TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-518c-5p
miRNA Sequence: UCUCUGGAGGGAAGCACUUUCUG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000020chr1291903 891 885 706 486 405 396 342 307 32298 1603 321 22368 301 21636 479
NM_000084chrX136567 6413 6388 6233 5436 4863 2641 1989 1612 1560 987 750 501 21009 461 16481 22476 2400
NM_000092chr263763 3514 3370 1709 867 143 ----2719 650
NM_000112chr5105485 4682 3951 3632 2027 1994 1818 1812 1659 1558 14051 --11952
NM_000125chr653552 2869 668 127 28 11057 --12958
NM_000176chr563462 3222 3088 1545 1046 385 --13096 --
NM_000202chrX83231 3164 2800 2606 2582 1278 1066 717 1678 ----
NM_000208chr1974347 4133 4109 4029 3524 523 454 ----1117
NM_000216chrX33206 656 101 13262 23313 81 --
NM_000259chr1596159 6152 5084 4915 4560 4287 3994 2533 2486 --25653 4896 21957 1349
NM_000321chr1321698 306 ----11664
NM_000332chr6126602 6291 5896 5615 4501 2883 1874 1776 1058 763 242 52 11974 46646 6336 4957 487 25527 2412
NM_000337chr596596 5766 5587 4512 2600 2182 1913 385 344 15842 24309 1331 --
NM_000346chr171585 11665 1309 1790
NM_000368chr984486 4079 3727 3274 654 566 459 386 --33898 3814 90 11137
NM_000390chrX73356 3100 2787 728 480 370 54 --13423 --
NM_000408chr233035 2968 667 22195 65 1581 --
NM_000439chr552188 1705 671 588 188 11951 1689 --
NM_000448chr1142671 2476 2364 1065 1274 1675 23134 2413
NM_000474chr71437 137 --285 61
NM_000555chrX117694 7251 5737 5274 2262 2250 2025 1844 1128 787 21 15973 23153 28 27715 250
NM_000610chr1192735 2110 2007 1953 942 639 511 500 361 42089 2054 1934 806 22932 2249 --
NM_000618chr12116570 5798 5241 5136 4809 2577 2355 2203 1980 1356 1080 11458 --11123
NM_000618chr12116570 5798 5241 5136 4809 2577 2355 2203 1980 1356 1080 11458 --11123
NM_000633chr1894799 4087 3588 3407 1542 1170 932 922 638 13768 --24209 1052
NM_000663chr16112655 2325 2053 1999 1096 1030 911 873 483 287 96 1231 22674 2437 --
NM_000719chr12176591 6541 6465 6295 6257 5206 5186 5025 4752 4330 4324 4243 2250 459 418 412 64 46584 6388 4306 482 34340 2444 503 --
NM_000793chr1454633 4028 3945 3833 2059 1894 13527 14453
NM_000813chr574659 4566 4460 2117 2092 288 91 --11001 --
NM_000831chr1176316 6020 5457 5451 5336 5269 5202 4819 4761 4754 4208 3944 2504 1772 1396 781 103 65970 5425 4717 2413 1176 417 64460 4038 2025 1440 1328 302 11206
NM_000859chr531463 1127 566 21100 266 11179 2698 152
NM_000872chr1041447 986 492 237 ----11010
NM_000875chr15126655 5959 5107 2812 2189 2173 2133 2034 2023 1380 1235 118 35075 4956 2228 24752 644 11014
NM_000899chr1263709 2894 1611 387 345 162 23137 2670 13050 --
NM_000902chr332405 2187 1213 ----32735 963 720
NM_000959chr183604 3311 3292 2486 1414 1372 583 543 33442 912 332 ----
NM_000962chr9122324 2260 1192 853 701 684 474 430 374 212 184 68 --42746 2627 1230 54 --
NM_001001389chr1192735 2110 2007 1953 942 639 511 500 361 42089 2054 1934 806 22932 2249 --
NM_001001390chr1192735 2110 2007 1953 942 639 511 500 361 42089 2054 1934 806 22932 2249 --
NM_001001391chr1192735 2110 2007 1953 942 639 511 500 361 42089 2054 1934 806 22932 2249 --
NM_001001392chr1192781 2156 2053 1999 988 685 557 546 407 42135 2100 1980 852 22978 2295 --
NM_001001396chr153613 2765 1405 983 23 21122 272 21372 678 13559
NM_001001419chr574858 4495 4070 2098 584 407 242 --13281 --
NM_001001420chr574858 4495 4070 2098 584 407 242 --13281 --
NM_001002233chr852037 2004 870 607 299 2293 261 2685 58 --
NM_001002762chr1082791 2628 2291 2248 1848 1141 881 43 22765 907 1272 1174
NM_001002814chr853653 3282 870 607 299 32464 293 261 2685 58 --
NM_001002860chr1424024 3015 --23548 3112 24321 545
NM_001003794chr3112908 2842 2326 1233 1205 1110 941 886 692 493 325 52632 2619 2182 2034 1040 22429 753 --
NM_001003800chr972517 2363 1368 1361 1003 470 243 1586 42355 1117 964 667 --
NM_001004317chr663804 2940 1456 706 523 515 34193 1339 1232 --1198
NM_001004441chr531560 636 332 261 45 ----
NM_001005242chr1261614 1595 1165 487 170 135 --11555 11108
NM_001005463chr1052578 2017 960 852 725 --11619 --
NM_001005473chr535482 5271 1147 16475 1702 15816
NM_001005609chrX103636 3368 3294 2835 2612 2481 1023 370 218 178 33248 481 350 32690 336 152 13162
NM_001007023chr1454633 4028 3945 3833 2059 1894 13527 14453
NM_001007097chr964261 4146 4139 4068 3559 826 13137 34911 1378 515 24570 3331
NM_001007237chr122214 270 1884 11141 22879 2113
NM_001008220chr5123465 3319 3267 2745 2641 2589 2545 2479 2433 579 178 133 23175 2812 22498 913 21502 1204
NM_001008408chr775800 5296 5032 4345 1505 728 552 14264 31673 163 133 11749
NM_001008701chr19153058 2651 2585 2577 2507 2332 2206 1148 1109 469 310 267 257 182 115 22231 41 22446 1024 11130
NM_001009554chr463964 3937 3329 3260 1873 581 24396 554 1255 --
NM_001009554chr463964 3937 3329 3260 1873 581 24396 554 1255 --
NM_001009899chr375513 5475 5193 5027 4658 2319 447 14031 26316 4877 --
NM_001010000chr1892662 2648 2603 2282 1109 958 472 260 243 ------
NM_001010861chr152405 2310 2233 2051 1873 --11882 --
NM_001010867chr1166386 6186 5743 5026 5018 4858 4741 2383 1941 1507 1220 1031 657 648 254 224 --54718 1857 503 416 68 14051
NM_001010888chrX144469 3785 3551 1867 1648 1383 1189 934 715 373 357 340 327 217 --23570 503 --
NM_001011513chr443167 3148 3037 2845 ----13427
NM_001012393chr1133650 1486 115 --35008 4841 4178 --
NM_001012426chr6143369 3284 2514 2129 1365 833 807 634 428 388 239 107 55 48 22927 194 ----
NM_001012427chr6143369 3284 2514 2129 1365 833 807 634 428 388 239 107 55 48 22927 194 ----
NM_001012755chrX84535 4474 4314 3406 3076 1110 373 235 13119 1890 --
NM_001013031chr10113101 3040 2840 2557 2386 2229 2150 1248 1072 344 118 22458 2371 ----
NM_001014797chr10137717 7700 7045 6892 5810 5745 5402 2928 2761 1715 1423 1069 627 37172 6900 111 26614 6471 26112 5203
NM_001017995chr5114600 4083 4035 3868 3186 1597 1499 1240 1017 329 22 21939 1693 24122 740 23011 541
NM_001018065chr9125918 5728 4574 4148 3983 3657 2210 2013 1330 1265 1221 626 24482 1275 36043 5928 848 --
NM_001018066chr9125918 5728 4574 4148 3983 3657 2210 2013 1330 1265 1221 626 24482 1275 36043 5928 848 --
NM_001018074chr563462 3222 3088 1545 1046 385 --13096 --
NM_001018075chr563462 3222 3088 1545 1046 385 --13096 --
NM_001018076chr563462 3222 3088 1545 1046 385 --13096 --
NM_001018077chr563462 3222 3088 1545 1046 385 --13096 --
NM_001018091chr1552861 1833 494 263 40 ----11151
NM_001018111chr762433 823 352 182 135 43 1936 1439 33352 2562 1088
NM_001024094chr563462 3222 3088 1545 1046 385 --13096 --
NM_001024455chrX82599 2359 2157 2076 524 192 147 111 22372 171 11855 22302 873
NM_001024647chr12127030 6699 6655 6600 6098 2292 1674 1606 1296 971 438 209 1625 25674 1381 --
NM_001024956chr1154326 4140 2086 1354 699 32301 1875 1576 ----
NM_001025076chr1064933 4551 1824 1450 1115 957 --1506 24427 429
NM_001025077chr1076291 5909 2808 2473 2315 1215 464 --21864 983 25785 1787
NM_001025108chr294013 3354 2533 1213 680 285 271 217 22 --13941 13187
NM_001025580chrX63762 3006 2846 1685 1343 1194 ------
NM_001029864chr20132137 1910 1708 1585 1559 765 506 451 270 234 171 49 34 22200 741 1312 --
