TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-518f-3p
miRNA Sequence: GAAAGCGCUUCUCUUUAGAGG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr5--1110 ----
NM_000032chrX138 ------
NM_000037chr832389 2267 1907 ------
NM_000038chr51516 1522 ----
NM_000044chrX1327 ------
NM_000052chrX42617 2164 390 136 23272 2485 1586 13108
NM_000055chr31321 ------
NM_000081chr131544 616 499 21408 1163 ----
NM_000084chrX86522 5277 2332 1878 1294 620 449 272 26952 6589 --1943
NM_000090chr22861 199 ------
NM_000093chr93961 559 483 ------
NM_000109chrX--12657 --1418
NM_000125chr644187 4044 3709 2708 ------
NM_000129chr62164 87 ------
NM_000133chrX1120 ------
NM_000141chr1041341 1238 1031 585 ------
NM_000163chr53835 697 332 ------
NM_000168chr763303 2762 2384 2369 2288 403 --1715 --
NM_000170chr91199 ------
NM_000176chr523951 685 ------
NM_000208chr1973817 2986 1643 1391 701 585 47 ------
NM_000217chr1254094 4010 1758 341 92 14745 ----
NM_000228chr1279 48 ------
NM_000245chr711427 ------
NM_000248chr31840 1123 ----
NM_000252chrX21066 401 ------
NM_000253chr42211 92 ------
NM_000259chr1576338 5619 5449 5213 4157 4002 2107 12175 24277 4015 --
NM_000264chr933005 2448 879 ------
NM_000267chr1713133 ------
NM_000275chr152431 104 ------
NM_000278chr1022252 1588 ------
NM_000280chr111894 ------
NM_000314chr10--1287 11127 --
NM_000319chr122280 50 ------
NM_000321chr1341718 1274 618 598 11711 --1282
NM_000332chr687063 6161 4472 2766 2242 1236 737 176 ----12021
NM_000333chr31234 ------
NM_000334chr1721663 641 ------
NM_000340chr311490 11412 ----
NM_000345chr41179 1892 ----
NM_000346chr1721681 607 ------
NM_000353chr161141 ------
NM_000368chr954644 3452 526 503 373 23825 1826 11903 --
NM_000369chr1421854 580 ------
NM_000378chr113343 144 57 ------
NM_000386chr17------1160
NM_000393chr231546 1348 302 ------
NM_000397chrX32414 2215 692 ------
NM_000399chr1021013 390 1293 ----
NM_000408chr242717 2632 2142 1274 ------
NM_000411chr211160 --32369 2108 2027 --
NM_000430chr1742643 875 711 457 11248 ----
NM_000437chr122096 1954 ------
NM_000445chr8169 ------
NM_000461chr334335 3173 1570 ------
NM_000462chr1531818 1684 521 ----11869
NM_000484chr211828 2381 103 ----
NM_000489chrX43409 2425 1088 315 1528 12297 --
NM_000495chrX2936 450 ------
NM_000522chr741226 1147 889 58 ------
NM_000523chr211145 ------
NM_000533chrX1530 ------
NM_000539chr331473 363 299 ------
NM_000555chrX55444 4858 2936 1506 1423 16936 22984 97 --
NM_000601chr71333 ------
NM_000609chr1012254 ----13047
NM_000610chr112441 195 ------
NM_000611chr1151918 1282 797 423 53 --26689 6128 --
NM_000618chr1235092 1402 127 ------
NM_000618chr1235092 1402 127 ------
NM_000619chr121482 ----1400
NM_000620chr1232132 541 209 ------
NM_000676chr171216 ------
NM_000679chr51152 ------
NM_000686chrX21401 43 1613 ----
NM_000698chr101336 ------
NM_000702chr111507 11874 ----
NM_000719chr1222578 787 --11763 --
NM_000721chr142304 2285 2229 2139 1184 ----
NM_000723chr17----1401 --
NM_000724chr1011503 1677 ----
NM_000726chr2--11139 ----
NM_000747chr172880 668 ------
NM_000780chr831125 1050 136 1514 ----
NM_000788chr42569 113 1993 ----
NM_000793chr1465112 5055 5029 4056 3386 318 ------
NM_000806chr531859 503 485 2694 83 ----
NM_000813chr521661 1562 --11379 --
NM_000814chr152639 595 12666 ----
NM_000817chr221029 454 ----11210
NM_000820chr131264 ------
NM_000826chr412552 --11687 --
NM_000829chr1132330 1917 588 ------
NM_000839chr31336 ------
NM_000844chr31319 1163 ----
NM_000845chr7--1190 ----
NM_000868chrX2900 508 ------
NM_000875chr1567036 6618 6284 5883 2380 1371 --35575 5473 4540 --
NM_000876chr61951 1327 ----
NM_000891chr1721393 492 --1902 12717
NM_000899chr1244002 3770 3496 2844 13427 21745 1271 --
NM_000901chr41229 1384 ----
NM_000909chr431335 147 137 --2934 239 --
NM_000922chr112393 294 ------
NM_000924chr12----1854 --
NM_000933chr20--1671 ----
NM_000935chr341010 959 810 251 ------
NM_000938chr41133 ------
NM_000944chr41662 ------
NM_000945chr231852 1551 36 --1537 --
NM_000950chrX23120 2756 ------
NM_000951chr191157 ------
NM_000962chr931111 749 42 ------
NM_000965chr321246 480 --1381 --
NM_000966chr121352 ------
NM_001001132chr21----1319 --
NM_001001323chr1232074 1197 961 --22514 476 --
NM_001001331chr332171 1725 56 --11686 --
NM_001001342chr102394 239 ------
NM_001001389chr112441 195 ------
NM_001001390chr112441 195 ------
NM_001001391chr112441 195 ------
NM_001001392chr112487 241 ------
NM_001001395chr1262339 2299 2187 810 422 250 ------
NM_001001396chr121344 1076 --12925 --
NM_001001419chr555079 2059 998 796 276 --15176 --
NM_001001420chr555079 2059 998 796 276 --15176 --
NM_001001433chr2022871 1216 --23001 2807 --
NM_001001483chr111427 ------
NM_001001549chr752703 2452 2070 928 458 --12757 --
NM_001001550chr752703 2452 2070 928 458 --12757 --
NM_001001552chr11327 ------
NM_001001555chr752703 2452 2070 928 458 --12757 --
NM_001001560chr223846 528 122 ------
NM_001001664chr254039 1484 1309 1217 893 23576 3085 ----
NM_001001787chr1--1164 ----
NM_001001852chr222807 138 ------
NM_001001890chr2131475 1017 600 ------
NM_001001936chr10160 1298 ----
NM_001001938chr953609 3116 2832 817 427 ------
NM_001001974chr1031627 1496 940 21524 703 ----
NM_001001994chrX--1414 ----
NM_001001996chrX--1414 ----
NM_001002033chr171764 ------
NM_001002257chr21932 11426 13136 --
NM_001002838chrX1559 1280 ----
NM_001002843chr1521148 822 --11206 --
NM_001002860chr1444350 1782 1369 1310 ------
NM_001002909chr1752022 1695 835 327 168 ------
NM_001002914chr1711291 ------
NM_001003652chr1868203 6638 3425 2976 2748 1047 46465 6441 3142 2100 18623 --
NM_001003665chr11164 ------
NM_001003674chr1866860 6622 5885 1269 442 279 15446 25126 4946 --
NM_001003675chr1866860 6622 5885 1269 442 279 15446 25126 4946 --
NM_001003681chr2221895 180 --11481 --
NM_001003694chr31496 ------
NM_001003698chr631605 1384 556 ------
NM_001003699chr631605 1384 556 ------
NM_001003792chr3----1943 --
NM_001003793chr3----1943 --
NM_001003800chr9----22966 1475 --
NM_001003810chr42871 196 --1655 --
NM_001003891chr221118 ------
NM_001004051chrX----161 --
NM_001004065chr963931 3080 2636 2498 512 34 ------
NM_001004106chr511048 ------
NM_001004196chr331098 1080 936 ------
NM_001004317chr634382 4164 1513 12815 ----
NM_001004342chr145982 5521 3982 1636 ------
NM_001004360chr221686 772 ------
NM_001004720chr2----1662 --
NM_001004722chr2172 --1831 --
NM_001005158chr32469 394 165 ----
NM_001005159chr32469 394 165 ----
NM_001005366chr122759 46 ------
NM_001005375chrY--157 11608 --
NM_001005386chr23991 243 37 --1473 --
NM_001005404chr1753835 3762 3540 1747 191 ------
NM_001005415chr192424 360 ------
NM_001005416chr192424 360 ------
NM_001005417chr1------1702
NM_001005463chr10----12105 --
NM_001005609chrX23845 3731 --2663 500 --
NM_001005732chr21164 ------
NM_001005733chr21164 ------
NM_001005739chr21351 ------
NM_001005746chr2--11139 ----
NM_001005747chr2--11139 ----
NM_001005861chr36948 908 892 658 359 73 1139 ----
NM_001005910chr32482 270 1565 ----
NM_001005911chr32482 270 1565 ----
NM_001005920chr163919 799 118 ------
NM_001006115chr362701 2478 2301 2247 2122 91 ------
NM_001006600chr511588 ------
NM_001006612chrX148 ------
NM_001006613chrX148 ------
NM_001006614chrX148 ------
NM_001006623chr24697 538 247 159 --22497 327 --
NM_001006635chr22142 101 ------
NM_001006636chr21358 ------
NM_001006933chrX155 188 ----
NM_001006935chrX------136
NM_001006936chrX------136
NM_001006937chrX------136
NM_001006938chrX2715 105 2163 138 ----
NM_001006946chr231437 1191 338 ------
NM_001007023chr1465112 5055 5029 4056 3386 318 ------
NM_001007024chr1744306 385 247 37 --23579 1617 --
NM_001007025chr1744306 385 247 37 --23579 1617 --
NM_001007075chr41942 ------
NM_001007097chr943817 3630 907 41 11152 24017 340 --
NM_001007098chr11378 1153 ----
NM_001007099chr13864 690 194 ------
NM_001007100chr13864 690 194 ------
NM_001007102chr641446 1440 1163 174 138 ----
NM_001007237chr142376 2186 839 523 --1983 --
NM_001007257chr12546 437 ------
NM_001007271chr101409 ------
NM_001007466chr654660 3273 2041 1751 1222 ----15002
NM_001007467chr221107 ------
NM_001007471chr91126 196 ----
NM_001007553chr111187 1460 ----
NM_001008220chr532429 1317 907 ------
NM_001008225chr7286 40 ------
NM_001008239chr1833707 3132 3018 ------
NM_001008392chr323228 231 12401 ----
NM_001008408chr7186173 6040 5967 5948 5514 5276 5081 4817 4713 4110 4053 4026 1621 1558 1547 1066 275 255 11445 ----
NM_001008539chr845379 3506 1754 1350 15360 ----
NM_001008540chr21356 ------
NM_001008564chr1332280 1378 904 ------
NM_001008660chr11----11170 --
NM_001008783chr61649 2688 87 ----
NM_001008860chr15--2739 306 ----
NM_001008892chr15--2739 306 ----
NM_001008894chr15--2739 306 ----
NM_001009552chr81569 ------
NM_001009554chr431408 450 364 14754 ----
NM_001009554chr431408 450 364 14754 ----
NM_001009566chr141137 276 142 32 ------
NM_001009899chr351618 1147 759 753 196 --16190 --
NM_001009955chr11442 ------
NM_001009955chr11442 ------
NM_001009960chr722809 860 --12827 --
NM_001009993chr224312 1386 33821 3444 945 13672 --
NM_001010854chr141178 ------
NM_001010862chrX53299 2855 151 109 69 ------
NM_001010888chrX34531 1175 131 14345 23399 3357 199
NM_001010891chr511168 --1545 --
NM_001010924chr101780 1862 ----
NM_001010927chr6--1391 ----
NM_001010932chr71333 ------
NM_001010971chr11872 --1994 --
NM_001010984chr11995 ------
NM_001010986chrX12449 --1930 --
NM_001010989chr162491 130 ----1509
NM_001010990chr162491 130 ----1509
NM_001011513chr424052 1624 --12764 --
NM_001011515chr42946 785 ------
NM_001011516chr42946 785 ------
NM_001011537chr332118 1692 537 ----12294
NM_001011545chr211202 ------
NM_001011553chr71395 ------
NM_001011645chrX1327 ------
NM_001011663chr103953 669 146 --1408 --
NM_001011666chr744652 2551 811 221 --34502 2112 229 --
