ----
NM_152903chr1342730 2217 2008 1012 ------
NM_152924chr15116734 6268 6006 5985 5357 5295 5155 4748 2412 1854 1117 --1979 --
NM_152989chr122540 418 ------
NM_152996chr151988 1894 1405 682 672 1414 ----
NM_152998chr7174 ------
NM_152999chr7144896 4424 4219 4119 3943 3700 3469 3380 3323 1669 1434 1186 841 330 13928 11995 --
NM_153013chr542126 1721 724 537 21995 577 ----
NM_153020chr661721 1489 560 207 57 49 ----11554
NM_153026chr121181 ------
NM_153035chr162968 2860 2310 2143 1001 701 12363 12932 --
NM_153038chr22715 99 ------
NM_153042chr62427 346 ------
NM_153182chr321050 722 23045 364 12805 --
NM_153184chr341830 1508 1429 1397 1222 ----
NM_153188chr5115514 4950 4243 3882 3465 1878 1196 828 606 298 47 33716 2199 2080 --14632
NM_153207chr12104101 4065 3566 2854 2654 924 798 755 584 49 33477 3378 2924 ----
NM_153223chr551266 323 254 106 49 11050 ----
NM_153261chr16--11382 11372 --
NM_153262chr172806 2113 1041 1024 938 835 371 ------
NM_153264chr33859 729 255 ------
NM_153267chr94940 769 96 87 ------
NM_153321chr171750 ------
NM_153322chr171750 ------
NM_153332chr883131 3051 2274 2073 2055 1314 1201 511 3306 118 64 12366 11108
NM_153342chr2183 ------
NM_153346chrX21458 436 31937 1399 1288 ----
NM_153367chr1053043 2658 2598 2446 1321 12784 ----
NM_153371chr1362172 2146 896 843 201 25 11552 1688 2531 495
NM_153456chr1386320 5645 4862 4358 1813 966 925 297 --25039 1995 --
NM_153607chr522911 949 23124 440 --12968
NM_153616chr1552196 2177 1934 1910 862 --1497 --
NM_153617chr1552196 2177 1934 1910 862 --1497 --
NM_153618chr1552196 2177 1934 1910 862 --1497 --
NM_153619chr1573434 3415 3172 3148 2399 2279 662 ------
NM_153620chr711565 --31228 1145 491 --
NM_153631chr731712 562 34 --1199 --
NM_153632chr731712 562 34 --1199 --
NM_153634chr1231514 283 247 1405 2613 367 --
NM_153640chr203403 392 165 ----183
NM_153645chr2231206 310 232 13277 --12730
NM_153689chr221518 862 1949 ----
NM_153693chr12------1680
NM_153702chr41104 ------
NM_153706chr5------1196
NM_153712chr22773 764 11119 ----
NM_153715chr7--11208 11141 --
NM_153757chr41414 ------
NM_153764chr1131095 79 34 2398 252 ----
NM_153765chr1131095 79 34 2398 252 ----
NM_153766chr1131095 79 34 2398 252 ----
NM_153767chr1131095 79 34 2398 252 ----
NM_153810chr1065129 3858 3653 2008 1266 420 11279 1227 --
NM_153828chr2------1743
NM_153831chr82297 144 ------
NM_170607chr1731395 1154 49 ------
NM_170665chr1244504 4050 467 444 11246 ----
NM_170674chr15------11057
NM_170675chr15------1733
NM_170676chr15------1733
NM_170677chr15------11057
NM_170686chr722720 741 2810 168 ----
NM_170706chr194326 4222 3997 3849 3461 2859 1426 1261 203 --11642 --
NM_170709chr822165 232 ----1356
NM_170710chr463084 2435 843 816 268 72 22624 880 12305 12093
NM_170723chrY------1100
NM_170740chr633484 2311 1167 31332 1216 137 ----
NM_170754chr121479 ------
NM_170775chr51310 1235 ----
NM_170783chr61176 ------
NM_171998chrX42109 802 787 69 21987 1971 ----
NM_172016chr621289 1264 ------
NM_172037chr82581 528 11182 --1412
NM_172058chr841746 1421 462 133 --2103 69 --
NM_172059chr841746 1421 462 133 --2103 69 --
NM_172060chr841746 1421 462 133 --2103 69 --
