TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-518a-5p
miRNA Sequence: CUGCAAAGGGAAGCCCUUUC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000024chr52351 198 --1218 --
NM_000084chrX135950 5843 5557 5484 5279 5158 5115 4274 2353 1924 1636 783 446 26980 2233 26291 2446 11051
NM_000088chr1711331 --1150 --
NM_000089chr75769 728 684 311 54 ----1265
NM_000090chr21170 ----1904
NM_000093chr932241 2160 591 ------
NM_000109chrX2570 519 11794 ----
NM_000112chr564196 4082 3551 519 150 87 34927 4747 4473 25202 3929 1656
NM_000114chr2011020 ----1133
NM_000125chr674220 4184 4138 3813 3769 1568 370 --23954 2607 1223
NM_000129chr641541 1452 1104 543 11153 ----
NM_000138chr1562080 1953 1885 931 371 118 42489 670 364 356 1140 12416
NM_000141chr1031338 582 452 1321 --11364
NM_000165chr641584 1382 1273 500 1631 ----
NM_000167chrX41668 1435 1429 441 --1716 --
NM_000168chr753300 2394 2233 370 67 13327 13375 --
NM_000176chr563875 3572 2879 2818 1019 783 21267 956 ----
NM_000183chr22142 86 1338 --1329
NM_000188chr101705 --2737 227 --
NM_000194chrX4544 183 139 107 ------
NM_000210chr262093 2038 2021 1637 824 363 ------
NM_000214chr2031570 1514 383 --31417 586 436 11141
NM_000216chrX64085 3699 3462 1014 947 466 34018 2964 2879 1910 --
NM_000217chr1264843 4658 3647 1755 1273 981 14535 33253 1565 95 22097 436
NM_000222chr441759 1742 1653 1314 11950 11909 --
NM_000232chr432938 2457 542 23206 565 ----
NM_000248chr382699 2482 2309 966 926 837 517 285 32553 1115 977 11048 11104
NM_000252chrX--51394 1354 1209 1160 71 --11276
NM_000259chr1546319 2208 2130 606 15470 11450 --
NM_000264chr9103146 3099 2991 2731 2644 2438 2313 2294 1257 457 1426 ----
NM_000271chr18----1465 --
NM_000278chr1012317 ------
NM_000280chr112386 276 1263 2990 183 --
NM_000297chr431873 1677 112 1596 ----
NM_000304chr1721069 819 --11075 --
NM_000314chr1092751 2256 2157 1225 1217 655 472 440 385 11082 22683 416 --
NM_000319chr1221229 940 --11183 --
NM_000332chr6107008 6809 5315 5278 5227 4756 4644 2530 1534 46 35602 5233 976 14632 --
NM_000334chr17----22182 1384 --
NM_000337chr5115282 4928 4725 4299 2327 2266 2010 1801 1654 1086 631 --22260 477 15713
NM_000346chr1771992 1472 1428 1384 1350 695 595 1763 11330 2716 379
NM_000362chr2263376 2495 2401 1014 1002 405 ------
NM_000368chr964882 4531 4456 3126 1775 934 13298 ----
NM_000376chr1233170 3125 762 12840 --12612
NM_000384chr21250 1218 ----
NM_000393chr221643 418 1688 1266 11352
NM_000396chr11172 --1528 --
NM_000397chrX31766 482 471 12419 12456 --
NM_000399chr1051015 1007 317 108 52 --11043 --
NM_000408chr283400 2893 2751 2714 2258 1277 254 185 12620 12380 --
NM_000430chr1712645 22463 1108 --1715
NM_000448chr1173125 3045 2692 2316 947 542 411 133 ----
NM_000449chr121313 46 --2573 68 --
NM_000458chr17------1589
NM_000461chr3114583 4547 3622 3465 3043 2948 1460 1067 915 505 88 54445 3977 3527 1654 1576 ----
NM_000474chr7--1656 1667 --
NM_000486chr1263111 3064 2566 1024 1002 985 --13080 --
NM_000489chrX73037 2890 2741 2408 2300 2240 447 22495 2265 ----
NM_000495chrX3780 447 291 ----1454
NM_000508chr42935 39 --1130 --
NM_000522chr7160 --1435 --
NM_000523chr2--11107 1185 --
NM_000527chr1972458 2345 2165 874 543 491 107 12245 12172 --
NM_000530chr12689 275 1761 ----
NM_000538chr1321641 163 11632 1581 --
NM_000555chrX116661 5923 5895 5708 5647 5488 2938 2064 1969 1950 326 17863 16966 11540
NM_000575chr22898 203 ----1146
NM_000597chr21306 ------
NM_000598chr731513 345 47 --11537 --
NM_000599chr254598 4491 1147 1041 1007 23768 891 ----
NM_000609chr1062972 2251 2129 313 135 121 22902 2216 ----
NM_000615chr11112948 2217 1181 1104 966 918 713 649 218 194 147 --23002 533 --
NM_000618chr12106276 5904 4600 2558 1720 915 602 423 183 51 ------
NM_000627chr21811 ------
NM_000633chr1865186 5000 3860 3437 2010 501 24843 3630 1585 --
NM_000668chr441391 1191 1132 273 11019 ----
NM_000683chr41199 ----1526
NM_000684chr102941 503 ------
NM_000719chr12104550 1945 1882 1809 1722 1697 1511 860 784 378 36516 5855 5444 35297 4981 1375 --
NM_000721chr132287 294 228 ----1197
NM_000724chr1041300 1235 420 124 3721 568 187 ----
NM_000734chr121015 817 1336 ----
NM_000788chr421484 51 ----11141
NM_000793chr1454935 4769 3433 1387 590 1941 13221 14060
NM_000794chr51929 --11024 --
NM_000801chr2041019 848 711 165 2768 393 1121 --
NM_000806chr531497 500 337 ------
NM_000810chr151115 ------
NM_000813chr5105236 4517 4312 4200 4003 1739 1658 1182 694 595 14482 ----
NM_000814chr1544118 1617 1013 263 22569 1508 ----
NM_000818chr101122 ------
NM_000826chr431658 1628 881 11679 1417 --
NM_000828chrX32117 769 225 12185 ----
NM_000829chr113933 366 90 ------
NM_000833chr161146 ------
NM_000844chr32791 407 2981 841 1401 --
NM_000861chr332430 1718 911 21951 1920 21978 1737 1225
NM_000868chrX42530 1977 351 250 11728 --1133
NM_000875chr15146909 6682 6493 6286 5887 5698 2354 2113 1736 1678 1298 1188 1117 589 25669 1044 11374 --
NM_000876chr631010 247 95 ------
NM_000877chr263025 3003 2958 2409 2259 1009 22905 2821 13109 --
NM_000891chr1783618 3226 3010 2440 1075 846 738 595 ------
NM_000899chr1274199 3798 3373 1647 1636 1452 335 23804 848 ----
NM_000901chr4102403 2319 2299 2275 869 842 698 688 404 26 32039 895 765 --12539
NM_000933chr2021518 319 1472 ----
NM_000944chr472056 1958 1941 765 626 502 389 12030 ----
NM_000945chr241815 1623 1579 33 1603 11370 1790
NM_000950chrX73239 3033 1359 1313 1172 1007 187 2657 445 ----
NM_000957chr12481 361 1142 ----
NM_000962chr973034 2900 2672 2338 2045 366 38 22706 299 ----
NM_000963chr122509 182 ------
NM_000965chr311217 --1332 --
NM_000966chr122954 135 11087 ----
NM_001001132chr211393 1409 1309 --
NM_001001323chr1262823 2526 2293 963 888 748 23169 2175 22848 2125 --
NM_001001330chr1021270 355 ------
NM_001001331chr372375 1705 1671 947 837 726 564 11088 1620 --
NM_001001344chrX82369 2357 2307 2109 1713 1629 969 724 22039 155 ----
NM_001001395chr1252564 2184 802 236 57 12754 1371 --
NM_001001396chr1134451 4313 4276 4130 3913 3875 3684 3233 1641 1537 1002 848 486 14242 ----
NM_001001419chr5165210 5204 5067 4974 4751 4538 4284 3845 3707 1969 984 949 849 433 171 143 3690 659 476 ----
NM_001001433chr2023179 713 --1133 --
NM_001001481chr821275 851 22646 979 ----
NM_001001549chr7102821 2759 2308 2143 2115 2043 1147 412 399 383 --12370 --
NM_001001560chr222616 88 ------
NM_001001664chr274104 3887 3793 2652 1592 890 863 21562 373 ----
NM_001001852chr221941 --1755 --
NM_001001870chr171839 1521 1769 --
NM_001001890chr2133654 1467 529 13699 14256 --
NM_001001924chr832071 1318 184 ----1355
NM_001001933chr13475 234 127 2459 190 ----
NM_001001971chr1011115 11066 --1884
NM_001001974chr1031819 1569 562 22027 767 --11957
NM_001002243chr22755 276 ------
NM_001002257chr253364 3224 524 135 81 ------
NM_001002295chr10168 ----1149
NM_001002838chrX41881 1867 756 189 ------
NM_001002860chr1443816 3360 388 296 11299 11612 14478
NM_001002909chr1762113 2019 1633 1525 869 840 ------
NM_001002919chr24499 166 148 113 ------
NM_001002926chr742095 1940 420 263 12693 22794 975 --
NM_001003407chr1045085 4301 4180 863 23749 96 14342 1801
NM_001003652chr18188368 7566 7432 6934 6668 6635 5679 5537 2870 2771 2341 2255 2236 1832 1770 1509 871 369 11149 --28266 6900
NM_001003674chr18116086 5863 5576 5292 5128 4921 2693 1446 789 555 135 35152 5140 4984 34549 2028 345 --
NM_001003698chr62552 354 11285 ----
NM_001003712chr1274006 3647 2705 2647 1271 1010 656 23957 515 1322 --
NM_001003792chr35993 778 212 81 33 ------
NM_001003800chr942440 1477 824 171 13472 2992 482 13107
NM_001003810chr42636 118 --1697 --
NM_001003845chr21425 --1404 --
NM_001003940chr1562715 1363 1094 935 851 212 ------
NM_001004019chr31115 ----199
NM_001004065chr963817 3211 2909 1501 1152 992 31537 1472 1294 13083 --
NM_001004106chr52259 68 ------
NM_001004317chr653541 3389 3311 2934 313 --13180 13618
NM_001004329chr1231459 1249 1000 1187 ----
NM_001004360chr231830 774 252 --2352 207 --
NM_001005158chr31384 --1128 --
NM_001005271chr1751049 1023 885 170 131 ------
NM_001005291chr172516 476 1485 ----
NM_001005339chr102260 82 191 ----
NM_001005366chr125913 903 762 756 308 1807 1652 --
NM_001005404chr1754442 4383 4228 752 188 23145 796 33765 3244 194 --
NM_001005463chr1092369 2291 1723 912 877 771 349 287 139 12134 22108 2094 1610
NM_001005473chr576628 6429 5645 4460 4433 2627 258 44598 4369 2489 2237 --1280
NM_001005474chr321337 197 11396 11473 1511
NM_001005505chr311726 ----11776
NM_001005609chrX23695 3058 ----13833
NM_001005739chr22819 581 --1354 --
NM_001005845chr821813 248 1409 ----
NM_001005862chr172587 221 1597 1457 --
NM_001006115chr362581 1057 995 946 800 216 ------
NM_001006600chr552445 1590 481 273 124 11661 --11827
NM_001006610chr163920 331 248 2991 953 ----
NM_001006636chr21702 --1369 --
NM_001006658chr13598 565 293 ------
NM_001006684chrX2422 205 1508 ----
NM_001006946chr241188 537 514 474 ------
NM_001007024chr1794344 4303 4156 3744 3400 3194 2694 1746 1619 --13601 14295
NM_001007075chr42921 713 21092 395 --1950
NM_001007094chr1054172 1618 776 242 77 14074 14459 --
NM_001007097chr91955 --24028 1269 --
NM_001007102chr661631 1566 1390 1195 1057 622 21275 340 11504 2532 248
NM_001007214chr12622 406 --1603 --
NM_001007226chr1741265 1094 971 426 1589 ----
NM_001007237chr192392 2092 1862 985 644 575 477 471 199 12842 1618 1339
NM_001007246chr2141822 482 382 282 ------
NM_001007255chr12242 56 ------
NM_001007278chr1385146 5115 5026 4631 3193 941 934 534 ------
NM_001007466chr675217 5090 4707 4520 4499 3952 1688 --158 --
NM_001007466chr675217 5090 4707 4520 4499 3952 1688 --158 --
NM_001007467chr22------1111
NM_001007527chr51583 1564 1679 --
NM_001007553chr131184 1059 302 ----11167
NM_001007559chr1862046 1788 1620 775 419 155 2374 262 1323 --
NM_001007794chr11632 ------
NM_001008220chr523066 653 --13913 --
NM_001008225chr74594 586 83 62 ------
NM_001008239chr1883505 3015 2390 2366 1381 623 113 57 ----1689
NM_001008392chr322949 1050 23563 2935 ----
NM_001008393chr4112818 2244 2049 1020 987 947 838 825 807 704 64 31840 953 331 11137 1911
NM_001008408chr7126258 6042 5930 5842 5764 5511 5273 4873 4002 2562 2111 302 25120 4529 1534 --
NM_001008495chr862030 1488 1391 559 423 349 12003 ----
NM_001008541chr1031778 1684 824 --11472 --
NM_001008563chr941086 281 203 122 --11103 --
NM_001008564chr1372230 2141 1954 1895 1806 1690 836 12174 11430 --
NM_001008566chr222335 136 1147 ----
NM_001008660chr1141172 543 519 335 ------
NM_001008738chr512269 22375 452 11107 --
NM_001008895chr1311483 ------
NM_001008938chr112474 157 1305 ----
NM_001009552chr8----127 --
NM_001009554chr4104768 4579 3687 3491 3175 1863 1405 734 447 422 12932 ----
NM_001009555chr441651 1594 162 75 1547 ----
NM_001009569chr1051589 1517 1389 589 225 11432 1112 --
NM_001009571chr72633 489 ------
NM_001009899chr3116551 6501 6209 4840 4502 4138 4020 2005 910 815 768 56304 5696 5419 4810 953 16544 --
NM_001009958chr71427 ----1571
NM_001009993chr233269 3071 1318 ------
NM_001010861chr122743 2559 --32657 2162 976 --
NM_001010888chrX54013 4003 3471 1816 582 13389 33961 1213 291 34535 4240 3403
NM_001010895chr921965 1299 --22082 708 --
NM_001010922chr164113 4092 3466 1699 655 351 53221 2954 2884 1275 445 ----
NM_001010924chr1041038 858 498 363 ------
NM_001010926chr11257 --1640 --
NM_001010935chr12947 159 ----1233
NM_001010942chr1261215 1031 906 225 160 79 1877 21074 342 --
NM_001010971chr13996 874 707 ----176
NM_001010986chrX41597 355 337 275 ----22291 2176
NM_001011515chr42782 254 --11053 --
NM_001011537chr352274 2120 2052 361 343 11731 12222 --
NM_001011553chr72975 88 1662 ----
NM_001011657chrX41079 1067 1052 138 ------
NM_001011663chr105675 437 320 284 97 ----11049
NM_001011666chr766561 4830 4754 2548 1173 320 26344 6308 26301 4703 1951
NM_001011713chr1431579 1154 66 1266 281 50 1656
NM_001011724chr131270 ------
NM_001011885chr15----1365 --
NM_001012329chr12842 312 12316 12219 1575
NM_001012398chr1641061 925 852 716 ------
NM_001012423chr1572890 2220 2058 1808 893 743 314 22318 153 --1507
NM_001012514chr21973 --11085 --
NM_001012761chr572569 2260 2196 2131 744 378 215 11681 --12617
NM_001012977chrX51115 942 502 326 264 ------
NM_001013406chr721366 1179 139 11185 --
NM_001013415chr431293 558 521 ----1260
NM_001013438chr32985 757 ------
NM_001013635chr1231159 1139 153 ------
NM_001013690chr1222429 415 1787 22209 610 --
NM_001013699chr122101 28 175 ----
NM_001013843chr153657 323 297 1888 ----
NM_001014342chr121750 509 ------
NM_001014797chr10148227 8199 7410 5904 5597 5235 5082 2134 2080 1896 1208 793 757 279 11091 --13187
NM_001014809chr41865 --1344 1883
NM_001014812chr15--1319 1184 --
NM_001015048chr1492950 2940 2878 2449 2320 1985 285 247 34 32224 732 547 ----
NM_001015877chrX43063 2630 630 215 195 21957 903 12512
NM_001015885chr202350 270 1337 ----
NM_001015887chr311510 ----11729
NM_001017369chr431088 1066 1021 ------
NM_001017371chr221079 202 1406 1154 --
NM_001017396chr221887 1690 --1811 11346
NM_001017405chr43899 881 176 1209 ----
NM_001017424chr1--21936 424 11284 --
NM_001017923chr142435 325 21072 184 1260 --
NM_001017926chr811429 ------
NM_001017969chr92671 179 ------
NM_001017973chr5----3267 77 65 --
NM_001017992chr531245 445 226 --1463 --
NM_001017999chr121704 807 22171 433 ----
NM_001018004chr15----1228 --
NM_001018038chr91111 --1208 123
NM_001018054chr11430 1410 --11451
NM_001018056chr91507 2546 171 1126 --
NM_001018067chr185188 4833 4500 2075 278 204 58 33 13411 55170 4945 4514 3326 446 11123
NM_001018090chr1572841 2169 2075 1914 1072 469 312 22195 227 --11874
NM_001018108chr1541920 1841 1767 120 12164 --1270
NM_001020658chr121441 1419 31637 1565 429 --1173
NM_001023567chr1572381 2363 2282 2197 1829 896 746 1153 1314 1510
NM_001024226chr121122 999 ------
NM_001024460chr621114 243 ------
NM_001024596chr19113628 3388 3299 3069 2761 2546 2332 1403 612 431 241 21247 558 1794 --
NM_001024647chr1267314 6861 6814 4738 1314 1026 25522 119 ----
NM_001024649chr562931 2912 2870 2569 312 285 ------
NM_001024666chrX2485 456 1632 ----
NM_001024680chr22316 160 1292 ----
NM_001024847chr331721 1561 270 1583 21672 523 --
NM_001024937chr17197 ------
NM_001024947chr53859 813 170 ------
NM_001024948chr163348 2727 1137 732 446 227 --12977 12536
NM_001025076chr10125907 3914 3799 2466 2404 1859 1570 1177 836 679 613 205 23884 1304 ----
NM_001025077chr10177265 5272 5157 4997 4810 4595 2928 2535 2194 2037 1971 1563 1313 1062 303 251 202 55242 2662 1086 846 258 ----
NM_001025079chr3103902 3787 3743 3526 3359 3060 2725 1541 1274 430 --12548 13942
NM_001025105chr5--21555 472 11394 1988
NM_001025205chr32426 104 --1119 --
NM_001025266chr353884 1751 207 55 48 24248 1881 ----
NM_001025356chr122990 43 12921 1737 --
NM_001025579chr1711054 11030 11072 --
NM_001025580chrX123861 3785 3553 3532 3339 3049 2711 564 529 340 281 228 23840 763 12644 --
NM_001025596chr112465 426 ----1380
NM_001025780chr931107 1083 313 21446 90 ----
NM_001029835chr71329 ------
NM_001029858chr6103341 3052 2318 2106 1363 590 451 353 299 50 12422 11095 --
NM_001029863chr631987 981 634 1876 --1345
NM_001029875chr552871 2420 2345 1104 1084 1642 12238 --
NM_001029883chr283130 3098 2927 1179 666 613 489 399 --12873 --
NM_001029989chr152390 70 1147 ----
NM_001030002chr171149 --1321 --
NM_001030007chr1643657 3008 1008 367 31556 738 666 23297 225 --
NM_001030055chr1484492 4052 4013 3641 3078 1152 1101 739 ------
NM_001031623chr671356 556 483 355 158 152 124 ------
NM_001031679chr1283451 3056 2827 2584 488 290 224 137 1173 1432 13468
NM_001031680chr1----22478 2085 --
NM_001031684chr22965 934 11031 ----
