TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-518a-3p
miRNA Sequence: GAAAGCGCUUCCCUUUGCUGGA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000037chr832389 2267 1907 ------
NM_000052chrX42617 2164 390 136 23272 2485 1586 13108
NM_000080chr17----1961 --
NM_000084chrX86522 5277 2332 1878 1294 620 449 272 26952 6589 --1943
NM_000109chrX--12657 --1418
NM_000138chr1521842 678 --1327 --
NM_000151chr1711372 ------
NM_000163chr53835 697 332 ------
NM_000192chr1211593 --11354 --
NM_000217chr1254094 4010 1758 341 92 14745 ----
NM_000314chr10--1287 11127 --
NM_000366chr15----1190 --
NM_000386chr17------1160
NM_000393chr231546 1348 302 ------
NM_000428chr1422347 131 1216 ----
NM_000430chr1742643 875 711 457 11248 ----
NM_000462chr1531818 1684 521 ----11869
NM_000484chr211828 2381 103 ----
NM_000489chrX43409 2425 1088 315 1528 12297 --
NM_000505chr5----1140 --
NM_000555chrX55444 4858 2936 1506 1423 16936 22984 97 --
NM_000633chr1854935 1894 1182 959 374 11806 11832 --
NM_000719chr1222578 787 --11763 --
NM_000801chr20------11116
NM_000817chr221029 454 ----11210
NM_000828chrX2716 228 --1814 --
NM_000842chr11----1299 --
NM_000872chr10----1260 --
NM_000875chr1567036 6618 6284 5883 2380 1371 --35575 5473 4540 --
NM_000891chr1721393 492 --1902 12717
NM_000924chr12----1854 --
NM_000945chr231852 1551 36 --1537 --
NM_000961chr2023203 126 ------
NM_000962chr931111 749 42 ------
NM_000965chr321246 480 --1381 --
NM_001001132chr21----1319 --
NM_001001323chr1232074 1197 961 --22514 476 --
NM_001001331chr332171 1725 56 --11686 --
NM_001001396chr121344 1076 --12925 --
NM_001001419chr555079 2059 998 796 276 --15176 --
NM_001001433chr2022871 1216 --23001 2807 --
NM_001001549chr752703 2452 2070 928 458 --12757 --
NM_001001852chr222807 138 ------
NM_001001995chrX----11258 --
NM_001002257chr21932 11426 13136 --
NM_001002843chr1521148 822 --11206 --
NM_001003407chr1044339 3744 1610 1598 --11217 15142
NM_001003652chr1868203 6638 3425 2976 2748 1047 46465 6441 3142 2100 18623 --
NM_001003674chr1866860 6622 5885 1269 442 279 15446 25126 4946 --
NM_001003786chr17----1661 --
NM_001003792chr3----1943 --
NM_001003800chr9----22966 1475 --
NM_001003810chr42871 196 --1655 --
NM_001004051chrX----161 --
NM_001004720chr2----1662 --
NM_001005417chr1------1702
NM_001005463chr10----12105 --
NM_001005609chrX23845 3731 --2663 500 --
NM_001006623chr24697 538 247 159 --22497 327 --
NM_001006635chr22142 101 ------
NM_001006932chr643324 3273 3035 2412 12974 11126 --
NM_001006935chrX------136
NM_001007097chr943817 3630 907 41 11152 24017 340 --
NM_001007237chr142376 2186 839 523 --1983 --
NM_001007527chr5--1715 1547 --
NM_001007538chr1311211 ------
NM_001008408chr7186173 6040 5967 5948 5514 5276 5081 4817 4713 4110 4053 4026 1621 1558 1547 1066 275 255 11445 ----
NM_001008493chr11450 11569 ----
NM_001008660chr11----11170 --
NM_001009584chrX2371 47 --1585 --
NM_001009899chr351618 1147 759 753 196 --16190 --
NM_001009960chr722809 860 --12827 --
NM_001009993chr224312 1386 33821 3444 945 13672 --
NM_001010888chrX34531 1175 131 14345 23399 3357 199
NM_001010891chr511168 --1545 --
NM_001010942chr1221071 939 --1519 --
NM_001010971chr11872 --1994 --
NM_001010989chr162491 130 ----1509
NM_001011513chr424052 1624 --12764 --
NM_001011537chr332118 1692 537 ----12294
NM_001011663chr103953 669 146 --1408 --
NM_001011666chr744652 2551 811 221 --34502 2112 229 --
NM_001012329chr122311 189 1753 1571 1359
NM_001012977chrX21426 468 ------
NM_001012979chrX155 ----188
NM_001013620chr1268425 8333 5311 1665 1448 791 --15703 --
NM_001014431chr142987 144 --1904 --
NM_001015508chr81246 --1646 --
NM_001015877chrX32892 984 747 --1627 --
NM_001017368chr1722180 1833 12824 --1460
NM_001017440chr777269 7068 5249 5180 3310 2780 1081 ----1217
NM_001017523chr122572 401 --11892 --
NM_001017926chr831332 708 97 --11148 --
NM_001018037chr931459 1323 1010 ------
NM_001023567chr15----1355 --
NM_001024649chr532928 2287 601 ------
NM_001024808chr1252357 859 747 409 368 --11098 --
NM_001025068chr331691 1132 652 --11261 --
NM_001025076chr1055470 5206 3794 1790 790 ------
NM_001025079chr321469 1247 --11362 --
NM_001025201chr22686 189 ------
NM_001025252chr8--1312 23200 102 --
NM_001025266chr343653 3252 1953 908 --13434 --
NM_001030007chr1613132 13556 33655 2846 1380 --
NM_001030055chr1443098 1218 384 372 --13067 --
NM_001030287chr1----1467 --