NM_172069chr232215 1611 137 --1343 --
NM_172070chr21617 2777 609 ----
NM_172071chr1147248 7085 6609 6234 5953 5493 5124 4939 4839 2834 2773 2258 1486 713 36952 5415 5198 16417 14587
NM_172103chr642581 1913 706 551 22060 991 ----
NM_172105chr642581 1913 706 551 22060 991 ----
NM_172127chr461825 1713 1503 1380 771 436 150 ----
NM_172128chr461781 1669 1459 1336 727 392 ------
NM_172159chr32632 79 --1778 11858
NM_172160chr32632 79 --1778 11858
NM_172218chr82608 168 1875 1880 --
NM_172315chr15------11057
NM_172316chr15------11057
NM_172344chr251661 1558 1531 1154 421 ------
NM_173082chr621510 1495 1130 11230 --
NM_173083chr161297 984 864 464 284 118 ------
NM_173198chr952550 1111 1092 613 510 ------
NM_173200chr952550 1111 1092 613 510 ------
NM_173214chr16147810 7177 7139 7052 6703 6468 6308 3199 2960 2374 1135 951 827 505 68164 7951 7695 5354 5057 2703 23265 291 --
NM_173355chr22946 223 1195 ----
NM_173359chr32595 107 ------
NM_173463chr454534 4485 3821 2771 785 21139 438 21401 1073 13590
NM_173468chr4125512 5219 4247 4106 2042 1987 1957 1919 1844 1834 1662 1495 25207 2147 --11389
NM_173469chr1541419 1256 134 50 ------
NM_173470chrX102399 2239 2218 1923 1817 1038 913 724 629 351 12148 12906 --
NM_173471chr311089 --1236 --
NM_173478chr17198 2745 277 --2921 128
NM_173495chrX72493 2421 2128 2057 1781 286 183 ------
NM_173508chr131001 470 141 3444 344 325 ----
NM_173510chr2242343 1976 759 514 11843 ----
NM_173511chr283833 3755 3366 3316 3133 2788 2585 2532 1592 23144 1465 23117 586
NM_173515chr6----1114 --
NM_173517chr71181 1121 --2351 30
NM_173519chr81482 21908 1388 ----
NM_173531chr1963850 3098 2862 2545 1547 905 33336 1370 1297 ----
NM_173536chr495136 4558 4199 3880 3357 1370 589 349 55 1983 24796 3980 --
NM_173552chr332320 376 72 1922 ----
NM_173576chr1092345 2190 1962 1738 1717 1478 901 727 465 1651 ----
NM_173595chr12104963 4949 4472 4305 4269 3858 2126 1660 905 468 --14344 --
NM_173602chr1253362 3092 2913 1196 960 32445 858 656 ----
NM_173607chr1452139 1764 1712 1524 610 1454 ----
NM_173645chr22482 24 ------
NM_173654chr341819 1558 901 80 42156 510 344 308 --12175
NM_173658chr31269 ------
NM_173667chr521577 715 12476 1910 2419 177
NM_173683chr811676 ------
NM_173797chr531016 919 478 ------
NM_173803chr161547 1409 ----
NM_173808chr1104122 3440 1797 1611 1282 836 765 681 282 63 34269 3148 675 24175 1253 11596
NM_173809chr10--31380 535 204 --11095
NM_173822chr231955 1417 414 ------
NM_173825chr372616 2288 2187 2089 1132 1080 737 --1467 --
NM_173826chr351310 1199 383 152 72 ------
NM_173829chr5106114 5654 5041 4548 2207 1227 861 649 507 196 36138 4558 2309 --24042 3922
NM_173848chr84904 668 258 106 1832 ----
NM_174890chr101294 1772 --1838
NM_174902chr1151539 1252 1214 64 35 ------
NM_174909chr51121 ------
NM_174911chr833452 3100 1025 11172 11268 --
NM_174916chr1561717 1526 918 417 348 210 1760 1569 --
NM_174921chr41320 2916 150 ----
NM_175038chr12----182 --
NM_175056chr361830 1605 1567 1556 1445 479 2123 82 ----
NM_175061chr762143 1917 1653 1527 768 644 --11949 --
NM_175610chr1551419 1411 1382 1304 51 11405 ----
NM_175630chr21928 2805 191 --1655