NM_001030055chr1474732 4567 4360 1524 1419 1283 50 ------
NM_001031679chr1293483 2936 2867 2476 2429 2351 2295 377 313 13275 12610 --
NM_001031695chr2285238 5173 5135 4507 3983 3401 1950 1880 34161 3343 915 11224 25161 1679
NM_001032296chr1382537 2406 2375 2018 1981 1948 741 281 --11048 31844 1135 145
NM_001032394chr662436 2183 720 405 282 75 ------
NM_001032999chr20154482 4456 4230 4189 3761 3579 3405 3386 2150 1827 1453 1303 1095 563 545 13733 24295 3936 --
NM_001033117chr3174541 4353 4078 3676 1894 1851 1653 1583 1348 1278 1234 821 754 693 676 219 54 21247 801 14662 23800 1498
NM_001034841chr1633638 1174 201 1884 14782 1667
NM_001034954chr10103275 2506 2379 1309 1106 1066 1017 1000 835 309 ----1645
NM_001034955chr10103275 2506 2379 1309 1106 1066 1017 1000 835 309 ----1645
NM_001034956chr10103275 2506 2379 1309 1106 1066 1017 1000 835 309 ----1645
NM_001034957chr10103275 2506 2379 1309 1106 1066 1017 1000 835 309 ----1645
NM_001035254chr9132064 2011 1949 1779 903 792 784 626 504 417 241 85 50 22208 1004 11036 --
NM_001035511chr162186 2023 1417 570 519 436 2873 845 --1674
NM_001035512chr172293 2130 1524 677 626 543 126 ----1781
NM_001035513chr172293 2130 1524 677 626 543 126 ----1781
NM_001037132chr74843 653 450 36 11963 11775 1811
NM_001037133chr74843 653 450 36 11963 11775 1811
NM_001037317chr152405 2310 2233 2051 1873 --11882 --
NM_001039585chr183861 3568 3549 2743 1671 1629 840 800 33699 1169 589 ----
NM_001039709chr20154482 4456 4230 4189 3761 3579 3405 3386 2150 1827 1453 1303 1095 563 545 13733 24295 3936 --
NM_001040108chr1463234 2873 2798 2737 2206 438 32638 1325 681 12361 --
NM_001040110chr741564 1316 1243 510 1646 --21732 667
NM_001040429chr1333523 3272 1237 ----2872 182
NM_001040441chr135258 3923 3335 --13535 21424 285
NM_001040624chr872267 2220 2184 1730 1026 832 187 --32611 1867 1011 --
NM_001040625chr872267 2220 2184 1730 1026 832 187 --32611 1867 1011 --
NM_001040626chr872267 2220 2184 1730 1026 832 187 --32611 1867 1011 --
NM_001040627chr872267 2220 2184 1730 1026 832 187 --32611 1867 1011 --
NM_001040628chr872267 2220 2184 1730 1026 832 187 --32611 1867 1011 --
NM_001040629chr872267 2220 2184 1730 1026 832 187 --32611 1867 1011 --
NM_001040630chr872267 2220 2184 1730 1026 832 187 --32611 1867 1011 --
NM_001040665chr721189 1099 13258 34516 1144 1115 24038 1562
NM_001042355chr16105141 4948 4588 3996 3778 3417 2021 928 201 125 --14999 11934
NM_001042412chr16105141 4948 4588 3996 3778 3417 2021 928 201 125 --14999 11934
NM_001042413chr943999 2537 2526 138 22856 951 23594 1636 --
NM_001042555chr1244445 4031 2909 683 23295 1504 ----
NM_001042599chr236411 5181 5088 46756 5028 2850 259 23126 2297 33042 2540 1262
NM_001042603chr1275302 5182 4807 1065 912 798 669 --12022 24826 120
NM_001042604chr344208 3877 3784 1535 --11404 13665
NM_001044385chr254035 2576 1586 919 871 1853 12938 13798
NM_001044387chr1994010 2663 2550 1170 870 795 253 227 175 ----1972
NM_001044388chr1994010 2663 2550 1170 870 795 253 227 175 ----1972
NM_001099678chr365132 2539 1170 737 510 381 12237 14507 --
NM_001100108chr1107587 7424 7384 7312 7043 6609 3186 1126 545 83 37458 6560 1008 1857 13136
NM_001106chr3179757 8531 8488 8168 7339 7124 6962 6716 6537 6499 6042 3893 1904 1199 1121 423 26 --27539 6727 --
NM_001113490chrX52588 2450 796 729 333 53537 3039 2468 599 408 ----
NM_001173chr1474732 4567 4360 1524 1419 1283 50 ------
NM_001204chr297350 6275 6130 5952 5347 4741 2986 1627 1099 ----11673
NM_001256chr1772915 2764 2470 2285 1984 1059 356 ----1782
NM_001259chr7146389 6368 6158 6114 5353 4781 4594 2314 1840 1746 1692 736 338 256 11035 12039 --
NM_001304chr1773361 2735 2608 952 906 380 301 --13626 --
NM_001356chrX32141 1765 194 --12526 11590
NM_001364chr1174027 3965 3520 3395 1771 1692 1266 --1315 21255 1046
NM_001390chr1842974 2815 2683 620 ----13448
NM_001399chrX103636 3368 3294 2835 2612 2481 1023 370 218 178 33248 481 350 32690 336 152 13162
NM_001419chr1974504 4361 3295 1689 1397 730 492 23314 1850 34615 846 712 23238 630
NM_001438chr1113619 3393 2989 2791 2679 2566 2524 2497 855 807 154 ------
NM_001497chr992610 2324 1895 1746 665 623 260 143 131 32656 2531 41 1606 --
NM_001542chr122214 270 1884 11141 22879 2113
NM_001543chr5144027 3226 1930 1897 1704 1648 1467 1349 1287 971 760 493 400 94 21138 898 22958 2950 --
NM_001609chr1084221 4047 3961 3479 3243 3085 1150 313 13459 23023 585 --
NM_001616chr242814 1258 1186 406 22451 2163 ----
NM_001627chr312138 ----2158 28
NM_001650chr1863437 3235 3045 1361 1043 672 33134 2632 1658 ----
NM_001699chr1971577 1343 1320 1272 1250 1131 291 --21827 269 --
NM_001858chr694658 4489 3911 3427 1342 1309 1098 395 245 ------
NM_001918chr1108370 8063 7386 7277 6944 5919 5683 3325 2131 221 19171 17431 --
NM_001920chr121196 1242 --1747
NM_001939chrX103563 3222 3143 3037 1338 1241 1230 958 549 300 12841 11293 12540
NM_001987chr1294145 3388 3036 2889 2827 1553 1259 1033 675 141 13118 1870
NM_001995chr43426 156 21 1492 --11171
NM_002006chr475111 4982 4968 3600 1410 740 241 14259 13943 --
NM_002015chr1373094 2641 2230 824 738 308 37 ----22423 1184
NM_002025chrX129001 8829 8381 7338 5845 5643 3453 2741 2230 850 619 450 12267 ----
NM_002035chr1863575 1481 1308 830 355 296 1344 ----
NM_002103chr199964 942 891 705 303 266 214 181 89 ----31126 781 48
NM_002111chr4123779 3716 3689 3305 2935 2746 2488 1479 1348 1289 232 44 --23329 3019 1994
NM_002126chr1793749 3385 3029 2889 2685 1467 748 381 104 --12807 12972
NM_002158chr211298 13036 --22803 701
NM_002203chr552970 2927 799 270 47 --23666 1638 12722
NM_002210chr243205 2446 470 177 --11379 --
NM_002214chr734111 3649 1421 1338 14626 1190
NM_002241chr192943 2842 2512 2133 912 792 531 466 166 2803 671 --12781
NM_002264chr344126 3223 1597 589 11488 31698 1557 465 --
NM_002285chr294013 3354 2533 1213 680 285 271 217 22 --13941 13187
NM_002309chr22162637 2494 2330 2224 2148 1946 1188 1182 978 889 748 594 451 374 90 54 21258 557 12822 --
NM_002387chr575052 4120 3680 3175 1608 882 402 11328 21451 195 --
NM_002507chr1791879 1594 1405 779 538 416 395 142 136 3605 388 355 --1214
NM_002522chr17112558 1589 1553 1482 1315 1213 1160 1003 915 718 516 --11171 11183
NM_002545chr1133650 1486 115 --35008 4841 4178 --
NM_002581chr994712 4499 4228 3749 2181 1698 1247 1097 255 35627 1574 106 2700 317 25032 1173
NM_002639chr184857 504 396 86 ----173
NM_002667chr63904 850 21 11274 ----
NM_002737chr1796343 6051 5780 5167 5117 4544 4107 2074 760 22562 372 55754 2369 1977 1814 826 25911 5084
NM_002745chr22104468 4393 4124 4112 4025 1114 904 573 510 24 1376 44236 3486 3472 3087 1190
NM_002833chr1531565 1031 632 1420 --1447
NM_002834chr1284057 3741 2693 2687 2678 2482 1122 1067 ------
NM_002855chr11133533 3239 3125 2352 1108 1085 857 739 527 467 157 147 87 1585 1331 23615 941
NM_002857chr162043 1911 1900 1654 634 514 11703 1353 12492
NM_002869chr1142196 1435 795 30 ----11810
NM_002874chr931929 371 318 ----12507
NM_002886chr384805 4526 4327 4265 3326 1352 552 113 14735 11579 14238
NM_002957chr9133863 2741 2682 1551 1267 1178 1007 790 784 764 704 401 197 ----13580