NM_001011713chr1451547 1302 1157 1029 78 11111 ----
NM_001011885chr1511139 ------
NM_001012393chr111156 24960 3377 ----
NM_001012398chr16--1781 ----
NM_001012415chr94820 198 100 83 ------
NM_001012418chr644226 3658 3255 3205 --23940 666 --
NM_001012446chr9--175 ----
NM_001012514chr231082 827 105 ------
NM_001012516chr231082 827 105 ------
NM_001012732chr411027 1198 ----
NM_001012751chr10--1727 ----
NM_001012754chr13159 11942 ----
NM_001012755chrX44728 4651 3832 1794 14129 ----
NM_001012761chr52352 305 1803 1550 --
NM_001012968chrX32775 1070 457 --1712 --
NM_001012977chrX21426 468 ------
NM_001012979chrX155 ----188
NM_001012989chrX1256 ------
NM_001013031chr1053280 3077 3026 2912 534 ------
NM_001013406chr711182 ------
NM_001013437chr18366 50 39 1332 ----
NM_001013438chr32208 47 ------
NM_001013439chr3154 ------
NM_001013620chr1268425 8333 5311 1665 1448 791 --15703 --
NM_001013635chr1221179 341 --11040 --
NM_001013703chr151501 ------
NM_001013839chr172878 169 ------
NM_001013843chr152262 140 ------
NM_001014283chr1331657 203 164 --1429 --
NM_001015053chr1721535 1386 ------
NM_001015877chrX32892 984 747 --1627 --
NM_001015881chrX11028 ------
NM_001017368chr1722180 1833 12824 --1460
NM_001017395chr321068 808 22220 1101 ----
NM_001017402chr1279 48 ------
NM_001017405chr42891 97 ------
NM_001017415chr11306 ------
NM_001017416chr11306 ------
NM_001017440chr777269 7068 5249 5180 3310 2780 1081 ----1217
NM_001017523chr122572 401 --11892 --
NM_001017922chr131719 1067 620 ------
NM_001017926chr831332 708 97 --11148 --
NM_001017977chr11371 ------
NM_001017999chr11462 --11767 --
NM_001017999chr11462 --11767 --
NM_001018000chr11462 --11767 --
NM_001018000chr11462 --11767 --
NM_001018001chr11462 --11767 --
NM_001018003chr81256 ------
NM_001018004chr153668 253 35 ------
NM_001018005chr15----1142 --
NM_001018006chr153668 253 35 ------
NM_001018007chr153668 253 35 ------
NM_001018008chr151105 1535 ----
NM_001018020chr153668 253 35 ------
NM_001018037chr931459 1323 1010 ------
NM_001018053chr121968 1431 ------
NM_001018054chr121447 428 ------
NM_001018056chr91155 ------
NM_001018057chr1141289 396 265 198 ----168
NM_001018065chr931456 1371 415 34696 1774 1365 ----
NM_001018066chr931456 1371 415 34696 1774 1365 ----
NM_001018067chr11443 15056 13323 --
NM_001018068chr11443 15056 13323 --
NM_001018069chr11443 15056 13323 --
NM_001018072chr122572 401 --11892 --
NM_001018074chr523951 685 ------
NM_001018075chr523951 685 ------
NM_001018076chr523951 685 ------
NM_001018077chr523951 685 ------
NM_001018090chr1532179 315 172 12549 ----
NM_001018091chr1532289 425 282 12659 ----
NM_001018100chr151637 ------
NM_001018102chr1532179 315 172 12549 ----
NM_001018108chr152151 73 ------
NM_001018676chr82124 31 ------
NM_001018677chr82124 31 ------
NM_001019chr16151 ------
NM_001023560chr61150 1683 ----
NM_001023567chr15----1355 --
NM_001024024chr14--1103 ----
NM_001024070chr14--199 ----
NM_001024071chr14--2397 71 ----
NM_001024094chr523951 685 ------
NM_001024218chr141245 ------
NM_001024226chr111091 142 ----
NM_001024227chr111091 142 ----
NM_001024228chr111091 142 ----
NM_001024660chr321259 1064 ------
NM_001024808chr1252357 859 747 409 368 --11098 --
NM_001024855chr31160 ------
NM_001024934chr6295 56 ------
NM_001024935chr6295 56 ------
NM_001024936chr6295 56 ------
NM_001024937chr172158 100 ------
NM_001024948chr133166 2500 1347 32841 2260 231 ----
NM_001024956chr1145427 4315 4307 378 14783 23847 1451 --
NM_001024959chr32277 145 ------
NM_001024960chr32277 145 ------
NM_001025068chr331691 1132 652 --11261 --
NM_001025069chr331691 1132 652 --11261 --
NM_001025076chr1055470 5206 3794 1790 790 ------
NM_001025077chr1076828 6564 5152 4950 2148 480 306 11045 ----
NM_001025079chr321469 1247 --11362 --
NM_001025105chr521375 361 ------
NM_001025108chr2156 --11124 --
NM_001025201chr22686 189 ------
NM_001025205chr32401 102 ------
NM_001025233chr1231022 407 232 ------
NM_001025252chr8--1312 23200 102 --
NM_001025253chr8--1312 23200 102 --
NM_001025356chr1232887 734 278 ------
NM_001025580chrX53052 2681 369 338 284 ------
NM_001025595chr411508 ------
NM_001025596chr112479 211 ------
NM_001025616chr451549 1526 645 609 336 ------
NM_001025780chr921588 310 ------
NM_001029858chr612977 13411 ----
NM_001029875chr532674 1082 524 ------
NM_001029884chr622511 2217 --1950 --
NM_001030007chr1613132 13556 33655 2846 1380 --
NM_001030009chr16151 ------
NM_001030055chr1443098 1218 384 372 --13067 --
NM_001030287chr1----1467 --
NM_001031623chr61127 1587 11347 --
NM_001031679chr1212943 13390 ----
NM_001031690chr752565 2336 2192 1898 431 12598 ----
NM_001031692chr71307 ------
NM_001031695chr2264658 2187 2181 594 565 306 23947 3336 --14577
NM_001031723chr41370 ------
NM_001031804chr1664181 3715 2853 2729 1684 1180 --13084 --
NM_001031812chr542128 1828 724 674 --1231 --
NM_001032280chr61429 11372 ----
NM_001032282chr8----11023 1947
NM_001032296chr131508 1375 12612 --
NM_001032363chr111784 21987 119 ----
NM_001032363chr111784 21987 119 ----
NM_001032367chr151444 ------
NM_001032999chr2024316 49 14207 15245 --
NM_001033047chr42454 158 ------
NM_001033057chr31314 ------
NM_001033059chr6160 --189 --
NM_001033087chr2042921 2306 2296 341 12341 ----
NM_001033112chr51730 --1720 --
NM_001033117chr343455 1815 1155 79 ------
NM_001033518chr722151 289 1548 12744 --
NM_001033519chr722151 289 1548 12744 --
NM_001033520chr722151 289 1548 12744 --
NM_001033557chr2128 151 ----
NM_001033561chr17----1717 --
NM_001033566chr17--162 ----
NM_001033568chr17--162 ----
NM_001033602chr131829 21882 215 ----
NM_001033723chr812536 21122 1020 ----
NM_001033925chr1031448 522 143 --1762 --
NM_001034194chr4------1143
NM_001034841chr1645460 5200 4776 1263 15538 ----
NM_001035260chr101424 --1289 --
NM_001037164chr73544 340 181 ------
NM_001037165chr756821 3332 3217 974 240 --12910 18505
NM_001037172chr31102 --11200 --
NM_001037174chr221930 181 ------
NM_001037324chr31177 ------
NM_001037331chr181178 --1370 --
NM_001037332chr521902 730 --1247 --
NM_001037333chr521902 730 --1247 --
NM_001037339chr111687 ------
NM_001037340chr111687 ------
NM_001037341chr111687 ------
NM_001037341chr111687 ------
NM_001037637chr5171 ------
NM_001037954chr1133369 2230 423 ------
NM_001037967chrX138 ------
NM_001037969chrX138 ------
NM_001038493chr221522 1397 ------
NM_001039091chrX21345 242 ------
NM_001039199chr201280 13315 ----
NM_001039348chr22420 321 11055 ----
NM_001039349chr22420 321 11055 ----
NM_001039350chr731661 1499 546 ------
NM_001039465chr14----198 --
NM_001039479chr1432127 1823 805 ------
NM_001039538chr232467 1068 979 ------
NM_001039547chr356138 3100 2555 585 139 ------
NM_001039577chr144498 3817 3239 161 11050 31590 185 32 11549
NM_001039582chrX2315 62 ------
NM_001039590chrX22591 979 ------
NM_001039591chrX22591 979 ------
NM_001039616chr19--153 ----
NM_001039618chr1135714 331 30 11413 --1901
NM_001039690chr1611513 --32329 1831 1722 --
NM_001039709chr2024316 49 14207 15245 --
NM_001039762chr1011520 11710 ----
NM_001039802chr121362 96 ------
NM_001039840chrX52430 1982 1472 462 447 1511 14680 --
NM_001039937chr131610 13905 ----
NM_001039960chr1221302 318 ------
NM_001040001chr6----11872 --
NM_001040031chr19----1270 --
NM_001040057chr71213 ------
NM_001040101chr421318 139 ------
NM_001040110chr72653 27 ------
NM_001040113chr161960 ------
NM_001040142chr242214 1802 1727 654 ------
NM_001040143chr242214 1802 1727 654 ------
NM_001040144chr1611513 --32329 1831 1722 --
NM_001040146chr1611513 --32329 1831 1722 --
NM_001040152chr744998 4581 3373 141 ------
NM_001040153chr132928 306 ------
NM_001040158chr5------1374
NM_001040159chr42326 184 1434 ----
NM_001040181chr3----1765 --
NM_001040182chr3----1765 --
NM_001040183chr3----1765 --
NM_001040199chr3----1765 --
NM_001040200chr3----1765 --
NM_001040202chr432513 1575 366 2175 124 ----
NM_001040214chr611826 12047 1956 1753
NM_001040284chr1635915 1506 1207 --1126 --
NM_001040402chr443008 2366 831 193 --12824 --
NM_001040429chr1353584 2915 2869 2219 200 1114 ----
NM_001040441chr144283 4074 3346 140 ------
NM_001040446chr51256 12221 12683 --
NM_001040450chr1522556 120 ------
NM_001040453chr1522556 120 ------
NM_001040455chr1131338 1216 250 ------
NM_001040633chr72172 60 ------
NM_001040709chr132540 2307 225 ------
NM_001040712chr933396 538 414 13201 23511 2708 --
NM_001040876chr421437 1406 --1603 --
NM_001042355chr1621476 158 ------
NM_001042361chr101141 ------
NM_001042364chr101141 ------
NM_001042365chr101141 ------
NM_001042387chr101141 ------
NM_001042388chr181349 ------
NM_001042393chr101141 ------
NM_001042396chr101141 ------
NM_001042397chr101141 ------
NM_001042404chr111675 ------
NM_001042406chr6----1918 --
NM_001042412chr1621476 158 ------
NM_001042413chr943990 3609 2790 1058 --1682 --
NM_001042425chr61429 11372 ----
NM_001042453chrX2252 159 ------
NM_001042472chr20149 ------
NM_001042473chr1042106 1763 343 108 --1821 --
NM_001042481chr1452486 2313 1854 808 316 22165 820 --1259
NM_001042492chr1713133 ------
NM_001042494chr1523281 22 ------
NM_001042495chr1523281 22 ------
NM_001042496chr1523281 22 ------
NM_001042497chr1523281 22 ------
NM_001042506chrX31387 578 468 ------
NM_001042510chr821368 79 --11651 --
NM_001042511chr821368 79 --11651 --
NM_001042517chr132158 80 1282 1677 --
NM_001042537chrX32196 2000 482 ------
NM_001042543chr411387 ------
NM_001042555chr1244365 1872 227 64 24730 1762 24389 600 --
NM_001042573chr1712191 --1690 --
NM_001042599chr267768 7271 6160 5137 3104 151 25918 2888 ----
NM_001042603chr12124766 3872 3523 3465 3407 3349 2143 1404 1301 880 732 579 11316 ----
NM_001042669chr451549 1526 645 609 336 ------
NM_001042681chr132244 2207 809 ------
NM_001042682chr132244 2207 809 ------
NM_001042682chr132244 2207 809 ------
NM_001042728chr121352 ------