NM_175736chr12157706 7583 7172 7112 6979 6700 6652 5597 5469 5229 2887 2373 2329 970 305 26166 5559 --25488 442
NM_175748chr1421755 838 1736 ----
NM_175834chr121283 ------
NM_175854chr1332737 2096 1067 1482 12770 --
NM_175863chr651363 1322 1066 504 107 1394 ----
NM_175873chr541466 1313 1157 540 ------
NM_175907chr1842603 2286 1947 74 ------
NM_175921chr564280 3903 3398 581 274 205 41189 987 522 373 ----
NM_176081chr10115669 5208 5063 4525 3844 3806 2379 1682 441 278 113 55537 4569 4321 1806 1797 13860 --
NM_176083chr10115669 5208 5063 4525 3844 3806 2379 1682 441 278 113 55537 4569 4321 1806 1797 13860 --
NM_176812chr201243 ------
NM_176814chr72364 324 1951 ----
NM_176823chr143430 2379 785 142 13485 23906 1132 23889 3308
NM_177414chr121473 1159 1650 --2667 72
NM_177424chr161336 827 613 572 473 182 --1324 --
NM_177438chr14124248 4183 4016 3935 3699 2808 1544 1503 1118 1104 823 697 ----1224
NM_177452chr1452177 1543 1534 953 130 ------
NM_177538chr2118884 8534 8324 8260 8129 7516 6160 6123 5853 2632 469 45819 2377 2012 1175 18519 18362
NM_177949chrX--137 ----
NM_177952chr141254 1672 1677 --
NM_177966chr321748 1723 11292 1390 --
NM_177968chr23685 534 66 1472 1485 --
NM_177974chr1572197 2172 2107 2083 730 512 240 11518 1473 --
NM_177976chr32443 30 ------
NM_177985chr222309 1820 31741 1523 165 ----
NM_177989chr3----1121 --
NM_177990chr2031847 1750 644 ------
NM_178006chr1341990 1819 399 165 32028 1627 772 ----
NM_178007chr1341990 1819 399 165 32028 1627 772 ----
NM_178010chr122540 418 ------
NM_178037chr1222835 607 --11095 1844
NM_178038chr1222835 607 --11095 1844
NM_178042chr3----1121 --
NM_178151chrX156189 6103 4932 3083 3037 2642 2613 2598 2545 2500 1943 1394 1324 724 337 32176 1215 454 65574 5031 4970 2383 922 708 --
NM_178152chrX156189 6103 4932 3083 3037 2642 2613 2598 2545 2500 1943 1394 1324 724 337 32176 1215 454 65574 5031 4970 2383 922 708 --
NM_178153chrX156189 6103 4932 3083 3037 2642 2613 2598 2545 2500 1943 1394 1324 724 337 32176 1215 454 65574 5031 4970 2383 922 708 --
NM_178171chr171627 1114 --1706
NM_178313chr221704 152 ----1576
NM_178424chr52421 139 ------
NM_178426chr162031 1730 1639 781 300 167 12164 ----
NM_178427chr161931 1630 1539 681 200 67 12064 ----
NM_178445chr3--192 2934 374 1369
NM_178509chr1783140 2999 2932 2742 1595 1216 219 79 21234 305 ----
NM_178539chr1241867 1443 518 501 12052 ----
NM_178548chr12439 231 ------
NM_178554chr353502 3079 2427 841 505 ----11181
NM_178565chr811171 ------
NM_178566chr951384 702 471 111 81 1349 ----
NM_178582chr201437 --1453 --
NM_178812chr84573 493 248 113 --11015 --
NM_178815chr1052734 2161 2025 1880 194 --12338 --
NM_180989chr1332107 1758 580 ------
NM_181054chr142275 206 1163 ----
NM_181265chr463084 2435 843 816 268 72 22624 880 12305 12093
NM_181302chr141454 1111 ----
NM_181308chr141454 1111 ----
NM_181354chr81382 11238 1583 --
NM_181356chr61832 ------
NM_181358chr153102 2757 1298 915 101 13828 1532 --
NM_181443chr2072669 2564 2435 935 442 338 136 1695 ----
NM_181481chr1876762 6032 5617 5452 5085 2172 2008 --22814 991 --
NM_181482chr1876762 6032 5617 5452 5085 2172 2008 --22814 991 --
NM_181483chr1876762 6032 5617 5452 5085 2172 2008 --22814 991 --