NM_001031695chr2264658 2187 2181 594 565 306 23947 3336 --14577
NM_001031804chr1664181 3715 2853 2729 1684 1180 --13084 --
NM_001031812chr542128 1828 724 674 --1231 --
NM_001032280chr61429 11372 ----
NM_001032282chr8----11023 1947
NM_001032999chr2024316 49 14207 15245 --
NM_001033059chr6160 --189 --
NM_001033112chr51730 --1720 --
NM_001033518chr722151 289 1548 12744 --
NM_001033561chr17----1717 --
NM_001033925chr1031448 522 143 --1762 --
NM_001034194chr4------1143
NM_001035260chr101424 --1289 --
NM_001035534chr921190 490 11496 ----
NM_001037164chr73544 340 181 ------
NM_001037165chr756821 3332 3217 974 240 --12910 18505
NM_001037172chr31102 --11200 --
NM_001037331chr181178 --1370 --
NM_001037332chr521902 730 --1247 --
NM_001039465chr14----198 --
NM_001039547chr356138 3100 2555 585 139 ------
NM_001039577chr144498 3817 3239 161 11050 31590 185 32 11549
NM_001039690chr1611513 --32329 1831 1722 --
NM_001039840chrX52430 1982 1472 462 447 1511 14680 --
NM_001040001chr6----11872 --
NM_001040031chr19----1270 --
NM_001040142chr242214 1802 1727 654 ------
NM_001040158chr5------1374
NM_001040181chr3----1765 --
NM_001040214chr611826 12047 1956 1753
NM_001040284chr1635915 1506 1207 --1126 --
NM_001040402chr443008 2366 831 193 --12824 --
NM_001040429chr1353584 2915 2869 2219 200 1114 ----
NM_001040446chr51256 12221 12683 --
NM_001040712chr933396 538 414 13201 23511 2708 --
NM_001040876chr421437 1406 --1603 --
NM_001042473chr1042106 1763 343 108 --1821 --
NM_001042506chrX31387 578 468 ------
NM_001042510chr821368 79 --11651 --
NM_001042555chr1244365 1872 227 64 24730 1762 24389 600 --
NM_001042663chr131223 1043 462 --1155 --
NM_001043318chr1433621 1620 1321 --34050 3162 701 --
NM_001043351chr132067 774 116 --1906 --
NM_001046chr523002 2964 --11178 --
NM_001049chr1452293 2193 728 707 281 12031 22224 874 --
NM_001092chr173831 652 333 ------
NM_001104548chr1161 --1159 --
NM_001106chr387558 6739 6269 3717 3146 2443 337 328 --17033 18145
NM_001149chr1011041 21068 1010 ----
NM_001174chrX21689 1670 --11543 --
NM_001183chrX3584 435 52 ------
NM_001198chr6--12446 12187 --
NM_001222chr1021713 1593 ----1281
NM_001254chr171266 ----174
NM_001257chr1631367 1166 427 --11398 --
NM_001259chr776356 5472 4690 2484 2461 1525 1213 1793 11735 --
NM_001270chr5--11034 ----
NM_001315chr621634 368 ------
NM_001316chr201401 1143 ----
NM_001326chr112453 80 ------
NM_001332chr51396 ----1274
NM_001338chr21----1290 1970
NM_001364chr1154691 4464 3808 1583 1085 1353 14193 --
NM_001396chr2172665 2092 1954 1127 1108 1072 901 ----12451
NM_001408chr121326 1163 --11646 180
NM_001412chrX42946 2900 601 284 ----1876
NM_001431chr62916 317 --1850 --
NM_001438chr11797 ----12367
NM_001449chrX1527 ------
NM_001453chr641300 461 349 334 --1604 --
NM_001455chr624343 995 1374 11331 --
NM_001482chr15--176 --1102
NM_001616chr233281 2830 1384 33350 2656 1271 ----
NM_001619chr1111032 --11087 --
NM_001621chr732954 460 157 --2521 495 --
NM_001628chr7----1367 --
NM_001635chr7----1236 --
NM_001681chr12----160 --
NM_001701chr9----11566 --
NM_001709chr1132651 818 458 2515 309 ----
NM_001730chr13----1310 --
NM_001753chr7--2715 264 ----
NM_001759chr1244600 3995 2038 1348 15008 ----
NM_001792chr183401 381 109 ------
NM_001800chr19--1533 --1503
NM_001859chr9--12606 --11324
NM_001935chr2----1737 --
NM_001939chrX43850 3263 3247 888 --13825 --
NM_001964chr51429 ----11165
NM_001982chr12----1243 --
NM_001999chr5--11188 1507 --
NM_002011chr5------1428
NM_002019chr131124 --1148 --
NM_002025chrX68168 7905 6970 6698 1330 1314 1193 29146 9135 29071 264
NM_002037chr6----1316 --
NM_002039chr4----1167 --
NM_002087chr171283 --1240 --
NM_002128chr1322343 526 ------
NM_002166chr2--1659 1679 --
NM_002168chr15------1195
NM_002196chr201287 ----1890
NM_002211chr10----1838 --
NM_002226chr143683 649 304 --1729 --
NM_002233chr11------1435
NM_002247chr1011500 11521 1397 --
NM_002249chr12153 71 ------
NM_002264chr385071 4521 3579 3088 1968 1375 1341 755 14876 21015 643 --
NM_002265chr17----1404 --
NM_002267chr132955 691 ------
NM_002270chr523812 3741 23490 207 11226 --
NM_002309chr22----11104 --
NM_002310chr555619 5440 4668 4350 2354 --1157 --
NM_002336chr1234793 3741 1668 --24896 4523 14985
NM_002397chr541616 1604 1429 880 ------
NM_002480chr12--11096 11033 --
NM_002487chr151235 --2229 133 --
NM_002509chr202689 548 --1679 --