NM_001031689chr91161 ------
NM_001031695chr2295339 5179 4485 3825 3722 3626 3573 2184 2178 --35425 1330 1187 34897 4085 1814
NM_001031711chr521362 156 21444 1373 ----
NM_001031804chr1684376 4190 3565 3247 2850 1721 1160 908 11644 ----
NM_001031812chr532243 750 233 11925 --11568
NM_001032279chr112386 112 --1400 --
NM_001032282chr851291 1202 814 447 327 ------
NM_001032296chr1362794 1020 684 631 625 436 ------
NM_001032380chr103559 447 153 ------
NM_001032393chrX2683 204 ------
NM_001032999chr2085247 4540 4119 3791 3509 1532 889 723 --14214 --
NM_001033057chr341826 1403 798 657 1493 --11432
NM_001033059chr631781 1434 593 ------
NM_001033081chr151867 1786 1752 671 81 11764 ----
NM_001033087chr2072918 2844 2610 2293 1000 813 281 --12196 --
NM_001033117chr344375 3237 1421 569 --13045 --
NM_001033518chr751940 831 749 246 60 --1292 --
NM_001033551chr1733858 969 446 ------
NM_001033557chr231363 338 71 ----11122
NM_001033561chr172211 199 --1126 --
NM_001033578chr842298 938 395 282 11985 --1387
NM_001034841chr1695534 5486 5197 4399 4196 3835 3819 1392 983 23519 489 13878 11766
NM_001034845chr431402 1116 1080 1124 ----
NM_001034852chr1452071 2046 840 376 129 ------
NM_001034954chr1083006 2826 2661 2439 2369 2343 2158 1159 12330 12742 --
NM_001035003chr461430 1225 356 344 180 128 11271 --11283
NM_001035260chr1041573 1289 421 311 1415 ----
NM_001035chr131030 174 86 11262 ----
NM_001037164chr731669 1405 119 --11976 2392 367
NM_001037339chr131308 713 385 31670 587 412 ----
NM_001037582chr451736 1550 1445 1082 375 ----11513
NM_001037738chr51231 --1285 --
NM_001037872chr23641 300 129 164 ----
NM_001037954chr114934 862 681 426 13542 1895 --
NM_001038493chr251399 1362 963 574 486 --11525 11547
NM_001039091chrX31339 1090 286 --2943 125 --
NM_001039348chr2------1424
NM_001039459chr731049 1026 1014 1981 ----
NM_001039465chr14----1151 --
NM_001039538chr252521 1065 494 259 244 33693 3659 196 12470 --
NM_001039574chr13693 287 116 ------
NM_001039577chr183901 3478 3445 1492 1466 1076 953 765 14064 21593 398 --
NM_001039577chr183901 3478 3445 1492 1466 1076 953 765 14064 21593 398 --
NM_001039590chrX83818 3472 3058 2925 1435 1408 504 486 33723 3368 202 ----
NM_001039618chr11135813 5346 5043 4909 4766 4686 3793 3666 1978 1346 1290 754 333 11680 11992 --
NM_001039711chr11833 ----1306
NM_001039802chr121153 930 2873 101 11383 --
NM_001039840chrX135555 5055 4326 3937 2432 2089 1838 1653 1391 507 197 161 86 54964 3700 2410 1405 674 22379 574 1775
NM_001039937chr1393315 3257 3104 2677 1577 1093 1084 422 349 1188 23683 771 1375
NM_001040001chr621788 59 12023 21966 25 --
NM_001040002chr171217 ----11484
NM_001040020chr711602 --11425 --
NM_001040057chr721398 940 --11195 --
NM_001040092chr8162 1341 ----
NM_001040100chr351121 1048 1040 792 181 21290 1271 1929 --
NM_001040101chr4------21062 143
NM_001040110chr721755 60 ------
NM_001040142chr242242 2224 2067 1590 1469 ----
NM_001040153chr133914 308 249 ------
NM_001040158chr51113 2552 452 ----
NM_001040159chr41119 ----1294
NM_001040167chr731190 944 853 --21213 351 11110
NM_001040181chr31423 ------
NM_001040214chr632383 2320 1630 ------
NM_001040284chr1675962 5284 4666 3622 1262 921 475 2794 537 21050 937 --
NM_001040402chr4103096 1260 1230 1158 889 837 796 276 203 75 --1196 --
NM_001040429chr1333119 2444 1423 22210 646 ----
NM_001040441chr134328 1556 174 24898 3468 ----
NM_001040446chr5112508 2367 2266 1845 1825 1808 1706 800 623 450 360 ----12187
NM_001040450chr151636 --1712 1834
NM_001040455chr1131355 362 49 ----1313
NM_001040613chr831452 543 427 ------
NM_001040624chr831784 779 82 --22365 914 --
NM_001040665chr784831 4275 4212 1629 1205 857 829 241 23759 334 14284 --
NM_001040708chr83327 283 271 ----1305
NM_001040712chr993572 3387 3336 3197 2945 2906 2358 1399 713 22858 2205 23019 3002 --
NM_001042355chr1694827 3353 3294 1998 1450 1358 404 193 108 ------
NM_001042404chr151917 1252 698 630 580 ------
NM_001042413chr983423 3089 2645 1569 1117 776 730 617 13355 1170 --
NM_001042437chr21197 2304 211 ----
NM_001042440chr53648 380 344 21604 275 ----
NM_001042465chr1021100 95 ------
NM_001042473chr1062108 1625 1384 646 533 159 --12049 1771
NM_001042481chr1482691 2519 2385 2330 2235 2214 2028 1851 12634 ----
NM_001042506chrX61125 1063 942 502 326 264 ------
NM_001042510chr842048 1392 1376 1370 ------
NM_001042537chrX5929 470 437 62 38 130 ----
NM_001042555chr12164306 4196 4154 4056 3783 3721 3679 3581 3151 2955 968 922 602 556 33 26 14619 24290 3832 --
NM_001042599chr2187770 7329 7013 6346 6287 6144 5955 5894 5627 5605 5481 5243 5210 3152 1306 1084 662 338 17252 11429 15397
NM_001042603chr12114127 3513 3455 3397 3339 2145 1796 1434 1401 1312 965 --21344 151 24732 650
NM_001042604chr384420 3741 3720 1645 847 618 600 535 24666 3713 11080 --
NM_001042646chr3--1656 --1173
NM_001042681chr142405 2241 883 771 12635 ----
NM_001042749chrX51854 1765 1742 815 521 21958 1291 ----
NM_001042762chr71173 --1797 --
NM_001043318chr1464004 3797 3752 3722 2777 1100 --1670 --
NM_001043351chr12818 311 2325 289 1909 --
NM_001044305chr641650 1142 312 213 ------
NM_001046chr542795 2026 400 257 12169 13005 --
NM_001071775chr1321698 647 31608 1310 723 11745 --
NM_001079874chr162068 1989 1971 1778 605 368 22137 668 22126 1622 --
NM_001092chr1742552 654 396 335 ------
NM_001106chr3189783 9652 9581 9569 9253 9181 8886 8796 7211 6331 6157 3772 3077 2646 2268 2094 1595 345 38898 6323 6036 23677 2759 17674
NM_001109977chr42734 240 2848 39 ----
NM_001119chr411413 --11428 --
NM_001123chr10------1291
NM_001126chr12989 396 ------
NM_001144chr1631397 1173 924 ----1172
NM_001148chr452057 1994 444 398 308 ------
NM_001149chr101486 21227 871 ----
NM_001156chr103475 464 147 1246 ----
NM_001167chrX106535 6484 6372 5774 5649 4996 1308 1249 1056 913 21142 888 12244 --
NM_001169chr161364 ----1416
NM_001174chrX21971 1546 --12050 --
NM_001198chr662349 1822 1651 978 887 300 --1479 --
NM_001200chr2041006 390 356 307 ------
NM_001201chr4103930 3920 3337 3192 3070 1192 855 701 666 87 2313 247 ----
NM_001204chr2197584 7495 7488 7430 7187 7110 6040 5802 5719 5645 5173 5021 2294 2167 1464 1354 646 207 37 25833 1583 16351 --
NM_001206chr963129 3067 3040 2922 2455 320 23083 985 1763 --
NM_001219chr761673 1505 599 265 218 74 1396 31815 746 233 --
NM_001222chr1031965 1897 1715 ------
NM_001241chr262250 1903 1885 831 594 513 22149 222 11819 --
NM_001256chr1792895 2862 2811 2416 2380 2213 2181 1963 278 32964 2042 459 ----
NM_001257chr1651442 1388 1131 545 336 11082 ----
NM_001259chr732336 2238 1403 1486 11880 14644
NM_001260chr13----1345 --
NM_001268chr1351138 966 782 772 152 ------
NM_001271chr1512506 --32825 1115 697 --
NM_001286chr142772 2759 1899 354 12825 ----
NM_001290chr42983 815 2886 737 ----
NM_001304chr1782724 2640 2461 1300 1116 356 316 134 33778 2480 1348 ----
NM_001310chr1252518 1950 1881 690 305 11918 ----
NM_001315chr652227 1582 1510 371 176 12048 12062 --
NM_001351chr341715 1160 1129 111 --21834 426 --
NM_001356chrX62498 2245 1775 1748 1643 1546 11829 ----
NM_001364chr1192924 2899 2889 1586 1136 1082 663 349 107 31245 779 584 ----
NM_001378chr22468 69 ------
NM_001380chr102987 761 1329 1971 --
NM_001390chr1863513 3183 3091 2371 1236 241 13047 1418 --
NM_001396chr2141124 904 373 235 12147 22596 1014 --
NM_001400chr131336 355 262 1868 ----
NM_001407chr361213 1185 1152 1068 487 226 ----1235
NM_001412chrX133455 3403 3144 3042 2943 2902 2890 2810 2530 1155 796 554 202 1638 ----
NM_001417chr1241855 1402 702 155 21886 1457 ----
NM_001419chr19124602 4236 4156 1205 1173 1140 1059 993 986 113 85 22 ------
NM_001420chr1953164 2412 2244 2229 2092 22201 605 ----
NM_001423chr1251949 1763 1427 722 413 1591 ----
NM_001424chr162188 62 ------
NM_001430chr23559 442 238 175 --21510 771
NM_001431chr651213 1139 933 300 37 --1919 --
NM_001432chr463636 3404 3179 2659 890 766 ----23397 2718
NM_001438chr153198 3092 2359 1057 280 11400 ----
NM_001452chr62667 638 ------
NM_001455chr674888 4274 3562 3398 992 130 75 14934 21491 998 --
NM_001458chr71683 ------
NM_001461chr11174 ------
NM_001463chr22645 305 1265 --1189
NM_001485chr2----1228 --
NM_001497chr962810 2764 1696 791 720 169 --31905 1862 226 --
NM_001498chr62458 446 41321 1027 547 305 11085 --
NM_001537chr164411 313 145 69 ------
NM_001546chr621024 362 --1192 --
NM_001584chr1141148 1039 464 381 2211 111 ----
NM_001609chr1054400 3517 3473 3037 853 11324 ----
NM_001616chr242575 2383 876 137 1669 ----
NM_001620chr111268 2676 622 ----
NM_001621chr733010 1911 154 ------
NM_001627chr352013 1800 1697 1513 348 22346 1557 ----
NM_001650chr1843336 2895 1335 889 23430 935 --13681
NM_001656chr542035 1669 629 156 --150 11681
NM_001656chr542035 1669 629 156 --150 11681
NM_001663chr1451049 947 856 444 405 --1223 1337
NM_001676chr131164 ------
NM_001681chr123258 138 21 ------
NM_001690chr35789 415 295 183 89 1469 2484 362 --
NM_001693chr841114 989 86 65 ------
NM_001701chr951583 1460 1143 1039 107 11107 --21018 462
NM_001706chr33804 690 373 1701 ----
NM_001709chr1162611 1836 886 667 197 54 1687 --12288
NM_001718chr621148 1088 11107 ----
NM_001730chr1341527 1503 1040 133 21436 554 ----
NM_001731chr124850 805 368 53 1740 ----
NM_001742chr731831 1384 1321 11289 ----
NM_001748chr12920 194 1738 180 --
NM_001753chr761701 1561 1503 1304 1252 243 ------
NM_001755chr1642258 572 447 208 ------
NM_001759chr1295004 4292 3317 1692 1481 1050 651 547 78 ------
NM_001792chr1841109 974 798 251 --190 --
NM_001801chr51654 --1430 --
NM_001812chr4159 ----183
NM_001842chr93479 109 86 ------
NM_001845chr1321296 137 21385 1282 11393 --
NM_001854chr121293 148 11491 1577 --
NM_001858chr6114282 4212 4196 4025 3890 3522 3159 2060 752 344 216 --24062 3503 --
NM_001860chr91404 ------
NM_001881chr10----1114 --
NM_001882chr52176 170 2495 193 1521 --
NM_001894chr2221196 158 ----11145
NM_001902chr11402 ----186
NM_001904chr33833 671 236 2250 117 ----
NM_001924chr1----2172 60 --
NM_001932chr171698 --1278 --
NM_001935chr22832 133 --1296 --
NM_001938chr161726 1574 1498 598 353 89 ------
NM_001945chr51155 --11302 11428
NM_001946chr1251014 829 411 360 84 ----1819
NM_001949chr6133247 3087 2804 2705 2446 2381 2154 2140 2017 991 793 769 227 43168 3028 2728 895 --12761
NM_001950chr163759 733 668 ------
NM_001957chr442099 870 793 306 --12262 --
NM_001964chr531059 463 273 --11107 --
NM_001965chr21416 2503 456 1374 --
NM_001968chr44871 825 696 157 1682 1853 --
NM_001977chr42586 166 --1298 --
NM_001981chr182310 1784 916 909 866 545 401 265 22299 757 --11580
NM_001982chr1231187 1079 362 ------
NM_001987chr1254110 3870 3402 2724 757 23690 433 ----
NM_001992chr521382 325 1506 ----
NM_002009chr1552737 2591 2409 2152 1870 --1828 --
NM_002015chr13123242 2602 2543 1336 1262 1219 951 904 834 709 470 333 2702 424 21076 660 --
NM_002017chr1131311 979 166 --1123 --
NM_002024chrX41754 289 184 70 ------
NM_002025chrX139148 8496 8170 8094 7207 6967 6821 6271 6252 6106 3445 1160 985 --49107 7908 2957 2071 1921
NM_002031chr61620 ------
NM_002035chr1883602 2761 1611 934 527 396 333 233 43835 2964 2491 959 13707 --
NM_002039chr42617 169 1792 ----
NM_002040chr2193109 3038 2705 2495 2414 2297 1275 1011 909 33129 3019 564 ----
NM_002048chr9--1416 1974 --
NM_002054chr21422 1312 1114 --
NM_002069chr71542 ----11620
NM_002072chr93797 146 90 ------
NM_002076chr1223170 256 33155 2770 330 ----
NM_002126chr1773893 2935 1453 1122 707 351 215 ------
NM_002128chr1372442 2387 2281 874 529 523 141 11968 ----
NM_002131chr641314 1099 825 63 ------
NM_002136chr121270 ------
NM_002137chr722229 604 22110 340 --1298
NM_002140chr931181 351 175 2763 458 --11016
NM_002146chr1731383 1347 1101 --1401 --
NM_002158chr293749 3711 3245 3086 2958 1276 784 481 409 --33400 2918 1011 1753
NM_002165chr20----1323 --
NM_002167chr12486 412 ------
NM_002168chr151219 ------
NM_002182chr342740 2198 769 676 12766 1236 --
NM_002187chr541279 391 153 143 ----11316
NM_002204chr17----11360 --
NM_002207chr3----155 --
NM_002214chr785192 4542 3687 1991 1356 1332 866 652 25363 617 --14857
NM_002221chr182650 2644 2253 2218 2166 1804 203 191 11988 1129 --
NM_002239chr22902 250 ------
NM_002245chr12477 448 1129 ----
NM_002247chr1021502 126 ----12120
NM_002250chr19------1542
NM_002253chr441379 1194 446 419 --11363 --
NM_002264chr3135051 4298 3631 3283 3240 3076 1970 964 758 748 704 533 118 --14959 12027
NM_002267chr1362426 2105 1550 982 694 112 12446 1153 --
NM_002268chr351799 1780 1707 1570 1239 --11462 --
NM_002270chr5155648 5636 5127 4749 4286 4141 4117 3957 3854 3809 3743 1199 770 514 224 24306 3603 21988 1935 12193
NM_002271chr1332164 915 71 22276 897 ----
NM_002294chrX180 --1445 --
NM_002296chr161715 1557 658 563 357 232 2631 54 ----
NM_002333chr1931252 419 313 ----141
NM_002335chr11--1198 1164 --
NM_002336chr12124526 4322 3628 3609 3373 1978 900 770 540 241 226 157 45080 4972 4771 262 --14900
NM_002345chr122570 497 2226 124 1657 --
NM_002351chrX31672 430 167 ------
NM_002355chr1251420 1363 256 171 139 --1498 --
NM_002356chr672703 2657 2057 1955 1137 350 310 31086 882 857 1320 --
NM_002359chr1794309 3508 3062 1630 1286 959 891 254 200 11095 131 --
NM_002360chr732637 2333 2163 --12394 12646
NM_002375chr331481 1446 1434 --1304 --
NM_002381chr24961 934 710 67 ------
NM_002397chr551606 882 840 749 694 2729 136 --1280
NM_002398chr2--11277 ----
NM_002399chr1531367 1263 44 ------
NM_002401chr1731637 875 36 --1856 --
NM_002408chr142730 705 --1310 --
NM_002473chr2231116 1043 459 1468 ----
NM_002479chr14728 702 690 513 1575 ----
NM_002494chr42134 128 ------
NM_002500chr22903 453 11250 1934 --
NM_002501chr1934108 2906 1315 ------
NM_002515chr1431623 719 220 1671 175 --
NM_002518chr241242 1145 1003 993 11224 1403 --
NM_002519chr1131435 1318 214 1170 ----
NM_002522chr1793182 3141 3121 2822 2649 1325 747 497 441 2609 503 11505 --
NM_002536chrX2285 50 --1231 --
NM_002539chr21263 ----1100
NM_002541chr71863 --11029 --
NM_002547chrX54221 2904 2582 704 78 --1198 --
NM_002569chr1511297 11448 ----
NM_002572chr11----194 --
NM_002577chr3104036 3344 3254 2657 1557 866 459 308 299 288 --1541 --
NM_002581chr955641 5526 4282 4129 476 11125 ----
NM_002590chr131452 1159 ----
NM_002594chr2022285 770 ------
NM_002599chr112355 301 --11203 1204
NM_002613chr1685068 4365 3741 1356 1195 648 498 222 13809 ----
NM_002623chr201202 ----1707
NM_002628chr361153 884 392 262 210 145 --1766 --
NM_002641chrX61859 1735 1653 1412 760 635 21757 37 ----
NM_002645chr1142160 1043 324 101 --12431 12006
NM_002657chr2073855 3563 3357 3320 3133 2569 1198 23697 3274 --23752 2431
NM_002658chr10156 1890 ----
NM_002662chr322074 711 11558 --1301
NM_002663chr17----1525 --
NM_002687chr1461201 1015 998 846 362 167 1179 135 --
NM_002699chr111276 --11466 --
NM_002709chr242605 2426 2336 684 --22571 1225 --
NM_002713chr11994 --1982 --
NM_002716chr1123151 3003 ------
NM_002718chr342686 627 135 75 ------
NM_002729chr102605 53 ------
NM_002731chr143083 2024 483 42 22612 1071 --1990
NM_002734chr1772204 2054 1812 1732 547 243 224 --1423 --
NM_002736chr731953 850 596 31602 746 575 1231 --
NM_002737chr17126648 6635 6613 6462 6385 6145 5930 5431 4301 1754 1250 900 11227 16117 1707
NM_002738chr1621122 433 11096 ----
NM_002740chr332645 2516 1752 1946 ----
NM_002742chr143724 539 176 ----1293
NM_002745chr2233313 1768 477 53277 3230 1628 1101 798 23585 3574 --
NM_002748chr152886 198 --127 --
NM_002756chr171669 ------
NM_002779chr101216 --1545 --
NM_002787chr7287 76 ------
NM_002819chr1921273 1058 ------
NM_002825chr71148 --184 --
NM_002828chr18--1255 --1822
NM_002834chr1254032 3897 3550 3370 316 34074 3925 3212 2741 580 --