NM_001042749chrX1281 ------
NM_001042750chrX1281 ------
NM_001042751chrX1281 ------
NM_001043351chr132067 774 116 --1906 --
NM_001044305chr621516 522 ------
NM_001044385chr212675 23690 2999 ----
NM_001044722chr542128 1828 724 674 --1231 --
NM_001044723chr542128 1828 724 674 --1231 --
NM_001046chr523002 2964 --11178 --
NM_001049chr1452293 2193 728 707 281 12031 22224 874 --
NM_001068chr31287 ------
NM_001071775chr1321919 235 ------
NM_001083620chr412550 --11686 --
NM_001094chr173841 802 768 ------
NM_001096chr171332 191 ----
NM_001100108chr178317 6716 5988 5746 2325 1248 1200 27339 2261 --13054
NM_001104548chr1161 --1159 --
NM_001105518chr11801 ------
NM_001106chr387558 6739 6269 3717 3146 2443 337 328 --17033 18145
NM_001113490chrX62965 1003 725 304 294 42 --1630 --
NM_001116chr1662862 2577 2501 2080 1958 372 --175 --
NM_001117chr183736 639 56 ------
NM_001121chr1031823 1710 1361 1454 ----
NM_001122631chr11----1561 --
NM_001122679chr5--1110 ----
NM_001123chr101339 ------
NM_001128chr1613132 13556 33655 2846 1380 --
NM_001143chrY148 ------
NM_001146chr821540 281 ------
NM_001149chr1011041 21068 1010 ----
NM_001153chr2--1183 ----
NM_001160chr122605 403 1484 ----
NM_001167chrX26703 1054 ------
NM_001173chr1443098 1218 384 372 --13067 --
NM_001177chr1222102 227 ------
NM_001186chr2112074 12054 ----
NM_001198chr6--12446 12187 --
NM_001200chr2011078 ------
NM_001201chr453722 3379 1304 1195 876 --1404 --
NM_001204chr257662 7491 7344 7288 1976 32362 135 87 ----
NM_001206chr963078 1049 838 760 515 269 ------
NM_001207chr5171 ------
NM_001219chr721610 181 ------
NM_001222chr1021713 1593 ----1281
NM_001241chr2--1233 ----
NM_001241chr2--1233 ----
NM_001254chr171266 ----174
NM_001256chr1722038 371 32899 639 312 ----
NM_001257chr1631367 1166 427 --11398 --
NM_001259chr776356 5472 4690 2484 2461 1525 1213 1793 11735 --
NM_001262chr11335 ------
NM_001270chr5--11034 ----
NM_001271chr15--13052 ----
NM_001277chr11174 ------
NM_001290chr42924 433 11062 ----
NM_001304chr1733679 2714 1342 12780 ----
NM_001310chr1242994 2449 2043 1948 2327 175 ----
NM_001315chr621634 368 ------
NM_001316chr201401 1143 ----
NM_001319chr192705 433 11036 ----
NM_001326chr112453 80 ------
NM_001331chr1132827 2193 2092 ------
NM_001332chr51396 ----1274
NM_001338chr21----1290 1970
NM_001343chr51166 ------
NM_001358chr41385 ------
NM_001364chr1154691 4464 3808 1583 1085 1353 14193 --
NM_001386chr842133 1909 1729 952 ------
NM_001387chr52726 181 ------
NM_001389chr211171 ------
NM_001391chr182124 45 ------
NM_001394chr82920 802 ------
NM_001396chr2172665 2092 1954 1127 1108 1072 901 ----12451
NM_001399chrX23845 3731 --2663 500 --
NM_001401chr921366 473 ------
NM_001406chr1711595 ------
NM_001407chr32490 223 ------
NM_001408chr121326 1163 --11646 180
NM_001419chr19104093 3206 2960 1474 1143 989 943 840 466 335 1308 33743 3507 430 --
NM_001427chr712050 ------
NM_001429chr221899 ------
NM_001431chr62916 317 --1850 --
NM_001438chr11797 ----12367
NM_001448chrX2700 84 11552 ----
NM_001449chrX1527 ------
NM_001452chr61572 ------
NM_001453chr641300 461 349 334 --1604 --
NM_001457chr3143 1511 ----
NM_001482chr15--176 --1102
NM_001491chr611751 22527 610 ----
NM_001494chr10188 ------
NM_001530chr141435 ------
NM_001542chr142376 2186 839 523 --1983 --
NM_001543chr534799 3051 1072 ----14507
NM_001546chr621240 132 1580 ----
NM_001560chrX31630 877 327 --1185 --
NM_001584chr111147 1322 ----
NM_001604chr111894 ------
NM_001614chr171528 ------
NM_001614chr171528 ------
NM_001616chr233281 2830 1384 33350 2656 1271 ----
NM_001619chr1111032 --11087 --
NM_001621chr732954 460 157 --2521 495 --
NM_001621chr732954 460 157 --2521 495 --
NM_001634chr6160 --189 --
NM_001656chr5--22010 160 ----
NM_001658chr111091 142 ----
NM_001659chr1212536 ------
NM_001660chr32681 181 ------
NM_001663chr1422028 392 ------
NM_001664chr31732 ------
NM_001668chr131785 856 744 ------
NM_001674chr1----1467 --
NM_001675chr22130 ------
NM_001677chr1--2802 123 ----
NM_001679chr32765 142 ------
NM_001681chr12----160 --
NM_001682chr1231788 911 675 --22228 190 --
NM_001683chr332171 1725 56 --11686 --
NM_001684chr121061 793 --12642 --
NM_001690chr31481 ------
NM_001693chr83954 456 372 1162 1245 --
NM_001702chr81388 ------
NM_001704chr6--1459 ----
NM_001706chr3121 ------
NM_001709chr1132651 818 458 2515 309 ----
NM_001718chr611308 ------
NM_001730chr13----1310 --
NM_001730chr13----1310 --
NM_001731chr12156 ------
NM_001735chr93400 145 63 ------
NM_001742chr72604 173 ------
NM_001743chr21506 ------
NM_001744chr5--1170 ----
NM_001754chr2131475 1017 600 ------
NM_001755chr1622255 1831 ------
NM_001759chr1244600 3995 2038 1348 15008 ----
NM_001773chr111286 ------
NM_001774chr19----1270 --
NM_001777chr321469 1247 --11362 --
NM_001788chr71395 ------
NM_001791chr121362 96 ------
NM_001792chr183401 381 109 ------
NM_001797chr16--1768 ----
NM_001802chr161118 ------
NM_001810chr202658 544 1825 ----
NM_001822chr22686 189 ------
NM_001826chr11152 ------
NM_001830chrX63460 3368 2703 1568 833 486 13734 1915 --
NM_001833chr91244 ------
NM_001834chr5165 ------
NM_001838chr171865 ------
NM_001846chr13135 ------
NM_001851chr62642 488 ------
NM_001854chr11942 ------
NM_001855chr9--1574 1896 --
NM_001859chr9--12606 --11324
NM_001876chr112514 374 --2501 346 --
NM_001880chr21208 ------
NM_001892chr521375 361 ------
NM_001903chr52614 180 ------
NM_001913chr71628 ------
NM_001918chr149240 8194 6529 964 26753 2342 ----
NM_001921chr411027 1198 ----
NM_001933chr142513 313 ------
NM_001935chr2----1737 --
NM_001936chr731661 1499 546 ------
NM_001939chrX43850 3263 3247 888 --13825 --
NM_001946chr12178 ------
NM_001949chr632757 1003 225 12654 ----
NM_001955chr621072 210 1870 ----
NM_001964chr51429 ----11165
NM_001967chr3171 ------
NM_001968chr41874 ------
NM_001969chr1442448 1036 1018 799 ------
NM_001977chr41112 ------
NM_001978chr81864 ------
NM_001982chr12----1243 --
NM_001999chr5--11188 1507 --
NM_002006chr455790 4033 3633 1568 1395 24788 269 ----
NM_002009chr1542502 1011 887 497 ------
NM_002011chr5------1428
NM_002015chr1332731 2541 1079 --1322 --
NM_002024chrX31829 681 218 ------
NM_002025chrX68168 7905 6970 6698 1330 1314 1193 29146 9135 29071 264
NM_002026chr21381 1907 ----
NM_002027chr82124 31 ------
NM_002028chr1421285 1242 ------
NM_002037chr6----1316 --
NM_002039chr4----1167 --
NM_002040chr2132417 2214 1968 2421 409 ----
NM_002056chr21710 ------
NM_002063chrX2848 46 ------
NM_002074chr111446 ------
NM_002078chr3121 ------
NM_002082chr511011 ------
NM_002086chr1711982 ------
NM_002087chr171283 --1240 --
NM_002092chr433106 1146 889 34032 3322 1031 11540 --
NM_002126chr1753811 1598 1259 545 167 11664 ----
NM_002128chr1322343 526 ------
NM_002129chr41343 ------
NM_002137chr71434 ------
NM_002138chr42871 196 --1655 --
NM_002139chrX1204 ------
NM_002140chr91349 1469 ----
NM_002141chr7142 ------
NM_002145chr171133 ------
NM_002146chr171170 ------
NM_002156chr22341 281 ------
NM_002158chr233574 3471 1492 --21210 749 --
NM_002165chr202320 295 ------
NM_002166chr2--1659 1679 --
NM_002189chr102612 459 154 ----
NM_002193chr221451 586 ------
NM_002196chr201287 ----1890
NM_002196chr201287 ----1890
NM_002199chr4--1653 ----
NM_002202chr51279 ------
NM_002214chr725359 565 ------
NM_002226chr143683 649 304 --1729 --
NM_002227chr12381 168 ------
NM_002228chr131131 851 242 ------
NM_002233chr11------1435
NM_002235chr1231426 367 352 ------
NM_002240chr212465 89 ------
NM_002241chr122082 1159 12216 1462 --
NM_002247chr1011500 11521 1397 --
NM_002253chr421416 524 ------
NM_002264chr385071 4521 3579 3088 1968 1375 1341 755 14876 21015 643 --
NM_002265chr17----1404 --
NM_002267chr132955 691 ------
NM_002270chr523812 3741 23490 207 11226 --
NM_002271chr1322261 1576 ------
NM_002285chr2156 --11124 --
NM_002310chr555619 5440 4668 4350 2354 --1157 --
NM_002332chr121706 1724 ----
NM_002334chr1121360 97 ------
NM_002336chr1234793 3741 1668 --24896 4523 14985
NM_002355chr123424 130 118 ------
NM_002356chr622376 999 ------
NM_002360chr742633 2508 2397 2251 --12161 --
NM_002374chr232467 1068 979 ------
NM_002383chr161723 ------
NM_002387chr534740 1143 277 --11630 --
NM_002389chr131627 310 29 11546 ----
NM_002395chr61982 11236 ----
NM_002397chr541616 1604 1429 880 ------
NM_002398chr211445 ------
NM_002399chr151930 ------
NM_002402chr711152 ------
NM_002403chr11290 --173 --
NM_002408chr14--198 ----
NM_002430chr222473 417 ------
NM_002436chrX--168 1387 --
NM_002449chr521219 1014 --1356 --
NM_002457chr111127 ------
NM_002467chr81401 ------
NM_002478chr111484 ----198
NM_002480chr12--11096 11033 --
NM_002481chr147811 6704 5417 1669 ----16730
NM_002486chr942537 2306 2186 84 ------
NM_002489chr7--2302 29 ----
NM_002499chr1521809 766 ------
NM_002500chr2146 ------
NM_002501chr1964090 3868 2799 2596 2570 1113 12822 ----
NM_002509chr202689 548 --1679 --
NM_002515chr1412057 ------
NM_002518chr22996 162 ------
NM_002538chr51167 2214 131 ----
NM_002545chr111156 24960 3377 ----
NM_002553chr7----1350 --
NM_002556chr1121633 818 11975 194 --
NM_002568chr8135 1424 ----
NM_002581chr945194 4859 4470 4154 --33905 2015 1470 --
NM_002585chr11395 ------
NM_002588chr511678 --11532 --
NM_002591chr202549 531 ------
NM_002595chr1211523 ------
NM_002600chr111687 ------
NM_002607chr71441 1903 1415 21177 103
NM_002613chr1663697 1604 1302 1025 517 220 ----15350
NM_002648chr61112 --11313 --
NM_002651chr11832 ------
NM_002653chr51175 ------
NM_002655chr833753 478 105 13489 --13380
NM_002656chr61192 1972 ----
NM_002657chr2023323 550 ------
NM_002674chr121158 ------
NM_002687chr142501 358 11122 ----
NM_002693chr15----185 --
NM_002698chr19--11058 ----
NM_002699chr131219 526 89 ------
NM_002703chr411695 21847 300 11666 --
NM_002709chr211105 22598 688 ----
NM_002711chr71729 ------
NM_002713chr1--11024 ----