NM_002553chr7----1350 --
NM_002556chr1121633 818 11975 194 --
NM_002581chr945194 4859 4470 4154 --33905 2015 1470 --
NM_002588chr511678 --11532 --
NM_002599chr1111200 --11150 --
NM_002607chr71441 1903 1415 21177 103
NM_002613chr1663697 1604 1302 1025 517 220 ----15350
NM_002648chr61112 --11313 --
NM_002655chr833753 478 105 13489 --13380
NM_002693chr15----185 --
NM_002719chr1442261 1664 511 473 1393 11782 --
NM_002737chr1766646 6598 6382 2043 1223 960 --21971 1427 --
NM_002738chr164923 793 431 304 1879 ----
NM_002745chr2284452 3582 3571 3199 1689 562 292 166 1277 --13342
NM_002775chr10----1393 --
NM_002825chr7----1158 --
NM_002852chr31509 --1230 --
NM_002869chr1152128 791 633 388 43 --11913 1757
NM_002894chr181151 --1178 --
NM_002897chr22675 492 ----186
NM_002906chr1121806 605 --11741 --
NM_002912chr6145 1634 173 --
NM_002926chr41348 --11159 --
NM_002941chr321269 121 --21058 266 --
NM_002968chr161205 ------
NM_002971chr3------1838
NM_003017chr61256 1574 1903 --
NM_003026chr931038 410 61 --1212 --
NM_003040chr7----1148 --
NM_003068chr81380 ------
NM_003070chr91770 --1855 --
NM_003107chr6----22188 181 --
NM_003108chr257183 7177 5707 5107 4739 --25141 4553 --
NM_003110chr171709 ------
NM_003112chr71958 --11994 --
NM_003131chr632169 2009 70 1688 1787 --
NM_003139chr11133 ----172
NM_003145chr11454 --167 --
NM_003150chr171203 ----1926
NM_003161chr1723551 3479 --12643 --
NM_003178chr34893 494 463 188 --21904 487 --
NM_003204chr1711359 --21719 1183 --
NM_003205chr15--1864 2752 597 --
NM_003211chr1231507 1412 1307 1538 11425 --
NM_003214chr6------1179
NM_003246chr1531937 241 121 11740 11988 --
NM_003286chr20----1373 --
NM_003320chr1144066 3670 3438 3112 21741 1163 14454 14430
NM_003326chr142344 2055 714 649 --22687 628 --
NM_003341chr3------1511
NM_003342chr1763048 2837 2475 1324 567 338 12700 1681 --
NM_003344chr711743 --1420 --
NM_003345chr161450 --1516 --
NM_003367chr19----1107 --
NM_003373chr101694 --11804 --
NM_003400chr2------1844
NM_003410chrX33073 2053 696 ----12198
NM_003411chrY31603 1236 686 ----11751
NM_003412chr31195 12933 1648 --
NM_003489chr211365 --13118 --
NM_003498chr1641950 867 578 361 --1256 --
NM_003575chr721460 447 ----1460
NM_003590chr243185 1548 1220 1173 --33588 1187 254 --
NM_003629chr162485 2270 1240 1042 895 422 13153 22911 988 --
NM_003633chr551638 1591 1012 939 753 --1783 --
NM_003660chr192628 255 ------
NM_003672chr1------11266
NM_003685chr192733 203 --2996 947 --
NM_003713chr111282 --11763 --
NM_003718chr71487 ------
NM_003743chr22793 162 --11950 --
NM_003800chr652362 2309 2277 1842 1643 1821 11543 --
NM_003831chr181113 1386 21828 122 --
NM_003872chr232786 1993 430 --1773 --
NM_003884chr31590 11793 21580 548 --
NM_003895chr212769 34 1444 11637 --
NM_003902chr11278 ----1340
NM_003908chr2051101 923 895 419 339 --1229 --
NM_003932chr2221722 1359 1481 1120 --
NM_003956chr10--1111 --1508
NM_003993chr11337 --168 --
NM_004094chr1421058 46 ----12788
NM_004170chr91324 --11501 --
NM_004171chr1157390 6138 1835 1660 891 1199 11101 --
NM_004229chrX31980 1368 447 ------
NM_004236chr15----1132 --
NM_004242chr61161 --1345 --
NM_004268chr112971 936 11178 2286 177 --
NM_004281chr101170 ----144
NM_004293chr933847 682 662 1852 1617 --
NM_004301chr34347 314 265 251 ------
NM_004316chr12----179 --
NM_004326chr12129 63 --1289 --
NM_004329chr10----1342 11010
NM_004379chr21245 11274 2577 155 --
NM_004393chr31558 --1371 --
NM_004414chr2141397 1338 603 479 --11519 --
NM_004427chr11767 ------
NM_004430chr831099 807 266 --11840 --
NM_004442chr1--11748 11062 --
NM_004454chr322311 1606 --11596 --
NM_004458chrX1683 22257 1064 11625 --
NM_004459chr172418 123 ------
NM_004501chr164042 1642 1619 1417 875 314 --23817 1146 --
NM_004549chr11------21614 541
NM_004555chr162428 133 1477 1384 --
NM_004578chr1----1869 --
NM_004586chrX53856 3603 2142 497 149 23701 166 --14222
NM_004593chr32806 583 --1189 --
NM_004622chr22909 703 ----1111
NM_004657chr2--11306 11457 11234
NM_004690chr6----1283 --
NM_004745chr876503 5766 5441 5250 4558 198 39 16655 15577 --
NM_004768chr11928 ------
NM_004774chr1713065 ------
NM_004798chr2023105 987 --12571 --
NM_004801chr2----1416 --
NM_004840chrX1185 --1910 12473
NM_004852chr181014159 14027 12848 9957 9210 3940 3736 2714 2486 498 19920 512658 11968 9931 9615 9533 --
NM_004859chr1731952 1911 526 --1693 --
NM_004883chr5----1197 --
