TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-5188
miRNA Sequence: AAUCGGACCCAUUUAAACCGGAG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000618chr1236435 6027 4727 ----1468
NM_000618chr1236435 6027 4727 ----1468
NM_001001974chr1031654 746 236 ----12102
NM_001003652chr1868250 7543 7096 6377 2623 1353 27701 7453 11470 --
NM_001013620chr1257784 7351 7023 2733 2104 ----12672
NM_001018090chr1522441 587 ----1249
NM_001018091chr1532551 697 101 ----1359
NM_001018102chr1522441 587 ----1249
NM_001025077chr1076215 5449 5182 4648 2651 1492 1120 --35989 1849 1072 --
NM_001039547chr356985 6523 5879 5414 1518 ----13048
NM_001204chr267507 5168 5142 1715 1619 717 12601 ----
NM_001356chrX32458 2031 614 ----1835
NM_001358chr42150 67 ----193
NM_003034chr1247499 5543 5303 4962 --17411 17184
NM_005065chr1455231 1372 450 442 153 24279 1136 ----
NM_005095chr1----12079 21746 1717
NM_005901chr1868250 7543 7096 6377 2623 1353 27701 7453 11470 --
NM_005909chr521088 581 ----11534
NM_006599chr1636338 5385 1794 1767 12109 12135
NM_006620chr634607 3822 1058 24095 1064 ----
NM_006731chr9105558 5086 2247 2241 2064 1530 1290 746 474 143 13517 ----
NM_007236chr1532467 806 292 ----12323
NM_007249chr1388755 6361 1907 1853 700 678 161 120 --13212 --
NM_013231chr1433867 2961 481 14294 2768 740 13949
NM_014877chr1757092 6384 5437 5299 2021 32497 2129 1484 15398 --
NM_014904chr1024014 1364 13645 --11003
NM_015049chr243097 2312 822 79 --12159 13241
NM_015532chr1522441 587 ----1249
NM_016260chr257513 5961 5537 2470 332 11700 16426 --
NM_017563chr385538 2563 2069 1455 1125 735 235 51 ------
NM_017650chr715862 --15827 15774
NM_020766chrX22924 1369 ----13868
NM_021622chr1031654 746 236 ----12102
NM_032160chr1813996 12802 13671 13988
NM_080927chr332845 2765 723 ----12356
NM_138713chr1636338 5385 1794 1767 12109 12135
NM_138714chr1636338 5385 1794 1767 12109 12135
NM_173214chr1636338 5385 1794 1767 12109 12135
NM_173552chr321522 439 ----1305
NM_173602chr1232944 1242 361 ----11346
NM_175624chr1297749 6740 6118 5745 5508 5307 2692 495 96 ------
NM_175625chr1297749 6740 6118 5745 5508 5307 2692 495 96 ------
NM_198581chr227546 1698 ----16236
NM_207406chr444865 2586 1836 229 --15820 14969