NM_002715chr51275 ------
NM_002718chr321885 84 ------
NM_002719chr1442261 1664 511 473 1393 11782 --
NM_002731chr132684 1159 389 ------
NM_002734chr1752201 1919 873 284 141 167 ----
NM_002737chr1766646 6598 6382 2043 1223 960 --21971 1427 --
NM_002738chr164923 793 431 304 1879 ----
NM_002745chr2284452 3582 3571 3199 1689 562 292 166 1277 --13342
NM_002748chr151900 ------
NM_002755chr152220 57 ------
NM_002756chr171877 1673 ----
NM_002757chr151358 ------
NM_002758chr171408 ------
NM_002760chrY65761 5459 5201 4780 4429 1730 --14735 --
NM_002763chr11217 ------
NM_002765chrX21345 242 ------
NM_002767chr171429 1541 ----
NM_002821chr61760 ------
NM_002822chr12------1524
NM_002823chr21230 ------
NM_002824chr121500 ------
NM_002839chr933396 538 414 13201 23511 2708 --
NM_002843chr1123397 2610 11003 ----
NM_002844chr631393 1110 446 ------
NM_002845chr181107 ------
NM_002849chr12--1392 ----
NM_002852chr31509 --1230 --
NM_002868chr122770 380 ------
NM_002869chr1152128 791 633 388 43 --11913 1757
NM_002874chr91809 1342 ----
NM_002890chr52820 693 ------
NM_002892chr1421268 461 ------
NM_002893chrX1295 ------
NM_002894chr181151 --1178 --
NM_002897chr22675 492 ----186
NM_002906chr1121806 605 --11741 --
NM_002912chr6145 1634 173 --
NM_002924chr11197 ------
NM_002926chr41348 --11159 --
NM_002931chr6----1303 --
NM_002938chr411985 ------
NM_002940chr421437 1406 --1603 --
NM_002941chr321269 121 --21058 266 --
NM_002942chr311249 ------
NM_002945chr173863 743 711 ------
NM_002951chr201252 ------
NM_002955chr631605 1384 556 ------
NM_002957chr923946 3343 ------
NM_002958chr36948 908 892 658 359 73 1139 ----
NM_002968chr161205 ------
NM_002970chrX165 ------
NM_002971chr3------1838
NM_002979chr13864 690 194 ------
NM_002997chr231437 1191 338 ------
NM_002998chr811400 21626 593 ----
NM_003002chr113822 574 54 ------
NM_003010chr1711492 1544 ----
NM_003016chr1711667 ------
NM_003017chr61256 1574 1903 --
NM_003020chr151171 ------
NM_003022chrX151 11291 ----
NM_003026chr931038 410 61 --1212 --
NM_003028chr933716 3518 1548 --1452 --
NM_003030chr32782 226 ------
NM_003036chr121088 1068 ------
NM_003040chr7----1148 --
NM_003042chr312008 ------
NM_003043chr324280 4236 --11173 --
NM_003046chr845379 3506 1754 1350 15360 ----
NM_003048chr222698 2047 ------
NM_003068chr81380 ------
NM_003069chrX3728 576 297 ------
NM_003070chr91770 --1855 --
NM_003074chr32534 356 ------
NM_003077chr17----1272 --
NM_003079chr172649 343 ------
NM_003081chr202887 59 ------
NM_003099chr1565094 5072 1575 1528 914 331 24754 214 14095 --
NM_003100chr51381 ------
NM_003107chr6----22188 181 --
NM_003108chr257183 7177 5707 5107 4739 --25141 4553 --
NM_003110chr171709 ------
NM_003112chr71958 --11994 --
NM_003114chr82780 173 ------
NM_003128chr232695 1098 340 ------
NM_003131chr632169 2009 70 1688 1787 --
NM_003139chr11133 ----172
NM_003145chr11454 --167 --
NM_003146chr11127 ------
NM_003156chr111365 ------
NM_003161chr1723551 3479 --12643 --
NM_003162chr221089 753 ------
NM_003178chr34893 494 463 188 --21904 487 --
NM_003184chr8------11002
NM_003189chr142263 1022 670 304 ------
NM_003199chr1875559 5384 3672 1324 1205 1030 461 ------
NM_003204chr1711359 --21719 1183 --
NM_003211chr1231507 1412 1307 1538 11425 --
NM_003214chr6------1179
NM_003215chr411103 ------
NM_003217chr123590 540 322 --11758 --
NM_003220chr61429 11372 ----
NM_003221chr663759 3635 3509 2892 1449 394 11465 ----
NM_003246chr1531937 241 121 11740 11988 --
NM_003248chr5127 1105 ----
NM_003250chr172319 182 ------
NM_003253chr2121787 1509 ------
NM_003255chr1722632 2079 1914 11705 --
NM_003257chr1521113 247 ------
NM_003262chr364116 3767 3675 3280 1300 1141 11338 ----
NM_003263chr4147 ------
NM_003275chr921229 387 ------
NM_003284chr2130 ------
NM_003286chr20----1373 --
NM_003292chr1--11407 ----
NM_003304chr311366 ----1274
NM_003311chr111254 ------
NM_003317chr142123 94 ------
NM_003320chr1144066 3670 3438 3112 21741 1163 14454 14430
NM_003336chrX1331 1918 ----
NM_003339chr531623 339 86 11152 ----
NM_003340chr41200 1479 ----
NM_003341chr3------1511
NM_003342chr1763048 2837 2475 1324 567 338 12700 1681 --
NM_003344chr711743 --1420 --
NM_003345chr161450 --1516 --
NM_003348chr1221310 256 11345 ----
NM_003350chr8--1363 ----
NM_003367chr19----1107 --
NM_003368chr11306 ------
NM_003369chr1152315 859 292 206 193 ------
NM_003370chr19160 ------
NM_003373chr101694 --11804 --
NM_003380chr101261 ------
NM_003383chr91155 ------
NM_003404chr2041859 1795 1473 746 ------
NM_003405chr222801 192 ------
NM_003406chr811377 ------
NM_003409chr181134 ------
NM_003410chrX33073 2053 696 ----12198
NM_003411chrY31603 1236 686 ----11751
NM_003412chr31195 12933 1648 --
NM_003413chrX21648 1393 1729 ----
NM_003418chr31222 ------
NM_003430chr191566 ------
NM_003454chr1621431 361 11212 ----
NM_003458chr323809 2517 ------
NM_003463chr662957 2758 2287 2126 873 233 ------
NM_003466chr221736 885 --12525 --
NM_003467chr21356 ------
NM_003468chr283404 1565 1179 1115 687 621 307 210 11468 3481 145 52 --
NM_003471chr3--2905 647 ----
NM_003472chr62960 235 ------
NM_003474chr1041571 751 406 354 --1291 --
NM_003478chr112332 47 ------
NM_003483chr1231906 1808 1149 --11177 --
NM_003487chr17172 ------
NM_003489chr211365 --13118 --
NM_003498chr1641950 867 578 361 --1256 --
NM_003503chr11817 ------
NM_003507chr241770 610 475 441 ------
NM_003558chr91261 ------
NM_003559chr1723888 3370 13905 23128 1073 --
NM_003565chr1211438 ------
NM_003566chr1223454 950 ------
NM_003567chr11282 ------
NM_003571chr31222 1165 ----
NM_003575chr721460 447 ----1460
NM_003576chr131508 1375 12612 --
NM_003581chr2----1662 --
NM_003583chr123789 734 451 22470 190 ----
NM_003590chr243185 1548 1220 1173 --33588 1187 254 --
NM_003591chr101273 ------
NM_003607chr131077 348 255 14177 13148 --
NM_003615chr343098 1287 1135 278 23669 848 1528 1413
NM_003618chr221133 199 ------
NM_003624chr19137 11356 ----
NM_003626chr1121370 1240 ------
NM_003629chr162485 2270 1240 1042 895 422 13153 22911 988 --
NM_003631chr101824 ------
NM_003632chr17--1604 ----
NM_003633chr551638 1591 1012 939 753 --1783 --
NM_003637chr11488 ------
NM_003644chr1786572 6018 4813 4307 2284 1894 1634 252 ------
NM_003651chr123530 417 405 ------
NM_003654chr11163 1776 ----
NM_003663chr353362 3037 2343 988 308 23185 2884 ----
NM_003671chr922671 107 ----1571
NM_003672chr1------11266
NM_003673chr17193 ------
NM_003676chr1--1651 ----
NM_003685chr192733 203 --2996 947 --
NM_003692chr91204 ------
NM_003710chr151444 ------
NM_003716chr32980 738 ------
NM_003718chr71487 ------
NM_003722chr311851 12601 ----
NM_003735chr511678 --11532 --
NM_003736chr511678 --11532 --
NM_003743chr22793 162 --11950 --
NM_003749chr1311837 --1232 --
NM_003750chr102723 74 ------
NM_003758chr151451 ------
NM_003758chr151451 ------
NM_003763chr2022871 1216 --23001 2807 --
NM_003769chr12151 ------
NM_003780chr1------1702
NM_003787chr1831480 225 165 ------
NM_003795chr6--1174 ----
NM_003796chr191424 ------
NM_003797chr111191 ------
NM_003800chr652362 2309 2277 1842 1643 1821 11543 --
NM_003822chr1126 1128 ----
NM_003825chr1541282 554 374 293 ------
NM_003829chr92249 159 ------
NM_003831chr181113 1386 21828 122 --
NM_003861chr1431950 855 346 12422 ----
NM_003862chr51244 ------
NM_003872chr232786 1993 430 --1773 --
NM_003873chr102944 628 ------
NM_003876chr17----1285 --
NM_003884chr31590 11793 21580 548 --
NM_003885chr1712172 ------
NM_003888chr1531604 1261 54 ------
NM_003895chr212769 34 1444 11637 --
NM_003902chr11278 ----1340
NM_003908chr2051101 923 895 419 339 --1229 --
NM_003913chr663261 3229 2649 1075 730 393 23752 972 ----
NM_003916chrX11508 ------
NM_003921chr11331 ----11680
NM_003929chr111759 ----1311
NM_003930chr7145 12238 11870 --
NM_003931chr6295 56 ------
NM_003932chr2221722 1359 1481 1120 --
NM_003934chr91898 ------
NM_003939chr1024049 377 --13712 --
NM_003941chr71132 12215 ----
NM_003947chr3--11027 ----
NM_003951chrX1283 ------
NM_003968chr32673 179 ------
NM_003970chr82355 63 1452 1133 --
NM_003980chr6199 ------
NM_003987chr1022252 1588 ------
NM_003988chr1022329 1665 ------
NM_003989chr1022188 1524 ------
NM_003990chr1022188 1524 ------
NM_003993chr11337 --168 --
NM_003994chr1244002 3770 3496 2844 13427 21745 1271 --
NM_003998chr41476 ------
NM_004006chrX--12657 --1418
NM_004007chrX--12657 --1418
NM_004009chrX--12657 --1418
NM_004010chrX--12657 --1418
NM_004011chrX--12657 --1418
NM_004012chrX--12657 --1418
NM_004013chrX--12657 --1418
NM_004014chrX--12657 --1418
NM_004015chrX--12657 --1418
NM_004016chrX--12571 --1332
NM_004017chrX--12657 --1418
NM_004018chrX--12571 --1332
NM_004020chrX--12657 --1418
NM_004021chrX--12571 --1332
NM_004022chrX--12571 --1332
NM_004023chrX--12571 --1332
NM_004056chr81834 ------
NM_004061chr51243 ------
NM_004067chr731295 997 628 --1591 --
NM_004068chr32401 102 ------
NM_004071chr21220 ------
NM_004078chr1----141 --
NM_004081chrY--157 11608 --
NM_004086chr141553 182 ----
NM_004089chrX11028 ------
NM_004093chr1332518 2074 1102 13183 127 --
NM_004094chr1421058 46 ----12788
NM_004096chr1032070 1658 545 ------
NM_004099chr91366 --11921 --
NM_004105chr22420 321 11055 ----
NM_004112chr17--11424 ----
NM_004116chr22483 83 ------
NM_004124chr1443569 3301 3041 2900 ------
NM_004130chr32606 207 ------
NM_004133chr82664 367 2544 334 ----
NM_004156chr81569 ------
NM_004157chr32745 358 ------
NM_004161chr221042 258 ------
NM_004170chr91324 --11501 --
NM_004171chr1157390 6138 1835 1660 891 1199 11101 --
NM_004175chr222216 69 ------
NM_004177chr1131555 1541 706 ------
NM_004183chr111640 ------
NM_004187chrX1586 11251 ----
NM_004200chr1143269 1034 429 230 ------
NM_004202chrY149 ------
NM_004225chr81127 --1139 --
NM_004229chrX31980 1368 447 ------
NM_004232chr1843319 3219 2688 667 13273 12674 --
NM_004236chr15----1132 --
NM_004237chr51826 --126 --