NM_004902chr20----1287 --
NM_004906chr62201 110 ------
NM_004926chr1431862 1770 1202 ------
NM_004929chr81264 --1468 --
NM_004930chr1167 --1603 --
NM_004947chr332353 521 273 ------
NM_004952chr1----1936 --
NM_004985chr1223200 1185 21789 1405 14320 --
NM_005028chr1022079 2058 1164 ----
NM_005067chr3------1619
NM_005110chr5----1157 --
NM_005121chr1723687 598 1537 --13643
NM_005154chr151496 --1534 --
NM_005168chr271580 1558 1394 1388 1353 320 123 --11613 --
NM_005171chr1221229 1149 ----1816
NM_005180chr1061547 1489 1342 1190 653 111 --1417 --
NM_005222chr71837 ------
NM_005238chr1122734 2727 --23373 2957 --
NM_005244chr20----2666 492 --
NM_005277chr431922 610 96 --21900 1835 --
NM_005302chr71295 --1163 --
NM_005316chr113417 350 329 --1839 --
NM_005324chr1731754 1698 1584 --125 --
NM_005329chr1642313 1660 1444 643 --21715 1504 1569
NM_005399chr164292 3778 3273 1699 146 98 12814 24257 3793 --
NM_005402chr711733 1534 ----
NM_005418chr11----1256 --
NM_005436chr1023135 2805 --13182 11591
NM_005437chr1021125 975 21062 959 ----
NM_005455chr141544 1284 1142 231 --11668 --
NM_005458chr911942 12371 ----
NM_005493chr61794 1124 ----
NM_005509chr531166 342 101 --1728 --
NM_005596chr965857 5297 4774 4208 1939 1047 --21879 1330 --
NM_005604chr632500 630 610 31864 854 636 ----
NM_005607chr81732 --1246 --
NM_005618chr61488 ------
NM_005632chr16----11111 --
NM_005647chrX53139 3125 2708 819 696 ----1924
NM_005668chr512916 11424 --14188
NM_005686chr12446 353 ----11497
NM_005704chr1----21112 939 --
NM_005721chr2----1961 --
NM_005731chr23300 166 114 ------
NM_005736chr1021518 57 ------
NM_005751chr7----174 --
NM_005765chrX1668 ----177
NM_005822chr621686 48 11543 1856 --
NM_005824chr72744 46 ------
NM_005841chr4----1954 --
NM_005859chr5----11508 --
NM_005898chr1122823 625 ------
NM_005904chr182112 83 21378 1306 11200 --
NM_005905chr13----1157 --
NM_005909chr544007 3670 3581 3281 12640 14227 --
NM_005911chr221087 281 --11048 --
NM_005920chr143789 2393 199 113 ------
NM_005926chr151446 --1158 --
NM_005977chr13----1138 --
NM_005986chr1342774 2503 2007 1782 --1294 --
NM_006094chr8--1355 11657 --
NM_006106chr1143139 2770 2703 1001 --22579 1030 --
NM_006135chr141304 1297 506 420 ------
NM_006145chr19------1437
NM_006160chr173622 391 252 --1541 --
NM_006195chr911444 --178 --
NM_006224chr1711787 --1921 --
NM_006237chr1321906 1621 1502 12266 --
NM_006241chr322258 814 1303 ----
NM_006243chr1148 --1378 --
NM_006245chr61745 ----1967
NM_006251chr532976 2949 2102 --1113 --
NM_006252chr144768 4619 1244 351 16436 27343 1205 --
NM_006275chr20------12513
NM_006282chr2032881 1602 962 --2877 232 --
NM_006283chr863654 3214 1693 818 732 149 14319 ----
NM_006300chr191617 ----1195
NM_006336chr91143 11480 ----
NM_006363chr201574 --1232 --
NM_006379chr71352 ----185
NM_006380chr1733308 2995 521 24050 3381 --13737
NM_006389chr11----1934 --
NM_006403chr6----21547 259 --
NM_006407chr3----182 --
NM_006420chr2053459 2567 958 327 293 12505 ----
NM_006460chr1731593 617 209 --1169 --
NM_006469chr1------1562
NM_006517chrX2667 193 --12195 --
NM_006521chrX----11419 --
NM_006526chr20145 --11560 --
NM_006572chr1733202 1018 571 --13336 --
NM_006599chr1656942 5727 5668 2651 1817 16020 --11198
NM_006614chr342235 1102 837 621 --13286 --
NM_006618chr111386 ----1632
NM_006667chrX----11181 --
NM_006698chr2031222 1212 547 --1179 --
NM_006699chr1----1233 --
NM_006704chr132425 412 ----1131
NM_006717chr921015 75 12771 --1549
NM_006749chr8----11044 --
NM_006791chr151439 1564 2419 83 --
NM_006805chr52575 283 1503 1433 --
NM_006807chr17------1155
NM_006811chr202665 105 --1635 --
NM_006815chr12--1555 11121 --
NM_006852chr1742572 1045 352 132 --1118 --
NM_006908chr721290 52 --31099 1065 963 --
NM_006920chr231764 1689 1606 --1676 --
NM_006939chr14----21161 323 --
NM_006951chr101724 --1241 --
NM_006981chr932879 1199 374 --11942 --
NM_006988chr2121222 809 ------
NM_006990chr11158 --21995 981 --
NM_006996chr121563 677 --11297 --
NM_007007chr1221736 686 --23398 561 --
NM_007033chr131651 590 172 2844 462 1811 --
NM_007084chr131283 --1312 --
NM_007085chr3------1212
NM_007129chr13----1763 --
NM_007146chr1722763 2633 1888 ----
NM_007150chrX2528 130 ----1232
NM_007162chr6----1618 --
NM_007174chr1252028 1545 826 778 626 --11740 11808
NM_007191chr12--2714 23 1217 --
NM_007260chr11215 ------
NM_007269chr11194 --1226 --
NM_007375chr121837 628 ------