NM_002959chr1133583 3431 3381 3314 3301 3259 3238 3186 2833 1198 1068 900 372 11058 --1585
NM_003001chr172293 2130 1524 677 626 543 126 ----1781
NM_003034chr12106803 6152 4971 3215 3192 2756 1661 873 279 32 37444 4942 2638 --11594
NM_003043chr3144004 3723 3526 3249 3214 3182 3132 2839 1577 1460 1330 922 573 526 33694 828 813 12697 --
NM_003045chr13123650 3384 1779 1493 1389 1240 767 568 502 203 53 22 1745 23247 1757 --
NM_003051chr12626 453 --11773 1311
NM_003108chr286822 4856 2165 2110 1255 787 774 438 14630 ----
NM_003199chr1835150 704 246 1288 34828 1056 852 --
NM_003215chr481051 457 348 287 181 166 154 138 --11537 11329
NM_003216chr2283340 3299 3032 3009 1134 792 782 751 23223 2437 22966 1166 --
NM_003281chr1164563 4144 4002 3750 3475 3438 2131 1988 1848 1786 1741 1627 1149 852 621 541 55168 4811 4159 4032 1003 35055 2151 493 --
NM_003298chr3154991 4925 4855 4558 4319 2264 1592 1428 1339 1050 1007 782 697 403 43 44552 4533 1230 306 11391 12486
NM_003344chr751416 1294 1226 498 24 ----11266
NM_003369chr1142118 1111 426 321 ----22607 1755
NM_003410chrX42605 1218 800 519 1430 --21033 994
NM_003439chr773465 3323 2571 2227 1367 1341 946 13311 --157
NM_003468chr264213 4104 3994 3981 3282 1698 130 13904 --
NM_003559chr17153627 3548 3482 3385 3213 2831 1305 1225 944 881 833 706 489 373 23 5781 698 678 322 30 ----
NM_003576chr1382537 2406 2375 2018 1981 1948 741 281 --11048 31844 1135 145
NM_003590chr262817 2644 2475 1289 863 122 --11226 1704
NM_003607chr1113718 3701 3573 2846 2758 1337 1133 842 727 404 106 --33877 3051 2919 --
NM_003644chr17106071 5887 5450 4859 4438 4237 1804 887 566 135 26091 5434 52353 2068 2019 1214 379 14596
NM_003663chr373446 3317 2550 1255 1038 960 492 11206 ----
NM_003759chr484028 4009 3693 3121 2906 601 568 366 23778 2632 --12868
NM_003831chr1861554 1488 1234 537 467 440 ----21708 1605
NM_003966chr5116306 6217 5715 2387 1869 1676 1174 1168 766 223 129 --25517 86 13081
NM_003983chr1673962 3902 3548 3398 3258 3160 518 --34005 1708 202 --
NM_003994chr1263709 2894 1611 387 345 162 23137 2670 13050 --
NM_004028chr1863437 3235 3045 1361 1043 672 33134 2632 1658 ----
NM_004035chr1795109 4883 4347 3148 1476 1239 928 219 33 14086 --1152
NM_004094chr1442695 878 341 297 22512 237 --12746
NM_004099chr962074 1949 815 803 407 312 11594 --1431
NM_004100chr672404 2006 1731 1638 788 148 134 ------
NM_004124chr1453365 3176 2202 704 552 ----21272 238
NM_004132chr103334 275 24 1434 3471 95 86 11094
NM_004171chr11109304 8528 7014 6542 6036 3363 1252 805 465 334 37528 6811 6163 38763 8361 2874 1368
NM_004227chr773115 2396 2320 2285 505 449 289 --3813 216 123 12589
NM_004229chrX21505 698 ----22262 573
NM_004232chr1853889 3700 3223 2601 1438 ----13597
NM_004293chr963851 3347 2818 1420 907 472 ----1598
NM_004342chr762001 1985 1653 1639 485 358 ----1177
NM_004397chr11104256 4137 3826 3484 3202 1490 1150 923 626 481 11285 ----
NM_004423chr372078 1906 752 711 617 609 123 ----21021 657
NM_004437chr192877 2593 2523 2401 2215 694 493 173 96 21018 525 33535 2564 1082 --
NM_004516chr1911124 ----3492 279 242
NM_004554chr1471602 1459 1380 637 589 549 515 --2366 283 1743
NM_004571chr2133105 1154 1129 --43265 3256 2668 1315 1663
NM_004575chr431166 453 415 --1270 123
NM_004586chrX75376 4520 4166 3886 3797 3415 2088 1743 14591 --
NM_004588chr1163556 2696 718 574 477 111 33032 1552 297 22951 555 1377
NM_004612chr993937 3926 1712 979 605 451 436 418 38 ------
NM_004703chr1772262 2008 1834 1779 1712 967 226 1196 2408 138 --
NM_004734chr1383177 2678 2630 2161 1989 1192 672 558 12619 ----
NM_004738chr2052393 2192 2112 1963 1007 --12453 1695
NM_004745chr8185773 5436 5201 5105 5064 5020 4910 4873 4611 4365 2101 1949 1356 1256 1105 643 293 163 25914 5086 34391 1652 1410 --
NM_004774chr174953 758 164 33 12308 --1836
NM_004781chr13392 341 270 21192 620 1256 --
NM_004781chr13392 341 270 21192 620 1256 --
NM_004815chr184936 4120 3671 3454 3441 3392 1981 831 14714 ----
NM_004845chrX53918 2689 1473 1152 810 23760 284 21566 241 13965
NM_004862chr1631421 1132 418 --21244 109 11275
NM_004863chr1484320 4063 3649 988 464 456 74 23 14995 1772 23389 1313
NM_004898chr44865 572 512 484 ----1314
NM_004947chr381743 1031 949 939 644 633 559 58 42175 825 101 93 21683 385 --
NM_004956chr774373 3659 3430 3329 3202 2815 1661 13285 44222 3913 3058 3030 --
NM_004975chr203938 737 703 2385 124 --1142
NM_004976chr11135006 4907 4515 4277 3836 3517 1923 1829 1546 774 274 162 36 74976 4877 4571 3210 1902 1167 120 35038 4564 650 14428
NM_004992chrX188362 8100 7801 7230 6455 6340 6299 6154 6136 5842 5744 2611 2144 1312 873 778 725 227 26233 6095 57756 6850 3023 2805 1709 27216 1577
NM_004992chrX188362 8100 7801 7230 6455 6340 6299 6154 6136 5842 5744 2611 2144 1312 873 778 725 227 26233 6095 57756 6850 3023 2805 1709 27216 1577
NM_004999chr673153 1373 1004 728 585 577 486 14208 --13009
NM_005010chr74843 653 450 36 11963 11775 1811
NM_005011chr741564 1316 1243 510 1646 --21732 667
NM_005056chr1285546 5426 5051 1309 1156 1042 913 108 ----25070 364
NM_005065chr1495242 4741 4206 4139 4084 1004 815 807 282 11047 ----
NM_005093chr20154482 4456 4230 4189 3761 3579 3405 3386 2150 1827 1453 1303 1095 563 545 13733 24295 3936 --
NM_005116chr2074172 3662 3124 1181 524 331 116 23883 3679 2366 359 23850 3393
NM_005156chr954606 1702 870 331 56 1690 13962 14353
NM_005168chr22261 108 --31177 550 477 11318
NM_005188chr11137991 7705 7642 7250 6105 6043 5816 2141 1866 1848 1036 440 290 47757 6679 5280 5228 25524 1604 --
NM_005235chr236411 5181 5088 46756 5028 2850 259 23126 2297 33042 2540 1262
NM_005329chr16101952 1870 1749 1582 1488 834 768 557 408 233 --1288 1605
NM_005338chr763125 2824 1622 481 233 97 31589 1476 1110 33919 822 715 13410
NM_005359chr18115663 5585 4716 4137 4061 2035 1955 1619 595 212 190 16398 36371 5953 5115 --
NM_005397chr762433 823 352 182 135 43 1936 1439 33352 2562 1088
NM_005399chr173486 3212 2844 1640 1158 596 498 13369 1122 11412
NM_005436chr1074041 3799 3716 2845 2833 469 312 21361 1313 ----
NM_005475chr1273314 3086 2400 2363 2249 536 316 12938 --21240 96
NM_005497chr1775190 4742 2068 933 647 525 245 31998 1399 833 25771 2295 --
NM_005502chr982522 1245 993 851 696 573 515 492 ------
NM_005504chr1266491 5275 4621 4555 4541 972 1161 --21716 1327
NM_005563chr13677 140 134 ----1756
NM_005578chr384570 3984 3913 1646 1044 857 618 66 14152 1957 --
NM_005596chr996016 5246 4323 2346 1629 1334 1260 538 423 --26179 4314 --
NM_005665chr174372 4052 3420 3320 1429 1007 355 ------
NM_005715chr672081 2056 1979 1776 420 375 42 ----32048 1912 414
NM_005759chr2114722 4617 4076 3301 1628 1573 1377 950 916 519 308 --24660 1439 --
NM_005795chr262838 2279 2256 2125 2000 503 12191 ----
NM_005828chr17104605 3987 3655 3474 3425 3333 3282 1686 1273 213 14035 1927 --
NM_005840chrX127314 6810 6419 6119 5679 2676 2647 2316 2161 1922 891 607 16930 21952 24 57643 6532 5962 1868 447
NM_005843chr261702 1610 1420 278 258 215 --1506 --
NM_005885chr531419 1162 469 11235 --1139
NM_005902chr15124178 4044 3597 3443 3302 3285 3062 1738 1591 1105 911 169 11847 ----