NM_004238chr21275 ------
NM_004239chr142153 120 ------
NM_004241chr101734 ------
NM_004242chr61161 --1345 --
NM_004253chr92955 324 ------
NM_004268chr112971 936 11178 2286 177 --
NM_004272chr51378 ------
NM_004274chr142904 783 ------
NM_004279chr71354 ------
NM_004281chr101170 ----144
NM_004293chr933847 682 662 1852 1617 --
NM_004295chr1741275 985 973 168 ------
NM_004297chr9172 ------
NM_004301chr34347 314 265 251 ------
NM_004302chr123709 535 331 --1473 --
NM_004311chr1052931 2767 2511 2127 72 ------
NM_004319chr132988 2872 260 ------
NM_004326chr12129 63 --1289 --
NM_004329chr10----1342 11010
NM_004330chr151947 1228 ----
NM_004338chr1866860 6622 5885 1269 442 279 15446 25126 4946 --
NM_004342chr721932 737 ------
NM_004349chr811236 1346 ----
NM_004359chr193498 165 120 ------
NM_004360chr1621541 428 ------
NM_004369chr21114 ------
NM_004370chr632127 760 79 ------
NM_004379chr21245 11274 2577 155 --
NM_004383chr151527 ------
NM_004384chr542128 1828 724 674 --1231 --
NM_004385chr51460 ------
NM_004392chr1312340 12111 ----
NM_004393chr31558 --1371 --
NM_004397chr1163244 2662 1592 540 419 56 11731 13238 --
NM_004411chr72319 172 ------
NM_004414chr2141397 1338 603 479 --11519 --
NM_004416chr122804 32 ------
NM_004422chr17169 ------
NM_004424chr16--1148 ----
NM_004428chr11798 ------
NM_004429chrX31458 378 176 ------
NM_004430chr831099 807 266 --11840 --
NM_004432chr942249 2097 1898 1808 ------
NM_004433chr131708 1602 440 ------
NM_004440chr611380 ------
NM_004442chr1--11748 11062 --
NM_004444chr72815 575 ------
NM_004447chr12154 ------
NM_004449chr2111132 ------
NM_004454chr322311 1606 --11596 --
NM_004458chrX1683 22257 1064 11625 --
NM_004459chr172418 123 ------
NM_004464chr41982 21622 244 ----
NM_004469chrX151 ------
NM_004475chr17--160 ----
NM_004491chr1963442 3356 2928 1704 1089 920 ------
NM_004492chr15149 ------
NM_004496chr1431160 1075 862 11217 1403 --
NM_004498chr151279 ------
NM_004499chr5140 ------
NM_004501chr164042 1642 1619 1417 875 314 --23817 1146 --
NM_004505chr172562 284 ------
NM_004506chr62140 95 ------
NM_004516chr1941074 785 320 92 ------
NM_004519chr81188 ------
NM_004575chr421626 1214 ------
NM_004576chr51270 ------
NM_004578chr1----1869 --
NM_004586chrX53856 3603 2142 497 149 23701 166 --14222
NM_004588chr1144002 3341 355 89 --13863 --
NM_004591chr22172 103 ------
NM_004593chr32806 583 --1189 --
NM_004595chrX1430 ------
NM_004598chr553240 2557 2025 1168 418 ------
NM_004600chr141433 365 357 280 ------
NM_004602chr2031174 557 65 ------
NM_004612chr922967 844 13853 ----
NM_004616chr12153 ------
NM_004622chr22909 703 ----1111
NM_004626chr111471 --1138 --
NM_004631chr121447 428 ------
NM_004634chr31496 ------
NM_004639chr6196 ------
NM_004642chr123632 510 111 ------
NM_004643chr141184 ------
NM_004654chrY2938 376 ------
NM_004655chr1721126 526 1422 1855 --
NM_004661chr521082 270 ------
NM_004663chr1511241 ------
NM_004664chr12160 ------
NM_004671chr18145 ------
NM_004694chr172784 158 ------
NM_004703chr1742127 847 553 291 1394 ----
NM_004709chrX31427 484 44 ------
NM_004713chr141758 ------
NM_004719chr1211947 22443 2420 12677 --
NM_004726chrX75056 4792 3614 1781 767 620 407 14311 ----
NM_004729chrX62062 1848 1535 1515 1485 54 ------
NM_004730chr521738 728 ------
NM_004733chr31610 ------
NM_004734chr1362685 2302 2154 1149 1054 905 --12703 --
NM_004736chr132028 1965 1955 1844 ----
NM_004737chr222342 97 ------
NM_004739chr111602 ------
NM_004742chr31206 ------
NM_004744chr421331 149 1859 ----
NM_004745chr876503 5766 5441 5250 4558 198 39 16655 15577 --
NM_004747chr102479 418 ----1221
NM_004748chr1554208 3328 3086 2717 1668 1987 --21350 76
NM_004757chr41538 ------
NM_004760chr722025 881 1545 12049 --
NM_004766chr3----180 --
NM_004768chr11928 ------
NM_004772chr511356 1130 ----
NM_004776chr2012463 33199 2271 25 --1443
NM_004785chr161365 ------
NM_004788chr111390 --1867 --
NM_004796chr1442379 2202 776 148 11640 ----
NM_004798chr2023105 987 --12571 --
NM_004822chr172961 300 13133 ----
NM_004824chr611072 ------
NM_004840chrX1185 --1910 12473
NM_004845chrX42800 796 468 314 21171 590 ----
NM_004857chr1434560 3263 1020 --1280 --
NM_004859chr1731952 1911 526 --1693 --
NM_004863chr1445066 3984 942 234 ------
NM_004866chr524729 468 --13341 11795
NM_004867chrX--1123 ----
NM_004871chr1744306 385 247 37 --23579 1617 --
NM_004874chr81427 ------
NM_004883chr5----1197 --
NM_004893chr5------1374
NM_004896chr101339 --1204 --
NM_004898chr432735 2672 1962 1924 ----
NM_004902chr20----1287 --
NM_004904chr744652 2551 811 221 --34502 2112 229 --
NM_004906chr62201 110 ------
NM_004912chr711182 ------
NM_004926chr1431862 1770 1202 ------
NM_004930chr1167 --1603 --
NM_004937chr171342 ------
NM_004947chr332353 521 273 ------
NM_004949chr1832090 2084 624 1586 ----
NM_004952chr1----1936 --
NM_004955chr61117 ------
NM_004956chr733438 2811 1511 1588 236 28 --
NM_004958chr1130 ------
NM_004961chrX----1409 --
NM_004969chr101442 ------
NM_004973chr62543 478 ------
NM_004976chr1145098 3608 2021 1583 15167 ----
NM_004981chr221390 ------
NM_004985chr1223200 1185 21789 1405 14320 --
NM_004991chr3------151
NM_004992chrX98347 6201 5782 5417 5404 5372 1850 1121 397 18323 17495 --
NM_004992chrX98347 6201 5782 5417 5404 5372 1850 1121 397 18323 17495 --
NM_004998chr153916 889 645 ------
NM_005011chr72653 27 ------
NM_005020chr71592 ------
NM_005028chr1022079 2058 1164 ----
NM_005032chrX31004 396 76 ------
NM_005033chr4------1143
NM_005044chrX84317 4014 3720 3299 3160 2948 1497 634 --23254 1112 --
NM_005054chr2--1587 ----
NM_005056chr12125010 4116 3767 3709 3651 3593 1648 1545 1124 976 823 28 11560 ----
NM_005057chr141268 1198 606 542 1766 11179 --
NM_005063chr1033500 3125 2906 ------
NM_005065chr1433996 1510 1444 11756 12052 --
NM_005066chr11311 ------
NM_005068chr611432 ------
NM_005069chr2121705 646 11228 ----
NM_005079chr8--1312 23200 102 --
NM_005080chr221201 --1941 --
NM_005087chr3154 ------
NM_005093chr2024316 49 14207 15245 --
NM_005095chr112088 ------
NM_005097chr101249 ------
NM_005104chr61619 ------
NM_005110chr5----1157 --
NM_005112chr41755 ----1998
NM_005113chr141395 ------
NM_005117chr11169 ------
NM_005119chr121204 1086 ------
NM_005121chr1723687 598 1537 --13643
NM_005124chr6151 ------
NM_005134chr181349 ------
NM_005135chr1523281 22 ------
NM_005154chr151496 --1534 --
NM_005156chr943611 1441 1236 1068 ------
NM_005159chr1542195 874 238 134 21966 152 ----
NM_005168chr271580 1558 1394 1388 1353 320 123 --11613 --
NM_005171chr1221229 1149 ----1816
NM_005180chr1061547 1489 1342 1190 653 111 --1417 --
NM_005197chr1435374 4047 1481 15047 ----
NM_005206chr17----11164 --
NM_005207chr2233379 417 28 ------
NM_005208chr17195 ------
NM_005217chr8138 ------
NM_005220chr1721462 150 ------
NM_005222chr71837 ------
NM_005229chrX----1452 --
NM_005231chr112175 148 11293 ----
NM_005233chr32983 219 ------
NM_005235chr267768 7271 6160 5137 3104 151 25918 2888 ----
NM_005238chr1122734 2727 --23373 2957 --
NM_005241chr321325 430 ------
NM_005244chr20----2666 492 --
NM_005245chr4183 ------
NM_005249chr141256 134 ----
NM_005252chr14--1632 ----
NM_005254chr1511013 21257 1234 ----
NM_005256chr111838 1359 ----
NM_005259chr2--1331 ----
NM_005269chr121148 ------
NM_005275chr62105 43 ------
NM_005277chr431922 610 96 --21900 1835 --
NM_005278chrX--1414 ----
NM_005279chr2161 ------
NM_005302chr71295 --1163 --
NM_005311chr752703 2452 2070 928 458 --12757 --
NM_005316chr113417 350 329 --1839 --
NM_005324chr1731754 1698 1584 --125 --
NM_005328chr8--1304 ----
NM_005329chr1642313 1660 1444 643 --21715 1504 1569
NM_005334chrX21751 237 ------
NM_005339chr422855 1426 1996 14008 --
NM_005340chr52253 180 ------
NM_005359chr1886422 5743 5099 4550 4171 2572 2541 1269 24091 101 ----
NM_005376chr121121 145 ------
NM_005378chr21341 ------
NM_005385chr332571 755 748 ------
NM_005386chr201730 ------
NM_005399chr164292 3778 3273 1699 146 98 12814 24257 3793 --
NM_005400chr242255 1105 595 476 22952 2835 ----
NM_005402chr711733 1534 ----
NM_005406chr181146 1617 ----
NM_005407chr141167 ------
NM_005415chr21154 ------
NM_005433chr1822718 525 12691 ----
NM_005435chr71177 --1171 --
NM_005436chr1023135 2805 --13182 11591
NM_005447chr12128 ------
NM_005455chr141544 1284 1142 231 --11668 --
NM_005461chr2051762 1483 1470 1235 388 ------
NM_005474chr1721535 1386 ------
NM_005479chr1031509 1386 1329 1410 ----
NM_005487chr2221895 180 --11481 --
NM_005488chr22193 ------
NM_005493chr61794 1124 ----
NM_005494chr71246 1615 ----
NM_005497chr1753916 3889 1964 1312 740 --127 --
NM_005502chr932724 2557 633 ------
NM_005509chr531166 342 101 --1728 --
NM_005520chr51486 ------
NM_005521chr101831 ------
NM_005523chr71482 ------
NM_005524chr31261 ------
NM_005530chr151203 ------
NM_005536chr8134 ------
NM_005537chr131780 ------
NM_005539chr1021001 556 ------
NM_005542chr721448 398 ------
NM_005544chr21995 ------
NM_005552chr141530 ------
NM_005563chr11634 ------
NM_005570chr18152 ------
NM_005578chr344772 3256 1862 427 24042 494 1392 --
NM_005595chr11945 ------
NM_005596chr965857 5297 4774 4208 1939 1047 --21879 1330 --
NM_005597chr192664 81 ------
NM_005604chr632500 630 610 31864 854 636 ----
NM_005607chr81732 --1246 --
NM_005610chr13939 919 810 ------
NM_005613chr122162 437 ----194
NM_005614chr711104 --11005 --
NM_005626chr11147 ------
NM_005632chr16----11111 --
NM_005638chrX31746 1507 441 ------
NM_005639chr1231478 1375 333 ------
NM_005644chr11415 198 ----
NM_005647chrX53139 3125 2708 819 696 ----1924
NM_005650chr2211098 ------
NM_005655chr8----11023 1947
NM_005668chr512916 11424 --14188
NM_005669chr522134 218 ------
NM_005686chr12446 353 ----11497
NM_005688chr31935 ------
NM_005704chr1----21112 939 --
NM_005707chr1521225 137 ------
NM_005708chr131109 ------
NM_005715chr612753 11018 ----
NM_005717chr141267 1171 1101 123 ------