NM_012106chr1611095 ------
NM_012156chr20----1932 --
NM_012160chr61467 --136 --
NM_012164chr947440 7104 6064 5392 17360 16238 17000
NM_012207chr10----1992 --
NM_012234chr323471 541 23716 2516 ----
NM_012247chr101977 --1308 --
NM_012249chr222488 422 --1609 --
NM_012262chr164940 4687 4681 3707 3337 3225 ----1912
NM_012301chr721744 159 11977 --173
NM_012309chr112399 295 24595 3982 24455 3313 --
NM_012322chr7----1126 --
NM_012326chr2----1102 --
NM_012328chr7----2908 247 --
NM_012333chr12610 442 11266 ----
NM_012402chr112970 541 --1898 --
NM_012421chr1----1401 --
NM_012479chr752049 1837 1047 983 401 --22594 1967 --
NM_013230chrY41754 1657 1144 616 11696 ----
NM_013261chr431350 342 264 ----13190
NM_013267chr12----1141 --
NM_013354chr8----11009 --
NM_013363chr3----1427 --
NM_013377chr121493 --187 --
NM_013438chr91305 31698 1252 73 ----
NM_013444chrX1288 --1971 --
NM_013943chr12599 52 12348 ----
NM_013995chrX22082 580 ----1775
NM_014011chr232324 714 39 ----1697
NM_014016chr331610 1223 74 ------
NM_014023chr1032879 863 629 --1116 --
NM_014059chr13----1290 --
NM_014154chr3----1167 --
NM_014181chr22820 777 1673 1738 --
NM_014207chr11----2444 416 --
NM_014240chr323216 1111 --31347 567 201 --
NM_014241chr10----125 --
NM_014268chr181152 --1433 --
NM_014286chr963493 3124 2844 1246 1039 851 1358 2624 331 --
NM_014292chr22----1102 --
NM_014294chr8145 ----2986 539
NM_014319chr1221436 83 --11505 --
NM_014322chr1----11112 1203
NM_014332chrX------1361
NM_014342chr11----192 --
NM_014345chr61764 --1326 --
NM_014368chr921371 460 --12118 --
NM_014405chr1721466 462 --1601 --
NM_014423chr565597 5488 4976 1635 1595 210 --11082 --
NM_014456chr1011358 --1438 --
NM_014504chr731500 273 146 --11801 --
NM_014554chr122599 253 --11443 --
NM_014587chr161299 --11586 --
NM_014636chr91578 1592 1323 --
NM_014667chr32702 362 --2369 321 1804
NM_014671chr741354 1107 199 41 --1563 --
NM_014686chr1912400 --11993 --
NM_014705chr751950 1769 762 579 355 11846 11599 --
NM_014709chr2187 ----1509
NM_014711chr161219 --21988 1372 11724
NM_014717chr19----1661 --
NM_014723chr2011023 ------
NM_014730chr1265286 3937 1912 1635 1020 195 11667 14670 14628
NM_014751chr8--11512 --12059
NM_014755chr263583 2859 2767 2651 1449 145 --11061 1822
NM_014770chr121313 --1817 --
NM_014824chr1121380 162 --11976 --
NM_014839chr15868 667 650 572 381 ----12336
NM_014841chr6----1281 --
NM_014844chr1432919 2601 1489 ------
NM_014873chr144369 2996 1508 1196 --24567 662 14179
NM_014877chr1766887 5722 5665 1234 808 134 22592 936 11967 --
NM_014893chrY11469 1244 1715 --
NM_014901chr511608 ------
NM_014903chr12135 ------
NM_014906chr1733366 1237 93 1833 21190 721 --
NM_014909chr1433789 3448 300 --12726 --
NM_014912chr1022167 1330 --13250 --
NM_014917chr1--1974 ----
NM_014926chr3----128 --
NM_014943chr81402 --1228 --
NM_014962chr2032765 2538 183 22419 514 1272 --
NM_014969chr1----1177 --
NM_014974chr10----1306 --
NM_014989chr6----12033 --
NM_015009chr32770 556 ------
NM_015020chr161100 12592 ----
NM_015025chr232242 2113 445 3551 338 154 12092 --
NM_015042chr1514241 --21315 498 --
NM_015049chr222014 1096 --12850 --
NM_015051chr912092 --1361 --
NM_015059chr1543032 2983 573 133 --11453 --
NM_015064chr1232280 936 549 22486 375 1817 --
NM_015069chr162605 521 --1233 --
NM_015076chr644455 4434 1054 471 11371 13724 1651
NM_015082chr52504 113 ------
NM_015092chr1634011 3136 3027 13699 --11306
NM_015094chr2221114 416 --1859 --
NM_015137chr822587 217 1492 21837 766 --
NM_015138chr1532804 1728 1033 11835 ----
NM_015144chr16--1951 12495 1116
NM_015156chr1463307 1475 1428 832 716 498 11502 13701 --
NM_015170chr822039 1868 --12238 --
NM_015172chr11221 11117 --11143
NM_015176chr11496 11274 ----
NM_015185chrX3706 353 324 --12840 --
NM_015192chr2022792 508 --13009 --
NM_015199chr3--12795 21950 49 --
NM_015205chr1314381 --11961 --
NM_015215chr122721 40 23171 2503 ----
NM_015216chr5----11085 --
NM_015265chr22556 52 11652 11712 --
NM_015271chr434004 3874 3276 24234 3881 11380 --
NM_015296chr132182 157 ------
NM_015317chr231111 1000 886 --11792 --
NM_015328chr732776 401 312 ------
NM_015329chr1932748 1053 89 --22847 1894 --
NM_015344chr821876 238 --1672 --
NM_015346chr1411197 --1398 1454
NM_015347chr1232499 952 597 1701 ----
NM_015349chr632907 702 274 --1670 --
NM_015355chr1711591 --11863 --
NM_015361chr2------1815
NM_015367chr22--1437 11628 --