NM_005903chr574858 4495 4070 2098 584 407 242 --13281 --
NM_005920chr1103370 2618 2587 2535 1529 1329 1250 998 992 452 --33607 2570 2398 --
NM_005935chr461800 1772 1027 662 288 70 34308 1834 219 21230 1126 --
NM_005937chr17124001 3687 3493 3260 1439 1296 1241 1135 976 838 233 113 2888 301 --23470 133
NM_005941chr873952 3852 3824 2701 2663 506 138 23476 1651 11041 --
NM_005955chr1135067 4957 4909 4059 3886 1823 1693 1434 1009 911 840 787 127 1484 24107 3524 --
NM_006047chr2073421 1174 761 564 296 81 59 ------
NM_006055chr26647 609 592 512 280 132 --11134 --
NM_006067chr1621046 182 ----1921
NM_006080chr752926 2200 824 702 568 12480 ----
NM_006095chr483735 1626 1571 1429 1227 414 266 140 11032 13019 11442
NM_006108chr1151556 893 362 34 22 2290 147 2750 42 12296
NM_006203chr595211 4884 3884 3549 3460 1747 911 645 369 13663 35100 4443 3844 --
NM_006206chr452451 2416 2200 879 57 ----1721
NM_006256chr131114 825 795 --12516 11694
NM_006283chr8154650 4629 4587 4555 4513 4347 4087 3925 3176 3108 1099 878 201 185 77 11626 11311 14064
NM_006371chr3114781 4656 4176 3796 1702 1659 1350 1017 757 442 92 24500 1097 15133 --
NM_006380chr1743879 3455 1045 759 ----145
NM_006420chr2042497 1361 882 805 ----22537 989
NM_006434chr10103275 2506 2379 1309 1106 1066 1017 1000 835 309 ----1645
NM_006457chr443167 3148 3037 2845 ----13427
NM_006538chr283941 3909 3218 1298 1054 710 416 136 11436 33341 3010 1418 --
NM_006544chr1434639 4621 255 21814 1608 35208 1525 1416 --
NM_006546chr17166256 6228 5395 5306 4811 4605 4538 4289 4086 1989 1974 1284 1059 814 280 30 12356 25224 2021 --
NM_006549chr1272589 1951 924 904 878 510 320 --2890 488 12060
NM_006561chr1064933 4551 1824 1450 1115 957 --1506 24427 429
NM_006577chr251173 1078 994 887 485 ------
NM_006599chr1697579 6999 6328 6187 5569 5014 2705 1860 1324 --28120 2523 1657
NM_006609chr232481 2247 1913 ----1258
NM_006621chr121936 1406 11505 --41291 823 534 420
NM_006650chr5123465 3319 3267 2745 2641 2589 2545 2479 2433 579 178 133 23175 2812 22498 913 21502 1204
NM_006654chr1244445 4031 2909 683 23295 1504 ----
NM_006717chr953194 2449 2175 1235 1179 11122 1664 12610
NM_006729chrX64968 4154 3854 3641 2020 961 ----25058 1474
NM_006738chr1584623 3903 3529 3386 2865 1002 781 531 23825 570 34173 3186 2849 --
NM_006851chr1252681 2523 1164 415 103 --11080 --
NM_006918chr1154326 4140 2086 1354 699 32301 1875 1576 ----
NM_006981chr962888 2595 2338 949 899 414 22483 1035 ----
NM_007011chr15126526 6368 5763 4198 2660 2223 2025 1735 1581 500 440 176 11813 21091 842 --
NM_007038chr21105806 5544 5156 4767 4459 3903 2290 1343 771 516 12282 1917 12423
NM_007050chr20157210 7034 6714 6095 5781 5719 4991 2897 2603 2531 2486 2217 2211 1652 27 66931 6013 5510 5214 1763 1328 27404 34 37702 5277 2613
NM_007114chr31715 1299 --1687
NM_007137chrX75246 4440 2219 2089 1942 1559 159 23578 2141 --11957
NM_007146chr1742171 1064 993 946 ----1511
NM_007200chr1584623 3903 3529 3386 2865 1002 781 531 23825 570 34173 3186 2849 --
NM_007238chr20104804 4646 4253 4037 4010 1123 1058 450 295 115 11807 23179 1052 14678
NM_007249chr13209179 9095 8825 8470 7993 7642 7102 7058 7011 6999 6039 5916 3601 3568 2225 1892 1597 881 365 128 39207 8808 7257 17142 --
NM_007283chr3112908 2842 2326 1233 1205 1110 941 886 692 493 325 52632 2619 2182 2034 1040 22429 753 --
NM_007287chr332405 2187 1213 ----32735 963 720
NM_007288chr332405 2187 1213 ----32735 963 720
NM_007289chr332405 2187 1213 ----32735 963 720
NM_007292chr1795109 4883 4347 3148 1476 1239 928 219 33 14086 --1152
NM_007345chr1842298 2265 1741 447 --32021 1667 738 1155
NM_007347chr1552776 2273 1286 709 619 12819 12123 --
NM_007350chr1274398 4148 3478 1627 944 605 496 11123 12826 --
NM_012072chr2093153 3067 1729 1478 889 576 290 50 28 34469 1601 767 ----
NM_012137chr152746 1081 752 678 638 31824 1800 739 --22880 429
NM_012164chr9136889 5892 5673 5526 5410 4890 4603 2580 2112 1437 1393 156 149 17413 26612 1878 16075
NM_012193chr11105254 5223 4988 3787 3637 2051 1349 472 431 307 1887 34425 842 317 33556 3294 1768
NM_012249chr232641 2598 1010 12578 1442 11101
NM_012262chr145167 4717 1728 309 13510 13762 --
NM_012281chr761783 1771 803 687 530 181 11676 11969 --
NM_012287chr373714 3371 3155 3077 1492 464 255 1540 ----
NM_012306chr12102900 2677 1398 1322 1274 1255 1217 1143 451 317 1743 12321 23453 32
NM_012307chr182127 61 --1933 1716
NM_012309chr11154242 3791 3670 1640 1553 1404 1299 1267 962 887 851 843 465 370 172 24470 1144 ----
NM_012316chr195563 4584 3762 3755 1889 1701 809 664 292 14551 25517 466 13819
NM_012334chr574429 4384 3260 3177 2906 1416 1080 14626 14147 --
NM_012338chr741040 890 828 79 ----11268
NM_012382chr554297 3997 2894 924 120 --34306 3734 1508 11584
NM_012398chr19102852 1924 1878 1175 1154 700 330 181 87 25 32767 1939 1900 12007 12179
NM_013231chr1483540 3486 3062 1612 1588 854 482 476 23446 1516 12972 --
NM_013255chr7168747 8406 8058 7986 7293 6947 5894 5774 5501 2820 1119 902 882 782 323 111 15601 1967 --
NM_013286chr3113715 3501 3352 2467 1414 1268 1143 1066 885 802 775 31402 1039 844 22897 337 --
NM_013372chr1542118 1014 603 95 42100 1293 218 197 ----
NM_013374chr363141 2680 1930 806 37 31 23036 367 ----
NM_013989chr1454633 4028 3945 3833 2059 1894 13527 14453
NM_014028chr682954 2666 1168 520 304 204 123 66 ------
NM_014048chr16133897 3472 3442 3399 2036 1773 1711 1496 1175 704 565 472 259 24414 463 21915 881 14215
NM_014155chr1186653 6362 5108 4810 1835 1004 248 191 2590 229 --16385
NM_014181chr262600 2430 2074 1885 507 223 --11144 --
NM_014253chrX72032 1665 516 458 313 264 80 ------
NM_014263chr1031374 1127 391 ----11200
NM_014309chr2285228 5163 5125 4497 3973 3391 1940 1870 34151 3333 905 11214 25151 1669
NM_014325chr1252113 1673 814 758 125 11439 --12273
NM_014331chr4106219 5519 1840 1424 1307 1178 1095 1081 640 557 --15369 184
NM_014352chr1131450 611 92 --21398 1018 2319 164
NM_014381chr1463234 2873 2798 2737 2206 438 32638 1325 681 12361 --
NM_014423chr594773 4351 4224 4187 2181 1581 1284 994 783 --15310 --
NM_014504chr772061 1817 1564 1455 1443 690 78 1667 ----
NM_014586chr21164506 4276 3953 3861 3530 3453 2999 1779 1767 1503 1126 1069 530 434 231 32 33934 1441 176 34388 987 208 --
NM_014600chr261593 1413 637 340 235 21 11425 --1535
NM_014615chr1652848 2547 2236 146 139 13202 11351 13010
NM_014634chr22133560 3400 3265 3104 2806 2466 919 730 620 550 462 285 132 12698 1591 1703
NM_014636chr9123786 3584 3499 3128 3043 1654 1519 1319 1035 758 155 96 1291 21462 30 --
NM_014721chr686410 4768 2839 2734 2564 1789 1513 860 1929 --24566 4516
NM_014730chr12184902 4548 4147 4037 3964 3850 3683 3665 3493 1892 1777 1641 1389 1230 1006 448 436 327 23572 1118 --14789
NM_014730chr12184902 4548 4147 4037 3964 3850 3683 3665 3493 1892 1777 1641 1389 1230 1006 448 436 327 23572 1118 --14789
NM_014732chr16175654 5495 5339 5123 4711 4493 3566 2346 2211 2039 1967 1824 1158 926 708 657 112 14017 21907 1210 21504 1486
NM_014743chr472880 2514 2340 2130 1988 1929 119 1921 --1388
NM_014747chr1145451 5424 4903 4280 3993 3641 1818 1598 1275 1167 1116 1110 672 645 11974 44747 4614 2188 755 1344