NM_005718chr32277 145 ------
NM_005720chr72200 77 ------
NM_005721chr2----1961 --
NM_005722chr23991 243 37 --1473 --
NM_005725chr122390 639 2798 240 ----
NM_005730chr1283455 3025 2306 2229 1297 1235 1147 967 11324 ----
NM_005731chr23300 166 114 ------
NM_005734chr111804 ------
NM_005736chr1021518 57 ------
NM_005737chr222050 763 12424 1723 --
NM_005738chr73544 340 181 ------
NM_005739chr1521648 918 ------
NM_005746chr7--1345 ----
NM_005748chr1243378 3104 2911 1252 1570 ----
NM_005749chr171548 ------
NM_005751chr7----174 --
NM_005765chrX1668 ----177
NM_005768chr121199 ------
NM_005775chr81256 ------
NM_005776chr14--1619 ----
NM_005779chr523206 2602 --1818 --
NM_005786chr181986 ------
NM_005795chr2135 --12238 --
NM_005808chr323228 231 12401 ----
NM_005819chr133002 2182 594 11164 1834 --
NM_005822chr621686 48 11543 1856 --
NM_005826chr11241 ------
NM_005828chr1784544 3763 3633 1933 1840 1121 1022 112 11728 ----
NM_005840chrX66894 2469 2312 2169 1611 554 24727 2825 --11035
NM_005841chr4----1954 --
NM_005842chr131142 1161 ----
NM_005857chr111389 1285 ----
NM_005859chr5----11508 --
NM_005862chr3--1415 ----
NM_005871chr101351 ------
NM_005880chr161288 ------
NM_005882chr42891 97 ------
NM_005895chr1244146 3176 2781 579 --14007 --
NM_005898chr1122823 625 ------
NM_005899chr172578 308 11431 ----
NM_005901chr1868203 6638 3425 2976 2748 1047 46465 6441 3142 2100 18623 --
NM_005902chr1533313 3244 1529 11584 ----
NM_005903chr555079 2059 998 796 276 --15176 --
NM_005904chr182112 83 21378 1306 11200 --
NM_005907chr621659 277 1377 ----
NM_005909chr544007 3670 3581 3281 12640 14227 --
NM_005910chr1723617 143 --13749 --
NM_005911chr221087 281 --11048 --
NM_005917chr21132 ------
NM_005920chr143789 2393 199 113 ------
NM_005924chr73429 276 218 ------
NM_005927chr521157 837 ------
NM_005928chr152637 33 ------
NM_005933chr1122476 755 ------
NM_005935chr434808 4511 4235 13571 23821 937 --
NM_005938chrX--1104 ----
NM_005941chr822691 564 2717 454 ----
NM_005944chr331098 1080 936 ------
NM_005955chr121876 559 --13782 --
NM_005964chr1721308 1212 ------
NM_005967chr122469 462 ------
NM_005969chr113986 954 188 ------
NM_005981chr12186 ------
NM_005985chr202770 315 ------
NM_005986chr1342774 2503 2007 1782 --1294 --
NM_006007chr911354 24169 1027 ----
NM_006009chr122149 28 ------
NM_006022chr131361 ------
NM_006024chr7198 1216 ----
NM_006033chr1842242 1755 1733 405 ------
NM_006036chr232546 355 126 ------
NM_006037chr241314 1078 502 417 1897 ----
NM_006042chr17----1465 --
NM_006051chr5--161 ----
NM_006068chr41278 ------
NM_006079chr61201 ------
NM_006106chr1143139 2770 2703 1001 --22579 1030 --
NM_006135chr141304 1297 506 420 ------
NM_006139chr232727 2672 685 ------
NM_006141chr1632761 2365 717 1860 ----
NM_006148chr1712290 ------
NM_006154chr15----22039 1801 --
NM_006156chr141213 ------
NM_006158chr831777 1578 1421 ------
NM_006160chr173622 391 252 --1541 --
NM_006166chr1211608 ------
NM_006178chr1721231 224 ------
NM_006186chr211032 ------
NM_006195chr911444 --178 --
NM_006197chr822253 114 ------
NM_006201chrX1436 ------
NM_006203chr524973 1134 24117 1285 1223 --
NM_006206chr422013 289 --12266 --
NM_006207chr81303 --182 --
NM_006212chr145073 4495 598 482 14789 ----
NM_006226chr211259 ------
NM_006237chr1321906 1621 1502 12266 --
NM_006241chr322258 814 1303 ----
NM_006243chr1148 --1378 --
NM_006245chr61745 ----1967
NM_006246chr1411266 ------
NM_006251chr532976 2949 2102 --1113 --
NM_006252chr144768 4619 1244 351 16436 27343 1205 --
NM_006258chr101286 ------
NM_006265chr8143 1533 ----
NM_006275chr20------12513
NM_006282chr2032881 1602 962 --2877 232 --
NM_006283chr863654 3214 1693 818 732 149 14319 ----
NM_006287chr252602 1716 514 161 89 1898 ----
NM_006289chr91357 ------
NM_006300chr191617 ----1195
NM_006301chr121606 ------
NM_006306chrX35847 1413 603 15936 ----
NM_006312chr12----1757 --
NM_006313chr1231591 1333 1218 11540 ----
NM_006315chr473852 3074 2942 2809 322 244 65 --11056 --
NM_006320chr41955 ------
NM_006321chr31499 1895 ----
NM_006325chr121116 ------
NM_006330chr8--11106 ----
NM_006335chr11263 ------
NM_006338chr12164 110 ------
NM_006345chr4--1951 ----
NM_006350chr5--173 ----
NM_006352chr151919 1629 1576 460 283 ------
NM_006357chr21120 ------
NM_006359chrX32196 2000 482 ------
NM_006363chr201574 --1232 --
NM_006371chr333686 3522 751 --14235 --
NM_006379chr71352 ----185
NM_006380chr1733308 2995 521 24050 3381 --13737
NM_006386chr22--12155 21760 513 1450
NM_006390chr1241485 1373 1296 92 ------
NM_006391chr11129 ------
NM_006393chr1064164 3317 2870 1734 1251 424 ------
NM_006400chr121275 ------
NM_006401chr91402 ------
NM_006403chr6----21547 259 --
NM_006407chr3----182 --
NM_006420chr2053459 2567 958 327 293 12505 ----
NM_006421chr81288 ------
NM_006439chr42383 211 ------
NM_006451chr5--2810 708 ----
NM_006457chr424052 1624 --12764 --
NM_006459chr10----11747 --
NM_006460chr1731593 617 209 --1169 --
NM_006469chr1------1562
NM_006482chr123789 734 451 22470 190 ----
NM_006489chr1412057 ------
NM_006496chr1------11270
NM_006504chr101168 ------
NM_006516chr121608 1275 ------
NM_006517chrX2667 193 --12195 --
NM_006521chrX----11419 --
NM_006526chr20145 --11560 --
NM_006529chr411378 ------
NM_006534chr2043409 2680 1230 882 --12198 --
NM_006537chr15--1216 ----
NM_006540chr821055 396 ------
NM_006544chr1476049 2360 1821 1358 1029 667 204 ------
NM_006546chr1766544 5945 5117 4758 2386 534 12230 ----
NM_006549chr1251964 1123 288 276 65 ------
NM_006554chr22142 101 ------
NM_006559chr11249 181 ----
NM_006560chr112479 211 ------
NM_006561chr1055470 5206 3794 1790 790 ------
NM_006565chr1641117 434 428 267 ------
NM_006570chr9186 ------
NM_006574chr32308 135 ------
NM_006587chr41460 ------
NM_006595chr1132048 626 263 ------
NM_006599chr1656942 5727 5668 2651 1817 16020 --11198
NM_006602chr201622 1563 ----
NM_006603chrX1281 ------
NM_006609chr232879 2398 2003 12591 12382 --
NM_006614chr342235 1102 837 621 --13286 --
NM_006618chr111386 ----1632
NM_006621chr111659 ------
NM_006624chr101757 ------
NM_006625chr11463 ------
NM_006625chr11463 ------
NM_006625chr11463 ------
NM_006628chr1564590 4105 1840 1167 600 502 --11274 --
NM_006644chr131488 ------
NM_006650chr532429 1317 907 ------
NM_006653chr61101 ------
NM_006654chr1244365 1872 227 64 24730 1762 24389 600 --
NM_006660chr15--1266 ----
NM_006667chrX----11181 --
NM_006682chr711958 11013 ----
NM_006695chr171305 ------
NM_006698chr2031222 1212 547 --1179 --
NM_006699chr1----1233 --
NM_006704chr132425 412 ----1131
NM_006706chr51171 --1547 --
NM_006717chr921015 75 12771 --1549
NM_006718chr61192 1972 ----
NM_006721chr101339 ------
NM_006722chr31840 1123 ----
NM_006729chrX45488 3432 2118 597 ------
NM_006734chr62537 324 ------
NM_006736chr22575 99 ------
NM_006738chr1562814 1511 1444 1418 1291 1285 --23658 3410 --
NM_006749chr8----11044 --
NM_006750chr1667777 7735 2722 1262 726 393 18124 ----
NM_006754chr741225 887 844 136 ------
NM_006763chr15763 749 645 588 234 11770 ----
NM_006766chr812502 ------
NM_006772chr611254 ------
NM_006775chr612171 ------
NM_006788chr1822123 330 12133 ----
NM_006790chr52376 353 ------
NM_006791chr151439 1564 2419 83 --
NM_006802chr12259 57 ------
NM_006805chr52575 283 1503 1433 --
NM_006807chr17------1155
NM_006811chr202665 105 --1635 --
NM_006815chr12--1555 11121 --
NM_006823chr811304 ------
NM_006827chr1412971 --23195 3077 --
NM_006838chr1241277 387 341 277 ------
NM_006851chr1222793 923 ------
NM_006852chr1742572 1045 352 132 --1118 --
NM_006854chr721891 755 ------
NM_006861chr1222108 1820 ------
NM_006884chr32782 226 ------
NM_006885chr1643429 3393 3109 1693 21541 657 ----
NM_006888chr141910 23497 2650 ----
NM_006895chr231459 738 418 --1460 --
NM_006897chr121606 ------
NM_006901chr15167 ------
NM_006908chr721290 52 --31099 1065 963 --
NM_006915chrX--1977 ----
NM_006918chr1145427 4315 4307 378 14783 23847 1451 --
NM_006920chr231764 1689 1606 --1676 --
NM_006922chr232096 855 763 1819 ----
NM_006924chr1764105 4099 758 626 396 346 14060 11677 --
NM_006925chr14----198 --
NM_006931chr1211592 11325 --12012
NM_006939chr14----21161 323 --
NM_006943chr2023324 1181 ------
NM_006950chrX1787 --1309 --
NM_006951chr101724 --1241 --
NM_006981chr932879 1199 374 --11942 --
NM_006990chr11158 --21995 981 --
NM_006996chr121563 677 --11297 --
NM_007005chr921426 1053 11215 ----
NM_007007chr1221736 686 --23398 561 --
NM_007008chr21606 ------
NM_007011chr1596352 5338 4439 1843 944 586 337 279 190 1794 ----
NM_007013chr81813 1360 ----
NM_007017chr51654 ------
NM_007033chr131651 590 172 2844 462 1811 --
NM_007038chr2176091 5723 5563 4849 2315 1853 1786 14050 ----
NM_007039chr1462094 2080 2046 898 63 41 --1937 --
NM_007040chr1921072 771 ------
NM_007050chr2047252 1794 700 306 12497 ----
NM_007064chr321259 1064 ------
NM_007067chr1721097 364 1524 ----
NM_007073chr624190 4033 23738 97 23698 3321 --
NM_007084chr131283 --1312 --
NM_007096chr91244 ------
NM_007097chr5165 ------
NM_007111chr132779 220 --1653 --
NM_007114chr312226 ------
NM_007118chr53561 318 151 ------
NM_007121chr191354 ------
NM_007124chr6--11643 ----
NM_007125chrY--1463 ----
NM_007126chr92464 66 ------
NM_007129chr13----1763 --
NM_007137chrX35057 1734 1606 ------
NM_007146chr1722763 2633 1888 ----
NM_007149chr61392 ------
NM_007158chr111187 1460 ----
NM_007159chr311448 1142 ----
NM_007166chr11----11170 --
NM_007174chr1252028 1545 826 778 626 --11740 11808
NM_007185chr12817 327 ------
NM_007189chr71363 --11030 --
NM_007191chr12--2714 23 1217 --
NM_007192chr14191 ------
NM_007195chr1843125 2800 2792 2782 ------
NM_007200chr1562814 1511 1444 1418 1291 1285 --23658 3410 --
NM_007203chr963931 3080 2636 2498 512 34 ------
NM_007212chr111815 --1773 --
NM_007214chr611128 1942 ----
NM_007222chr831332 708 97 --11148 --
NM_007231chrX22296 187 ------