NM_015435chr811108 --11286 --
NM_015475chr2--1853 11078 --
NM_015527chr161658 --1808 --
NM_015554chr1542910 2686 1938 1817 22927 2398 ----
NM_015564chr523519 1047 --12768 --
NM_015601chr10------1826
NM_015680chr22652 630 ------
NM_015726chr1--1114 11552 --
NM_015878chr821576 244 --1470 --
NM_015879chr1878643 8461 7550 3391 2768 1138 572 ------
NM_015955chr21354 1187 ----
NM_015980chr5------11566
NM_015981chr533168 2396 628 ------
NM_015999chr1----144 --
NM_016009chr134608 4444 485 11491 --14942
NM_016048chr5----1234 --
NM_016083chr622519 1338 --12454 --
NM_016206chr358471 7968 5965 776 261 --1577 --
NM_016224chr621358 551 --2737 36 --
NM_016231chr17----1195 --
NM_016248chr1333838 1473 1231 --1143 1815
NM_016252chr2----1192 --
NM_016275chr32640 119 --1395 --
NM_016277chr6----1150 --
NM_016279chr51375 ------
NM_016287chr1185 --1174 --
NM_016315chr2----11831 --
NM_016374chr121415 184 --11336 --
NM_016441chr232131 866 681 ------
NM_016472chr1411378 ------
NM_016485chr632022 1902 447 ----2766 651
NM_016526chr111534 --22103 54 --
NM_016530chr151240 --13142 --
NM_016545chr1----1745 --
NM_016577chr3----21115 343 --
NM_016614chr61253 1720 --1757
NM_017415chr5104295 3929 3643 3350 3055 2892 1340 1282 673 485 --11224 --
NM_017420chr1413720 23049 1096 --13283
NM_017519chr6------1443
NM_017544chrX----1838 --
NM_017628chr422057 797 11027 25113 4879 --
NM_017633chr633752 3099 2508 --1531 --
NM_017637chr9109267 8756 8460 8338 7567 3684 3436 2423 1080 77 22466 760 26085 191 13395
NM_017644chr345066 5024 3655 1336 14993 24710 1084 --
NM_017650chr775879 5595 5530 5092 4244 2033 1312 --11917 --
NM_017714chr201157 ----1330
NM_017736chr1613135 --12948 --
NM_017799chr1421675 1357 ------
NM_017848chrX33318 1657 884 --14410 --
NM_017994chr732605 1007 894 --32827 657 203 13007
NM_018013chr642899 1950 1083 498 ------
NM_018015chrX1143 21023 47 ----
NM_018061chr1155 --1406 --
NM_018062chr21150 --1415 --
NM_018086chr211553 21670 1398 --1368
NM_018159chrX----1239 --
NM_018171chr12----1215 --
NM_018178chr121534 1361 --1289 --
NM_018224chr7----1268 --
NM_018243chr473575 3451 3377 300 245 145 40 ------
NM_018254chr131870 862 569 --12135 --
NM_018362chr1142700 1590 1432 296 ----136
NM_018364chr112732 23619 1381 14023 --
NM_018371chr831047 610 183 ------
NM_018375chr1421621 1342 ----2458 255
NM_018403chr343878 3719 3634 326 --14079 --
NM_018433chr21550 ------
NM_018566chr131077 1029 637 --14088 --
NM_018569chr451487 1257 1092 205 77 ------
NM_018571chr22569 54 --1471 --
NM_018593chr63692 509 35 ----1705
NM_018602chr1521561 297 180 ----
NM_018649chr10162 --1441 --
NM_018650chr121959 337 ------
NM_018686chr12156 --1269 --
NM_018715chr152127 1449 526 494 188 1147 ----
NM_018898chr521838 1467 --12285 --
NM_018953chr121577 --1143 --
NM_018979chr1262654 2594 2570 1833 371 249 12086 12588 1572
NM_019012chr121124 --1272 --
NM_019049chr11267 --1195 --
NM_019091chr2----1820 --
NM_019116chr1633540 3296 1197 13070 ----
NM_019558chr2--1341 1144 --
NM_019593chr2042806 2709 2374 942 1760 --1892
NM_020062chr202719 122 ------
NM_020116chr4--21682 261 --136
NM_020133chr646128 4284 4024 3919 --1457 2408 202
NM_020148chr1822539 23 --11082 --
NM_020177chr511266 ----1521
NM_020180chr1811375 ------
NM_020198chr171377 11227 1314 --
NM_020199chr52484 442 11264 1128 11163
NM_020234chr15----163 --
NM_020235chr32253 112 ----132
NM_020337chr432879 2533 192 23028 632 1216 --
NM_020340chr621851 1812 --1288 --
NM_020363chrY--157 11608 --
NM_020403chr1311762 --1371 --
NM_020438chr9----11214 --
NM_020456chr1372318 2177 1637 1461 569 558 512 1707 ----
NM_020474chr182673 312 11681 1100 --
NM_020640chr351766 1594 817 695 428 ------
NM_020647chr851971 1811 1784 765 438 1586 21633 204 --
NM_020653chr17----1442 --
NM_020699chr123303 963 --12156 14810
NM_020717chrX31290 1106 309 --21976 53 --
NM_020718chr1666336 5492 4670 2059 2046 507 16539 46293 1490 1474 84 --
NM_020728chr712239 12105 --1302
NM_020742chrX--1263 1730 --
NM_020747chr51919 ----154
NM_020760chr231520 1246 528 1689 ----
NM_020801chr511796 22502 156 --11941
NM_020813chr1942353 2323 1025 401 --1195 --
NM_020826chr1123003 240 --1828 --
NM_020860chr41273 ------
NM_020872chr3----2710 58 --
NM_020873chr3147 154 1350 --
NM_020918chr1032339 2268 1317 ----1536
NM_020935chr223960 1854 13726 1713 --
NM_020962chr153941 623 131 --12427 --
NM_020988chr1611044 --1249 --