NM_002835chr71130 1556 1517 --
NM_002841chr34224 178 140 70 131 ----
NM_002844chr631238 903 276 11336 11189 --
NM_002848chr1231224 1143 307 11025 1863 1110
NM_002849chr1231074 829 783 2402 191 ----
NM_002850chr19----21247 1149 --
NM_002851chr71672 1175 ----
NM_002855chr1153659 3514 2595 2553 177 ------
NM_002858chr141244 1222 1209 1124 ------
NM_002859chr121432 ------
NM_002868chr1222380 966 --1273 --
NM_002869chr1142223 1956 1593 1402 11579 ----
NM_002871chr131862 455 305 11335 1205 --
NM_002874chr972397 2316 2243 825 456 435 244 12404 11841 --
NM_002886chr335201 1957 1263 --2227 103 11004
NM_002890chr54695 348 204 77 ------
NM_002892chr1451400 1343 1270 1178 298 11305 --11670
NM_002894chr182186 154 ------
NM_002897chr22159 107 ------
NM_002898chr121668 2559 271 ----
NM_002902chr152681 566 ------
NM_002906chr1152137 2118 1752 1562 735 12208 21828 67 --
NM_002918chr1911124 1735 1394 --
NM_002924chr1----153 --
NM_002941chr351606 1089 520 326 319 ----1604
NM_002942chr31434 1880 ----
NM_002956chr123448 387 360 --1510 --
NM_002959chr174461 3478 1776 1763 1209 1136 818 --14401 1265
NM_002968chr162754 147 11116 --1209
NM_002971chr321223 89 11009 ----
NM_002973chr12----1538 --
NM_002977chr252789 2470 1357 1302 178 12981 --1431
NM_002995chr12813 543 --1119 --
NM_002998chr84455 378 82 60 21405 628 1551 --
NM_003013chr42148 139 1719 ----
NM_003016chr1731969 1504 1455 ----11941
NM_003026chr921180 407 --1376 --
NM_003028chr933793 2928 359 1264 13055 13354
NM_003030chr321540 257 ----21986 1807
NM_003037chr11437 1603 ----
NM_003042chr321771 455 22015 1834 1401 --
NM_003043chr374277 4233 4212 4122 3802 213 91 24298 114 1309 --
NM_003048chr252820 2700 2600 1126 1029 12203 --12315
NM_003068chr811050 ----1384
NM_003070chr92767 622 1195 1777 --
NM_003071chr361841 1835 1759 489 419 246 ------
NM_003076chr1231594 1151 207 ------
NM_003093chr6----1181 --
NM_003099chr15126558 6542 6513 5397 4786 2314 2102 1919 1566 1199 916 419 12169 12128 24351 2468
NM_003101chr121176 491 1553 ----
NM_003106chr31270 2899 398 1386 --
NM_003107chr652461 2100 850 484 348 11746 12330 --
NM_003108chr296902 6605 5572 4873 4606 1470 1216 1184 978 57274 7139 5280 844 353 15319 14557
NM_003112chr783233 3058 2134 2082 2003 880 370 327 33209 2123 917 11961 --
NM_003137chr621559 806 ----12236
NM_003142chr2157 ----1247
NM_003151chr2163 ----197
NM_003152chr1731211 790 412 1808 21218 95 --
NM_003155chr842576 2518 2413 1928 22165 836 ----
NM_003161chr1712769 12536 13482 --
NM_003162chr231122 1092 1003 1148 ----
NM_003173chrX21114 344 --1496 --
NM_003175chr1----1119 --
NM_003185chr2031253 931 37 2417 55 1996 --
NM_003188chr6------1239
NM_003189chr152577 1360 1039 949 752 21341 1285 23306 1025 12772
NM_003198chr11101 ----1278
NM_003200chr1952089 1587 646 615 378 1628 ----
NM_003205chr1532223 1677 675 1240 21842 755 --
NM_003222chr2011111 ------
NM_003223chr162863 857 ----1836
NM_003234chr332291 1770 718 --11848 1258
NM_003239chr14----11004 --
NM_003246chr1541996 1934 1868 307 11361 ----
NM_003253chr2141601 703 619 161 --11654 --
NM_003255chr1742440 2076 910 378 --12635 --
NM_003257chr1521388 244 2986 260 11054 --
NM_003262chr3105306 4578 3910 3310 1591 1334 1302 1154 611 89 --1969 --
NM_003272chr12634 264 ------
NM_003274chr2132634 2291 858 12052 ----
NM_003285chr12452 48 197 ----
NM_003286chr2021039 797 2979 392 --1130
NM_003298chr3136134 6120 6031 5949 5919 3926 2415 2006 1575 1568 645 500 251 --25589 5429 --
NM_003304chr331369 507 206 1340 ----
NM_003318chr6------1291
NM_003319chr25778 620 349 243 110 ------
NM_003320chr1174361 3756 3440 1653 1428 1255 163 14443 ----
NM_003336chrX----11099 --
NM_003338chr104420 399 311 205 ------
NM_003339chr521352 604 --11340 --
NM_003340chr42964 892 21257 872 ----
NM_003345chr162500 210 171 ----
NM_003348chr1231085 622 62 ------
NM_003356chr111199 ------
NM_003358chr91136 ------
NM_003371chr921899 1869 21691 820 --11536
NM_003374chr5139 ----1305
NM_003378chr72457 91 ------
NM_003379chr611000 --1440 11161
NM_003385chr21332 ------
NM_003390chr1121089 875 2780 80 ----
NM_003400chr22210 140 194 ----
NM_003403chr142755 609 1243 181 --
NM_003406chr831598 658 639 1607 11822 --
NM_003409chr1821107 25 ------
NM_003410chrX52096 2082 569 161 24 33106 1016 830 --12921
NM_003411chrY21617 688 --1679 11155
NM_003412chr3103110 2929 2798 2603 2364 2286 1943 655 540 352 22792 2548 31251 594 461 --
NM_003430chr1911365 --11585 --
NM_003432chr5------1550
NM_003436chr192905 818 1718 1755 --
NM_003442chr112834 684 ------
NM_003452chr92898 742 ------
NM_003458chr363806 3408 2603 2480 1623 385 ------
NM_003462chr131768 1448 653 ----193
NM_003463chr692305 2197 2123 1318 875 805 721 619 243 ------
NM_003470chr1621347 1181 11303 --1616
NM_003471chr311691 ------
NM_003478chr1152925 2915 1020 279 151 12329 ----
NM_003482chr1252751 2685 2427 835 702 11809 --12238
NM_003483chr1262957 2812 2734 2661 1909 970 22007 1823 11881 2886 202
NM_003488chr173878 699 33 1640 ----
NM_003489chr2183103 2804 2479 715 525 362 335 168 11205 ----
NM_003498chr1632811 373 32 ------
NM_003506chr861314 995 963 933 359 97 171 11351 --
NM_003507chr231586 740 443 31953 1936 1903 1146 --
NM_003557chr121392 281 --11591 --
NM_003559chr1733997 3254 425 ----1570
NM_003565chr1251701 1519 696 557 463 --11742 11413
NM_003566chr1273310 3267 2773 2218 1388 1033 458 ----11238
NM_003574chr18105576 5375 4692 4575 4254 4040 1929 486 286 135 15806 --21680 1152
NM_003590chr2113692 3590 3473 3403 3082 2946 1189 930 749 597 376 13861 1396 --
NM_003603chr472093 1882 1544 1521 675 624 435 --21404 1387 --
NM_003607chr1104375 4281 4103 3862 3728 3185 1557 813 703 345 ------
NM_003615chr353630 1284 1004 834 344 42940 735 254 141 1758 --
NM_003618chr2----1224 1115
NM_003629chr172958 1332 1267 1111 957 419 99 ----1947
NM_003630chr62706 583 --1731 --
NM_003633chr541721 785 755 581 22547 1625 ----
NM_003636chr121516 98 --11392 --
NM_003637chr121129 318 ----11298
NM_003645chr152212 105 1219 ----
NM_003654chr112713 170 ------
NM_003658chr111657 --1583 --
NM_003660chr191657 ----1274
NM_003673chr17----196 --
NM_003690chr2----2217 189 --
NM_003692chr92216 175 1271 ----
NM_003701chr13--1224 ----
NM_003704chr41442 ------
NM_003705chr23788 669 350 1227 2308 265 --
NM_003714chr542594 2450 2346 260 --12773 --
NM_003718chr72515 170 1343 1479 --
NM_003722chr332134 1969 1855 --11776 12063
NM_003743chr241953 1463 557 424 1289 --1203
NM_003749chr1332181 2149 228 --12141 11841
NM_003750chr101863 ------
NM_003758chr152453 411 ------
NM_003768chr121529 505 ------
NM_003778chr33714 133 42 2702 48 ----
NM_003787chr1841302 1192 612 39 ------
NM_003794chr33967 933 921 1896 1977 --
NM_003797chr11----1162 --
NM_003799chr1874509 3950 3622 2858 1824 1306 177 24125 1378 21476 911 12886
NM_003822chr143014 968 933 201 22983 2868 ----
NM_003827chr191647 ------
NM_003850chr132238 182 ----1543
NM_003870chr15----12100 --
NM_003872chr283027 2908 2715 1987 1932 861 775 305 ------
NM_003873chr1062465 2344 1888 982 764 320 22238 2188 ----
NM_003884chr31747 31821 1785 1278 11583 --
NM_003887chr242046 1660 318 94 ------
NM_003902chr12280 55 1260 ----
NM_003913chr673736 3597 3258 3127 1297 946 613 23773 1118 ----
NM_003922chr15--1310 ----
NM_003930chr762519 2490 2263 2132 2035 1851 2360 235 ----
NM_003941chr751805 930 923 648 129 --12344 --
NM_003945chr52192 183 ------
NM_003947chr321313 132 1851 11269 --
NM_003948chr452649 2634 1755 1738 415 ------
NM_003954chr1711365 --11017 11478
NM_003955chr17----11566 --
NM_003958chr663941 3743 2994 2987 1271 431 --23359 2877 --
NM_003968chr32676 47 1519 --1143
NM_003972chr1041159 1085 356 177 --1322 --
NM_003998chr42597 267 1506 ----
NM_004040chr221016 905 --1862 --
NM_004050chr1422499 1922 ------
NM_004071chr2178 ----189
NM_004073chr12308 57 ------
NM_004075chr122588 187 --1429 --
NM_004093chr1363143 2923 2730 2647 2071 839 23095 2942 12989 --
NM_004098chr101501 ------
NM_004100chr651970 1917 1790 914 744 22252 829 ----
NM_004113chr351439 500 453 442 155 21887 515 11653 --
NM_004124chr1443147 2517 1435 246 1924 11386 1188
NM_004134chr52485 106 1138 ----
NM_004136chr1553121 2565 2365 787 351 22323 286 ----
NM_004145chr192598 278 --1298 --
NM_004161chr241638 1231 373 217 140 ----
NM_004171chr11199151 8508 8066 7387 7070 6690 6658 6364 6336 3858 3742 3474 3098 2835 2395 2112 1832 888 185 38195 7002 3839 28302 6141 18346
NM_004172chr5----12026 --
NM_004177chr1141811 1739 1389 129 --11870 21610 710
NM_004180chr2----1248 1509
NM_004200chr1153124 3055 2843 954 232 --1547 13237
NM_004226chr22299 71 ------
NM_004228chr19------1135
NM_004232chr1843755 1518 304 92 43819 3626 2449 1372 --13210
NM_004235chr94847 841 796 688 1805 ----
NM_004236chr151157 1464 ----
NM_004241chr101233 1508 2767 122 --
NM_004261chr121025 81 1719 --1249
NM_004272chr521462 484 11517 ----
NM_004290chr521261 355 --174 11075
NM_004293chr963872 3803 3509 619 589 573 12553 ----
NM_004301chr33248 108 88 ------
NM_004308chr1151932 1923 1746 1244 231 --1478 --
NM_004316chr122774 732 1889 1256 --
NM_004329chr1031192 429 399 11017 --1443
NM_004330chr1541050 746 279 141 31094 469 179 ----
NM_004331chr81806 22425 254 12638 --
NM_004337chr831983 839 63 ------
NM_004342chr721934 76 --1205 --
NM_004352chr161166 ------
NM_004354chr42869 730 ------
NM_004367chr621780 222 ----21760 209
NM_004370chr671727 1587 1560 1554 657 417 70 32101 879 608 ----
NM_004379chr221302 158 ------
NM_004386chr1932229 1977 352 --1143 --
NM_004389chr23754 136 73 ----1234
NM_004392chr1362394 1958 1802 1039 634 317 22345 218 145 --
NM_004393chr351725 1463 560 373 220 --22225 1686 --
NM_004397chr11113386 3240 3228 3032 1705 1609 1483 1346 844 205 79 --13700 1996
NM_004405chr22996 831 2864 790 ----
NM_004411chr72139 38 --1277 --
NM_004420chr111394 11672 12423 1324
NM_004429chrX31429 468 115 --1103 --
NM_004430chr8112699 2610 2452 2291 2237 2087 1996 1109 1102 1036 268 --12072 --
NM_004432chr941813 787 424 356 2895 526 42410 1890 1624 844 191
NM_004436chr1190 ------
NM_004437chr133484 3411 576 1288 --13007
NM_004438chr223305 3008 13268 11131 --
NM_004439chr4--1145 --148
NM_004440chr621608 451 21966 713 --21975 1572
NM_004441chr32814 470 21238 945 ----
NM_004449chr2141475 1399 1018 937 ------
NM_004454chr33809 741 402 ------
NM_004458chrX112657 2634 2566 2292 2253 1878 1060 1037 356 180 75 31629 987 288 --11991
NM_004459chr1782038 1742 1665 1461 1440 1325 805 257 1772 --11420
NM_004481chr142677 2597 2112 759 12521 12293 --
NM_004491chr1963775 3063 2999 828 591 366 --14091 --
NM_004496chr1421346 1157 1385 1865 --
NM_004501chr174145 4090 3626 1530 762 164 134 24122 1044 1317 1903
NM_004502chr171389 1366 ----
NM_004504chr263031 1165 901 884 599 588 32855 2218 332 1859 --
NM_004505chr1721327 572 ------
NM_004506chr62137 97 187 ----
NM_004516chr1961070 1032 867 404 381 317 ------
NM_004519chr81208 --147 --
NM_004523chr1011201 1504 1475 --
NM_004525chr2142 1261 1214 --
NM_004535chr2031768 1595 349 21400 332 ----
NM_004537chr1251435 1235 1136 194 133 1619 ----
NM_004555chr162469 431 ------
NM_004560chr92678 126 11022 ----
NM_004566chr1062554 2546 2186 1785 809 696 11957 --22308 2040
NM_004567chr341627 1356 323 167 --11422 12042
NM_004571chr2162164 1253 767 138 108 38 12788 13092 --
NM_004575chr441445 1276 1216 294 ----1403
NM_004586chrX115036 4464 4267 4206 4045 3582 1994 1384 928 452 359 25439 463 --1826
NM_004593chr34898 861 226 191 ------
NM_004598chr593350 2910 1165 822 805 181 170 67 30 ------
NM_004612chr994734 4234 4015 3943 3218 1004 926 576 117 13638 --11281
NM_004617chr32488 153 ------
NM_004630chr113998 276 245 ------
NM_004637chr331097 922 532 ------
NM_004642chr126739 682 495 482 189 171 --1690 --
NM_004643chr141730 --1574 --
NM_004654chrY41396 989 440 144 2205 155 ----
NM_004660chrY41707 1681 581 530 11759 ----
NM_004663chr1531238 976 379 31514 568 72 11528 --
NM_004687chr1711591 --1844 --
NM_004704chr3----155 --
NM_004715chr182150 119 2713 201 ----
NM_004719chr1262822 2485 1944 1834 723 657 22201 1907 11081 --
NM_004721chr3----1307 --
NM_004730chr561980 1932 1815 1759 1735 706 --22115 742 --
NM_004734chr1312687 1350 1254 11153
NM_004745chr855692 2375 1569 1550 1095 25445 2059 15642 --
NM_004747chr1031402 1098 481 --21599 149 11287
NM_004748chr1594257 3811 3648 2874 2847 2714 2684 1670 758 --13331 --
NM_004755chr145989 825 813 398 361 --1881 --
NM_004757chr42535 99 1230 ----
NM_004758chr1731131 958 935 --11119 --
NM_004759chr152153 2064 1844 1694 112 1872 11823 --
NM_004770chr8--1197 ----
NM_004774chr1741074 461 441 218 23069 593 ----
NM_004775chr1882332 2301 2227 1994 705 450 399 338 ------
NM_004776chr2073315 3305 3277 3224 2393 2325 1225 13026 12713 --
NM_004798chr2053620 3608 3386 3380 684 11249 1131 --
NM_004799chr1167 --1431 --
NM_004824chr631361 1254 207 ------
NM_004831chr1921114 1044 1971 ----
NM_004834chr293356 3248 2681 2119 2073 1177 960 823 805 1508 ----
NM_004840chrX21819 912 ------
NM_004845chrX93646 3133 2990 2943 2664 2545 1137 798 724 13903 ----
NM_004849chr631607 325 68 21357 477 1178 --
NM_004852chr182214145 13930 13695 12845 12660 11970 11790 11254 10534 10056 9647 8920 4794 3787 3545 3516 3387 2906 2336 2216 1473 888 211529 9936 313360 10621 4965 19619
NM_004857chr1433420 1830 1650 34247 3326 490 --14647
NM_004859chr1752339 1955 975 643 310 ------
NM_004863chr1485063 3863 3623 3453 1442 231 193 60 33854 267 160 ----
NM_004866chr5104835 4776 4678 4478 3274 1951 1812 854 593 512 23327 1688 ----
NM_004869chr1831558 1127 492 ----1321
NM_004887chr51319 --163 --
NM_004898chr482737 2729 1990 1964 1053 987 916 601 ------
NM_004902chr202722 111 ----2838 568
NM_004915chr211610 1520 ----
NM_004926chr1451836 1788 1466 1131 390 21824 1364 ----
NM_004929chr821487 1183 3341 185 169 ----
NM_004938chr93471 434 321 ------
NM_004947chr352473 2263 523 431 339 22235 1838 ----
NM_004956chr794444 3891 3856 1508 584 528 96 77 31 24032 1334 11514 --
NM_004961chrX31172 1068 158 --1402 --
NM_004963chr121434 ------
NM_004964chr1------1562
NM_004973chr671735 1487 1396 1118 475 263 174 2320 43 195 --
NM_004981chr222397 291 1434 ----
NM_004984chr12----1171 --
NM_004985chr1294309 4279 4194 3664 3645 3620 3315 2774 54 24486 2732 ----
NM_004992chrX188445 8377 8353 7455 7146 6990 5761 5519 5414 5401 5374 5169 2411 1853 1847 1373 1106 980 16206 1244 --
NM_004993chr1421009 310 1122 ----
NM_004996chr1611749 21719 1665 ----
NM_004999chr684337 3056 2781 1066 862 661 277 36 --1540 1998
NM_005014chr94853 819 717 637 4859 836 791 574 ----
NM_005020chr71456 ------
NM_005026chr11574 ----11688
NM_005032chrX41006 714 393 321 ------
NM_005044chrX54506 3622 2812 2784 1107 --44588 4278 3906 3639 14018
NM_005055chr112206 179 --1173 --
NM_005065chr1474286 3999 3908 3628 1322 1098 949 13896 25106 938 --
NM_005077chr93464 438 415 --1375 --
NM_005095chr152262 1972 1815 781 580 ------
NM_005109chr362385 2140 1910 773 591 513 --22545 486 --
NM_005112chr42920 200 ------
NM_005113chr14----1438 1422
NM_005120chrX1173 ----1231
NM_005121chr1753058 2597 1536 906 646 1619 ----
NM_005124chr62325 73 --1311 --
NM_005126chr342171 2028 2021 371 11692 ----
NM_005147chr16------1943
NM_005156chr9145313 4722 4647 4308 4240 3800 1966 1612 1448 991 510 365 161 88 35147 5013 4331 ----
NM_005171chr1251251 1183 1169 1114 357 1988 1208 --
NM_005180chr1051620 1491 1423 1339 119 21678 658 ----
NM_005187chr1611449 --12052 --
NM_005215chr181286 2644 567 145 --
NM_005221chr72131 47 ------
NM_005222chr71241 --1946 --
NM_005233chr342574 2379 546 355 1212 12301 --
NM_005238chr1183512 2826 2663 2633 2605 2294 1201 951 12412 ----