NM_007236chr1522137 482 ------
NM_007245chr161325 ------
NM_007246chr41276 ------
NM_007269chr11194 --1226 --
NM_007271chr641444 670 228 56 ------
NM_007275chr331114 390 324 ------
NM_007294chr1731331 1131 458 ------
NM_007295chr1731331 1131 458 ------
NM_007296chr1731331 1131 458 ------
NM_007297chr1731331 1131 458 ------
NM_007298chr1731331 1131 458 ------
NM_007299chr1731331 1131 458 ------
NM_007300chr1731331 1131 458 ------
NM_007302chr1731331 1131 458 ------
NM_007303chr1731331 1131 458 ------
NM_007304chr1731331 1131 458 ------
NM_007305chr1731331 1131 458 ------
NM_007308chr41179 ------
NM_007315chr2--1457 11419 --
NM_007345chr1852354 2152 1759 1586 47 180 ----
NM_007349chr72108 77 ------
NM_007353chr752365 2132 1199 953 280 ------
NM_007358chr1--22001 1482 ----
NM_007373chr1021590 1345 --11328 --
NM_007375chr121837 628 ------
NM_012074chr142918 122 ------
NM_012090chr11977 1336 ----
NM_012096chr333499 2365 378 ------
NM_012097chr221930 181 ------
NM_012102chr132244 2207 809 ------
NM_012104chr11--22521 481 --11312
NM_012104chr11--22521 481 --11312
NM_012115chr62583 390 ------
NM_012117chr121113 ------
NM_012118chr42456 386 ------
NM_012120chr612745 ------
NM_012124chr11--1919 ----
NM_012141chr131610 13905 ----
NM_012142chr15165 ------
NM_012153chr112789 322 12197 ----
NM_012154chr81138 ------
NM_012156chr20----1932 --
NM_012158chr1321853 1506 ------
NM_012161chr41930 21080 266 11074 --
NM_012164chr947440 7104 6064 5392 17360 16238 17000
NM_012175chr111177 ----1667
NM_012180chr41219 ------
NM_012193chr1165340 4983 3562 1660 1335 22 ------
NM_012199chr154548 4050 3278 2854 2828 ------
NM_012207chr10----1992 --
NM_012215chr1041846 1765 541 335 ------
NM_012218chr1932442 2339 356 1398 ----
NM_012233chr21942 ------
NM_012234chr323471 541 23716 2516 ----
NM_012238chr10--11362 ----
NM_012247chr101977 --1308 --
NM_012249chr222488 422 --1609 --
NM_012250chr112932 271 ------
NM_012252chr733445 1213 85 14622 ----
NM_012255chr201166 ------
NM_012257chr72916 167 ------
NM_012262chr164940 4687 4681 3707 3337 3225 ----1912
NM_012286chrX1426 ------
NM_012287chr344290 3255 2929 1230 33543 1481 83 13798 --
NM_012288chr6115645 5604 4919 4252 3548 1959 1145 889 341 154 148 13680 ----
NM_012290chr221314 628 ------
NM_012294chr754073 3904 1529 708 74 ------
NM_012295chr221411 ------
NM_012300chr552415 1780 829 737 369 ------
NM_012301chr721744 159 11977 --173
NM_012302chr121173 823 ------
NM_012307chr181695 ------
NM_012309chr112399 295 24595 3982 24455 3313 --
NM_012316chr135439 1913 1604 --14287 --
NM_012319chr183944 297 92 1165 ----
NM_012325chr2031270 468 53 ------
NM_012326chr2----1102 --
NM_012328chr7----2908 247 --
NM_012329chr1711240 ------
NM_012330chr1021780 1497 ------
NM_012333chr12610 442 11266 ----
NM_012342chr101198 ------
NM_012347chr633018 2886 2710 ------
NM_012383chr9141 1329 ----
NM_012388chr1563164 2368 2035 1931 1018 958 --12700 --
NM_012399chr2221526 141 ------
NM_012402chr112970 541 --1898 --
NM_012405chr143597 2533 826 541 2469 102 ----
NM_012414chr12711 565 ------
NM_012416chr91213 ------
NM_012417chr17190 ------
NM_012421chr1----1401 --
NM_012424chr11772 ------
NM_012428chr152679 238 ------
NM_012433chr2156 ------
NM_012434chr631513 1196 553 ------
NM_012446chr5--1473 ----
NM_012448chr173966 521 495 ------
NM_012453chr7----1217 --
NM_012454chr6--1391 ----
NM_012460chr14--151 ----
NM_012479chr752049 1837 1047 983 401 --22594 1967 --
NM_013229chr122605 403 1484 ----
NM_013231chr1432746 1579 224 ------
NM_013233chr2--1203 ----
NM_013243chr1531001 502 268 ------
NM_013253chr1141289 396 265 198 ----168
NM_013261chr431350 342 264 ----13190
NM_013262chr621033 925 1493 ----
NM_013263chr16164 ------
NM_013266chr10--159 ----
NM_013279chr1122367 2068 ------
NM_013281chr2011441 ------
NM_013293chr72278 257 ------
NM_013304chr161241 ------
NM_013309chr1522661 444 ----12274
NM_013322chr721193 510 ------
NM_013336chr31173 ------
NM_013354chr8----11009 --
NM_013365chr223846 528 122 ------
NM_013372chr1532588 941 455 1250 ----
NM_013373chr221933 1720 ----
NM_013377chr121493 --187 --
NM_013382chr1442231 1845 1794 732 ------
NM_013390chr91138 ------
NM_013396chr212292 259 ------
NM_013400chr71990 1664 ----
NM_013423chrX----1505 --
NM_013427chrX----1505 --
NM_013433chr1921780 1352 ------
NM_013437chr821013 387 --1471 --
NM_013438chr91305 31698 1252 73 ----
NM_013444chrX1288 --1971 --
NM_013446chr721340 365 ------
NM_013449chr1262650 2253 2103 1985 1853 1062 ------
NM_013450chr21465 1497 ----
NM_013943chr12599 52 12348 ----
NM_013951chr221736 885 --12525 --
NM_013952chr221813 962 --12602 --
NM_013953chr221813 962 --12602 --
NM_013958chr8125 ------
NM_013959chr8125 ------
NM_013961chr8125 ------
NM_013962chr8125 ------
NM_013981chr5----1197 --
NM_013982chr5----1197 --
NM_013983chr5----1197 --
NM_013989chr1465112 5055 5029 4056 3386 318 ------
NM_013992chr221813 962 --12602 --
NM_013995chrX22082 580 ----1775
NM_014000chr101694 --11804 --
NM_014007chr91787 ----1924
NM_014011chr232324 714 39 ----1697
NM_014016chr331610 1223 74 ------
NM_014021chr113029 --12341 --
NM_014023chr1032879 863 629 --1116 --
NM_014028chr623155 1236 1704 ----
NM_014041chr3255 26 ------
NM_014043chr31591 ------
NM_014048chr1621629 580 14635 ----
NM_014059chr13----1290 --
NM_014080chr152482 425 ------
NM_014089chr1332280 1378 904 ------
NM_014110chr1--11024 ----
NM_014112chr832041 1912 845 15386 ----
NM_014117chr1642260 2193 1807 351 ------
NM_014141chr755021 3806 976 352 245 23545 990 ----
NM_014154chr3----1167 --
NM_014155chr1187552 7273 5895 5742 4728 999 319 210 37576 6692 5636 ----
NM_014181chr22820 777 1673 1738 --
NM_014212chr121833 ------
NM_014225chr191382 ------
NM_014234chr61141 ------
NM_014240chr323216 1111 --31347 567 201 --
NM_014241chr10----125 --
NM_014243chr421411 161 ------
NM_014250chr2221895 180 --11481 --
NM_014253chrX32265 1703 453 12304 ----
NM_014263chr1031272 126 81 ------
NM_014267chr111139 ------
NM_014268chr181152 --1433 --
NM_014271chrX1812 ------
NM_014282chr931127 930 105 --11221 --
NM_014283chr121007 476 11331 ----
NM_014292chr22----1102 --
NM_014294chr8145 ----2986 539
NM_014309chr2274648 2183 2177 2171 584 555 296 23937 3326 --14567
NM_014319chr1221436 83 --11505 --
NM_014325chr123810 391 50 ------
NM_014329chr161341 ------
NM_014332chrX------1361
NM_014333chr1121109 490 ------
NM_014342chr11----192 --
NM_014345chr61764 --1326 --
NM_014350chr51958 ------
NM_014352chr1111406 ------
NM_014361chr11123 134 ----
NM_014372chr111820 ------
NM_014374chr71990 1664 ----
NM_014376chr521902 730 --1247 --
NM_014382chr321766 1705 1665 ----
NM_014392chr421318 139 ------
NM_014393chr811864 2548 114 ----
NM_014397chr91461 1546 ----
NM_014405chr1721466 462 --1601 --
NM_014410chr181357 ------
NM_014415chr32507 227 2577 519 ----
NM_014423chr565597 5488 4976 1635 1595 210 --11082 --
NM_014426chr20--1622 ----
NM_014445chr341954 1663 699 494 ------
NM_014447chr411507 ------
NM_014452chr61165 1921 ----
NM_014454chr631049 306 237 ------
NM_014456chr1011358 --1438 --
NM_014458chr121392 239 ------
NM_014460chr221143 --1502 --
NM_014469chr112620 153 ------
NM_014491chr721083 879 ------
NM_014494chr1622380 858 ------
NM_014500chrX153 ------
NM_014504chr731500 273 146 --11801 --
NM_014515chr121990 ------
NM_014517chr321785 1638 ------
NM_014554chr122599 253 --11443 --
NM_014572chr1341447 725 562 193 ------
NM_014574chr1411285 1503 ----
NM_014577chr22--1593 ----
NM_014585chr2153 ------
NM_014587chr161299 --11586 --
NM_014588chr201748 1145 ----
NM_014591chr1021306 344 ------
NM_014600chr251630 600 438 424 353 ------
NM_014603chr1711442 11681 ----
NM_014606chr431416 627 371 ------
NM_014607chr23849 543 321 187 ----
NM_014608chr151180 --1116 --
NM_014612chr911323 ------
NM_014613chr532908 686 365 12243 ----
NM_014615chr1653439 3359 964 772 414 ------
NM_014616chr332229 867 262 22597 839 ----
NM_014630chr1563979 3604 3008 2674 2624 1544 13142 ----
NM_014633chr111578 ------
NM_014635chr2--1551 ----
NM_014636chr91578 1592 1323 --
NM_014646chr1842629 2526 796 113 ------
NM_014647chr161903 ------
NM_014666chr51950 ------
NM_014667chr32702 362 --2369 321 1804
NM_014670chr221594 1135 ------
NM_014671chr741354 1107 199 41 --1563 --
NM_014674chr343863 3299 2957 2573 --12585 --
NM_014679chr1131239 536 384 ------
NM_014683chr1711990 12186 ----
NM_014685chr162491 130 ----1509
NM_014686chr1912400 --11993 --
NM_014690chr752565 2336 2192 1898 431 12598 ----
NM_014693chr31177 ------
NM_014702chr612774 23432 943 ----
NM_014705chr751950 1769 762 579 355 11846 11599 --
NM_014709chr2187 ----1509
NM_014711chr161219 --21988 1372 11724
NM_014717chr19----1661 --
NM_014720chr10--11740 ----
NM_014721chr686725 6148 5967 4799 2647 1953 1833 728 --11439 --
NM_014723chr2011023 ------
NM_014729chr841855 1624 724 64 ------
NM_014730chr1265286 3937 1912 1635 1020 195 11667 14670 14628
NM_014730chr1265286 3937 1912 1635 1020 195 11667 14670 14628
NM_014733chr532137 670 386 ------
NM_014735chrX31860 1503 1496 --11693 --
NM_014743chr42289 267 --1562 --
NM_014751chr8--11512 --12059
NM_014752chr112557 241 ------
NM_014755chr263583 2859 2767 2651 1449 145 --11061 1822
NM_014757chr512102 ------
NM_014761chr164986 248 174 44 ------
NM_014764chr121308 172 ----
NM_014765chr132308 2230 1981 11043 --12010
NM_014766chr753792 2652 2605 2490 647 --12988 13551
NM_014770chr121313 --1817 --
NM_014771chr161774 ------
NM_014772chr1843598 2730 2401 725 ------
NM_014775chr221107 ------
NM_014779chr32821 100 ------
NM_014782chrX182 ------
NM_014787chr122798 1745 ------
NM_014790chr5122 ------
NM_014807chr111639 ------
NM_014810chr13978 607 95 ------
NM_014812chr111675 ------
NM_014813chr11394 199 ----
NM_014819chr531926 660 440 ------
NM_014820chr321588 451 --11273 --
NM_014824chr1121380 162 --11976 --