NM_014755chr263433 2734 1292 913 667 41 1216 12905 1104
NM_014774chr182714 2291 1168 1049 982 682 615 196 22656 755 ----
NM_014810chr172735 2383 1430 1203 1053 830 276 1902 12773 --
NM_014826chr1113718 3701 3573 2846 2758 1337 1133 842 727 404 106 --33877 3051 2919 --
NM_014832chr1361685 1522 829 397 260 160 ----21957 1329
NM_014850chr3174541 4353 4078 3676 1894 1851 1653 1583 1348 1278 1234 821 754 693 676 219 54 21247 801 14662 23800 1498
NM_014873chr1104814 4130 3220 3059 1541 910 693 546 404 41 --13935 --
NM_014877chr1797041 6938 5368 5344 5270 4780 2836 1749 1667 25423 4754 35432 2894 1360 --
NM_014897chr1762811 1255 1180 810 203 28 --1402 2991 783
NM_014904chr1083839 3797 3568 3316 3288 2859 1029 308 11577 ----
NM_014906chr1783861 3803 3691 2945 1166 1078 931 56 ------
NM_014920chr673712 3513 2483 2360 1373 958 348 ------
NM_014921chr19153058 2651 2585 2577 2507 2332 2206 1148 1109 469 310 267 257 182 115 22231 41 22446 1024 11130
NM_014924chr1412591 --12511 22493 701
NM_014935chr1112878 2689 2397 1455 1442 776 649 528 418 255 172 21386 675 33286 3244 3127 --
NM_014982chr1494926 4677 4528 3852 1817 970 904 872 810 15257 14087 14108
NM_015000chr1263109 2574 1163 982 699 438 ------
NM_015026chr1244051 3548 1488 1009 --14101 13691
NM_015035chr20186554 5965 5902 5794 5067 4779 4719 4342 2461 2209 1714 1489 1161 1138 1079 863 153 132 21640 1571 54760 2232 990 965 277 11940
NM_015039chr164135 3492 3173 3008 1239 1020 --33408 3213 3064 33502 375 297
NM_015071chr5115734 5703 5606 5233 4745 4442 2361 1992 1509 420 329 25337 4718 36455 5245 1575 --
NM_015073chr1991832 1490 1339 755 711 517 374 359 195 1488 2671 112 11452
NM_015077chr17154426 4229 4214 3650 3523 3362 3175 1794 1788 1695 1657 1509 1421 1280 1171 23441 455 54393 1878 1472 840 623 23589 2861
NM_015090chr1125830 5598 4958 4788 3973 3859 2190 1776 1757 1423 1042 392 54769 4700 4250 4015 1601 11014 24758 927
NM_015094chr22134646 4579 4242 3801 3586 3480 2992 1477 783 497 358 198 148 13539 --22857 1876
NM_015107chrX92366 2025 1576 603 569 492 423 326 190 ----1781
NM_015156chr14103567 3443 3395 2540 1401 1304 1165 750 447 292 1199 2420 340 --
NM_015170chr842341 511 399 43 ----1368
NM_015172chr161547 1337 1202 1190 1174 1149 --1115 --
NM_015178chr8152610 2426 2242 2041 1981 1872 1856 1779 1709 1641 672 618 293 122 98 32369 359 163 52131 1905 665 527 322 --
NM_015192chr202730 22 --1142 22180 965
NM_015205chr13115221 4436 1875 1618 1505 1498 1438 1384 877 620 26 ----1491
NM_015247chr16105141 4948 4588 3996 3778 3417 2021 928 201 125 --14999 11934
NM_015271chr483784 3459 3142 3071 2988 789 584 86 1440 ----
NM_015284chr181899 1764 1474 557 331 217 100 68 11386 --21993 227
NM_015299chr14123859 3534 3213 2976 1574 1558 1454 1288 1214 1180 756 269 33456 1330 400 43109 2724 1347 98 2733 286
NM_015310chr8157998 7530 7524 7241 7103 6452 6239 5713 3327 1880 1482 1410 887 844 253 25547 1747 --36075 5674 2312
NM_015313chr1183805 3554 3220 1724 1419 1250 259 153 1668 13407 --
NM_015328chr792304 2178 1907 1086 974 818 590 326 182 --21934 1246 2933 346
NM_015353chr1752723 2234 547 217 23 22351 946 --11734
NM_015365chrX63762 3006 2846 1685 1343 1194 ------
NM_015385chr10103275 2506 2379 1309 1106 1066 1017 1000 835 309 ----1645
NM_015455chr552961 1372 725 719 412 ----1377
NM_015458chr855275 3835 3755 3522 820 23651 873 24575 343 23745 1896
NM_015508chr31117 1558 1604 11130
NM_015550chr752986 2588 1416 1313 408 2751 692 23476 1448 13413
NM_015553chr674536 4277 3342 3175 1925 842 168 1698 1463 1319
NM_015568chr20173904 3797 3689 3461 3051 2967 2952 1686 1424 1316 1148 1095 891 549 474 313 53 --41370 726 614 121 11012
NM_015569chr1104094 4018 3997 3436 1511 1155 1145 755 562 355 --1722 --
NM_015575chr242949 2702 986 516 23001 571 32964 2811 825 12605
NM_015879chr18197795 7754 7729 7512 7441 7110 6396 6126 5335 5310 2780 2414 1776 1740 1560 1171 363 319 69 184 ----
NM_015886chr874873 4700 4107 2048 1560 1366 1146 --11662 11535
NM_015906chr154169 3951 1568 1170 734 ----21633 1531
NM_015995chr1584958 4914 4529 4088 3824 1693 1299 992 25014 1636 44770 3742 1846 463 14327
NM_016021chr683012 2405 2290 997 882 768 160 152 ------
NM_016061chr241367 1255 542 87 ----1441
NM_016075chr1392689 2571 1269 683 455 352 245 191 157 1662 13014 --
NM_016083chr673972 3559 2889 2847 2778 972 60 2414 383 1191 --
NM_016089chr3111707 1694 1517 1410 800 548 464 380 272 56 44 11948 31991 1741 141 12036
NM_016206chr3138242 7972 7334 6831 6126 6077 5731 5585 2214 1798 1329 909 859 32821 1086 511 27190 2671 11524
NM_016248chr1393925 3605 3183 2983 2714 2603 2458 1185 275 11545 ----
NM_016260chr276129 6110 2893 1382 1175 788 350 --1379 25902 482
NM_016275chr322474 1765 1616 21073 566 --
NM_016289chr292055 1940 1663 1490 915 621 475 226 151 ------
NM_016322chr963139 2594 2095 2021 908 230 ------
NM_016356chr61458 --1603 22755 2569
NM_016472chr1431417 1322 333 --121 11037
NM_016513chr673712 3513 2483 2360 1373 958 348 ------
NM_016530chr1594097 3679 3200 2871 2766 1406 590 371 35 --1628 --
NM_016531chr443819 816 381 353 22815 401 ----
NM_016544chr253202 2975 1290 236 56 1388 11225 13636
NM_016591chr521066 883 1231 1427 11125
NM_016605chr572401 2072 1941 1737 815 372 221 1400 12419 31820 1811 1698
NM_016621chr11154416 4377 4199 3981 3911 3784 3335 2889 2808 1655 1482 837 392 158 67 --13966 23222 125
NM_016631chr212172 156 ----1917
NM_017415chr583699 3179 3155 1155 1117 1067 774 524 1929 11239 1823
NM_017447chr2154051 4041 3633 3442 2930 1341 --11661
NM_017551chr1022673 2005 12038 --11789
NM_017563chr3136073 6030 5444 4563 4422 4415 2472 2464 2440 2308 1807 341 273 42454 1884 1612 1275 45765 5573 4819 4481 --
NM_017590chr2292697 2411 2273 2046 916 669 546 201 88 12066 12206 22238 679
NM_017633chr663886 3175 2423 1106 455 39 23072 2928 ----
NM_017637chr9109039 8976 8905 8568 5884 3564 3003 2986 2210 1013 47530 7125 3059 1591 38364 2275 1221 --
NM_017644chr354724 1843 1698 1344 494 --25042 3281 44301 3959 1691 1385
NM_017650chr785901 4780 4622 3945 1717 1649 1425 732 1229 25949 75 --
NM_017658chr1442835 1645 914 59 24216 3412 ----
NM_017666chrX61872 771 578 295 280 152 1650 1468 --
NM_017686chr11435 --1814 2933 100
NM_017693chr1371434 1351 1232 1161 1140 180 142 ------
NM_017712chr19176190 6052 5848 5621 5385 5133 5007 4923 4828 4209 2509 2166 1206 800 695 374 272 2282 251 25875 2407 --
NM_017754chr694282 3662 1785 1766 1534 801 631 430 110 --13188 14252
NM_017787chr1082289 2279 2112 601 480 426 161 44 52654 2611 1908 1092 304 22213 95 --
NM_017813chr865730 4598 4571 2246 1795 956 21715 138 15429 --
NM_017847chr131857 226 206 ----2848 35
NM_017848chrX104580 4105 3894 1286 1271 1114 580 174 109 75 --11490 --
NM_017919chr9114785 4712 4632 4591 4279 4051 3893 3827 3754 1183 425 --11934 --
NM_017933chr21131 ----21411 1073
NM_017944chr1143096 2686 1008 456 --12834 12287
NM_017952chr294543 3944 3239 1734 1417 1379 961 301 248 13751 24144 3438 --
NM_017994chr772968 2555 2508 2034 1036 222 177 --1866 1286
NM_018036chr1484202 3999 3887 3776 3039 2743 1298 53 13813 23278 73 13381