NM_005239chr2151499 1352 1305 455 362 32021 619 371 1798 --
NM_005240chr11632 1212 ----
NM_005242chr541249 1192 1132 154 11393 ----
NM_005249chr142258 46 ------
NM_005254chr1521039 1017 11355 1468 --
NM_005257chr1821301 324 31249 998 509 ----
NM_005259chr211509 21440 978 ----
NM_005271chr102490 241 --21019 995 11209
NM_005277chr471955 1866 1818 1596 621 346 149 1584 21838 1468 --
NM_005313chr1521012 285 1941 --126
NM_005318chr2251256 896 268 236 98 ----11267
NM_005324chr1731337 104 28 2325 75 ----
NM_005328chr85546 521 277 232 23 ------
NM_005339chr484253 4010 3730 3575 3006 2852 1189 957 21606 1243 ----
NM_005359chr18176483 6463 6079 5356 4183 2550 2273 2249 1849 1634 1436 1358 1169 1113 1035 852 624 1564 11204 --
NM_005378chr2--1712 137 --
NM_005385chr352689 2665 2053 1060 343 32607 282 34 ----
NM_005387chr112460 231 ----1590
NM_005388chr921332 75 1381 1102 1679
NM_005398chr1021198 87 ------
NM_005399chr1113929 3888 3811 3765 3091 3014 1674 1454 874 735 149 14263 11286 13033
NM_005400chr292958 2939 2776 2337 1937 1915 1023 660 24 ------
NM_005402chr721730 716 11835 11378 --
NM_005406chr18----21333 1097 --
NM_005414chr31124 --1206 --
NM_005417chr2021878 1829 --12006 --
NM_005431chr72392 25 --1643 11909
NM_005433chr1831104 968 532 ----12475
NM_005434chr241590 1561 348 168 11703 ----
NM_005435chr71173 --1205 --
NM_005436chr1093936 3451 3200 3096 1514 1274 1236 301 105 1341 23288 1161 23001 2606
NM_005437chr1071474 1458 1119 1012 493 273 82 --11260 --
NM_005442chr33454 75 38 ------
NM_005443chr4181 --1421 --
NM_005445chr10--1216 ----
NM_005461chr2041995 1710 686 390 11433 1365 --
NM_005465chr11199 ------
NM_005479chr1011304 11167 --21247 605
NM_005493chr62619 312 --1772 --
NM_005502chr983214 3114 3056 2891 2726 2560 1169 1034 --31103 195 57 --
NM_005504chr12176583 6553 6521 6481 6449 6067 5879 4650 4128 2642 2238 1580 1464 782 757 293 118 --22177 690 16316
NM_005512chr1111671 --12039 --
NM_005522chr751008 947 525 317 155 ------
NM_005524chr31120 --1232 --
NM_005536chr841291 1172 202 107 31352 419 160 1460 --
NM_005542chr771930 1861 1784 1445 1432 1403 1268 21831 1276 ----
NM_005562chr131220 1168 403 11211 11311 --
NM_005563chr12636 608 1690 ----
NM_005570chr1831129 946 135 2801 415 ----
NM_005578chr353949 1024 429 238 214 34872 1409 603 ----
NM_005587chr152311 22 ------
NM_005595chr11942 ----2832 208
NM_005596chr9125934 5021 4924 3981 1990 1861 1622 1569 1459 1402 439 356 14035 35083 5049 2095 --
NM_005599chr131564 1494 1222 ------
NM_005603chr18172 21872 1339 ----
NM_005604chr642478 2283 627 525 11914 1226 --
NM_005607chr81698 --1735 --
NM_005627chr62794 108 2995 882 ----
NM_005634chrX4674 163 143 91 1276 1249 --
NM_005639chr123595 319 147 ------
NM_005644chr1--1332 --1378
NM_005647chrX73245 3127 3105 2728 1077 548 489 ----1513
NM_005648chr81146 ------
NM_005662chr82393 308 ------
NM_005668chr5104392 3906 2839 2824 1539 1328 1297 1211 978 828 14613 ----
NM_005704chr1--11104 --11116
NM_005721chr231015 1002 273 1914 11077 --
NM_005725chr141751 1529 951 131 ------
NM_005731chr21128 ----1304
NM_005737chr242454 2100 914 725 ------
NM_005742chr21165 ------
NM_005746chr772647 2476 2148 2126 372 323 226 11780 ----
NM_005748chr1273354 2869 2649 2429 1155 549 538 12208 ----
NM_005754chr541108 1033 913 119 --1281 --
NM_005759chr2104315 4303 3676 3640 3349 1784 1493 1394 1125 200 24489 4428 11810 --
NM_005776chr142790 158 1714 ----
NM_005779chr573340 2954 2745 2710 2551 1051 526 13663 ----
NM_005780chr1321004 684 1976 1761 --
NM_005786chr183251 142 95 --1967 --
NM_005813chr22251 54 42588 2425 2324 2237 42195 1017 782 74 --
NM_005819chr143501 3430 1365 335 13356 13317 --
NM_005822chr631699 835 270 --1827 --
NM_005828chr1774615 1876 1804 1724 1641 546 39 --3568 480 115 15077
NM_005842chr134687 496 130 122 ------
NM_005843chr251909 1549 1339 619 603 ------
NM_005853chr161223 ----1516
NM_005859chr521148 364 21463 400 ----
NM_005862chr32424 143 ------
NM_005880chr1651637 1573 1405 381 360 --1476 --
NM_005897chr13808 790 469 161 ----
NM_005899chr17--11302 ----
NM_005902chr1553676 1532 1506 1493 1443 ----14472
NM_005906chr651640 1548 451 429 392 ----11471
NM_005907chr641498 1067 393 128 1670 ----
NM_005909chr573053 2951 2746 2636 1296 170 38 ------
NM_005910chr1713788 --1980 22653 1017
NM_005920chr123547 2835 --1295 --
NM_005924chr72432 279 --21131 901 11171
NM_005933chr1152428 2281 2268 1914 971 12511 ----
NM_005935chr4105084 4972 4805 4565 4513 3776 3751 1536 1484 42 11677 ----
NM_005937chr17104128 3849 3798 2813 2785 2774 1616 913 693 222 14182 24110 1487 --
NM_005941chr883301 2850 1630 534 450 233 223 31 ------
NM_005955chr1135450 5401 5145 4895 3674 3537 2012 1873 1573 1063 930 377 263 24922 4074 13503 --
NM_005967chr12------1548
NM_005968chr193201 169 45 ------
NM_005982chr142220 94 ------
NM_006033chr1811860 --11609 12173
NM_006035chr14----2975 110 11258
NM_006037chr2144735 4442 4372 3850 3783 3716 3567 3493 3472 3373 1718 1537 1424 893 13420 14307 13132
NM_006038chr204722 659 241 195 ------
NM_006047chr2082613 2369 2213 1022 724 578 452 434 52841 2635 2605 601 257 22991 2586 --
NM_006060chr763754 3231 2964 2712 2692 1048 1126 1718 --
NM_006077chr10177 1838 ----
NM_006080chr782879 2672 2648 2458 2407 2091 472 293 12113 ----
NM_006089chrX51833 1601 1410 157 92 ------
NM_006094chr852410 1738 447 361 57 21606 964 1949 --
NM_006096chr821669 1166 21696 126 11703 --
NM_006106chr1162972 1358 424 314 241 147 --11033 --
NM_006108chr1151897 1616 953 937 110 32009 1796 908 11665 --
NM_006135chr121398 97 --1380 --
NM_006141chr1632495 2289 199 ------
NM_006145chr194876 835 709 347 ------
NM_006160chr1741144 1096 39 33 2608 545 ----
NM_006161chr53659 611 242 ------
NM_006162chr1811789 1667 11752 --
NM_006166chr123973 306 235 21600 348 1103 --
NM_006167chr862131 1520 975 552 231 124 22429 2070 1293 --
NM_006186chr2--2918 892 11164 --
NM_006192chr201386 1944 ----
NM_006194chr1441078 938 534 143 21056 406 ----
NM_006195chr961441 1276 985 964 168 82 ------
NM_006197chr8--12230 12222 --
NM_006202chr1931579 1480 630 11602 ----
NM_006216chr26676 669 661 520 97 42 ------
NM_006224chr172539 426 130 12461 --
NM_006226chr221031 923 11345 ----
NM_006237chr1341841 1623 1496 172 ------
NM_006241chr331890 568 274 1255 ----
NM_006246chr1431063 509 111 ----1221
NM_006247chr193315 150 128 ----1120
NM_006251chr5112980 2832 2769 2736 2414 2306 1017 526 502 128 27 32618 2407 75 ----
NM_006252chr1197511 7044 6290 6068 5659 5261 2906 2730 2720 1803 1599 1483 1368 1241 1011 821 805 546 353 15610 11624 --
NM_006253chr1221145 363 ----11288
NM_006256chr182557 2301 2171 2102 1091 1038 515 336 12357 --12211
NM_006264chr4--1556 --1575
NM_006267chr241908 1792 1756 1606 ----1564
NM_006275chr2031856 1530 733 1252 1200 --
NM_006277chr21678 ------
NM_006282chr2084622 4514 4484 3205 1906 1605 727 117 34582 4531 1676 1552 21495 715
NM_006283chr884124 3629 1956 1924 1917 1731 1202 151 24919 341 23279 95 --
NM_006290chr641916 1877 1521 532 ------
NM_006306chrX65342 4038 3633 1814 1666 1571 1376 ----
NM_006307chrX1248 1102 1138 --
NM_006309chr3----1126 --
NM_006311chr171346 ------
NM_006313chr1241536 1335 1087 359 ----1600
NM_006315chr4114055 3965 3874 3854 3500 2876 2773 1621 1006 871 131 24282 2739 --14359
NM_006328chr113666 634 180 ------
NM_006330chr831164 1102 96 1116 11049 --
NM_006333chr21501 ------
NM_006334chr9186 ------
NM_006336chr91129 ------
NM_006352chr152042 1951 1480 832 129 ------
NM_006357chr22444 374 1454 2481 182 --
NM_006364chr1471257 843 428 310 204 156 112 ------
NM_006372chr6----1386 --
NM_006375chrX1364 1569 --11350
NM_006380chr1793992 3377 3291 3055 2922 1658 1346 291 96 34349 4320 1259 12998 --
NM_006393chr1084186 3683 2887 1248 614 426 294 212 34490 4438 3098 11381 14205
NM_006401chr92404 64 ----1363
NM_006420chr2033208 2863 2787 2659 331 23062 961 --
NM_006421chr821017 484 ------
NM_006422chr121168 ------
NM_006424chr4148 11675 31790 1758 1665 --
NM_006449chr252095 1468 422 271 89 1159 ----
NM_006460chr1731596 1469 1278 2490 375 ----
NM_006464chr22985 979 14547 21523 225 --
NM_006466chr201742 133 ----
NM_006469chr14625 315 306 122 --11121 --
NM_006471chr18191 ------
NM_006475chr131536 --1477 --
NM_006480chr51450 ------
NM_006496chr191688 1462 1417 1402 1278 1251 508 150 61 1417 11258 --
NM_006504chr1022478 1815 21051 51 22888 107 --
NM_006526chr2082215 1853 1710 1650 1386 557 317 194 11689 21946 1563 --
NM_006527chr43762 188 139 ------
NM_006534chr2083411 3090 2727 1304 1024 857 793 478 22381 970 22585 642 --
NM_006538chr2114096 4065 3208 3072 2731 1601 985 720 381 235 41 1660 ----
NM_006544chr14175807 5712 5505 5302 5081 4694 4654 4466 3988 3888 3709 2362 2307 760 504 375 201 11746 42444 2399 2258 1730 11015
NM_006546chr1796658 6035 5424 5180 4784 4424 1726 1199 536 16300 15476 --
NM_006557chr941394 535 432 302 ------
NM_006559chr121125 258 --11096 --
NM_006577chr241046 857 406 23 1367 ----
NM_006595chr1141950 1304 288 265 42070 2000 1826 211 2629 191 --
NM_006599chr16138243 8224 8170 7609 6849 6794 5633 2378 2072 2003 1995 1970 1706 12486 16945 --
NM_006601chr122716 710 --11065 --
NM_006602chr201790 1159 2817 336 --
NM_006614chr3173613 3595 3472 3466 3080 3051 3002 2789 2699 2533 2237 1278 1253 982 410 332 200 23168 2488 11069 --
NM_006618chr131445 261 201 ------
NM_006620chr673756 3744 1533 1110 348 255 223 24357 3645 ----
NM_006624chr104741 727 138 102 32093 1934 1531 ----
NM_006626chr992454 2347 2145 1947 1878 1001 302 101 33 178 1946 --
NM_006628chr1594587 4418 4007 3604 2945 1181 851 737 491 2722 412 2344 114 --
NM_006644chr133485 256 46 ------
NM_006646chr1383093 3024 2684 2490 2244 2035 1983 105 22843 689 ----
NM_006651chr43980 577 477 --11019 --
NM_006663chr192546 79 ------
NM_006690chr2021737 438 1716 12347 11757
NM_006698chr2021193 499 ------
NM_006711chr164794 788 707 118 --1762 --
NM_006717chr953147 2641 1285 498 53 1846 ----
NM_006726chr441229 933 153 145 1840 11054 --
NM_006732chr1922073 2067 ------
NM_006734chr661578 1538 1444 495 296 259 ----1328
NM_006750chr16107476 2716 2682 2476 2117 1320 1154 742 624 86 26080 5552 --28093 6520
NM_006751chr251077 933 796 145 85 ------
NM_006754chr751123 423 394 130 102 11273 11078 1819
NM_006756chr841295 1104 576 125 21517 51 11284 --
NM_006761chr171794 ------
NM_006763chr131732 765 746 22041 802 ----
NM_006769chr1----193 --
NM_006775chr663103 3034 2905 2173 2137 88 12265 ----
NM_006777chrX22743 2225 ------
NM_006791chr151542 ----1464
NM_006800chrX3598 494 424 --1217 --
NM_006802chr12386 97 ------
NM_006804chr17----1536 --
NM_006805chr541438 1177 400 112 --21194 1086 --
NM_006807chr1731315 244 182 ------
NM_006809chr202319 158 --1931 1809
NM_006811chr203779 667 637 ----1109
NM_006813chr64659 336 274 248 1166 ----
NM_006815chr122551 538 ----11146
NM_006826chr21330 ----11037
NM_006827chr1422654 1158 21282 223 13006 --
NM_006832chr141123 --1673 --
NM_006874chr431031 958 824 161 ----
NM_006875chrX2779 268 ------
NM_006885chr1664168 2859 2626 1303 949 524 12594 11349 13953
NM_006888chr1423239 2828 11343 1353 1914
NM_006896chr7--1960 11007 --
NM_006902chr163323 3184 2362 2230 714 422 11175 12172 --
NM_006908chr751491 1466 1292 587 54 --146 1374
NM_006915chrX42503 2216 1880 526 12568 --21623 552
NM_006920chr241285 678 562 359 2694 455 --11693
NM_006939chr1421080 260 143 11164 --
NM_006940chr1231775 1698 728 11654 --1506
NM_006948chr2142487 2320 1786 889 11995 --1844
NM_006981chr912254 --1377 --
NM_006990chr11540 --12467 --
NM_006996chr131560 1262 680 11834 ----
NM_006997chr10----1301 --
NM_007005chr931260 994 48 ------
NM_007007chr1284722 4621 3826 3332 3222 722 624 332 44692 4482 1112 251 ----
NM_007008chr21294 1825 ----
NM_007011chr15116278 6038 5963 5340 4234 2482 2350 1361 1250 588 334 16719 1784 --
NM_007017chr52894 355 ------
NM_007038chr21105527 5444 5007 4809 4654 4302 1850 1610 1090 790 36043 4987 389 15579 35567 5395 5259
NM_007039chr1431892 439 258 11915 2901 484 --
NM_007040chr191776 --1734 --
NM_007054chr5103046 2872 2810 2785 2411 945 786 654 562 384 ----1592
NM_007084chr1331331 572 109 11279 2588 291 --
NM_007085chr342581 2246 1832 1695 42621 2356 762 146 ----
NM_007106chr1372573 1905 1117 991 361 303 37 21999 892 ----
NM_007118chr51563 1306 ----
NM_007124chr641819 1537 682 290 ------
NM_007129chr13--3891 768 425 ----
NM_007137chrX104673 4529 4404 4387 4025 3510 3492 1450 778 201 ----1910
NM_007139chr741121 1062 474 434 ------
NM_007144chr1731276 1233 930 ----11307
NM_007146chr1732387 1920 758 ----11139
NM_007170chr11698 1906 ----
NM_007173chr1131798 552 235 31911 1508 310 2705 692 --
NM_007174chr1252401 524 410 277 246 --21482 240 --
NM_007175chr8103525 3320 3291 2742 2663 2579 2548 2318 612 602 33394 593 232 23553 2799 --
NM_007190chr1041045 957 931 332 ----1918
NM_007191chr123689 615 49 ------
NM_007212chr141899 1811 864 781 11557 ----
NM_007214chr66892 477 364 255 50 31 21296 42 ----
NM_007236chr1521643 424 --1819 --
NM_007249chr13129464 9391 9346 9132 8386 7942 7677 3121 3033 2381 2183 287 27982 1543 26970 5882 21749 563
NM_007269chr11534 --1197 --
NM_007271chr631806 1399 1381 11749 41708 1697 1145 42 --
NM_007275chr311203 11031 1806 --
NM_007276chr71161 1946 11055 --
NM_007327chr91244 ------
NM_007345chr1842215 2157 1788 1588 --1332 --
NM_007368chr131239 11520 ----
NM_007373chr1051463 1334 676 578 201 ------
NM_007375chr142448 2034 1093 976 22287 2167 21840 332 --
NM_012081chr553300 1496 486 456 155 13561 --13773
NM_012082chr82705 314 1275 ----
NM_012084chrX3479 350 228 ------
NM_012090chr131200 1168 832 2454 150 ----
NM_012093chr111169 11000 1258 --
NM_012096chr373766 3088 2812 2652 1086 400 170 33520 2524 469 13502 --
NM_012104chr1153452 2990 2679 2548 298 --11046 --
NM_012110chr41271 ------
NM_012117chr12----133 --
NM_012129chr731989 199 94 11645 --12107
NM_012137chr132144 886 484 ----22720 2098
NM_012156chr2033122 2647 920 11161 32842 2583 276 --
NM_012161chr441076 927 793 21 --1379 11093
NM_012164chr9137447 7133 6437 6066 5700 5666 5384 5327 4698 2146 1151 233 144 37030 6977 2974 46810 5732 4921 4639 --
NM_012180chr43221 187 142 ------
NM_012193chr1195435 4741 4466 4382 1749 776 601 554 181 --24705 995 25094 1664
NM_012197chr941456 1358 1332 519 ------
NM_012199chr184510 2941 2916 1599 1000 917 818 568 --12904 --
NM_012215chr1031602 1345 700 2717 547 2668 604 --
NM_012218chr192259 234 11115 12916 --
NM_012223chr221229 990 ----142
NM_012231chr141754 712 390 371 11840 1672 --
NM_012234chr363628 3345 3193 2459 2319 1129 1771 12547 --
NM_012238chr1041679 1546 691 283 ----1436
NM_012243chr1--1341 --1305
NM_012245chr141399 ----177
NM_012247chr102876 641 2709 130 1953 --
NM_012249chr263402 2877 2806 2726 799 389 23383 2513 ----
NM_012257chr731040 919 35 --1833 --
NM_012259chr631397 1138 1066 ----11409
NM_012262chr1145035 4684 4520 4123 4001 3792 3460 3440 1650 1274 1023 461 110 58 1790 24690 4011 --
NM_012264chr2232036 1809 472 --11972 --
NM_012281chr72452 230 --1719 --
NM_012293chr222265 334 ----12273
NM_012294chr793614 3487 2957 2917 2635 923 710 679 397 --1618 --
NM_012297chr42938 53 ----11694
NM_012300chr532224 2052 1777 --32400 1717 372 --
NM_012301chr721941 774 ------
NM_012302chr131189 484 364 1342 1185 --
NM_012308chr1132040 1679 816 ------
NM_012309chr11134648 4457 4366 4222 4150 3362 1917 1764 1128 688 619 327 297 ------
NM_012311chr102495 101 ----1229
NM_012316chr154289 3864 716 574 326 ----15426
NM_012322chr71285 1150 ----
NM_012325chr2061362 1296 1272 1193 1128 464 --1144 --
NM_012328chr72371 237 ------
NM_012329chr1741616 1423 1242 563 1497 11050 --