NM_021012chr17--1132 --1123
NM_021033chr1332999 1030 696 --23104 2897 --
NM_021072chr5----1523 --
NM_021090chr2224628 769 --11338 --
NM_021156chr20----11041 --
NM_021165chr1----1268 --
NM_021183chrX2465 70 ------
NM_021224chr92449 114 --1400 --
NM_021227chr4----1445 --
NM_021619chr92947 418 --11096 --
NM_021629chr333969 3764 599 --15117 --
NM_021637chrX11204 --11245 --
NM_021643chr221555 636 11599 11870 --
NM_021784chr20------1586
NM_021785chrX----1306 --
NM_021945chr633328 784 462 ------
NM_021954chr1311206 --1785 --
NM_021961chr1146911 2407 1781 1770 16345 27259 6128 --
NM_021964chr335425 4607 4163 35881 4448 873 24538 1395 16502
NM_021998chrX21103 365 ------
NM_022055chr2----187 --
NM_022060chr141855 --11348 --
NM_022114chr121673 561 --24805 4057 --
NM_022140chr5--21923 1495 22345 849 --
NM_022170chr761586 1391 425 404 367 333 --1215 --
NM_022340chr333605 2481 229 ------
NM_022346chr431406 1212 125 152 1965 --
NM_022450chr16------1265
NM_022477chr2031666 389 377 ------
NM_022552chr2----1870 --
NM_022658chr1231141 1030 96 153 11131 --
NM_022753chr122588 1857 --186 --
NM_022763chr3--1780 ----
NM_022781chr911257 13258 1329 --
NM_022838chrX------1268
NM_022841chr1522559 116 1807 --12599
NM_022842chr343145 3032 665 22 ----13098
NM_022893chr21170 22838 1111 12640 12781
NM_022912chr252876 2802 2681 957 636 --1160 --
NM_023018chr131635 412 227 ------
NM_024076chr19134 ------
NM_024337chr52252 143 ------
NM_024408chr112672 --2538 473 --
NM_024522chr1----11825 --
NM_024612chr17153 --11113 --
NM_024624chr221532 393 --11359 --
NM_024675chr16----1244 --
NM_024700chr1----1301 --
NM_024721chr852147 2047 1686 206 24 ------
NM_024811chr1141697 1285 772 595 --1299 --
NM_024875chr103470 202 181 --1316 --
NM_024911chr1------1757
NM_024939chr161352 ----11521
NM_024945chr9----11172 --
NM_024979chr13----1309 --
NM_024989chr267382 6476 6137 3029 2167 1738 --18168 --
NM_025054chr813863 ----14208
NM_025090chr1711208 --11435 --
NM_025160chr143460 2769 867 830 --11403 --
NM_025187chr16------1930
NM_025191chr11547 13225 ----
NM_025222chr332742 2095 1984 --11036 --
NM_025235chr1032133 1900 447 21514 69 11687 --
NM_025250chr711114 ------
NM_030571chr511070 2344 115 ----
NM_030621chr1433316 2824 247 22919 1684 --22851 270
NM_030625chr1022608 407 11849 --1292
NM_030627chr5--23609 1369 23192 452 --
NM_030647chr765803 5680 4453 2149 2019 651 --11288 --
NM_030661chr7165 --2454 173 --
NM_030758chr221528 --1463 --
NM_030784chr61406 ----1303
NM_030820chr62969 961 --139 --
NM_031296chr432134 1086 134 ------
NM_031453chr1032404 726 454 --12308 --
NM_031461chr8----1310 --
NM_031476chr162986 56 --22742 2671 --
NM_031478chr16------1720
NM_031890chr2232679 2069 276 --1792 --
NM_031922chr6----1198 --
NM_032042chr532687 912 204 11105 22801 147 --
NM_032109chr5----11323 --
NM_032144chr231262 643 485 1224 11769 1609
NM_032153chr33690 443 419 ------
NM_032192chr17----3605 598 499 --
NM_032211chr10----1368 --
NM_032256chr122221 142 --1389 --
NM_032312chr2----1136 --
NM_032355chr3----1135 --
NM_032457chr423877 2918 --12602 --
NM_032458chrX33222 1314 1077 1212 1957 --
NM_032505chr321954 1077 ------
NM_032521chr2022730 2227 --1236 --
NM_032588chr11216 ------
NM_032626chr16----1333 --
NM_032802chr151169 ------
NM_032804chr101271 --12206 --
NM_032833chr1----1249 12421
NM_032932chr1745351 2048 1343 1053 ------
NM_032968chrX14149 --13853 13432
NM_032973chrY14141 --13845 --
NM_033121chr1211385 --21489 383 --
NM_033129chr2021961 97 11634 11568 --
NM_033132chr131490 --1861 --
NM_033143chr421313 325 1575 122 --
NM_033211chr531317 794 764 ----11852
NM_033272chr21317 --141 --
NM_033274chr533442 887 794 --21409 840 --
NM_052845chr1212202 12956 13069 1483
NM_052885chr1274644 3576 3340 1811 1758 1442 1183 ----23771 1885
NM_052898chr811383 --11414 --
NM_052900chr831836 241 221 ----1323
NM_052904chr621219 1127 198 11046 --
NM_052906chr2213552 --1723 --
NM_052917chr222448 38 42910 2061 396 264 ----
NM_052927chr5--12086 1410 --
NM_052937chr841959 1022 600 437 12289 ----
NM_052971chr5--1143 ----
NM_053002chr3--130 1291 --
NM_053023chr1153251 2591 2064 1325 1311 11331 11086 --
NM_053042chr43689 584 304 1433 22287 2089 --
NM_053064chr1421066 968 --1737 --
NM_057175chr41140 --11814 --
NM_058237chr14------1287
NM_080664chr14--12040 ----
NM_080737chrX41253 606 593 507 ----11514
NM_080867chr1444764 3903 1532 1260 --11868 --