NM_018227chr493060 2864 2843 2419 2365 2041 916 63 27 ----12232
NM_018293chr362771 2312 1912 583 222 150 ------
NM_018362chr1133850 2507 798 2889 44 --1169
NM_018373chr1476140 5851 3987 3924 1260 1045 794 24534 4484 --26333 4828
NM_018383chr21644 1353 --21873 1692
NM_018440chr8158564 7952 7826 7621 6977 6964 6747 3445 3063 2790 1598 1496 832 458 378 11323 ----
NM_018448chr122794 180 --1204 1512
NM_018638chr1245094 3864 3442 1302 --1966 24715 840
NM_018689chr1552359 2136 1892 1061 645 22711 155 1869 12161
NM_018844chr771876 1667 799 473 171 80 65 --11985 --
NM_018947chr7104949 4734 3648 3616 3312 3064 3036 1529 730 96 11659 ----
NM_018958chr1583481 3433 2948 1168 1012 962 330 125 13008 12883 13265
NM_018976chr1242650 1812 804 513 11981 --21054 264
NM_018979chr1272354 2204 1747 1615 528 240 126 --11738 --
NM_018999chr1073687 1553 1302 593 577 248 42 14214 1962 --
NM_019001chr344208 3877 3784 1535 --11404 13665
NM_019091chr21736 1782 --1890
NM_019116chr16103234 2883 2755 2727 2582 989 940 862 527 150 12684 185 22651 1117
NM_019591chr123889 338 156 1111 --1250
NM_019596chr2122735 2472 2699 257 1393 32720 934 163
NM_019859chr1041478 1017 523 268 ----11041
NM_019860chr1041526 1065 571 316 ----11089
NM_020182chr2073246 2785 2740 2279 2253 1104 945 22323 1094 23008 709 23210 2938
NM_020336chr2063825 3405 2800 1475 1378 986 1999 23791 2815 12980
NM_020338chr10103619 3350 2532 2438 1154 1147 590 388 349 106 12934 32510 1433 422 --
NM_020340chr632286 569 193 2450 119 --11603
NM_020348chr1052258 2201 1854 531 396 32316 805 703 31940 1876 42 --
NM_020443chr196898 5332 5102 4542 2776 1982 1695 1229 334 1494 2954 86 15252
NM_020455chr662436 2183 720 405 282 75 ------
NM_020456chr1341837 1677 691 604 12118 1643 1874
NM_020466chr674256 1814 1806 1303 1249 931 729 11500 ----
NM_020645chr112160 150 1511 1133 1555
NM_020673chr2086998 6933 5941 5889 2897 1918 1867 1655 11848 25617 1553 --
NM_020686chr16112655 2325 2053 1999 1096 1030 911 873 483 287 96 1231 22674 2437 --
NM_020718chr1696384 5978 5593 5026 4782 2488 1911 1117 909 ----1306
NM_020742chrX31971 1824 103 ----1503
NM_020752chr1062553 2444 2370 1826 556 154 22275 967 ----
NM_020766chrX44291 1675 1069 988 --33710 3317 110 11601
NM_020772chr1775339 3027 1864 1840 1834 1191 918 16424 13064 23213 2550
NM_020774chr1885692 4926 4332 3837 2054 627 489 119 11954 ----
NM_020781chr752993 2877 2207 1001 985 62481 1078 814 805 326 145 ----
NM_020805chr1831698 1530 231 1326 11283 21854 1342
NM_020810chr1433361 2756 959 --23489 606 11321
NM_020850chr1682973 2645 2636 2594 2572 801 534 46 11288 22798 2457 21169 781
NM_020927chr1672107 2085 2062 1928 1668 794 276 --21956 1853 --
NM_020956chr19244707 4551 4473 4448 4006 3965 3720 3706 3328 3293 1903 1888 1879 1825 1747 1669 1606 1361 1079 934 351 313 178 135 84419 1865 1811 1733 1709 1655 1631 1145 51840 1762 1684 1591 597 14538
NM_021090chr2294975 4061 3909 1626 1614 954 940 456 369 --34867 4311 4138 --
NM_021148chr742285 629 611 242 2573 364 1717 --
NM_021253chr651373 488 350 310 234 1577 --11161
NM_021255chr1483945 3812 2791 2672 2521 439 97 66 --12753 --
NM_021629chr374319 3789 3769 1451 1174 846 266 1642 13630 1917
NM_021638chr4124645 4533 4450 4027 1863 1458 1276 967 937 552 478 88 130 53267 1539 1022 719 113 13905
NM_021647chr463964 3937 3329 3260 1873 581 24396 554 1255 --
NM_021813chr675829 5301 4205 1807 1150 702 44 33611 1739 1281 25351 1131 --
NM_021911chr574659 4566 4460 2117 2092 288 91 --11001 --
NM_021913chr1971577 1343 1320 1272 1250 1131 291 --21827 269 --
NM_021914chr1442455 1753 1638 1496 ----12102
NM_021954chr1373559 2589 1302 656 436 415 22 --2628 397 --
NM_021961chr11127460 5300 3005 2971 2777 2754 2559 2330 2003 1939 1892 257 --24630 1495 --
NM_021964chr365229 2603 2539 2473 1098 664 ----11135
NM_021977chr693660 3237 3080 2731 2514 1141 774 635 37 --1145 --
NM_022048chr15156064 5968 5476 5222 5084 4385 4137 2052 1590 1314 1081 1035 694 221 166 21188 1137 24499 888 34485 1534 872
NM_022166chr16156331 5672 5613 5381 3991 2359 2201 1778 1136 1121 1021 496 472 320 54 15191 1798 12246
NM_022456chr12127030 6699 6655 6600 6098 2292 1674 1606 1296 971 438 209 1625 25674 1381 --
NM_022458chr762568 2208 444 391 107 48 12895 12486 1851
NM_022459chr1364702 2245 2121 1769 1211 664 25964 4628 2963 478 11241
NM_022462chr19203638 3309 3113 3054 2995 2743 2711 2618 2558 2528 2498 2437 2421 2355 1458 1392 1366 792 760 369 13624 12454 --
NM_022491chr12113406 2827 2723 2693 2505 2438 2365 2226 2196 768 209 1542 ----
NM_022763chr352326 830 454 280 61 12048 ----
NM_022912chr252904 1979 1170 1113 560 --12532 2878 619
NM_024341chr1994010 2663 2550 1170 870 795 253 227 175 ----1972
NM_024345chr995983 5542 5405 5199 4412 4369 2352 1423 668 15765 15096 --
NM_024423chr1864081 2711 2625 1574 1333 1319 ----21630 1173
NM_024607chr873691 3672 3350 2995 1374 1336 177 21396 84 13290 11510
NM_024636chr752870 2572 2318 1934 243 ----12330
NM_024639chr692864 2003 1911 1845 1151 1025 935 213 91 5500 358 155 116 51 --22112 1933
NM_024692chr231481 1358 528 ----1141
NM_024770chr2126706 6530 6377 6310 5466 5437 5088 4261 2625 1811 992 32 15378 36699 4948 530 1444
NM_024947chr397772 6479 3241 2466 2101 1928 979 694 81 1789 17191 --
NM_024963chr7165492 4900 4585 3890 3835 3777 3755 3748 2192 2163 2066 1991 1755 1729 1447 1436 35696 632 67 ----
NM_024989chr267806 6928 5820 3284 1284 1159 22753 1411 16963 --
NM_024991chr10103275 2506 2379 1309 1106 1066 1017 1000 835 309 ----1645
NM_025054chr8103575 3259 2758 2613 2586 1529 1427 1265 942 623 ------
NM_025134chr1641752 996 868 722 --1862 1146
NM_025151chr852037 2004 870 607 299 2293 261 2685 58 --
NM_025160chr163806 3615 2809 1616 1240 559 --1858 --
NM_025179chr194676 3955 3884 1835 1621 1613 705 687 98 2515 231 --13446
NM_025195chr831360 766 741 1757 --11287
NM_025237chr1741303 437 142 120 --21568 291 21576 364
NM_030627chr522940 754 1444 --22718 1019
NM_030648chr495278 4602 4415 3749 3575 1946 1833 1714 713 24765 84 --125
NM_030674chr1265735 1901 1693 783 558 360 11197 45816 5647 3666 2038 21652 652
NM_030755chr1453097 2314 837 145 114 --12098 --
NM_030761chr1102534 2466 2247 2201 1864 1699 1672 609 583 182 32292 753 45 --12233
NM_030799chr521497 1393 --12129 1872
NM_030806chr1149187 8228 8063 7843 7615 7149 7061 6783 6582 5935 5805 2356 2337 268 27655 7335 37726 6873 5715 33367 3084 460
NM_030816chr132778 1062 630 23001 2966 --12393
NM_030817chr1283168 2934 756 649 515 468 444 59 1524 21191 476 --
NM_030918chr1144991 4765 4313 3748 3689 2162 1707 1179 882 781 769 720 681 631 24936 4158 25391 107 15269
NM_031427chr1485816 5800 5597 5463 1417 502 430 393 21303 567 ----
NM_031469chr6113793 3755 3691 3613 3519 2992 2909 2673 1572 615 558 1313 43594 1364 1139 1086 12840
NM_032012chr9104666 4477 4331 4015 3883 2080 1634 1385 1120 775 11492 34829 3487 210 13944
NM_032041chr872267 2220 2184 1730 1026 832 187 --32611 1867 1011 --
NM_032042chr5112326 2303 1871 956 739 556 449 442 161 118 111 ------
NM_032105chr1197573 7501 7247 6776 6668 6498 6167 5907 5765 5208 1868 1837 1681 1492 570 146 110 78 47 26985 2837 --13142