NM_012330chr1041782 538 488 468 11604 ----
NM_012347chr652466 2390 1945 452 31 12291 --32890 2420 2209
NM_012384chr2032421 2355 1788 12440 12427 --
NM_012395chr753216 2902 2654 1245 250 42895 2343 592 481 1840 --
NM_012413chr2----1455 --
NM_012419chr63440 261 140 ------
NM_012426chr162363 316 ------
NM_012428chr152733 252 1385 ----
NM_012430chr31538 ------
NM_012464chr452561 2419 2190 905 510 --2439 142 --
NM_012478chr173985 845 653 ------
NM_013230chrY31788 1692 1299 ------
NM_013231chr1494353 3938 3680 3606 1634 1191 1081 342 221 24120 213 ----
NM_013233chr221374 1044 ------
NM_013261chr483591 3526 3266 2964 2780 2735 791 261 --23330 629 --
NM_013262chr631092 927 433 2478 401 11315 --
NM_013275chr162738 601 1764 ----
NM_013277chr121203 --1907 --
NM_013279chr1131615 1450 687 --12370 --
NM_013293chr71275 ----1261
NM_013302chr1694327 4168 3863 3644 1729 1051 656 458 163 ------
NM_013309chr1552665 2181 928 336 185 21721 653 ----
NM_013313chr2262852 2793 2714 1402 941 301 12871 12198 --
NM_013330chr11171 ------
NM_013354chr82976 427 21463 1427 --11147
NM_013374chr32555 429 32812 2650 2500 ----
NM_013390chr941580 546 304 207 2274 214 11425 --
NM_013392chr21442 ------
NM_013396chr2141426 1078 289 262 31552 1354 447 ----
NM_013433chr1942038 1846 725 576 ------
NM_013437chr841300 1015 868 390 162 ----
NM_013438chr931685 474 372 1428 ----
NM_013444chrX71078 929 900 749 437 243 191 11035 ----
NM_013446chr741414 1276 1171 1027 21430 232 ----
NM_013450chr221160 982 11092 1393 --
NM_013943chr172586 1194 875 792 621 588 97 1454 1602 --
NM_013995chrX102502 2432 2420 2344 1949 820 606 474 415 401 --12411 --
NM_014010chr91519 ----1180
NM_014011chr22428 229 21864 959 ----
NM_014021chr163260 2799 2470 2377 762 493 32624 2321 2243 1968 --
NM_014023chr1042876 2833 589 400 --1119 --
NM_014028chr672519 2404 2106 1257 1137 749 663 ----1598
NM_014043chr33257 162 24 2423 94 ----
NM_014048chr16105294 5239 5168 5122 4346 4325 1973 1554 811 785 14141 15109 --
NM_014112chr8115314 4035 3678 2200 2010 1990 1914 1383 1350 1038 719 24890 1630 24367 2044 11196
NM_014117chr1641821 649 454 393 11675 ----
NM_014139chr31731 ------
NM_014154chr341430 424 390 211 --11440 --
NM_014159chr31433 ----1474
NM_014178chr143587 565 237 ------
NM_014181chr222927 486 ----1754
NM_014216chr1421668 516 1274 ----
NM_014220chr3--178 187 --
NM_014223chr13665 548 44 --2730 576 --
NM_014226chr14----1279 1272
NM_014231chr1242098 634 570 155 --12006 --
NM_014232chr172320 194 --1517 --
NM_014238chr171155 --11377 --
NM_014240chr373571 3432 2601 1458 1350 793 780 --23081 570 --
NM_014243chr441849 1779 1413 465 ------
NM_014245chr32874 359 ------
NM_014251chr71226 1966 1628 --
NM_014253chrX22429 2239 22380 2270 122 11707
NM_014264chr41218 3649 493 464 ----
NM_014267chr11--1190 288 23 --
NM_014268chr1831284 1254 170 1444 ----
NM_014271chrX2300 220 1244 1164 --
NM_014279chr91211 --1961 --
NM_014283chr13555 442 334 11285 11010 --
NM_014292chr2221705 104 21952 1893 ----
NM_014299chr191389 --12151 --
NM_014300chr152306 129 --1468 --
NM_014319chr1261406 766 390 296 242 88 --1574 --
NM_014323chr221828 ----1791
NM_014325chr1282069 1485 790 773 556 456 439 185 --3613 465 450 --
NM_014326chr151567 ----1114
NM_014331chr4127798 7673 6794 6640 6287 5555 5362 3028 2488 2005 1321 1207 26954 372 47715 6347 5635 2820 16397
NM_014332chrX2138 82 --1398 --
NM_014342chr1141388 944 290 220 2979 370 --1326
NM_014345chr62797 282 --1828 --
NM_014352chr1131424 1369 1228 ------
NM_014363chr1321208 1070 --1425 --
NM_014368chr911805 12076 --12122
NM_014372chr12629 492 ----11582
NM_014382chr331702 548 535 21641 26 21769 1708 --
NM_014393chr862016 1600 1567 746 438 204 ------
NM_014399chr71996 --1299 --
NM_014410chr181360 --1258 --
NM_014415chr351455 624 363 334 230 11462 ----
NM_014421chr442077 1851 1637 1582 1527 12061 12093
NM_014423chr5135205 5187 5181 5143 4999 3722 2138 1885 1794 1712 1338 1167 1085 15560 15600 --
NM_014431chr1051682 1519 1435 1380 1125 --11464 --
NM_014445chr352296 2211 1660 647 526 1983 11825 --
NM_014452chr641141 917 305 239 11062 ----
NM_014454chr62983 234 --11027 --
NM_014456chr103468 344 295 1259 ----
NM_014458chr131332 1308 306 21220 312 167 --
NM_014491chr73786 732 288 ------
NM_014494chr1632376 1685 127 --1396 --
NM_014506chr951354 1072 622 105 96 --1380 --
NM_014515chr124866 660 381 260 2673 203 --11056
NM_014554chr1262300 2164 1718 713 170 50 1191 12029 --
NM_014571chr142743 2491 969 86 --12726 --
NM_014572chr1331444 576 351 ----11249
NM_014577chr223917 821 58 2614 305 ----
NM_014585chr261199 1116 1052 415 95 61 11089 --11253
NM_014587chr1621552 1381 --21353 302 11320
NM_014591chr10--11336 11309 --
NM_014600chr21164 --11530 --
NM_014603chr1721178 1139 1400 ----
NM_014612chr931436 1092 413 ------
NM_014614chr2--11018 11062 --
NM_014615chr1673425 3074 2833 1358 975 819 417 ----11378
NM_014616chr332521 831 242 13310 22389 110 --
NM_014620chr121534 ------
NM_014632chr111164 ------
NM_014634chr2263554 3434 2273 1081 866 742 22797 1310 ----
NM_014635chr241660 638 122 106 11201 11304 --
NM_014636chr984365 3452 2950 1666 1299 1021 767 453 ------
NM_014667chr382443 2126 1839 1526 482 378 364 162 1126 ----
NM_014670chr231610 1288 582 1394 --11604
NM_014674chr3123760 2881 2715 2692 2587 2575 2499 1295 1237 839 528 336 13937 12628 13867
NM_014679chr1131016 533 466 ----1272
NM_014682chr862259 2103 2067 1885 578 560 42206 2139 274 118 12122 --
NM_014683chr1752154 1992 1693 1448 173 21490 632 2763 221 --
NM_014686chr1932548 1967 1918 --22460 1996 --
NM_014689chr24168 159 142 49 1547 1631 --
NM_014701chr1583367 2825 2153 2101 1224 979 130 80 33087 2730 232 11052 --
NM_014702chr6113365 3081 2856 2120 1285 1189 497 462 415 307 261 --12777 --
NM_014705chr781766 1737 1587 1454 758 582 262 35 11791 11722 --
NM_014707chr762252 1972 1811 1569 1514 1424 1390 ----
NM_014712chr162561 245 --1220 --
NM_014713chr23520 503 337 ------
NM_014720chr1031433 1286 729 --1240 --
NM_014723chr2013207 --11026 --
NM_014729chr85730 706 646 463 259 1412 167 --
NM_014730chr1285308 5288 5085 3753 2113 612 297 216 --24290 989 --
NM_014746chr2114277 4069 3749 3662 3564 3282 2853 1494 1109 872 627 24418 4311 ----
NM_014751chr842073 1991 409 99 21786 200 --1299
NM_014757chr562395 2104 2022 1524 576 438 1432 ----
NM_014761chr1621164 1096 ------
NM_014765chr172503 2345 1920 1039 876 400 139 12652 ----
NM_014774chr163148 2603 2397 2065 716 117 1443 13237 --
NM_014776chr1242537 1936 512 146 ------
NM_014779chr31773 ----1891
NM_014783chr1561569 1544 404 187 171 83 ------
NM_014787chr132257 1813 822 22227 2186 22095 1909 --
NM_014791chr91232 ----1305
NM_014795chr22942 207 21388 924 --11361
NM_014798chr1711933 ----11889
NM_014802chr121712 --11028 1270
NM_014803chr1042638 2415 1802 728 11089 1801 --
NM_014810chr153569 2599 985 252 176 23597 3061 33307 2668 1120 13404
NM_014813chr13549 391 49 ------
NM_014819chr5102314 1923 1819 1527 859 463 362 315 236 165 ----1910
NM_014820chr341859 1428 1278 183 12059 ----
NM_014822chr41253 --1621 --
NM_014824chr1142003 1350 795 420 --182 --
NM_014829chr542343 2285 2226 605 ------
NM_014832chr1351769 1408 1373 1312 617 --1407 12098
NM_014838chr22----12774 1721
NM_014839chr182322 1876 1867 865 808 574 422 260 32476 2191 988 ----
NM_014841chr62952 942 --11340 --
NM_014848chr1592758 2588 2380 1016 926 706 656 472 124 1168 11069 12350
NM_014849chr1--11308 1250 --
NM_014851chr152377 1984 1976 921 73 12622 ----
NM_014864chr143648 3468 863 412 23089 1651 1743 1403
NM_014869chr331449 286 202 11052 ----
NM_014872chr931999 825 550 2332 259 ----
NM_014873chr1114670 4194 4005 3896 3862 3696 3444 1575 1371 687 485 24741 720 ----
NM_014877chr17177609 7222 6948 6884 6392 6073 5325 2950 1949 1032 650 454 265 183 136 100 47 46423 4804 3078 890 77554 7483 6890 4979 2958 1742 637 --
NM_014878chr9----1130 --
NM_014893chrY42050 1620 950 827 11832 11472 1601
NM_014897chr1772632 2205 2092 968 838 586 529 --1370 --
NM_014899chr552683 2542 2061 413 236 33164 3087 2845 12798 --
NM_014901chr532198 2128 765 ------
NM_014903chr1262466 2311 2244 434 319 32 12430 --12321
NM_014904chr1093948 3542 2962 2932 2613 1626 1552 1278 390 23342 1603 ----
NM_014912chr10103320 3183 2974 2965 2679 2614 691 633 244 225 22740 2190 23141 1160 13412
NM_014918chr1531255 286 63 11524 11137 --
NM_014920chr653417 2937 624 262 203 ----1305
NM_014924chr1472988 2755 2689 2032 1017 995 488 ------
NM_014926chr32901 248 --11008 --
NM_014932chr321772 1387 --11684 --
NM_014939chr18144 ----1545
NM_014947chr173027 3004 2612 2423 1083 325 259 13058 ----
NM_014949chr14968 889 872 365 --3999 986 110 --
NM_014961chr431865 1573 599 ------
NM_014969chr12449 331 --2989 910 --
NM_014974chr1031787 1759 562 --1675 --
NM_014982chr1475447 3398 3285 1121 364 240 155 11337 ----
NM_014988chr42210 203 --11930 --
NM_014989chr651611 1259 821 785 114 11443 ----
NM_014990chr142855 327 11295 ----
NM_014991chr483042 2830 2791 2431 2107 1195 1083 940 --22836 2629 22255 406
NM_014996chr331008 690 163 11023 1703 1394
NM_014999chr1241399 1195 1103 404 ------
NM_015000chr1243131 3022 2201 1933 12370 12630 --
NM_015001chr12815 381 --2798 356 --
NM_015009chr33767 700 86 2672 130 1773 --
NM_015011chr13----1442 --
NM_015017chr141252 818 392 255 ------
NM_015020chr1633572 2581 2546 13904 ----
NM_015025chr2102737 2611 2575 2524 2225 1714 645 464 200 55 --12671 --
NM_015026chr1264726 3995 3176 1580 472 388 32992 2928 1063 24702 4072 --
NM_015032chr1352126 1066 522 420 414 12165 12026 --
NM_015035chr2096623 6158 6078 5960 1854 1840 629 545 534 ------
NM_015040chr262912 2729 2232 2089 404 175 13186 12602 --
NM_015042chr1533985 3526 3175 --33533 1384 501 --
NM_015049chr283288 3274 3259 2437 2228 1041 701 665 1962 ----
NM_015059chr1533831 2805 567 ------
NM_015071chr546360 6157 516 83 --1771 --
NM_015072chr143389 383 105 --1436 --
NM_015074chr1124901 4882 4626 3568 1870 1657 1550 759 576 422 362 69 14822 --14735
NM_015075chrX21998 1490 ------
NM_015076chr6104243 3889 3538 3126 2906 1648 1323 1241 1178 1090 --2813 638 --
NM_015087chr133653 440 254 22617 578 12010 12677
NM_015090chr1136242 6069 6054 5733 5606 5028 4665 4190 4177 4048 2439 1093 375 26044 483 11330 25404 34
NM_015092chr1664645 4634 3725 2938 1314 949 23556 3245 ----
NM_015093chr621628 518 31548 1369 384 11621 11847
NM_015100chr151980 1778 1730 1668 779 ------
NM_015116chr1331552 1137 77 --41689 1202 173 50 --
NM_015124chr2232529 2465 830 1111 ----
NM_015132chr73741 698 446 1224 ----
NM_015137chr892307 2265 2023 1920 1897 1841 1641 916 787 2972 34 ----
NM_015138chr1562801 2526 2314 1935 1027 170 --1656 --
NM_015151chr212991 327 11042 ----
NM_015153chr63670 590 123 ------
NM_015156chr1463868 3691 2563 1451 400 166 13758 ----
NM_015161chr1661543 1510 607 351 292 103 ------
NM_015170chr831991 899 148 21817 844 --12242
NM_015171chr161448 1461 ----
NM_015172chr131577 457 420 ----21255 193
NM_015176chr141206 660 466 212 ----1202
NM_015184chr31233 --175 --
NM_015186chr9151 ------
NM_015191chr111508 12059 1954 --
NM_015192chr2072493 2329 2276 2002 898 759 505 22952 1986 --1512
NM_015193chr821342 52 11523 ----
NM_015199chr32262 239 22537 1181 ----
NM_015205chr1345150 4789 4500 461 24631 2054 23998 2089 --
NM_015215chr151172 1126 811 653 201 33054 3039 2231 ----
NM_015230chr421460 388 ------
NM_015231chr111233 194 --126
NM_015260chr1921596 280 --21557 1348 --
NM_015265chr262618 2337 2202 2042 936 171 ----32394 2025 472
NM_015267chr1232165 2086 458 1692 ----
NM_015271chr484192 4025 4001 3877 3364 2792 1324 359 1290 ----
NM_015272chr1651942 1309 680 288 154 2700 75 ----
NM_015277chr184686 461 77 56 ------
NM_015282chr252770 2665 1965 578 400 --12750 --
NM_015284chr11513 11326 --1136
NM_015288chr563670 3486 3413 3229 2660 1529 12980 23863 3619 --
NM_015291chr1103477 3384 3158 3085 3034 2610 2419 1413 1088 148 11129 22818 1007 --
NM_015293chr62712 539 --1726 --
NM_015294chr1741145 926 264 51 ----1217
NM_015296chr1321042 159 1168 ----
NM_015305chr1421670 1582 ------
NM_015308chr112870 27 1182 1839 --
NM_015310chr8147671 7514 7426 5368 3100 2381 1938 1800 1416 1174 703 296 184 168 46125 5875 5796 201 36876 5661 1300 27376 1788
NM_015313chr1194855 4713 4700 3978 3452 3115 1505 1155 432 --14682 13818
NM_015315chr523056 127 --13252 13440
NM_015317chr251819 997 883 837 826 41139 804 305 144 42793 2349 1795 462 --
NM_015326chr162924 2643 2231 1080 871 626 ----1566
NM_015332chr753293 2808 2751 620 571 12402 ----
NM_015335chr1232460 1648 332 11816 ----
NM_015339chr20----21015 821 --
NM_015344chr841900 1872 1521 345 ------
NM_015346chr1421647 427 11284 ----
NM_015347chr1252444 2245 2089 1906 254 22803 2737 12275 --
NM_015349chr642881 2602 922 166 22946 2922 22910 1003 --
NM_015355chr1782009 1839 1744 1565 769 503 329 144 ----1360
NM_015361chr23837 744 375 1913 ----
NM_015379chr71222 1102 ----
NM_015382chr143808 627 522 --1721 --
NM_015393chr493601 3581 3463 3257 2931 2626 1277 1154 219 13559 11232 --
NM_015396chr33307 287 88 21235 123 ----
NM_015409chr1232713 1827 329 12051 1348 12698
NM_015426chr33133 59 37 ------
NM_015435chr841424 1412 1105 594 ------
NM_015443chr1721468 1429 31369 1200 1116 ----
NM_015444chr3----1446 --
NM_015446chr11527 136 21459 537 --
NM_015447chr91244 1144 ----
NM_015455chr5134036 3994 3792 3387 2697 1444 1141 1060 648 620 494 224 92 1423 13173 11487
NM_015458chr835252 4973 1622 55112 5082 4630 1016 954 ----
NM_015461chr181168 1535 168 --
NM_015463chr2------1793
NM_015464chr71222 ----1899
NM_015465chr51106 ------
NM_015475chr261080 1029 912 435 135 23 1874 ----
NM_015483chr73145 54 42 ------
NM_015484chr11622 1231 1242 --
NM_015496chr82265 214 ------
NM_015507chrX1403 --129 1460
NM_015509chr1231286 1086 389 --11558 --
NM_015523chr11------1195
NM_015530chr2192 1629 ----
NM_015541chr321070 888 ------
NM_015542chr1031248 1121 926 1222 ----
NM_015550chr763260 2509 1180 1094 540 466 13502 --1931
NM_015553chr664586 4481 1981 1360 1117 972 24544 3260 13252 --
NM_015554chr1572859 2394 2268 1819 832 800 248 12185 12803 12785
NM_015557chr142435 1103 326 316 12698 13629 --
NM_015560chr342869 2627 2576 1136 12157 22813 2379 --
NM_015564chr522571 211 ------
NM_015565chr2142299 2252 657 484 --1267 1187
NM_015567chr1341139 373 309 29 11018 ----
NM_015570chr731732 1289 166 21493 524 1463 --
NM_015576chr352956 2526 2466 551 335 --12379 11877
NM_015577chr541846 1688 417 45 ----11804
NM_015578chr1922002 1474 11500 1652 175
NM_015601chr102656 283 1404 ----
NM_015602chr111483 --11343 --
NM_015609chr122122 997 1516 ----
NM_015630chr25399 373 356 255 200 2269 160 ----
NM_015652chr10157 ----1464
NM_015678chr1351556 1472 676 164 107 1469 41373 1360 1216 431 --
NM_015680chr21656 --1633 --
NM_015713chr8103561 3429 3316 3279 3100 2909 2852 2829 2640 147 --1554 13139
NM_015714chr12363 296 ------
NM_015726chr161569 1555 1250 615 458 110 ------
NM_015855chr111344 ----1844
NM_015872chr121483 1358 ------
NM_015878chr811892 ------
NM_015879chr18118645 6728 6225 2770 2754 1419 594 574 444 396 139 26734 1874 16540 --
NM_015885chr113551 306 162 ------
NM_015886chr885344 3729 3501 1888 1712 1249 836 79 24983 539 1133 --
NM_015891chr622085 122 1164 ----
NM_015902chr87892 759 639 600 330 282 48 --1693 --
NM_015906chr184678 4547 3751 3443 1507 1256 968 515 44250 1081 979 214 ----
NM_015912chr83779 217 206 --11569 12218
NM_015934chr2----1219 --
NM_015981chr553028 2223 1185 709 90 ------
NM_015995chr1545464 4993 4161 321 164 25453 4335 --
NM_016009chr133228 833 674 14788 140 --
NM_016018chr832301 1839 350 --22159 2002 --
NM_016019chr7--21020 321 1396 --
NM_016021chr642052 2034 593 97 1291 1237 1628