NM_181486chr123451 306 184 ------
NM_181643chr141584 1430 1289 314 ------
NM_181645chr113591 264 127 ------
NM_181659chr2072667 2527 2249 1379 1221 939 342 --11214 --
NM_181659chr2072667 2527 2249 1379 1221 939 342 --11214 --
NM_181671chr172378 174 --182 --
NM_181674chr51101 128 ----
NM_181675chr51101 128 ----
NM_181676chr51101 128 ----
NM_181677chr51101 128 ----
NM_181678chr51101 128 ----
NM_181702chr82793 65 --1650 --
NM_181705chr544770 4683 4528 4334 45533 5263 242 143 1281 --
NM_181706chr112628 427 31661 688 650 1544 --
NM_181712chr141691 1379 675 641 1588 --11290
NM_181714chr631794 1501 367 11394 --1599
NM_181782chr65912 807 777 563 300 21690 422 ----
NM_181783chr1251915 1860 1482 1424 286 11724 ----
NM_181787chr8123672 3655 3584 3366 2975 2389 1548 1059 1002 821 716 291 13778 23759 909 --
NM_181794chr63336 80 32 ------
NM_181795chr63336 80 32 ------
NM_181836chr592698 2649 2504 2446 2369 2201 2017 1886 1662 22325 915 12676 --
NM_181861chr1222206 189 12591 2792 637 1453
NM_181868chr1222206 189 12591 2792 637 1453
NM_181869chr1232291 274 51 12676 2877 722 1538
NM_181897chr352210 1911 1807 278 187 2676 557 ----
NM_182485chr473650 3644 3356 3106 1036 547 315 ------
NM_182488chr131816 1962 ----
NM_182493chr1674731 3906 3663 2103 704 670 606 35185 4798 3287 44992 4834 3955 2094 --
NM_182503chr6104856 4775 4669 4081 3808 3566 3487 1951 885 108 35162 3842 3654 12147 11445
NM_182540chrX2893 576 ------
NM_182551chr263444 3217 1214 193 179 169 ------
NM_182557chr1112189 ------
NM_182569chr172290 249 ------
NM_182607chrX31352 1307 214 21680 1462 1395 11525
NM_182641chr172711 162 1370 ----
NM_182646chr473650 3644 3356 3106 1036 547 315 ------
NM_182648chr141132 ------
NM_182689chr1--1306 ----
NM_182690chr1--1368 ----
NM_182691chr731220 985 433 1534 --1385
NM_182692chr731220 985 433 1534 --1385
NM_182697chr7187 --11708 --
NM_182710chr112372 321 ------
NM_182715chr731280 1133 969 ------
NM_182758chr1553780 3505 3385 944 433 1522 ----
NM_182762chr7135851 5674 5455 5347 5299 5069 4728 4077 4035 3992 2270 1973 1893 54635 4119 3948 2468 161 --15229
NM_182765chr1082349 2337 2252 2153 1599 1495 906 24 ------
NM_182767chr1231954 1358 323 1213 --1101
NM_182797chr2041822 1204 1188 562 11142 --1406
NM_182830chr1431932 1908 213 11501 ----
NM_182898chr785251 4641 4633 4234 2345 1800 419 337 25831 1358 24464 2093 --
NM_182899chr785251 4641 4633 4234 2345 1800 419 337 25831 1358 24464 2093 --
NM_182907chr682000 1932 1888 956 763 718 488 380 1169 ----
NM_182931chr71667 ------
NM_182948chr163098 2957 2363 2086 2072 1261 32697 2560 2533 12294 1289
NM_182972chr132524 1891 573 12737 --12047
NM_182976chr12800 139 ------
NM_182977chr54935 742 733 182 ------
NM_183006chr201152 ------
NM_183043chr132950 701 --1318 --
NM_183044chr132950 701 --1318 --
NM_183049chr41378 ------
NM_183078chr653280 3121 2663 2338 1447 --13768 2870 443
NM_183079chr2041093 328 269 35 1319 ----
NM_183353chrX1280 ------
NM_183376chr1522567 925 1698 --1977
NM_183380chr62834 724 ------
NM_183416chr121791 341 --11654 --
NM_183419chr831433 1323 1176 1491 ----
NM_183422chr132852 187 ------
NM_184234chr203860 718 666 --2833 120 --