NM_080872chr843603 1227 347 73 33976 3011 53 ----
NM_133265chrX62965 1003 725 304 294 42 --1630 --
NM_133478chr2178 --11665 --
NM_133494chr1----1112 --
NM_138328chr1733011 1054 214 12987 ----
NM_138355chr17------1147
NM_138357chr1011231 --1104 --
NM_138426chr732297 2157 2096 --12202 --
NM_138473chr1254958 3911 3354 625 235 --14491 --
NM_138969chr81961 --1953 11464
NM_139015chr121267 ------
NM_139201chr12----148 --
NM_139319chr12------1441
NM_144570chr1642067 779 747 537 --12365 --
NM_144578chr1465430 4867 3444 1173 774 29 14795 ----
NM_144599chr15--25432 747 25245 2139 --
NM_144605chr16199 --1118 --
NM_144631chr2------1288
NM_144664chr11----22355 508 --
NM_144710chr21308 --173 --
NM_144726chr52162 26 1786 ----
NM_144963chr822634 2068 1905 1195 --
NM_145117chr111540 12034 2633 611 --
NM_145251chr1411563 21287 242 --11481
NM_145284chrX32484 591 473 127 11610 --
NM_145808chr742375 2161 2070 1146 --13001 --
NM_147128chr711672 ------
NM_152247chr221867 ------
NM_152253chr2234253 2890 122 --13885 --
NM_152261chr1212128 --11989 --
NM_152277chr522020 605 --12155 1595
NM_152380chr11674 --1494 --
NM_152384chr2----1385 --
NM_152390chr21605 ----1194
NM_152424chrX54401 4170 2892 948 243 ----23887 3091
NM_152588chr121641 --11193 --
NM_152608chr112122 12535 ----
NM_152624chr5105144 4983 4591 4548 2721 1708 1645 960 603 236 46548 6192 2089 1474 25839 2626 --
NM_152625chr5----1294 1223
NM_152641chr1212442 12665 12548 --
NM_152716chr1111020 ----11574
NM_152758chr8----12614 11913
NM_152780chrX--1336 11229 --
NM_152787chrX53566 3161 2517 548 448 --1859 --
NM_152890chr111004 ----11308
NM_152896chr91723 --1554 --
NM_153026chr12----1103 --
NM_153035chr132280 183 72 --23028 2795 --
NM_153211chr18----1443 --
NM_153252chrX1380 --1119 --
NM_153261chr1611560 --1179 --
NM_153262chr132774 2589 677 1131 12171 --
NM_153347chr11----22474 948 --
NM_153607chr51409 --140 --
NM_153634chr1231535 555 56 11303 1129 --
NM_153757chr42485 400 ----1800
NM_172069chr21767 --1439 --
NM_172071chr187469 7068 6047 2028 1999 1399 1242 505 14618 1896 --
NM_172127chr421426 810 --11323 11487
NM_173078chrX----1328 --
NM_173473chr1022739 2641 --1584 --
NM_173500chr151985 --11396 --
NM_173511chr263430 573 272 204 194 79 --2721 527 1817
NM_173552chr342048 1836 1617 428 ------
NM_173570chr3----12237 --
NM_173595chr1225028 3259 11650 --1876
NM_173602chr1243733 3447 3248 2526 12534 1216 --
NM_173667chr521765 585 11583 11526 --
NM_173683chr821285 508 --11172 --
NM_173808chr133403 3007 108 ------
NM_173851chr853262 935 875 688 558 ------
NM_174916chr151162 --12395 --
NM_174934chr1112999 13313 13375 --
NM_175061chr721929 1407 1123 1589 12058
NM_175611chr21----1260 --
NM_175630chr2----1734 --
NM_175854chr1322655 266 --1403 --
NM_175884chr731406 403 324 ------
NM_175907chr1821779 386 ------
NM_175921chr532990 2626 428 13377 12923 --
NM_176814chr711471 --11323 --
NM_177539chr12358 118 --141 --
NM_177968chr252238 2046 729 111 25 ----11504
NM_178135chr421282 237 ----11377
NM_178517chr171640 --174 --
NM_178566chr941299 588 508 250 ------
NM_178812chr8----1443 --
NM_178835chr4----1678 --
NM_178857chr8----1449 --
NM_181077chr1511499 --1355 --
NM_181356chr6----1340 --
NM_181358chr143972 3884 3532 360 --13997 --
NM_181457chr221079 899 ------
NM_181504chr563378 3182 560 349 338 215 34170 2716 1127 13473 --
NM_181644chr11282 --1465 --
NM_181672chrX2321 195 22014 572 1607 --
NM_182485chr443556 3520 1471 105 ------
NM_182511chr1811119 ----1580
NM_182540chrX1102 --1705 --
NM_182557chr1121780 331 --21890 596 --
NM_182691chr741418 1320 155 127 --1561 --
NM_182760chr31956 ----2729 186
NM_182830chr14--12303 1247 --
NM_183238chr1212673 --23638 2957 --
NM_194071chr735452 655 347 --15336 --
NM_194247chr233044 1483 1158 12894 ----
NM_194272chr15------1986
NM_194291chr831933 1131 220 --22236 1862 --
NM_194314chr155396 4859 4760 3906 3736 34058 2179 1435 --13589
NM_197941chr542918 1871 1174 276 --11147 --
NM_198077chr11641 --1562 --
NM_198392chr61515 1678 11725 --
NM_198446chr1----150 --
NM_198468chr624227 3057 34354 3970 1041 14546 --
NM_198511chrX1687 --1119 --
NM_198513chr831313 822 620 ------
NM_199051chr11284 --152 --
NM_199181chr20----1289 --
NM_203364chr11----11099 --
NM_203406chr51639 1605 194 --
NM_203459chr132510 2402 362 1694 12265 --
NM_206853chr624093 328 23122 248 --11215
NM_207337chr12------1177