NM_016061chr241362 1338 1022 173 --11146 --
NM_016072chr121610 1526 21914 1883 --
NM_016076chr143167 2689 2419 92 1148 1376 1192
NM_016081chr472126 2088 1687 1562 1486 518 270 11518 --21871 726
NM_016083chr653273 3097 2967 2924 1382 1424 13766 1334
NM_016107chr521368 429 1486 ----
NM_016123chr12----1982 1479
NM_016129chr42379 79 --1291 --
NM_016131chr262250 2202 2096 1595 1523 369 ------
NM_016133chr22386 24 ----11605
NM_016141chr33744 227 215 ------
NM_016144chr52485 52 ------
NM_016162chr122663 263 --1326 1827
NM_016169chr1073102 2650 2098 2042 1093 513 439 23211 3139 13296 --
NM_016200chr72819 175 --138 --
NM_016201chr342283 2097 1464 642 --21858 1842 --
NM_016206chr3168496 8468 8382 8104 7867 7557 7198 6400 3610 2702 2342 1838 1816 403 379 225 23448 2444 28474 5883 26335 2182
NM_016226chr121107 ------
NM_016231chr1711529 164 11692 --
NM_016240chr821574 1416 --11244 --
NM_016248chr1383835 3026 2824 2435 1460 385 313 145 43949 3939 1421 181 13351 1395
NM_016269chr431110 1015 927 ----11187
NM_016270chr193488 454 337 ------
NM_016271chr1811638 51884 1836 1544 704 276 128 --
NM_016279chr53505 460 161 ----1379
NM_016281chr1211094 11178 ----
NM_016284chr164928 609 290 270 1899 ----
NM_016289chr271838 1552 817 772 356 345 215 1876 ----
NM_016297chr223499 98 11038 ----
NM_016304chr153811 595 301 ------
NM_016306chr3123 ------
NM_016308chr152092 1845 1764 605 559 --11335 --
NM_016315chr261716 1618 1562 1203 318 43 1248 ----
NM_016322chr953072 2840 1029 760 338 32075 1283 1019 1942 --
NM_016338chr521036 66 ----11174
NM_016339chr171213 --161 --
NM_016340chr51471 11268 1240 --
NM_016356chr682870 2826 1901 1892 989 953 740 255 --11974 22490 1061
NM_016357chr122444 61 --11160 --
NM_016374chr141463 1299 1163 431 --127 11153
NM_016376chr1743906 3829 1515 1452 11500 ----
NM_016396chr1582798 2412 1873 1006 612 391 101 92 ------
NM_016424chr1751531 520 497 469 220 1276 ----
NM_016436chr2061884 1066 1008 641 602 270 22687 2107 ----
NM_016441chr231951 868 675 11788 ----
NM_016447chr7----1219 --
NM_016453chr3178 --1431 --
NM_016467chr231319 1017 544 1305 11368 --
NM_016472chr1441380 1258 1224 339 11499 1429 --
NM_016505chr1----1659 1224
NM_016530chr15143967 3837 3145 2998 2857 2573 1655 1521 1356 1012 730 603 381 346 --1294 --
NM_016559chr351304 997 594 579 560 21371 432 ----
NM_016561chr161631 --1125 --
NM_016620chr151350 1277 425 407 330 ------
NM_016628chr103759 736 236 1177 ----
NM_016930chr42998 762 ------
NM_016952chr1184009 3988 3530 3093 1569 1474 238 123 --33766 3353 856 --
NM_017409chr123772 569 60 ------
NM_017412chr831038 65 58 --2452 324 --
NM_017415chr5134275 4151 3932 3812 3730 3551 2933 1749 1457 1374 1174 591 259 --23646 3092 --
NM_017420chr1432736 1358 812 1108 13441 13407
NM_017423chr431904 1667 1661 11797 2688 218 12055
NM_017426chr42454 424 2693 624 ----
NM_017440chr122466 422 --1657 --
NM_017443chr92416 201 --11553 --
NM_017508chr1182549 2429 2349 2343 2207 2169 897 541 --12047 --
NM_017542chr111796 --21430 514 --
NM_017544chrX--123 --1906
NM_017551chr1042609 2082 1034 443 ----1242
NM_017580chr1051706 1547 956 487 399 1212 ----
NM_017594chr953197 2610 2220 2197 982 33076 2981 2373 23007 1014 --
NM_017610chr1562115 1902 1622 1536 762 242 --1270 11494
NM_017628chr4115115 4036 3834 3628 3310 3283 1731 1408 1124 1062 779 43394 3293 1045 26 1220 14216
NM_017629chr161669 1470 1254 625 497 316 --1148 --
NM_017632chr44307 115 94 61 ------
NM_017633chr653120 2867 2388 553 345 23939 3401 ----
NM_017635chr1121517 538 11378 ----
NM_017637chr9169439 9364 9264 8370 8246 8168 8157 7569 6989 6455 3779 3415 2708 2510 2341 1936 57549 3663 3366 2582 2033 11001 --
NM_017640chr61181 --2641 245 --
NM_017649chr102380 318 ------
NM_017650chr795835 5811 4297 2217 2060 2051 1919 1373 254 --25727 2287 --
NM_017658chr14104495 4438 4415 4346 1848 1747 1016 896 681 237 21669 1564 11254 13954
NM_017666chrX42220 1769 1708 1479 --1186 --
NM_017672chr1541338 1210 286 29 --1260 --
NM_017694chr242027 1939 1576 254 ------
NM_017700chr4----1127 --
NM_017709chr154160 3954 3911 3331 143 --13393 13584
NM_017730chr31157 --1167 --
NM_017740chr1641678 1403 1299 1289 --1486 --
NM_017741chr422766 2002 --12827 --
NM_017744chr142482 2257 447 125 11955 ----
NM_017753chr971032 877 806 757 300 141 130 ------
NM_017757chr182872 831 ------
NM_017762chr1562409 2303 1941 1908 1577 124 ------
NM_017766chr1----1530 --
NM_017769chr1422780 890 32739 2150 341 --12625
NM_017770chr632884 2789 125 --12969 --
NM_017772chr631740 1524 1137 ------
NM_017778chr841123 1099 90 63 11535 --11091
NM_017780chr82853 758 1318 --1834
NM_017784chr331082 360 44 --11215 --
NM_017789chr22305 55 ------
NM_017799chr1441695 1496 1290 655 ------
NM_017813chr8165816 5718 5516 4043 3957 2258 2112 1502 1391 1240 1043 997 964 690 625 189 14554 --35666 1736 797
NM_017824chr1052671 2353 1065 354 203 1848 ----
NM_017848chrX22968 530 1731 1658 11661
NM_017851chr15--11228 1515 --
NM_017857chr111552 --1680 --
NM_017880chr23314 39 26 ------
NM_017890chr861708 600 551 536 385 178 ------
NM_017919chr994802 4118 4075 3954 3776 1397 1119 434 53 ------
NM_017922chr144542 503 423 237 3664 275 264 1596 --
NM_017925chr941823 1342 735 276 21850 1371 ----
NM_017926chr144583 321 309 62 ------
NM_017944chr1142092 1186 1049 585 13064 1966 --
NM_017946chr72259 99 1407 --1986
NM_017964chr21265 21025 158 172 --
NM_017969chr2----1175 --
NM_017998chr941124 1025 1008 997 21150 567 ----
NM_018011chr131644 1104 147 --
NM_018013chr642963 2896 464 438 ------
NM_018018chr124585 380 271 236 31823 1236 639 ----
NM_018023chr32238 126 11928 --1265
NM_018026chr1121279 259 ------
NM_018027chr1043266 3253 1146 1069 13287 ----
NM_018030chr182944 201 1892 ----
NM_018043chr1131391 1142 183 --1288 --
NM_018045chr133083 2736 918 --11008 12996
NM_018046chr561956 1717 1621 1561 698 142 --21735 1381 11879
NM_018056chr1----1121 --
NM_018061chr151413 1378 1257 359 320 ----1155
NM_018079chr22551 395 2485 76 ----
NM_018084chr242795 2600 1046 939 13355 12312 --
NM_018085chr1118102 8007 7590 7190 6095 5367 5246 601 461 343 54 27523 866 17165 --
NM_018086chr241498 1359 646 487 --11655 --
NM_018092chr16----11248 --
NM_018098chr331174 826 355 ----21213 294
NM_018117chr101182 1560 1692 --
NM_018119chr161261 --1231 --
NM_018120chr84619 556 515 205 185 21003 456 --
NM_018121chr1072772 2655 2635 2600 2232 2151 2127 ------
NM_018133chr341471 485 312 164 31932 1807 1653 ----
NM_018144chr101308 ------
NM_018150chr1----180 1911
NM_018151chr23812 745 612 1166 --1106
NM_018159chrX31699 643 605 1385 1309 --
NM_018171chr121217 ----1980
NM_018177chr4260 37 --1308 --
NM_018181chr18141924 1870 1730 1531 1299 1269 1261 583 368 302 245 233 199 72 --11902 --
NM_018201chr932173 846 211 ----12547
NM_018206chr162764 593 ------
NM_018211chr111461 11942 --11661
NM_018222chr1141840 1453 1174 580 --21289 664 --
NM_018224chr7----1271 --
NM_018237chr102251 222 ------
NM_018243chr4133812 3746 3684 3572 3379 3169 1575 1284 1212 495 407 147 43 13586 ----
NM_018247chr662965 2650 2495 1020 516 137 ----12422
NM_018254chr122157 769 12148 12138 --
NM_018263chr252461 1716 233 213 66 --1510 --
NM_018287chr103239 183 109 --11225 --
NM_018293chr362968 2496 2406 2263 1152 666 12038 32886 1901 815 --
NM_018310chr8------1536
NM_018317chr4----195 --
NM_018318chr12--1333 1948 --
NM_018330chr1011438 1354 ----
NM_018351chr1274679 4213 4050 1793 878 699 503 --24657 1875 1378
NM_018354chr202218 205 ------
NM_018361chr8103278 2715 2678 1472 1172 939 774 640 447 338 2601 304 ----
NM_018364chr174029 3914 3413 3388 1488 816 609 --13875 14070
NM_018367chr1142505 2437 1701 343 --22219 766 --
NM_018371chr831532 1222 185 2351 47 ----
NM_018374chr765278 4376 1787 1232 692 189 25247 977 11124 1611
NM_018375chr1451933 1344 1327 733 249 21612 1478 1760 --
NM_018387chr91372 1116 --1516
NM_018394chr341606 1591 1398 144 2371 109 ----
NM_018403chr343722 3120 1254 1092 24105 4043 ----
NM_018407chr83299 172 79 11100 143 --
NM_018413chr12--189 ----
NM_018416chr1252624 2542 1913 933 311 22075 2018 12565 --
NM_018426chr61564 ------
NM_018433chr22577 552 ------
NM_018434chr5133 --1146 --
NM_018439chr1862613 2556 1942 1673 987 320 12114 ----
NM_018440chr8168697 7994 7892 7802 6775 5809 5580 3091 3052 2911 2785 2178 2156 1933 666 507 36767 2432 2011 ----
NM_018445chr15------1470
NM_018448chr1221176 166 ------
NM_018489chr1------22294 1909
NM_018490chr1141841 1610 1551 1533 11655 11588 --
NM_018509chr1731440 1229 364 --1147 --
NM_018534chr2166 ------
NM_018557chr281683 1579 1526 609 461 184 158 57 --21444 291 --
NM_018566chr1125065 4978 4415 4310 4076 3494 2061 1936 1146 1055 938 849 11045 ----
NM_018584chr111064 21123 1077 ----
NM_018638chr1245305 1927 1755 1651 14348 35218 4972 1395 --
NM_018650chr162291 2181 2045 1759 1603 567 12171 ----
NM_018657chr31286 ------
NM_018682chr73636 552 147 3619 480 208 1103 --
NM_018686chr12----1235 --
NM_018697chr752262 1660 705 677 228 --11593 --
NM_018704chr12539 145 1847 ----
NM_018710chr82443 183 --11127 --
NM_018717chr442847 2381 2211 889 --32822 2734 2448 --
NM_018718chr782317 2260 2194 2134 1833 1721 1422 931 1362 11747 --
NM_018719chr721112 236 11237 1117 --
NM_018724chr11428 1216 1654 --
NM_018834chr53908 893 48 --1238 --
NM_018898chr532164 1553 800 22277 41 ----
NM_018939chr52398 219 ------
NM_018945chr673658 3598 3561 3436 2423 952 617 33478 915 419 1729 --
NM_018963chr2131456 1446 1237 ------
NM_018970chr773092 3058 2877 2840 2503 1960 604 32560 452 208 --1142
NM_018975chr163777 546 151 --1816 --
NM_018976chr1262781 2268 2024 1932 598 442 22605 2405 11963 --
NM_018977chrX1875 ----11048
NM_018979chr1252590 2548 1783 657 499 --22612 805 --
NM_018992chr1641303 1167 636 140 11359 1660 --
NM_018993chr2021462 1259 21438 544 11366 --
NM_018999chr10134615 4473 4057 3986 3266 3226 1707 1559 1461 1237 1208 1052 663 24073 1535 ----
NM_019004chr762302 2160 1559 1507 465 221 12242 21997 192 --
NM_019018chr51231 ----1623
NM_019042chr761081 826 816 315 169 123 1161 --1108
NM_019045chrX2693 624 ----1844
NM_019066chr152289 278 --1150 --
NM_019080chr1341572 240 206 154 11047 ----
NM_019091chr231162 869 766 1187 ----
NM_019094chr1253188 2519 1404 1268 132 22950 2700 22818 813 --
NM_019114chr961603 958 778 492 358 67 --1843 --
NM_019116chr1683707 3393 3380 3229 2747 465 351 99 23606 2962 11357 --
NM_019555chr341796 1166 146 56 1566 11679 1594
NM_019556chrX21228 974 ----11388
NM_019592chr93884 695 254 ------
NM_019593chr20122830 2808 2494 2425 2303 2229 1232 958 944 883 473 444 --13155 --
NM_019600chr151201 146 --1639
NM_019610chr142187 1949 1521 571 21711 738 ----
NM_019613chr1731293 1178 367 21307 977 ----
NM_019854chr122224 83 ------
NM_019887chr124684 447 285 142 --1460 --
NM_020062chr201224 ----1723
NM_020122chr2106055 5972 5743 5228 1632 929 895 738 544 384 --1952 --
NM_020123chr101117 31585 1307 1180 ----
NM_020127chr131719 1401 641 11763 11838 --
NM_020130chr841412 959 365 89 ------
NM_020131chr111672 1296 --11652
NM_020139chr421679 420 1145 --1181
NM_020148chr1852943 574 210 128 111 --1926 --
NM_020150chr1031986 1942 785 ------
NM_020157chr2011012 ------
NM_020159chr42423 149 2323 283 11214 --
NM_020177chr573395 3231 2504 2295 2233 2081 503 13061 ----
NM_020182chr2082382 2371 957 615 456 376 364 231 13106 23441 2542 --
NM_020184chr232205 2187 808 ----12139
NM_020190chr14462 448 157 21 ------
NM_020193chr1121338 92 1438 ----
NM_020194chr24607 434 158 69 2252 59 1242 --
NM_020198chr1711160 11573 --11292
NM_020205chr142953 2468 2347 1105 ------
NM_020307chr3140 ------
NM_020336chr2053820 3802 3627 1094 554 1349 ----
NM_020337chr452826 2717 1170 961 774 23166 993 21210 219 --
NM_020338chr1053658 1466 1407 1091 901 13097 23484 3380 --
NM_020341chr2021674 1331 42049 1547 445 434 ----
NM_020342chr22606 596 --2700 52 --
NM_020346chr1131638 1367 1265 ------
NM_020347chr351726 1659 917 655 361 ------
NM_020360chr17------1641
NM_020363chrY41742 1572 1324 1159 --21855 524 --
NM_020374chr1241865 1572 1369 413 1685 ----
NM_020381chr631313 700 558 --11802 --
NM_020382chr123527 250 240 --11573 --
NM_020390chr394872 4241 3218 3075 1839 1728 799 787 203 1147 --1746
NM_020401chr12184 ------
NM_020403chr1331764 648 124 2531 157 --11616
NM_020422chr161855 ------
NM_020428chr192968 921 ----1808
NM_020432chr762288 1824 1714 1503 685 85 ------
NM_020436chr20160 167 --1187
NM_020440chr151339 1253 1241 654 625 --12970 --
NM_020451chr121813 1671 ------
NM_020466chr655000 3282 3199 1703 1310 ------
NM_020630chr10--1103 1118 --
NM_020644chr11169 ------
NM_020651chr241716 1212 319 104 31804 616 530 --1609
NM_020673chr2097506 6359 6136 5804 5698 5436 5206 2274 1812 47653 7134 329 304 27376 2864 --
NM_020689chr2031696 1353 1319 11541 11077 --
NM_020697chr841140 906 458 264 --2235 201 --
NM_020698chr1222680 2107 --12710 --
NM_020699chr185178 4828 4697 4021 2144 1640 1356 387 23628 468 14320 35401 3307 937
NM_020718chr16156470 6127 5565 5516 5373 5070 4409 4165 2234 1703 1691 1441 1179 856 93 24469 1325 16104 1540
NM_020734chr1292749 2669 1130 1064 635 503 447 356 337 ------
NM_020738chr221526 97 21629 368 --1206
NM_020742chrX52682 2662 891 584 476 11898 --1615
NM_020748chr1761811 1642 1349 742 503 205 1590 --11592
NM_020752chr1022134 853 2573 359 ----
NM_020754chr3------1503
NM_020760chr252024 1986 1542 1255 777 21764 587 ----
NM_020770chr1----1495 11044
NM_020771chr651504 1177 1095 489 406 11524 ----
NM_020772chr17148645 8457 8395 7796 7252 7138 7123 7094 6102 5967 5474 2812 2318 590 27661 6832 17895 --
NM_020774chr1895329 5149 4932 3886 2158 1613 1599 1436 348 1315 2933 609 21570 1301
NM_020791chr1721272 1012 21081 140 ----
NM_020795chr1731724 391 341 --11993 --
NM_020796chr572819 2618 2331 2309 2136 891 442 22391 196 ----
NM_020801chr562673 659 647 401 325 111 12529 ----
NM_020802chr1122062 537 --22093 703 23394 335
NM_020803chr43917 359 347 2709 209 ----
NM_020808chr141124 1075 749 107 --1862 --
NM_020818chr14----1376 --
NM_020824chr101127 ------
NM_020836chr141791 ------
NM_020845chr122467 287 ------
NM_020854chr1821576 142 ------
NM_020856chr1981597 1423 1182 1168 1005 410 235 141 --11462 --
NM_020858chr1511485 22144 2119 --11961
NM_020859chr483105 3075 2748 2648 2574 1559 1292 1064 --31534 576 233 --
NM_020866chr1341105 763 709 252 11010 ----
NM_020870chr432263 2116 517 12140 ----
NM_020871chrX12494 2687 628 ----
NM_020899chr1742314 1007 457 153 --11714 --
NM_020909chr2114154 3958 3559 3516 3473 2883 2650 1635 1621 1436 96 --34049 3302 2890 --
NM_020921chr1443401 3177 3097 3040 13641 13569 --
NM_020946chr921746 273 11727 ----
NM_020962chr1542282 1894 1774 182 1590 12224 --
NM_020988chr1631131 893 49 --1252 21256 94
NM_020996chr12158 ------
NM_021003chr142785 62 2281 188 1703 --
NM_021005chr1541131 900 427 257 2909 842 1919 --
NM_021033chr1373106 2921 1320 1211 917 698 532 13427 ----
NM_021038chr343361 2626 2448 1031 12160 1211 11081
NM_021072chr512608 ----12283
NM_021097chr252683 2553 2509 922 399 --1222 --
NM_021109chrX------184
NM_021110chr8181 1782 1737 --
NM_021116chr7139064 8874 8469 8453 8283 7370 7048 6770 6644 6598 5521 1082 676 17475 22747 1720 13532
NM_021136chr143716 663 530 ------
NM_021137chr1742061 1935 885 509 --2736 595 --
NM_021140chrX2237 77 ----1401
NM_021147chr51166 ------
NM_021156chr20170 ----11135
NM_021168chr161327 --11621 --
NM_021174chr82254 233 --1722 --
NM_021183chrX61962 1954 1877 897 524 57 52564 2536 2493 645 479 ----
NM_021215chr2032381 1734 32 2595 219 ----
NM_021218chr921018 658 1237 --134
NM_021219chr21175 188 --1247
NM_021222chr111445 11426 ----