NM_032160chr1833075 1647 1093 --23052 1408 1352
NM_032174chr171459 1247 1154 1093 1061 985 378 --31143 1005 82 1515
NM_032199chr1041133 293 244 140 11034 11092 1507
NM_032208chr253537 2292 1247 772 244 11317 --2918 256
NM_032373chr1075400 5085 4949 4463 3641 663 89 14680 --15056
NM_032440chr1042573 1965 693 655 ----12367
NM_032457chr483654 3267 3220 1423 1217 793 465 140 ------
NM_032689chr1941566 1310 1065 601 ----1212
NM_032737chr1991920 823 587 555 432 425 275 262 39 1205 --22627 98
NM_032837chr1761784 1370 1350 692 568 307 ----1634
NM_032873chr1154593 3020 2908 878 324 11065 2625 181 --
NM_032932chr17176053 5944 5874 5719 5318 5278 5253 5110 4738 4271 3966 2493 2394 2138 1888 1086 998 36324 5091 522 36361 4377 2092 11946
NM_032975chr1842974 2815 2683 620 ----13448
NM_032980chr1842974 2815 2683 620 ----13448
NM_033020chr154169 3951 1568 1170 734 ----21633 1531
NM_033138chr762001 1985 1653 1639 485 358 ----1177
NM_033139chr762001 1985 1653 1639 485 358 ----1177
NM_033140chr762001 1985 1653 1639 485 358 ----1177
NM_033157chr762001 1985 1653 1639 485 358 ----1177
NM_033181chr673972 3559 2889 2847 2778 972 60 2414 383 1191 --
NM_033224chr7157916 7808 7768 7363 7186 7138 6936 6630 6141 6044 1974 1278 1207 733 716 22688 55 1341 16420
NM_033326chr1141546 956 820 682 11908 --11583
NM_033389chr17124609 4276 4143 3341 3182 1891 1884 1591 1541 480 438 29 11414 1574 1259
NM_033426chr1472625 2458 2362 2095 1918 1910 1155 22941 397 ----
NM_033429chr1553244 3083 950 659 562 11066 33129 2153 1073 --
NM_033505chr2116392 6344 5441 5267 4868 4596 4315 2542 2517 2330 344 11694 --24565 4112
NM_033542chr2041673 1285 482 70 1700 21334 489 12029
NM_033631chr163795 3353 2587 1163 530 168 23067 179 ----
NM_033656chr2195742 5338 4902 4215 1750 1508 1393 734 723 --15358 --
NM_052885chr12104715 4151 4017 3391 1743 1506 763 618 600 130 ------
NM_052906chr22154568 4206 3922 3656 1981 1566 1406 1213 1194 778 759 556 76 67 36 31715 535 278 24590 4461 --
NM_052918chr10113300 3239 3039 2756 2585 2428 2349 1447 1271 543 317 22657 2570 ----
NM_052934chr192143 1852 1828 1710 901 757 691 419 113 32203 894 542 --1176
NM_052978chr1421724 445 --1283 1666
NM_053016chr9117953 7924 7698 6517 5313 4872 2344 1310 1284 630 559 --15615 --
NM_053043chr775800 5296 5032 4345 1505 728 552 14264 31673 163 133 11749
NM_053064chr1473104 2212 1118 1007 999 973 802 1861 1905 11208
NM_078476chr63259 228 165 61288 1267 1237 326 268 78 11392 1120
NM_080546chr972063 2032 1951 1821 1695 935 485 1158 ----
NM_080591chr9122324 2260 1192 853 701 684 474 430 374 212 184 68 --42746 2627 1230 54 --
NM_080669chr17164252 4103 4092 3938 3852 3613 3526 3412 3316 3190 3085 1549 767 344 306 197 44668 4084 3288 1324 --14141
NM_080792chr20111858 1815 1579 1511 1451 735 549 471 133 126 94 21969 247 1371 --
NM_130830chr3123596 3510 2735 2626 2511 2479 1565 1175 1075 1038 1025 905 23579 1462 --13743
NM_133170chr20157210 7034 6714 6095 5781 5719 4991 2897 2603 2531 2486 2217 2211 1652 27 66931 6013 5510 5214 1763 1328 27404 34 37702 5277 2613
NM_133265chrX52588 2450 796 729 333 53537 3039 2468 599 408 ----
NM_133334chr495746 4586 2448 2378 2175 2098 1825 1800 1640 15044 1291 --
NM_133445chr9123811 3667 3533 3443 3036 3020 2870 1445 1313 962 731 456 --21370 194 11342
NM_133474chr451184 1166 1127 605 65 31395 1045 649 11542 --
NM_133493chr6103946 3704 3167 3097 1678 1476 939 682 533 278 4987 858 840 787 --12829
NM_133503chr121196 1242 --1747
NM_133504chr121196 1242 --1747
NM_133505chr121196 1242 --1747
NM_133506chr121196 1242 --1747
NM_133646chr2125518 5153 5059 5012 4689 4344 4138 3374 1712 1216 1090 765 23748 3526 24733 1006 --
NM_134325chr191678 1387 1363 1245 709 511 436 292 226 41738 614 429 77 --1659
NM_138286chr1964346 4159 1046 523 396 278 32749 1664 224 ----
NM_138288chr1462229 1901 687 560 93 23 12097 11585 --
NM_138333chr92965 206 --11766 1149
NM_138444chr1374803 4589 3965 3572 3173 373 233 --13203 --
NM_138457chr6143369 3284 2514 2129 1365 833 807 634 428 388 239 107 55 48 22927 194 ----
NM_138459chr621337 569 --2546 496 13495
NM_138468chr275824 5115 4456 2009 1847 1779 791 --11532 --
NM_138621chr283941 3909 3218 1298 1054 710 416 136 11436 33341 3010 1418 --
NM_138638chr1442455 1753 1638 1496 ----12102
NM_138694chr643553 2663 1096 504 1814 13195 12851
NM_138713chr1697579 6999 6328 6187 5569 5014 2705 1860 1324 --28120 2523 1657
NM_138714chr1697579 6999 6328 6187 5569 5014 2705 1860 1324 --28120 2523 1657
NM_138782chr551965 856 519 340 236 2788 390 1940 --
NM_138959chr1105234 4937 2400 2209 2070 1941 1398 1246 926 70 46241 5755 4511 4371 1380 26354 539
NM_139312chr1031374 1127 391 ----11200
NM_139321chr2093736 3384 3194 2717 2666 2597 1500 1099 52 11174 --2517 240
NM_144571chr466035 5224 4752 2727 1729 965 ----1435
NM_144578chr1484206 4082 3966 3774 3510 1753 907 687 1133 34981 1113 1010 --
NM_144590chr1042190 2075 739 352 32716 2606 802 ----
NM_144599chr15115149 4908 4685 4487 4260 3719 3555 3387 1549 1328 161 14500 14480 --
NM_144628chr2063022 2521 2091 2068 1098 895 1547 31901 158 104 12721
NM_144664chr1162574 526 385 335 327 225 ------
NM_144767chr1584623 3903 3529 3386 2865 1002 781 531 23825 570 34173 3186 2849 --
NM_144973chr1234873 2049 410 11162 24925 955 34853 4332 2018
NM_145165chr1472726 2440 2324 1979 376 342 219 --1172 --
NM_145176chr653391 3200 1010 980 502 12884 ----
NM_145307chr1084552 4283 4167 4155 3948 1404 874 231 --158 --
NM_145320chr752986 2588 1416 1313 408 2751 692 23476 1448 13413
NM_145321chr752986 2588 1416 1313 408 2751 692 23476 1448 13413
NM_145322chr752986 2588 1416 1313 408 2751 692 23476 1448 13413
NM_145799chrX72635 2236 2133 848 780 316 36 32328 1959 1057 22479 2040 --
NM_145912chr22144546 4264 4093 3502 3343 3333 3198 1719 1557 867 586 504 314 40 34013 1405 101 14146 --
NM_152253chr22113735 3538 1369 1047 986 935 892 803 625 433 304 23868 1027 32737 1519 425 --
NM_152267chr2241951 1655 329 146 3793 668 614 --11858
NM_152283chr52716 115 ----1968
NM_152388chr254035 2576 1586 919 871 1853 12938 13798
NM_152622chr583504 3148 2163 1161 1016 712 706 601 ------
NM_152624chr597393 7058 6359 6311 4856 1756 1694 1594 1195 138 15519 --
NM_152629chr943999 2537 2526 138 22856 951 23594 1636 --
NM_152733chr6176329 6195 6129 5958 5922 5541 4333 4325 4006 2569 2235 1963 1566 1522 1377 1201 514 26206 1811 15835 35991 2590 112
NM_152734chr6195280 5092 4869 4676 4666 4567 4438 3688 2151 1732 1573 1377 978 778 615 535 515 395 166 45337 4752 4201 3485 2842 34 15037
NM_152744chr792937 2924 2818 2565 2545 936 865 826 387 43119 2953 2268 1282 149 1432
NM_152765chr832050 2007 1835 22310 1671 11634 1794
NM_152787chrX31273 663 399 --11244 13653
NM_152838chr2073421 1174 761 564 296 81 59 ------
NM_152924chr15126526 6368 5763 4198 2660 2223 2025 1735 1581 500 440 176 11813 21091 842 --
NM_152999chr721189 1099 13258 34516 1144 1115 24038 1562
NM_153050chr2294975 4061 3909 1626 1614 954 940 456 369 --34867 4311 4138 --
NM_153051chr2294975 4061 3909 1626 1614 954 940 456 369 --34867 4311 4138 --