NM_194071chr733703 3307 1344 13329 24954 4781 --
NM_194247chr274069 3852 3656 3007 1384 1065 739 23771 732 13813 --
NM_194278chr1454084 3834 3749 2770 788 12632 11012 --
NM_194282chr422903 966 42043 1005 638 181 11164 13101
NM_194283chr544212 3172 1672 1443 32618 352 86 ----
NM_194285chr1133417 3101 483 11246 1309 --
NM_194286chr1285982 5255 5222 4585 4047 2232 1298 957 --21929 1628 14217
NM_194291chr872964 2719 2031 1094 956 687 461 42866 2617 1055 502 ----
NM_194314chr164937 4136 3887 1687 1276 182 45583 4751 1934 339 --15416
NM_194328chr993304 2407 2400 2367 2085 844 560 365 76 22813 1075 ----
NM_194329chr993304 2407 2400 2367 2085 844 560 365 76 22813 1075 ----
NM_194330chr993304 2407 2400 2367 2085 844 560 365 76 22813 1075 ----
NM_194332chr993304 2407 2400 2367 2085 844 560 365 76 22813 1075 ----
NM_194358chr1261245 681 611 456 354 235 --1323 --
NM_194359chr1261245 681 611 456 354 235 --1323 --
NM_194434chr1895571 5040 3993 3849 3606 2141 1307 1061 148 13521 --15188
NM_194463chrX21231 292 ------
NM_197941chr52596 500 1152 --1814
NM_197968chr132644 149 ------
NM_197970chr221112 1102 21497 1435 ----
NM_198040chr121049 1035 ------
NM_198057chrX--11267 ----
NM_198081chr641212 1114 557 151 43009 1922 935 624 12669 --
NM_198087chr1611383 1109 --1604
NM_198088chr1611383 1109 --1604
NM_198098chr7--11847 ----
NM_198123chr861550 1504 1411 1165 595 588 ------
NM_198124chr861550 1504 1411 1165 595 588 ------
NM_198128chr1832115 2086 657 22266 685 ----
NM_198129chr181268 ------
NM_198158chr322984 676 --22453 2410 11127
NM_198159chr322984 676 --22453 2410 11127
NM_198177chr322984 676 --22453 2410 11127
NM_198178chr322984 676 --22453 2410 11127
NM_198181chr1562224 2072 1922 1851 644 492 ------
NM_198204chr1731395 1154 49 ------
NM_198205chr1731395 1154 49 ------
NM_198212chr7--21655 1557 ----
NM_198215chr101460 ------
NM_198217chr132917 376 1254 ----
NM_198218chr132917 376 1254 ----
NM_198219chr132917 376 1254 ----
NM_198225chr1041857 555 525 45 11724 1725 --
NM_198240chr1241314 1008 932 164 --11016 --
NM_198243chr15----2914 89 --
NM_198268chr153102 2757 1298 915 101 13828 1532 --
NM_198269chr153102 2757 1298 915 101 13828 1532 --
NM_198270chrX62793 2469 2362 685 211 131 22374 89 1251 --
NM_198273chr583189 3157 3045 2539 2522 2192 1175 1156 ------
NM_198316chr121479 ------
NM_198320chr12104877 4839 3293 3238 3195 2026 1944 253 193 115 --15035 --
NM_198336chr741581 1516 1340 1191 ----2712 577
NM_198381chr1121355 127 ------
NM_198391chr2031308 1147 1103 1176 ----
NM_198395chr551233 825 266 205 96 1965 ----
NM_198400chr1542933 2849 982 56 --12681 --
NM_198428chr7--2784 334 ----
NM_198449chr51445 --1546 --
NM_198465chrX52603 2247 1833 1040 51 21824 471 12419 --
NM_198468chr6104254 4043 3389 3030 1829 1613 1488 1251 1076 110 33817 3723 3041 12925 --
NM_198503chr152011 1707 538 296 122 1914 ----
NM_198504chr31904 2655 84 ----
NM_198531chr181671 ------
NM_198549chr142650 2170 1306 23 --12031 --
NM_198567chr51136 194 ----
NM_198581chr287355 7064 5766 5439 5384 1861 999 667 11011 14903 15165
NM_198715chr165121 1533 1492 1035 848 207 --16030 --
NM_198793chr353861 3494 3027 994 561 23557 2879 23895 283 --