NM_021229chr1221232 1123 1889 ----
NM_021238chr1242050 1980 1857 104 --12016 --
NM_021239chr144330 115 74 42 11050 ----
NM_021252chr1072014 1904 1615 337 325 191 98 21919 135 --11337
NM_021269chr1972075 2010 1566 1326 740 704 676 11368 ----
NM_021572chr641173 418 100 23 1868 1299 --
NM_021627chr321112 1097 31195 371 198 ----
NM_021629chr3145065 4896 4512 4177 3480 2045 2027 1157 1107 1018 826 326 280 91 44566 1434 1098 390 1356 --
NM_021633chr131311 1068 927 --11376 --
NM_021639chr12757 157 ------
NM_021643chr231872 1704 638 --11168 --
NM_021648chr632477 2383 775 12218 1304 --
NM_021783chrX2870 211 12034 11727 --
NM_021785chrX4365 238 88 23 ------
NM_021809chr2071996 1638 994 527 516 488 299 ------
NM_021814chr651594 1441 596 479 383 1490 ----
NM_021914chr1452195 2058 1828 1524 967 2888 518 ----
NM_021945chr653557 2982 737 651 512 1562 11382 --
NM_021950chr1172226 2175 2005 1576 1441 672 439 22235 598 1125 --
NM_021951chr93850 687 78 2633 163 ----
NM_021954chr1333153 2447 1188 23205 2361 ----
NM_021961chr11167450 7291 7061 6874 6313 6262 6130 5955 5792 5058 4611 2712 2617 2099 1457 656 56740 4778 4575 1616 839 27469 2443 37403 7263 513
NM_021964chr395877 5820 5565 4153 1903 1865 1662 1497 557 25914 4649 24966 741 15429
NM_021970chr41531 --1518 --
NM_021979chr142295 32 1420 ----
NM_021992chrX3367 345 87 172 ----
NM_021998chrX41324 1292 1105 367 --1124 --
NM_022037chr251001 917 764 353 206 --1936 --
NM_022048chr15106166 6155 5914 5702 4781 4473 4330 1953 745 407 26261 4913 ----
NM_022051chr12599 486 1461 1177 --
NM_022058chr231650 1595 409 1335 --1788
NM_022060chr14--11306 11351 --
NM_022080chr2062680 2565 2494 2143 668 524 12106 1372 --
NM_022085chr61137 --21537 1273 --
NM_022114chr164125 1875 1687 1670 674 553 24620 582 ----
NM_022123chr141192 ------
NM_022130chr541201 545 147 85 11130 ----
NM_022133chr831687 1212 295 11256 ----
NM_022138chr62507 97 --2128 104 --
NM_022143chr731581 515 63 --1465 --
NM_022166chr16106244 6156 6132 5994 5726 4605 2450 2431 1632 1476 25910 3933 25716 5441 --
NM_022340chr353648 3471 3408 1410 1250 1257 ----
NM_022351chr853459 2485 819 694 229 1388 21334 518 --
NM_022374chr21351 ------
NM_022465chr1283055 2995 2649 2503 1869 276 203 89 12690 22848 95 --
NM_022473chr1573667 3155 3043 2883 1185 1089 271 2469 361 12795 14429
NM_022474chr1462531 932 898 650 639 561 --12766 --
NM_022477chr2031427 420 175 2522 501 ----
NM_022482chr2052524 2451 903 790 592 21821 853 --11807
NM_022574chr721555 544 11333 ----
NM_022648chr274616 4504 3931 1804 1302 676 551 12840 --24626 409
NM_022658chr12--11044 11343 --
NM_022659chr8----1368 --
NM_022739chr1731077 901 208 ----1464
NM_022749chr831401 1109 1072 ------
NM_022751chr18186 ------
NM_022756chr1--1494 1504 11390
NM_022763chr362830 2782 2674 2666 2129 1096 23137 317 1801 12098
NM_022764chr161673 ------
NM_022780chr261758 1704 731 490 262 130 21304 28 ----
NM_022781chr943226 3057 1007 717 --22454 129 --
NM_022818chr16----21343 266 --
NM_022841chr1522493 2452 1767 ----
NM_022843chr131259 11125 1375 --
NM_022893chr273098 3021 2745 2431 1939 997 961 12856 ----
NM_022894chr221262 707 11228 1257 --
NM_022898chr14104791 4485 4479 4245 4132 3441 3433 1398 666 336 33652 3068 246 --13877
NM_022900chr721008 45 1279 ----
NM_022902chr51392 162 ----
NM_022912chr272743 2721 2222 2112 1959 476 246 1407 ----
NM_022913chr51330 ------
NM_023016chr252772 2099 2013 489 315 ------
NM_023037chr133930 810 801 ------
NM_023076chr1622155 1832 ----1390
NM_024016chr171794 ------
NM_024019chr441044 759 427 317 ----1769
NM_024034chr201994 ------
NM_024052chr1763106 2824 1062 985 419 55 12126 ----
NM_024057chr12----135 --
NM_024312chr1251573 1286 406 395 77 --1379 1649
NM_024324chr22------1199
NM_024345chr995442 5351 3823 2124 1964 1136 349 272 212 --12292 1695
NM_024408chr163160 3088 2896 1471 533 482 33625 2889 42 ----
NM_024430chr1821469 668 11699 ----
NM_024490chr152586 68 ----1628
NM_024491chr3258 51 1603 ----
NM_024496chr143708 263 25 1585 ----
NM_024501chr22492 276 1746 ----
NM_024522chr121499 620 11859 ----
NM_024546chr135980 953 937 213 184 ------
NM_024551chr124600 558 321 124 ------
NM_024563chr551788 1711 1489 1462 551 ------
NM_024595chr11383 165 2944 100 --
NM_024607chr884499 4476 4421 4394 2929 1308 815 580 13515 ----
NM_024612chr173361 276 62 --21116 1086 --
NM_024613chr821862 1348 31196 1155 211 ----
NM_024624chr261140 647 529 504 390 294 1350 11333 --
NM_024640chr13937 208 83 1976 ----
NM_024646chr173607 3551 3227 2545 978 352 298 13895 13073 12685
NM_024652chr153819 773 299 ------
NM_024663chr20----149 --
NM_024665chr3114471 4254 3829 3510 3341 3297 1790 1014 929 767 417 14131 14672 --
NM_024674chr183144 2985 2254 919 863 745 737 29 11242 ----
NM_024680chr112394 198 3508 499 462 ----
NM_024692chr231848 1232 318 21506 1406 --11524
NM_024700chr12792 401 11202 1367 --
NM_024701chr1031469 1169 633 --21226 655 11726
NM_024745chr163446 147 40 ------
NM_024749chr121972 513 --1788 --
NM_024779chr1261416 1153 441 407 198 100 ----1293
NM_024787chr8------1838
NM_024792chr172964 187 1174 ----
NM_024841chr111935 32000 928 38 1200 --
NM_024844chr17--174 127 --
NM_024913chr731318 1143 496 ------
NM_024920chr461412 1405 1373 1325 977 535 ------
NM_024939chr1611498 --11044 --
NM_024944chr211215 132 1410 --
NM_024946chr1621470 97 --11572 --
NM_024947chr3219477 9243 8705 8593 8221 7470 6983 6669 6124 3116 2894 2858 2824 2810 1843 1831 1739 1371 1312 1216 643 12947 ----
NM_024948chr102313 255 ------
NM_024953chr1252582 2326 2040 1754 1103 12627 ----
NM_024969chr21652 1621 ----
NM_024989chr2116250 5696 5508 5359 5171 2824 2347 2101 1228 905 344 37777 5223 149 27931 5051 --
NM_025010chr332247 1913 1781 1753 ----
NM_025027chr191395 ------
NM_025054chr853867 2982 1680 1294 587 24160 1324 --23399 271
NM_025133chr23358 327 264 1397 ----
NM_025134chr1651675 954 707 309 154 22521 2445 11817 --
NM_025146chr32657 255 22164 1881 ----
NM_025160chr163667 3070 2964 2699 719 621 --1506 --
NM_025164chr1131640 763 179 --12088 --
NM_025176chr202260 123 1730 ----
NM_025179chr134942 3578 837 14923 2713 313 --
NM_025187chr1621404 463 21085 1068 ----
NM_025191chr121355 537 12798 ----
NM_025195chr811251 --11542 --
NM_025208chr1162207 2154 1575 709 364 150 ----21922 829
NM_025222chr343012 1067 854 825 ------
NM_025235chr102419 78 1396 21544 702 1451
NM_025250chr722857 2680 --1795 --
NM_030571chr53459 442 286 ------
NM_030621chr14104179 3810 3572 3262 1450 1381 980 345 249 209 34226 2793 1201 ----
NM_030625chr1032492 697 30 ------
NM_030627chr583996 3446 1216 979 455 245 162 101 34137 4092 3118 13432 --
NM_030629chr1641533 330 324 311 133 1242 --
NM_030637chr141194 --1676 --
NM_030639chrX31222 1140 585 21737 314 21775 1202 --
NM_030647chr7136267 6052 6022 5906 5805 5793 5672 4793 4397 4358 2016 871 654 36111 4737 1001 25131 761 --
NM_030648chr4115482 4621 4088 4070 3975 3690 1362 1210 793 760 621 25553 886 24461 1735 11697
NM_030650chr2133930 3777 3746 3554 3547 3337 3280 3088 2716 1166 859 813 86 11091 ----
NM_030661chr7--1548 --11698
NM_030755chr1453073 2986 2688 2228 993 ------
NM_030756chr10294 29 --1260 --
NM_030759chr101728 --1534 --
NM_030773chr2041748 322 277 187 11340 ----
NM_030790chr162292 241 ------
NM_030791chr1451383 1299 688 256 95 ------
NM_030802chr173876 790 772 ------
NM_030806chr1138750 8441 6985 6227 6081 3413 2535 2486 1973 1367 1324 677 219 48096 7969 5858 1021 23251 845 172
NM_030820chr631058 950 55 1974 ----
NM_030885chr372309 2277 2231 2139 229 98 88 1669 ----
NM_030906chr112428 138 1567 1414 --
NM_030912chr102677 163 --1860 --
NM_030915chr262084 2051 2013 791 564 128 1221 12072 --
NM_030918chr185049 3648 2136 2007 1456 1443 1170 1089 14184 14064 --
NM_030919chr205428 417 165 121 112 ------
NM_030920chr161995 1947 1476 1409 141 62 11491 12028 --
NM_030923chr2--1710 1600 --
NM_030938chr1731146 796 387 --1149 --
NM_030939chr631090 445 360 --1225 --
NM_030962chr1131482 1451 1439 11549 21463 1285 11490
NM_030964chr53879 529 229 --13617 --
NM_031216chr186629 500 393 181 34 26 --11525 1549
NM_031271chr841737 1626 1114 494 198 --1135
NM_031291chr43684 454 71 ------
NM_031296chr472329 1966 953 563 145 138 113 32341 2248 2058 ----
NM_031417chr19----1768 12450
NM_031422chr181237 ------
NM_031426chr912695 ----21842 142
NM_031442chrX73183 3147 2890 2308 1006 743 135 22716 1187 22521 381 --
NM_031444chr2242498 2463 2372 169 12531 ----
NM_031445chr253188 3110 3055 2789 2454 --23368 2647 --
NM_031461chr82757 62 --1313 --
NM_031462chrX42674 2215 2090 1816 12437 11002 --
NM_031469chr684065 3540 2886 2828 1565 1042 484 117 --13394 1526
NM_031476chr1682697 2592 2221 1847 980 721 135 53 --12745 1884
NM_031480chr62500 380 1522 1390 --
NM_031483chr2043450 3371 2743 2345 144 --12620
NM_031866chr102937 346 ------
NM_031892chrX1952 1632 1944 --
NM_031918chr1931949 1767 1314 ------
NM_031934chr174351 290 269 87 ------
NM_031946chr7----1415 --
NM_031954chr1282286 2027 1080 990 959 686 666 536 2325 122 22853 2265 --
NM_032016chr72620 534 --2731 469 --
NM_032021chr1121104 1078 --1998 11232
NM_032042chr541038 909 699 149 12246 --12359
NM_032047chr372381 2366 2318 2008 1841 617 207 ------
NM_032102chr1163030 2491 1202 1089 504 136 --22997 153 --
NM_032109chr5--11066 11255 --
NM_032120chr71156 ----1119
NM_032124chr1821072 894 2877 200 ----
NM_032142chr183226 97 84 ------
NM_032144chr241812 1450 1259 1177 11436 --11656
NM_032145chr651868 1809 1648 1489 298 ----155
NM_032160chr18114074 3780 3643 3483 3132 2954 892 213 133 53 26 ------
NM_032174chr11525 --11480 --
NM_032177chr52347 83 --1331 --
NM_032192chr171590 ----1755
NM_032195chr212502 199 --1477 --
NM_032199chr1073866 3776 3654 2789 2728 953 674 1738 23720 870 --
NM_032208chr232960 573 484 13335 ----
NM_032211chr102920 240 --1904 1372
NM_032217chr41126 ------
NM_032221chr2042063 1811 1486 1439 ------
NM_032228chr1173541 3501 3469 3281 2917 2681 984 22687 2392 ----
NM_032239chr441170 927 155 52 ------
NM_032283chr111842 ------
NM_032287chr22104212 4183 4163 3980 3851 3631 1117 883 89 56 23556 1220 23486 212 --
NM_032320chr11----1253 --
NM_032329chr243776 3222 2978 1764 ----14327
NM_032354chr174978 883 853 198 ----1182
NM_032373chr1075922 5735 1736 1213 552 451 298 35687 4591 1952 ----
NM_032408chr71148 --1791 --
NM_032410chr84396 226 189 162 --21215 274 1312
NM_032435chr182183 2008 1816 1742 1638 1559 325 316 22206 464 ----
NM_032440chr1072349 2206 2150 1102 729 218 120 --2896 112 --
NM_032446chr582927 2436 1233 1163 1128 1087 372 76 ------
NM_032456chr42636 94 2666 147 1219 --
NM_032457chr443881 3106 2547 120 13707 13861 --
NM_032458chrX53393 2960 960 545 146 2425 187 22287 1233 12842
NM_032485chr201664 ------
NM_032491chr1241065 1042 852 307 ------
NM_032505chr3132773 2752 2557 2443 2437 2256 2214 2132 1931 1860 1751 958 939 11896 ----
NM_032512chrX31056 464 157 --11177 --
NM_032539chrX3533 332 157 1165 1738 --
NM_032547chr451423 1367 975 273 89 1470 ----
NM_032552chr921535 394 21951 1804 11274 --
NM_032554chr122513 489 ------
NM_032560chr14--1291 1422 --
NM_032569chr1631903 1401 634 ------
NM_032582chr1741346 1215 587 565 ------
NM_032583chr16------1341
NM_032590chr1241085 1075 934 928 2979 123 1824 --
NM_032632chr1451964 1842 1631 755 272 22010 330 ----
NM_032682chr3113573 3383 3134 3041 1052 759 539 511 444 407 221 11239 12859 --
NM_032737chr1932717 2484 2163 12686 ----
NM_032777chr8--21604 1477 11405 --
NM_032808chr151629 ----1993
NM_032833chr132543 306 263 22697 144 22452 792 --
NM_032838chr1941074 954 441 319 ------
NM_032840chr1211084 --1373 --
NM_032869chr842089 1789 1772 1354 --127 --
NM_032873chr1184395 4359 3697 3469 2862 940 864 698 23214 979 --14440
NM_032875chr173794 771 191 ------
NM_032876chr1411506 ----11517
NM_032900chr1063775 2742 1207 944 811 474 1180 ----
NM_032905chr101382 1822 11176 --
NM_032918chr12190 21227 324 ----
NM_032930chr11135 ------
NM_032932chr17126375 6252 5734 5398 5353 4655 4176 4167 4137 2421 1200 226 12287 25625 1534 1239
NM_032961chr42231 39 ------
NM_033055chr11726 ----1999
NM_033089chr2051514 1442 1430 1204 492 ------
NM_033102chr121158 509 11278 ----
NM_033117chr9--1270 173 --
NM_033121chr1241720 1363 625 325 1734 11627 1413
NM_033129chr2031952 1801 1571 ------
NM_033132chr1362239 2150 1800 1573 1493 159 2627 601 ----
NM_033161chr921914 148 21453 399 11849 --
NM_033201chr161855 1996 --1880
NM_033211chr532114 520 243 ----11638
NM_033224chr7147593 7492 6988 6676 5528 4982 3081 2272 2209 2138 1799 1637 1427 664 38086 8041 2449 ----
NM_033225chr862910 2399 2028 1117 1019 654 32941 2766 604 ----
NM_033274chr563555 3445 3096 2776 1411 759 23640 1432 ----
NM_033285chr8124451 4375 4348 4071 4001 3897 3887 3826 2929 1465 359 207 23440 3152 13772 14430
NM_033316chr3----1548 --
NM_033393chr43913 692 90 1740 ----
NM_033394chr271587 1529 1424 1365 1038 305 284 11194 11487 --
NM_033396chr111420 --1162 --
NM_033426chr1452915 1981 1791 570 477 12732 ----
NM_033427chr73702 634 543 1147 ----
NM_033495chrX31036 938 159 ----142
NM_033505chr2116556 5670 5404 4370 4362 4240 1800 1744 1729 1203 311 ----21446 398
NM_033540chr331039 1028 855 ------
NM_033656chr2185974 5758 4538 1863 1607 1092 1050 163 23835 1978 1179 --
NM_052832chr862117 1858 846 771 675 69 1384 22991 2610 --
NM_052845chr1242608 2413 1246 1212 1499 13284 --
NM_052876chr191785 ----12737
NM_052879chr1264067 3841 3058 2939 2546 285 21518 948 23909 2828 12606
NM_052885chr1263337 3265 1439 1191 720 695 24573 4409 ----
NM_052896chr132611 2318 2286 12400 ----
NM_052897chr122837 325 1801 ----
NM_052898chr821298 311 11509 --11685
NM_052900chr831423 1371 282 31841 1746 1242 --11779
NM_052904chr621221 1100 11436 1279 --
NM_052905chr241336 658 556 384 --1434 --
NM_052906chr2224373 1637 25091 2006 ----
NM_052907chr1263959 3578 1535 966 710 489 ------
NM_052913chr62763 108 1725 1460 --
NM_052925chr192823 192 1930 156 --
NM_052937chr872449 2411 1743 1076 597 389 305 --1440 --
NM_052943chr11886 ------
NM_052948chr19177 ----1121
NM_052950chr1331869 338 130 1608 11366 --
NM_052966chr163148 2524 1186 687 202 171 ----13891
NM_052968chr11------1214
NM_053002chr331145 992 38 ------
NM_053023chr11103263 3248 3138 2822 2801 2255 2235 1327 893 805 12489 22955 42 --
NM_053024chr351475 1206 584 532 467 --21088 131 --
NM_053056chr1182936 2757 2136 1214 890 563 244 148 11121 22465 707 --
NM_057175chr411816 11021 ----
NM_058170chr131175 496 377 1277 ----
NM_058172chr441780 665 281 156 ------
NM_058182chr211135 ----1520
NM_058191chr212201 50 ----1263
NM_080415chr172373 266 ------
NM_080422chr18----1279 --
NM_080546chr942281 2273 846 642 22243 1705 ----
NM_080607chr2031021 721 331 1920 ----
NM_080671chr252216 563 425 413 206 ----12231
NM_080738chr121917 188 ------
NM_080743chr632590 2220 778 12360 ----
NM_080744chr72247 98 --1645 --
NM_080820chr20----1496 --
NM_080836chr2064650 4592 3634 1040 695 189 ----14742
NM_080927chr373384 3267 2908 2720 2445 1178 599 1862 12727 --
NM_130386chr181489 --1481 --
NM_130808chr33449 317 158 ------
NM_133334chr486337 6072 4542 4350 4044 1483 1072 773 25282 354 25506 309 --
NM_133445chr933716 3624 2406 73652 2757 2728 2391 2355 2335 77 11059 164
NM_133496chr1114202 3426 3295 2912 2812 2768 1440 1197 844 557 153 13837 33435 1460 608 11222
NM_133646chr2105577 5567 5418 5262 5244 5093 4911 1779 328 169 15597 ----
NM_138288chr1461539 1396 858 576 271 241 1443 ----
NM_138328chr1753351 3047 2687 850 831 13156 ----
NM_138340chr18----1167 --
NM_138344chr14------1395
NM_138348chr5105478 5118 4303 4217 1718 1644 1438 928 857 282 1656 ----
NM_138357chr1011190 --1324 --