NM_153235chr682389 2325 2179 1958 1650 954 940 155 190 11935 --
NM_153371chr1362365 2227 1637 1571 240 233 11625 ----
NM_153456chr13135743 5293 5137 5050 4516 4103 2492 2066 1748 1572 1410 1250 694 1611 25650 917 14931
NM_153487chr6134481 3999 3470 3411 3018 1919 1289 1216 1074 835 568 520 97 44353 3335 331 118 34293 3633 613 --
NM_153499chr1282687 2049 1022 1002 976 608 418 77 --2988 586 12158
NM_153500chr1282687 2049 1022 1002 976 608 418 77 --2988 586 12158
NM_153607chr573118 2880 2852 2001 837 730 501 --1185 --
NM_153689chr232223 2200 69 ----11579
NM_153810chr1064877 4030 3680 1583 816 778 11368 34362 3279 69 11339
NM_170665chr1263636 3230 1588 689 423 129 --33577 3383 3224 14077
NM_170686chr752993 2877 2207 1001 985 62481 1078 814 805 326 145 ----
NM_170706chr164135 3492 3173 3008 1239 1020 --33408 3213 3064 33502 375 297
NM_172016chr651373 488 350 310 234 1577 --11161
NM_172071chr196097 5790 5710 2463 600 568 238 127 114 25526 106 35462 2827 303 1491
NM_172103chr672404 2006 1731 1638 788 148 134 ------
NM_172105chr672404 2006 1731 1638 788 148 134 ------
NM_172216chr1272589 1951 924 904 878 510 320 --2890 488 12060
NM_172226chr1282687 2049 1022 1002 976 608 418 77 --2988 586 12158
NM_173065chr1132678 2650 2287 2225 1154 992 943 651 545 505 294 248 35 12755 23242 208 --
NM_173198chr962888 2595 2338 949 899 414 22483 1035 ----
NM_173200chr962888 2595 2338 949 899 414 22483 1035 ----
NM_173214chr1697579 6999 6328 6187 5569 5014 2705 1860 1324 --28120 2523 1657
NM_173468chr4105494 4610 4061 1889 1856 1822 1443 1391 962 466 --1800 --
NM_173531chr1953401 3149 3081 1372 883 4827 747 461 150 11264 13017
NM_173582chr1176225 5447 5415 4762 4508 4375 4177 --1192 --
NM_173632chr1973125 2926 2111 1271 1151 1005 713 2644 572 13014 --
NM_173642chr1148729 8208 7404 6761 5833 3632 3112 3050 2489 2376 2327 2241 1043 852 59089 6364 5860 3070 2230 16548 17183
NM_173808chr184166 3860 3471 3227 2942 702 512 481 ------
NM_173829chr535693 5312 4128 35737 5428 1136 14341 --
NM_174911chr893643 3276 3036 2814 2717 2672 786 505 421 --11298 12613
NM_174934chr11133275 3252 2939 2818 1355 1282 1202 1021 641 618 346 206 143 22692 190 12677 --
NM_175058chr113189 172 49 --11167 31021 324 117
NM_175623chr12127030 6699 6655 6600 6098 2292 1674 1606 1296 971 438 209 1625 25674 1381 --
NM_175624chr12127125 6794 6750 6695 6193 2387 1769 1701 1391 1066 533 304 1720 25769 1476 --
NM_175625chr12127125 6794 6750 6695 6193 2387 1769 1701 1391 1066 533 304 1720 25769 1476 --
NM_175709chr2282980 2890 2480 2418 2100 1972 914 237 1566 22298 1958 2545 61
NM_175733chr1181718 1474 524 494 430 391 152 93 31974 1837 703 11370 --
NM_175736chr12207738 7495 6950 6621 6291 5536 5388 5205 2988 2894 2684 2643 2590 2509 1273 1245 401 323 316 37 35180 3008 2554 35634 3123 1970 36769 2131 1440
NM_175767chr571850 1760 1566 1488 1407 741 569 --11297 --
NM_175907chr1852623 2387 1803 461 267 ----1284
NM_176823chr1133495 3113 2927 2445 1047 918 767 741 379 369 360 294 121 12728 2586 454 128
NM_178011chr1063125 2628 2312 621 584 22 --1450 13143
NM_178151chrX117694 7251 5737 5274 2262 2250 2025 1844 1128 787 21 15973 23153 28 27715 250
NM_178152chrX117694 7251 5737 5274 2262 2250 2025 1844 1128 787 21 15973 23153 28 27715 250
NM_178153chrX117694 7251 5737 5274 2262 2250 2025 1844 1128 787 21 15973 23153 28 27715 250
NM_178832chr104572 486 149 82 ----11265
NM_181054chr142829 126 ----1871
NM_181332chrX31971 1824 103 ----1503
NM_181489chr3126703 6632 6226 5564 5069 5054 2459 2279 2268 2093 2052 1146 64242 1085 957 844 725 52 ----
NM_181491chr9112977 2768 2731 2537 2219 2201 1119 1004 719 178 140 32013 620 434 41014 933 425 122 --
NM_181521chr16136534 6376 6258 5372 5310 5064 4893 4792 4514 2217 1046 666 484 54969 4945 2789 2173 561 ----
NM_181723chr821875 269 ----1443
NM_182503chr663996 1101 412 398 304 206 34179 1800 346 65343 4998 4842 1637 1307 454 --
NM_182507chr1282002 1518 1483 734 251 194 164 27 31571 627 557 --11984
NM_182620chr1722207 2153 ----292 52
NM_182664chr162356 2289 2199 1746 165 117 1744 11840 1754
NM_182697chr751416 1294 1226 498 24 ----11266
NM_182935chr382334 2136 2109 1830 1028 847 529 302 1620 2322 253 21619 600
NM_182970chr20214067 3952 3685 3664 3479 3466 3429 3271 2860 2854 2696 1437 1326 972 966 803 507 499 370 359 74 43873 3211 819 457 22616 486 1264
NM_183238chr1263425 2652 2491 1124 1040 883 --1852 12449
NM_183397chr20105028 4870 4477 4261 4234 1347 1282 674 519 339 12031 23403 1276 14902
NM_194285chr1173237 2955 2625 2571 703 168 63 11286 2180 31 --
NM_194286chr1285004 4866 4174 3969 2490 2413 1957 167 34221 1658 1570 35710 1420 1149 --
NM_197941chr562388 2155 1946 1072 436 73 12648 12401 11913
NM_198147chr1731019 989 353 21195 1179 1964 1828
NM_198392chr682370 2304 2116 2074 1459 551 403 361 11852 22242 434 12103
NM_198465chrX62638 1826 1009 387 300 62 1520 --171
NM_198484chr3105756 5691 5034 4981 4768 2532 2028 1416 170 102 14441 46213 5351 4603 1282 14208
NM_198490chr3103483 3283 3130 2163 1373 1285 1125 1099 507 445 --176 32863 488 380
NM_198560chr3113088 2832 2804 2733 1162 933 653 520 426 285 137 22749 317 32597 2521 439 --
NM_198595chr4124645 4533 4450 4027 1863 1458 1276 967 937 552 478 88 130 53267 1539 1022 719 113 13905
NM_198859chr354999 4340 4236 1758 1323 25076 1283 --24719 1977
NM_198896chr1142196 1435 795 30 ----11810
NM_198900chr12207738 7495 6950 6621 6291 5536 5388 5205 2988 2894 2684 2643 2590 2509 1273 1245 401 323 316 37 35180 3008 2554 35634 3123 1970 36769 2131 1440
NM_199005chr941020 930 213 91 4358 155 116 51 ----
NM_199169chr2073246 2785 2740 2279 2253 1104 945 22323 1094 23008 709 23210 2938
NM_199170chr2073246 2785 2740 2279 2253 1104 945 22323 1094 23008 709 23210 2938
NM_199171chr2073246 2785 2740 2279 2253 1104 945 22323 1094 23008 709 23210 2938
NM_199320chr461826 1178 928 903 128 53 --1145 --
NM_199320chr461826 1178 928 903 128 53 --1145 --
NM_201432chr17106071 5887 5450 4859 4438 4237 1804 887 566 135 26091 5434 52353 2068 2019 1214 379 14596
NM_201433chr17106071 5887 5450 4859 4438 4237 1804 887 566 135 26091 5434 52353 2068 2019 1214 379 14596
NM_203305chr9132064 2011 1949 1779 903 792 784 626 504 417 241 85 50 22208 1004 11036 --
NM_203327chr2074172 3662 3124 1181 524 331 116 23883 3679 2366 359 23850 3393
NM_203342chr192877 2593 2523 2401 2215 694 493 173 96 21018 525 33535 2564 1082 --
NM_203343chr192877 2593 2523 2401 2215 694 493 173 96 21018 525 33535 2564 1082 --
NM_203399chr13677 140 134 ----1756
NM_203401chr13677 140 134 ----1756
NM_203458chr163409 2878 2362 1547 1465 1017 1241 2697 371 --
NM_206594chr1113619 3393 2989 2791 2679 2566 2524 2497 855 807 154 ------
NM_206595chr1113619 3393 2989 2791 2679 2566 2524 2497 855 807 154 ------
NM_206909chr8157998 7530 7524 7241 7103 6452 6239 5713 3327 1880 1482 1410 887 844 253 25547 1747 --36075 5674 2312
NM_207303chr1044059 3768 3685 701 --1108 13756
NM_207306chr194324 4139 3766 3576 1688 1675 1622 1536 194 24279 378 23911 3628 --
NM_207481chr271437 1237 984 415 377 174 49 ------
NM_207577chr1152110 1989 1779 1162 134 22225 966 11868 1427