NM_198794chr1441402 988 483 264 ------
NM_198859chr373905 3854 3321 3148 1690 635 476 ----13652
NM_198889chr431257 1216 1109 21063 431 ----
NM_198896chr1132220 1530 1373 1323 11431 --
NM_198900chr12157706 7583 7172 7112 6979 6700 6652 5597 5469 5229 2887 2373 2329 970 305 26166 5559 --25488 442
NM_198904chr542052 1781 1356 516 145 11546 1841
NM_198935chr20123250 2948 2910 2880 2344 2247 2182 2140 1276 980 917 346 ----12095
NM_198968chr1363587 3110 2976 1475 1251 1075 ------
NM_198989chr134523 468 390 174 ------
NM_198990chr753089 2728 2451 2420 990 12299 --11256
NM_198991chr181720 ------
NM_199000chr722301 647 ------
NM_199040chr1293288 2740 2414 1099 498 484 316 157 129 ----33275 1300 39
NM_199053chr41719 1231 ----
NM_199072chr7102437 2256 2229 2085 826 764 414 214 133 48 23241 3111 ----
NM_199169chr2043319 1227 521 267 2706 340 ----
NM_199170chr2043319 1227 521 267 2706 340 ----
NM_199171chr2043319 1227 521 267 2706 340 ----
NM_199188chr12103766 3546 3423 3370 3309 1446 1346 964 439 310 2995 763 ----
NM_199190chr12103766 3546 3423 3370 3309 1446 1346 964 439 310 2995 763 ----
NM_199229chr241178 1093 202 38 ------
NM_199246chr541110 886 373 271 21235 943 ----
NM_199324chr452685 2313 1393 1165 822 13345 ----
NM_199328chr2131146 1053 311 1117 ----
NM_199346chr22135 28 ------
NM_199418chr11----125 --
NM_199421chr14114648 4406 3586 3564 1644 1363 976 785 646 420 116 63962 3248 1840 1706 1689 385 13626 --
NM_199437chr111833 ------
NM_199438chr111833 ------
NM_199439chr111833 ------
NM_199454chr134747 4615 1407 1194 --11368
NM_199461chr1043173 2902 2736 1044 1846 1352 1980
NM_199478chrX41928 1496 1288 329 11275 ----
NM_199511chr31728 ------
NM_199512chr31728 ------
NM_201269chr131469 1241 1043 ------
NM_201278chr1162141 2108 2046 1788 216 131 2956 855 ----
NM_201281chr1162141 2108 2046 1788 216 131 2956 855 ----
NM_201413chr2141073 966 952 781 ------
NM_201414chr2141073 966 952 781 ------
NM_201428chr1121631 1026 11649 ----
NM_201429chr1121631 1026 11649 ----
NM_201430chr1111557 11575 ----
NM_201435chr12145 1698 ----
NM_201436chr71848 1345 ----
NM_201437chr81614 11487 11312 --
NM_201516chr73904 581 21 ------
NM_201517chr71848 1345 ----
NM_201545chr1--21448 1208 --11367
NM_201570chr1041894 1263 489 371 --21396 1297 --
NM_201571chr1041894 1263 489 371 --21396 1297 --
NM_201572chr1041894 1263 489 371 --21396 1297 --
NM_201590chr1041894 1263 489 371 --21396 1297 --
NM_201591chr461858 1747 560 238 175 168 --21464 573 --
NM_201592chr461858 1747 560 238 175 168 --21464 573 --
NM_201593chr1041894 1263 489 371 --21396 1297 --
NM_201596chr1041894 1263 489 371 --21396 1297 --
NM_201597chr1041894 1263 489 371 --21396 1297 --
NM_201995chr112699 149 ------
NM_201998chr112764 214 ------
NM_201999chr41383 1364 ----
NM_203291chr181235 ------
NM_203292chr181228 ------
NM_203327chr2063456 3440 3072 2863 1152 518 13580 14253 --
NM_203342chr153264 3100 2962 2919 2633 53627 2933 821 178 135 11364 --
NM_203343chr153264 3100 2962 2919 2633 53627 2933 821 178 135 11364 --
NM_203354chr143264 213 184 2164 42 ----
NM_203355chr143264 213 184 2164 42 ----
NM_203356chr143264 213 184 2164 42 ----