NM_138423chr1532268 579 60 --1245 --
NM_138426chr762483 2384 2299 1984 759 611 ------
NM_138444chr1354449 4160 3360 1084 84 24426 1840 14120 --
NM_138455chr8--1340 1330 --
NM_138459chr663651 3553 3016 2665 2257 200 ------
NM_138468chr296137 5916 5720 4674 4652 2515 967 509 193 36309 263 48 12530 --
NM_138473chr12105138 5058 4062 3502 3453 3358 3351 1987 1826 1028 --13719 15178
NM_138477chr15----1349 --
NM_138479chr131433 1408 316 ----11377
NM_138572chr673005 2507 2207 998 778 520 385 --1952 13354
NM_138715chr852206 2078 1593 1524 358 ----1375
NM_138731chr1483703 3145 2825 1363 1174 774 525 172 23864 255 44258 4097 3179 2895 --
NM_138771chr731036 559 275 ------
NM_138782chr51262 42355 2260 904 895 12233 11919
NM_138795chr131595 1012 233 ------
NM_138799chr231477 1442 647 11564 ----
NM_138959chr1116476 5627 4986 4743 4737 2355 1838 1422 1153 519 512 16572 42321 2262 2186 1545 22311 1647
NM_138967chr1522377 673 --22307 120 --
NM_139126chr62768 633 --1185 --
NM_139136chr121829 ------
NM_139177chr172230 167 --11548 --
NM_139244chr62915 881 --1955 --
NM_139280chr172502 239 --11463 --
NM_139283chr1282103 1947 1933 507 476 157 126 90 11693 --12207
NM_139321chr2044123 2961 925 205 ------
NM_144563chr25825 772 716 614 79 ------
NM_144571chr4136408 6218 5926 5519 5466 4450 2681 2283 1391 1233 1145 897 488 47039 6260 4503 2114 1142 12692
NM_144599chr15115428 5247 5199 4812 4368 4135 4082 3937 1858 1252 453 25032 1531 --13521
NM_144604chr16166 ------
NM_144632chr262350 2050 1848 1711 1699 1656 ------
NM_144633chr3171 ------
NM_144635chr31147 ----11298
NM_144642chr33870 297 267 11018 ----
NM_144664chr1192562 1847 1676 1045 768 727 687 236 98 42236 1897 649 138 22614 474 12133
NM_144665chr111244 --1235 --
NM_144710chr251265 1177 357 305 81 ------
NM_144718chr31242 --1386 --
NM_144720chr41191 1218 ----
NM_144721chr432507 2286 746 1443 1827 --
NM_144726chr51914 1194 1988 --
NM_144775chr1764946 3958 3780 3515 1726 1334 ----11003
NM_144778chr1372704 2454 2309 2030 1952 1097 815 11868 2797 706 --
NM_144973chr1265348 4071 3686 2128 1357 927 14081 35184 1124 477 --
NM_144979chr44704 628 94 42 --1647 --
NM_144982chr121293 1696 2779 761 --
NM_145011chr1062095 2078 1734 1528 586 118 1285 11906 --
NM_145025chr651040 994 955 101 87 ------
NM_145056chr19------1849
NM_145117chr1162947 2860 2835 2639 655 245 --12602 --
NM_145165chr1422387 233 --199 --
NM_145206chr1073081 2785 2216 1148 634 258 174 ------
NM_145245chr1911210 ------
NM_145284chrX72443 2281 2231 1991 712 614 201 11905 ----
NM_145291chr44416 392 382 358 ------
NM_145296chr192891 831 ------
NM_145305chrX------11048
NM_145313chr1031423 1368 109 ------
NM_145349chr1752258 2167 1922 1629 698 12177 ----
NM_145735chr1382852 2592 2444 2171 1994 1908 1725 142 --12249 12518
NM_145753chr361483 1366 1354 1318 1197 499 31403 448 153 1652 --
NM_145756chr1821517 1121 ----31396 1215 94
NM_145799chrX42148 2120 1017 311 22011 410 1910 --
NM_145800chrX2926 917 --1873 --
NM_145808chr753003 2903 2476 2458 1929 22948 2182 12107 --
NM_145891chr1621519 1474 1430 ----
NM_145913chr12181 11038 ----
NM_147128chr72422 306 11094 ----
NM_147156chr1011376 1551 1278 11444
NM_147189chr871803 1619 1465 890 403 242 99 ------
NM_148894chr4----1226 --
NM_148957chr1382622 2267 2256 1961 1909 1878 1015 59 12670 ----
NM_152265chr151325 568 173 166 119 ------
NM_152271chr831155 1149 801 31129 1069 466 175 --
NM_152272chr831209 360 353 ------
NM_152275chr242355 730 444 363 12148 1267 1118
NM_152280chr1103121 2986 2907 2715 1393 1315 965 930 793 396 --11234 1202
NM_152284chr81647 ------
NM_152344chr1731191 1137 532 ------
NM_152374chr131448 492 45 ------
NM_152380chr1------11681
NM_152390chr2----1565 --
NM_152400chr442049 1971 1729 1323 21615 126 11587 11794
NM_152409chr573305 2575 853 828 497 202 141 1463 ----
NM_152414chr831644 1418 1325 ------
NM_152415chr84454 338 203 151 177 ----
NM_152417chr861318 1306 1036 909 81 53 2234 173 ----
NM_152423chrX21195 1124 11567 ----
NM_152424chrX74717 3484 1819 1772 1607 1275 240 24699 833 ----
NM_152450chr1531564 1474 36 32148 1612 537 ----
NM_152470chr1833887 2645 78 --13987 --
NM_152487chr11506 11167 ----
NM_152493chr141531 1383 1287 1251 --11635 --
NM_152510chr223338 183 118 2274 49 ----
NM_152520chr22883 808 1970 ----
NM_152556chr731988 855 100 1550 ----
NM_152581chrX2595 362 ----1515
NM_152594chr1572320 2306 1826 1626 306 218 36 12052 ----
NM_152609chr11975 ------
NM_152622chr5113468 3434 2953 2685 2313 1354 1321 1314 974 426 67 22590 2303 --11397
NM_152624chr5177198 6826 6668 6188 5937 2885 2675 2618 2491 2038 1710 1642 1470 1113 487 280 166 27437 5055 ----
NM_152636chr1152993 2747 2044 867 249 --21960 702 --
NM_152638chr121924 ------
NM_152653chr32526 478 ------
NM_152660chr11131 ------
NM_152667chr2051248 1118 1103 546 515 11363 ----
NM_152678chr342505 2348 1661 350 32277 1979 1889 ----
NM_152687chr531298 1005 950 ----1847
NM_152704chr135748 742 285 154 78 1907 1330 --
NM_152716chr1141341 1022 280 269 ------
NM_152722chr11--1463 11829 --
NM_152727chr161233 --1261 --
NM_152734chr644019 3950 2064 1756 35500 3326 1091 1123 --
NM_152737chr641937 1542 633 593 21827 1488 12033 --
NM_152739chr741138 1024 853 416 11079 ----
NM_152744chr723209 926 1191 1965 11318
NM_152756chr594286 4246 4107 3851 3236 1243 1186 1081 194 43728 1457 791 541 --13281
NM_152758chr862838 2520 1189 1166 970 400 32729 854 261 ----
NM_152774chr772042 1962 602 594 402 92 85 2521 331 ----
NM_152787chrX103602 3163 2929 2521 1026 950 861 645 613 133 22781 538 ----
NM_152793chr785003 3859 1597 588 460 244 176 82 11052 23603 1723 24681 1218
NM_152835chr1102639 2577 2448 2201 2195 1019 963 915 451 362 1618 --1393
NM_152896chr92648 537 1278 ----
NM_152903chr1372885 2870 2221 2012 1982 1971 1095 11000 11087 --
NM_153020chr621386 310 1292 ----
NM_153026chr121109 ----1356
NM_153029chr1653993 3558 3118 966 957 22935 1351 21637 1236 --
NM_153035chr121985 471 21175 998 1134 --
NM_153184chr311247 ------
NM_153207chr1273917 3324 3301 3055 2806 587 555 21109 616 1301 --
NM_153223chr531569 202 126 41578 1349 480 196 --156
NM_153234chr532219 2066 801 2765 626 --1486
NM_153261chr1651584 1562 391 249 85 1327 ----
NM_153262chr143167 2783 2768 544 32474 1244 434 ----
NM_153267chr92222 181 2707 145 ----
NM_153354chr51951 1683 1237 1802
NM_153365chr462240 1785 990 816 589 304 22097 2004 11896 --
NM_153367chr1093512 3349 3256 2838 2509 1606 1493 887 230 ----13048
NM_153607chr5102658 2617 2156 1938 1120 963 910 642 599 77 22342 1952 ----
NM_153634chr1241374 1124 458 58 --11538 --
NM_153646chr142490 151 ------
NM_153685chr1241158 1050 359 284 ----11241
NM_153687chr1241617 1571 1331 573 11449 ----
NM_153690chr33900 796 723 ------
NM_153697chr22326 243 ------
NM_153702chr42294 37 ------
NM_153757chr421068 482 1490 1879 --
NM_153810chr10154856 4615 4125 3686 3455 3427 3251 3211 2021 1269 745 611 555 507 426 21518 153 --23880 622
NM_153812chr171492 863 742 716 304 190 59 22330 834 ----
NM_170606chr761500 1398 1210 658 245 74 --1759 --
NM_170665chr1294093 3973 3856 2969 1226 781 410 248 140 11124 ----
NM_170672chr221328 317 ------
NM_170768chr1111294 --1332 --
NM_172070chr241661 579 390 96 11693 ----
NM_173078chrX2323 295 ----1332
NM_173083chr131215 1186 817 11316 ----
NM_173156chr142231 1458 423 58 ------
NM_173172chr2--21226 1200 21472 210 --
NM_173355chr23830 317 42 ------
NM_173359chr381908 1451 1256 1235 575 290 32 25 ------
NM_173468chr495401 5320 5294 5067 4277 3872 2394 1850 1635 24913 567 11288 --
NM_173469chr1531490 1329 176 21548 371 1170 11208
NM_173470chrX72588 2356 2242 1017 649 393 341 1258 ----
NM_173471chr31904 1968 11109 --
NM_173473chr1041066 922 434 123 ------
NM_173495chrX42166 1005 982 708 ------
NM_173511chr2123427 3253 3222 3152 3109 2639 2472 1570 1205 1164 1046 737 13656 ----
NM_173517chr7157 1495 ----
NM_173531chr19113753 3497 2605 2385 1554 1159 960 932 771 651 614 13801 12500 13277
NM_173536chr435021 5004 3733 45111 1097 669 364 15032 --
NM_173552chr342412 2388 2275 350 11865 ----
NM_173563chr61218 ------
NM_173567chr11205 ------
NM_173570chr322091 1425 ------
NM_173576chr1062268 2137 1695 1619 1599 841 11429 --11743
NM_173582chr1156257 4904 4679 777 684 11017 26077 2172 --
NM_173595chr1264175 3508 3284 1864 964 155 --14382 --
NM_173642chr1167627 7617 7578 7569 7330 6727 3103 2586 2250 1113 923 819 723 660 166 93 27357 6771 1577 1634
NM_173648chr21996 ------
NM_173654chr34810 615 388 212 1799 12041 --
NM_173683chr83647 537 46 1234 ----
NM_173698chrX71940 1759 1697 1549 773 562 460 1417 ----
NM_173794chrX1149 1467 ----
NM_173797chr561336 1275 1252 1229 877 536 21117 1008 ----
NM_173808chr173411 2971 1682 1135 799 666 641 24237 279 ----
NM_173829chr5105753 5672 4963 4708 1761 1755 1256 979 668 421 25368 676 25382 1159 25061 92
NM_173851chr81877 21452 276 ----
NM_174916chr1541890 716 352 107 11530 --1933
NM_174921chr43806 169 103 2741 292 ----
NM_174934chr1163620 3595 3324 2599 1212 1191 ----12383
NM_174937chr103700 646 182 --1726 --
NM_175056chr352156 2030 1959 393 107 ------
NM_175061chr74691 622 185 177 --1160 --
NM_175607chr331407 181 129 21738 1152 ----
NM_175611chr212221 205 ------
NM_175630chr23872 785 706 ------
NM_175709chr2253009 2951 2885 2807 2151 --22863 442 --
NM_175733chr1132109 2093 1556 22172 531 12043 --
NM_175747chr62855 246 ------
NM_175852chr162230 1013 932 833 816 591 1179 ----
NM_175854chr1392652 2584 2312 2219 2166 1887 923 406 335 --22646 1081 1368
NM_175873chr561363 1230 1203 926 549 115 21351 427 ----
NM_175875chr19----1640 --
NM_175884chr731327 1308 473 ------
NM_176814chr721240 1102 21025 535 11326 --
NM_177400chr10133 --175 --
NM_177424chr131938 1445 232 11893 11398 --
NM_177538chr297465 6267 5959 5696 3062 2540 330 273 118 58078 2384 1673 598 131 13482 1100
NM_177968chr22450 214 ------
NM_178011chr1042618 2602 1154 897 22191 466 --2189 42
NM_178123chr23893 277 27 ------
NM_178140chr52440 333 1451 12611 --
NM_178313chr241717 1681 1559 131 ------
NM_178496chr321471 213 11074 11034 --
NM_178505chr1073625 3105 2766 1194 963 758 366 --13642 --
NM_178509chr1754024 3716 1422 929 515 1151 23095 545 1300
NM_178539chr121703 --21487 757 11874
NM_178554chr342805 2727 2510 164 1422 --12348
NM_178565chr82641 93 143 ----
NM_178568chr1711706 --11714 --
NM_178812chr821477 496 134 --11186
NM_178815chr1032110 1688 614 22486 2170 11100 1907
NM_178818chr1672433 2301 1841 926 910 573 257 1604 ----
NM_178835chr41704 --1674 --
NM_178863chr16178 --1429 --
NM_178864chr111500 --1680 --
NM_178868chr3--1300 ----
NM_180989chr1332478 2123 1761 ----11525
NM_181077chr1562275 1827 1534 1503 896 746 1153 1314 1510
NM_181358chr173969 2817 2804 2750 1552 994 951 54057 2924 1327 1229 621 11110 --
NM_181457chr211285 1501 ----
NM_181489chr396759 6160 5896 4815 4660 2591 2375 1919 321 14181 16626 --
NM_181491chr913214 12091 12023 12440
NM_181504chr594067 3476 3380 3184 2726 2571 1547 783 752 33215 2992 509 --12535
NM_181521chr16147214 7082 6622 5916 5707 5691 5354 5038 4580 2543 2254 2195 1384 1015 45385 2282 1802 308 15792 --
NM_181534chr17----1228 --
NM_181552chr72955 683 --1296 --
NM_181571chr102945 312 1233 194 --
NM_181645chr11------1710
NM_181712chr131740 561 181 11695 1173 --
NM_181723chr821457 227 11898 ----
NM_181782chr632152 647 509 --1230 --
NM_181784chr242346 2296 929 396 1943 ----
NM_181807chr112293 118 ------
NM_182485chr4123274 3150 3022 2962 2674 2643 2548 2420 599 505 297 241 23733 1022 13110 13361
NM_182487chr944186 3489 3131 1780 24420 4396 152 --
NM_182488chr13----1127 1654
NM_182511chr1841422 1039 327 265 ------
NM_182524chr4----1236 --
NM_182537chr3142 --1289 --
NM_182540chrX4834 790 314 173 1801 ----
NM_182663chr161550 1391 727 457 163 45 166 ----
NM_182691chr751329 988 316 152 124 1335 21138 564 11359
NM_182700chr791937 1842 1775 1653 1557 1373 1280 690 648 11973 --21254 167
NM_182757chr672984 2757 2748 2611 2354 2312 1096 23413 3094 ----
NM_182765chr1062314 2255 2177 1646 1517 790 ------
NM_182830chr141666 11687 --164
NM_182920chr341264 1028 893 270 --1302 --
NM_182944chr141392 --1155 --
NM_182970chr2053472 1204 565 334 169 ----1476
NM_182976chr11232 ------
NM_183376chr1542479 2468 1839 1607 --12595 --
NM_183416chr141551 1459 737 173 --21401 582 --
NM_194071chr7145456 5254 5069 4517 4394 4342 4243 3370 1464 1329 1151 894 84 64 15266 25399 1246 --
NM_194247chr2104407 3632 2822 2753 1469 1183 1168 515 505 290 34073 641 211 --13559
NM_194250chr23393 350 341 ------
NM_194272chr153909 753 351 ------
NM_194282chr4112521 2395 2162 2148 2027 1933 1900 1890 1113 466 345 ------
NM_194285chr1163391 3067 2104 1029 324 137 23414 3075 12579 --
NM_194286chr1265660 5441 4719 2052 1244 1098 14262 ----
NM_194292chr161734 1659 1590 1425 1166 175 --11527 --
NM_194313chr921249 719 --11948 11688
NM_194314chr1125633 5399 5166 4847 3908 3433 1785 1364 1093 801 668 633 23410 267 23681 3514 --
NM_194317chr222112 435 12748 --12730
NM_194318chr1362574 2269 2174 1850 622 406 ------
NM_194439chr451377 1312 231 148 115 ----1291
NM_197941chr562915 1139 1042 866 569 372 22923 2149 12846 --
NM_198066chr1422783 1018 13004 --11153
NM_198077chr11564 ------
NM_198081chr642942 364 285 154 12149 11177 --
NM_198243chr154961 736 605 60 --1259 --
NM_198270chrX33274 2935 2393 33335 3292 3283 13373 --
NM_198279chrX1344 21017 825 --1225
NM_198353chr41476 1332 ----
NM_198401chr831353 665 118 31632 655 425 21721 231 --
NM_198404chr134763 627 316 263 --1853 --
NM_198427chr1148 ----1502
NM_198463chr34423 382 333 179 1140 ----
NM_198465chrX42919 2259 989 225 22316 1024 --1238
NM_198467chr7------1127
NM_198503chr142387 2048 1925 62 ------
NM_198504chr33824 636 102 ------
NM_198511chrX61823 1797 1348 1165 732 175 ----1528
NM_198513chr85804 753 565 448 210 21407 364 --11983
NM_198516chr112205 32 ------
NM_198844chr171841 --1396 --
NM_198859chr3125094 4928 4293 4181 4139 4010 3914 1998 1396 794 453 198 45156 2047 2012 461 --13590
NM_198935chr2032632 2417 670 12159 --12406
NM_198947chr11--1188 1783 --
NM_198993chr1741274 1176 594 152 ----1454
NM_199044chr153148 2893 842 711 406 11057 13041 --
NM_199072chr752826 2580 2518 329 106 12464 ----
NM_199168chr10--31366 1197 1187 ----
NM_199262chr1711795 --11718 --
NM_199320chr452465 2364 2112 1937 1916 42958 2684 2571 188 ----
NM_199355chr1621240 256 ------
NM_199461chr101225 22711 580 12926 --
NM_201439chr12------1393
NM_201613chr121845 ------
NM_203371chr1161739 742 609 201 182 119 --2680 484 --
NM_203406chr552298 1057 1017 601 213 --1545 --
NM_203434chr92233 199 --1919 --
NM_203458chr142898 1116 340 96 --13047 13812
NM_203459chr152405 1912 1615 238 44 1585 1446 --
NM_203463chr2103769 1604 1117 1072 894 622 407 268 238 232 31869 1617 275 23792 191 --
NM_206832chr17138 ------
NM_206853chr683845 3805 3284 3067 1143 726 646 122 34129 3715 886 24096 3430 --
NM_206854chr6145106 5066 4545 4328 3721 3600 1987 1907 1383 1064 982 696 344 86 35390 4976 2147 25357 4691 --
NM_206967chr161463 ------
NM_207009chr101903 1126 1400 --
NM_207015chr32322 169 11756 --12306
NM_207111chr732609 1848 1716 12790 12662 --
NM_207321chr103407 357 336 1269 --1916
NM_207325chr191814 --1556 --
NM_207335chr333198 2385 856 13035 --11012
NM_207351chr33657 527 489 ------
NM_207371chr1041566 1450 1038 72 ------
NM_207406chr4114918 4359 2510 2482 2402 2268 1532 1468 1008 774 730 25884 4510 25797 1284 --
NM_207423chr101138 ----186
NM_207445chr1521686 276 --1833 --
NM_207517chr1521778 439 11726 21852 1739 --
NM_212467chr1522376 829 ------
NM_212558chr973676 2905 1341 1161 1016 974 454 23284 282 --14066
NM_213609chr31425 --2874 292 --