NM_203390chr831302 1175 290 ------
NM_203391chrX51403 1341 1207 379 335 ------
NM_203394chr1231820 1694 530 12195 12270 --
NM_203406chr542433 2251 2244 2215 22391 631 ----
NM_203437chr23932 364 337 1919 ----
NM_203446chr2162855 2385 1110 501 83 23 11124 ----
NM_203458chr123191 1213 1708 ----
NM_203459chr141891 1729 888 73 --11909 --
NM_203473chrX1300 ------
NM_203474chrX1300 ------
NM_203475chrX1300 ------
NM_203476chrX1300 ------
NM_203487chr1361573 1517 1252 227 191 83 11366 --1727
NM_203504chr462252 2139 922 406 388 319 1540 --1173
NM_203505chr462252 2139 922 406 388 319 1540 --1173
NM_205836chr51226 ------
NM_205842chr22296 112 ----1697
NM_205860chr151167 1028 912 880 347 22491 377 12995 12176
NM_205864chr61161 ------
NM_206594chr153338 2853 1170 1153 951 --11189 --
NM_206595chr153338 2853 1170 1153 951 --11189 --
NM_206852chr141660 1119 ----
NM_206853chr663882 3210 1089 1037 743 307 163 ----
NM_206854chr685143 4471 3556 2004 1568 1044 685 231 21324 969 ----
NM_206855chr686108 5436 4521 2533 2009 1650 1196 506 64050 2289 1934 822 767 626 ----
NM_206857chr141660 1119 ----
NM_206860chr101177 ------
NM_206861chr101177 ------
NM_206862chr101177 ------
NM_206866chr2182749 2229 2157 2045 1202 436 334 132 1545 21087 725 --
NM_206876chr253469 3421 2434 1249 267 23219 540 ----
NM_206907chr552671 2603 2094 470 125 33342 2927 858 --11025
NM_206909chr8125119 5074 3324 2865 2849 2142 1998 1461 1147 809 449 300 58436 5782 5411 3160 2433 27567 1193 --
NM_206915chrX1237 ------
NM_206917chrX1237 ------
NM_206927chr112251 140 ------
NM_206928chr112251 140 ------
NM_206929chr112251 140 ------
NM_206930chr112251 140 ------
NM_206937chr133681 657 250 ------
NM_207012chr1073544 3367 3268 2258 1002 991 690 ----11288
NM_207015chr332029 652 298 2737 630 ----
NM_207170chr13299 234 48 1842 ----
NM_207189chr1------1100
NM_207292chr343319 2928 2409 820 13078 --12901
NM_207293chr343319 2928 2409 820 13078 --12901
NM_207294chr343319 2928 2409 820 13078 --12901
NM_207295chr343319 2928 2409 820 13078 --12901
NM_207296chr343319 2928 2409 820 13078 --12901
NM_207297chr343344 2953 2434 845 13103 --12926
NM_207311chr1221327 837 --11103 --
NM_207321chr105944 929 282 257 74 11080 ----
NM_207361chr13106218 5830 5498 5450 5257 4605 3913 2114 1885 1399 12207 ----
NM_207372chr1021731 536 1870 12329 12435
NM_207396chr111859 1418 2457 154 --
NM_207404chr351461 757 681 514 82 2609 594 ----
NM_207406chr4106574 6346 6242 6069 5900 5364 4234 4133 644 301 --11783 --
NM_207481chr251451 1386 1101 203 42 ------
NM_207517chr151192 11830 ----
NM_207518chr191549 2558 117 ----
NM_207520chr2------1743
NM_207521chr2------1743
NM_207577chr1132653 1938 315 11821 11893 12421
NM_207578chr13508 287 244 ------
NM_207645chr1131244 299 198 ------
NM_212471chr1772225 2061 1699 1688 911 615 161 1482 ----
NM_212472chr1772225 2061 1699 1688 911 615 161 1482 ----
NM_212554chr1021659 351 ------
NM_213589chr285271 4931 4218 3603 2019 1154 604 261 ----11506
NM_213606chr1032256 1754 26 22693 308 --2848 358
NM_213619chr82134 101 ------
NM_213620chr82134 101 ------
NM_213651chr181303 1290 693 560 429 384 335 256 11623 148 --
NM_213654chr341567 1522 421 335 ------