NM_014826chr131077 348 255 14177 13148 --
NM_014827chr121588 1530 ------
NM_014828chr1442542 1637 460 200 --12205 --
NM_014835chr2021841 1598 ------
NM_014838chr22--22403 409 ----
NM_014839chr15868 667 650 572 381 ----12336
NM_014840chr1222851 1061 33274 2651 235 11254 --
NM_014841chr6----1281 --
NM_014850chr343455 1815 1155 79 ------
NM_014868chr12165 ------
NM_014872chr932002 1614 220 1486 ----
NM_014873chr144369 2996 1508 1196 --24567 662 14179
NM_014877chr1766887 5722 5665 1234 808 134 22592 936 11967 --
NM_014884chr19------167
NM_014893chrY11469 1244 1715 --
NM_014897chr1742422 841 777 320 11170 ----
NM_014904chr1063210 3020 2928 2915 2616 2569 12625 ----
NM_014906chr1733366 1237 93 1833 21190 721 --
NM_014909chr1433789 3448 300 --12726 --
NM_014912chr1022167 1330 --13250 --
NM_014917chr1--1974 ----
NM_014918chr1521294 28 ------
NM_014923chr132142 72 --21495 729 --
NM_014926chr3----128 --
NM_014932chr3--1421 ----
NM_014939chr1821151 574 ------
NM_014944chr141137 276 142 32 ------
NM_014945chr51120 ------
NM_014946chr212387 21094 500 ----
NM_014947chr14783 698 472 169 ------
NM_014949chr11260 ------
NM_014952chr1511840 ------
NM_014961chr441712 1449 872 762 ----11744
NM_014962chr2032765 2538 183 22419 514 1272 --
NM_014969chr1----1177 --
NM_014978chr1011663 1251 ----
NM_014982chr1455044 4319 3599 1124 925 1308 ----
NM_014988chr4----12182 --
NM_014989chr6----12033 --
NM_014991chr422833 2717 ------
NM_014996chr31160 ------
NM_014997chr742504 2137 561 187 11140 ----
NM_014999chr12--11199 ----
NM_015000chr121108 ------
NM_015001chr12826 736 1208 ----
NM_015008chr321068 808 22220 1101 ----
NM_015009chr32770 556 ------
NM_015017chr11253 197 ----
NM_015020chr161100 12592 ----
NM_015023chr131644 1159 268 11395 ----
NM_015025chr232242 2113 445 3551 338 154 12092 --
NM_015026chr1233073 1703 1053 --24723 4020 --
NM_015027chr161111 --11736 --
NM_015032chr1322754 300 1170 ----
NM_015035chr20105958 5943 5629 5211 2623 1930 1728 1227 746 627 26468 712 ----
NM_015039chr124207 3420 14249 11623 --
NM_015042chr1514241 --21315 498 --
NM_015045chr102484 478 1304 ----
NM_015051chr912092 --1361 --
NM_015052chr711181 ------
NM_015054chr121430 ------
NM_015056chr2132080 215 33 ------
NM_015059chr1543032 2983 573 133 --11453 --
NM_015061chr92823 215 ------
NM_015064chr1232280 936 549 22486 375 1817 --
NM_015069chr162605 521 --1233 --
NM_015074chr164285 3309 1868 1553 1502 937 ------
NM_015076chr644455 4434 1054 471 11371 13724 1651
NM_015079chr1553223 2770 436 332 305 --11019 1531
NM_015087chr1322412 2378 11878 ----
NM_015091chr14--1706 ----
NM_015092chr1634011 3136 3027 13699 --11306
NM_015093chr611467 21197 661 ----
NM_015094chr2221114 416 --1859 --
NM_015097chr33812 397 139 11957 ----
NM_015100chr111581 ------
NM_015107chrX42034 1554 390 120 ------
NM_015110chr972513 2475 2384 1579 766 643 120 ------
NM_015115chr443008 2366 831 193 --12824 --
NM_015124chr2212527 --11581 1158
NM_015129chrX31789 1705 716 --11581 --
NM_015137chr822587 217 1492 21837 766 --
NM_015138chr1532804 1728 1033 11835 ----
NM_015143chr42324 284 11302 ----
NM_015144chr16--1951 12495 1116
NM_015149chr142130 1790 1782 792 ------
NM_015153chr6--1544 ----
NM_015155chr1043243 526 370 221 ------
NM_015156chr1463307 1475 1428 832 716 498 11502 13701 --
NM_015161chr161272 1355 ----
NM_015163chr1421674 284 ------
NM_015170chr822039 1868 --12238 --
NM_015172chr11221 11117 --11143
NM_015173chr421325 102 ------
NM_015176chr11496 11274 ----
NM_015180chr141785 1564 ----
NM_015184chr3172 ------
NM_015185chrX3706 353 324 --12840 --
NM_015191chr1132654 2022 1880 11063 1506 --
NM_015192chr2022792 508 --13009 --
NM_015193chr821158 584 ------
NM_015197chr141554 ------
NM_015199chr3--12795 21950 49 --
NM_015200chr421008 636 ------
NM_015203chr1--1162 ----
NM_015206chr1533757 2883 812 ------
NM_015209chr11462 --11767 --
NM_015215chr122721 40 23171 2503 ----
NM_015216chr5----11085 --
NM_015219chr172878 169 ------
NM_015221chr1051004 509 464 374 40 ------
NM_015225chr953087 2640 2615 530 29 1875 ----
NM_015233chr131829 21882 215 ----
NM_015236chr41363 ------
NM_015239chr91179 ------
NM_015245chr632171 1860 530 ------
NM_015246chr1622029 514 ------
NM_015247chr1621476 158 ------
NM_015250chr9----21268 532 --
NM_015252chr21602 ------
NM_015254chr832863 1001 122 --11976 --
NM_015263chr15173 ------
NM_015265chr22556 52 11652 11712 --
NM_015267chr122455 138 ------
NM_015268chr31740 ------
NM_015270chr1221455 143 ------
NM_015271chr434004 3874 3276 24234 3881 11380 --
NM_015275chr1222006 637 1667 --1144
NM_015278chr643044 2589 896 571 ------
NM_015289chr1511818 ------
NM_015292chr122548 247 ------
NM_015296chr132182 157 ------
NM_015305chr1431898 1285 346 ------
NM_015308chr111208 ------
NM_015310chr848012 6188 1780 187 38112 7231 5147 ----
NM_015313chr1113698 --14455 --
NM_015315chr533459 3388 693 13429 ----
NM_015317chr231111 1000 886 --11792 --
NM_015321chr1934946 4891 1819 ------
NM_015326chr112922 ------
NM_015328chr732776 401 312 ------
NM_015329chr1932748 1053 89 --22847 1894 --
NM_015335chr1222075 1841 --1541 --
NM_015336chr1212198 ------
NM_015344chr821876 238 --1672 --
NM_015347chr1232499 952 597 1701 ----
NM_015349chr632907 702 274 --1670 --
NM_015353chr1731927 1912 227 ------
NM_015355chr1711591 --11863 --
NM_015358chr21--1957 ----
NM_015359chr811929 11983 ----
NM_015361chr2------1815
NM_015365chrX53052 2681 369 338 284 ------
NM_015367chr22--1437 11628 --
NM_015379chr71212 ------
NM_015381chr221445 1739 ----
NM_015387chr211994 ------
NM_015393chr433013 2647 53 41516 1158 996 966 ----
NM_015396chr321230 1077 ------
NM_015397chr931883 1421 184 ------
NM_015423chr111530 11396 ----
NM_015429chr31728 ------
NM_015435chr811108 --11286 --
NM_015436chr422132 211 2452 317 ----
NM_015443chr1751508 1445 1389 1272 67 ------
NM_015444chr33608 169 80 ------
NM_015446chr111123 --11168 --
NM_015455chr574142 3276 2843 2522 1574 1056 350 1194 ----
NM_015458chr834971 3225 1025 11381 --13553
NM_015464chr73895 118 111 145 ----
NM_015469chr9162 1308 1154 --
NM_015475chr2--1853 11078 --
NM_015477chr151834 ------
NM_015481chr121437 ------
NM_015483chr721080 392 --140 --
NM_015492chr1521048 736 ------
NM_015507chrX--1169 ----
NM_015508chr33989 470 147 ------
NM_015523chr111240 ------
NM_015525chr61991 ------
NM_015530chr23915 645 209 ------
NM_015532chr1532179 315 172 12549 ----
NM_015534chr1193 ----1242
NM_015535chr253094 2591 1123 909 204 1468 33665 560 411 --
NM_015542chr1021041 929 ------
NM_015549chr141458 ------
NM_015550chr782922 2906 2832 1092 835 160 113 45 ------
NM_015553chr665184 4909 3863 3781 3591 1086 15061 1234 11972
NM_015554chr1542910 2686 1938 1817 22927 2398 ----
NM_015555chr61127 1587 11347 --
NM_015560chr332630 2490 1081 11955 --22718 155
NM_015564chr523519 1047 --12768 --
NM_015568chr2032841 1004 115 ------
NM_015569chr124627 301 ------
NM_015570chr71709 ------
NM_015589chr141134 ------
NM_015601chr10------1826
NM_015602chr11122 ------
NM_015605chr101141 ------
NM_015609chr112198 --12327 --
NM_015610chr722151 289 1548 12744 --
NM_015626chr1721149 289 ------
NM_015627chr131885 1374 740 ----11836
NM_015630chr21252 ------
NM_015635chr9176 ------
NM_015640chr11443 15056 13323 --
NM_015642chr31256 ------
NM_015652chr102259 75 ------
NM_015680chr22652 630 ------
NM_015686chrX32470 2303 1958 ------
NM_015695chr632030 1720 528 ------
NM_015696chr1176 ------
NM_015714chr11321 ------
NM_015716chr172158 100 ------
NM_015726chr1--1114 11552 --
NM_015850chr842240 1638 526 449 12061 ----
NM_015866chr12546 437 ------
NM_015878chr821576 244 --1470 --
NM_015879chr1878643 8461 7550 3391 2768 1138 572 ------
NM_015881chr1141289 396 265 198 ----168
NM_015885chr111193 ------
NM_015888chr11861 12206 ----
NM_015889chr221118 ------
NM_015904chr22569 531 ------
NM_015905chr7------1408
NM_015906chr123686 3140 ------
NM_015912chr8168 --1151 --
NM_015915chr14185 ------
NM_015955chr21354 1187 ----
NM_015980chr5------11566
NM_015981chr533168 2396 628 ------
NM_015982chr171310 ------
NM_015987chr12178 ------
NM_015990chr41942 ------
NM_015999chr1----144 --
NM_016003chr722151 289 1548 12744 --
NM_016009chr134608 4444 485 11491 --14942
NM_016022chr11139 ------
NM_016023chr832031 1632 854 1563 ----
NM_016027chr82446 36 1214 ----
NM_016039chr141151 ------
NM_016048chr5----1234 --
NM_016060chr1721110 722 --21038 131 1274
NM_016072chr121379 12361 ----
NM_016073chr151323 ------
NM_016076chr151987 1034 909 798 646 12508 ----
NM_016096chr821368 79 --11651 --
NM_016107chr541371 479 403 353 ------
NM_016120chrX4842 791 126 64 ------
NM_016129chr41313 ------
NM_016131chr22404 42 1783 ----
NM_016132chr1553356 2148 1131 987 913 ------
NM_016133chr231432 1341 374 ------
NM_016141chr32535 96 1620 ----
NM_016152chr321246 480 --1381 --
NM_016162chr121323 ------
NM_016179chr133198 192 21 ------
NM_016185chr171764 ------
NM_016203chr72172 60 ------
NM_016206chr358471 7968 5965 776 261 --1577 --
NM_016224chr621358 551 --2737 36 --
NM_016227chr121007 476 11331 ----
NM_016231chr17----1195 --
NM_016235chr1621386 1100 ------
NM_016248chr1333838 1473 1231 --1143 1815
NM_016252chr2----1192 --
NM_016255chr622291 914 11232 11281 --
NM_016260chr235933 2911 288 16086 ----
NM_016270chr191441 ------
NM_016271chr1832072 1678 311 12346 ----
NM_016275chr32640 119 --1395 --
NM_016279chr51375 ------
NM_016281chr12--1349 ----
NM_016287chr1185 --1174 --
NM_016289chr21606 ------
NM_016303chrX148 ------
NM_016308chr131859 1848 46 --11762 --
NM_016315chr2----11831 --
NM_016322chr952610 1026 1006 589 476 ------
NM_016329chr32469 394 165 ----
NM_016359chr151676 1669 ----
NM_016374chr121415 184 --11336 --
NM_016374chr121415 184 --11336 --
NM_016396chr154610 602 542 115 ------
NM_016410chr91177 ------
NM_016422chr1122138 727 --1871 --
NM_016424chr17--2524 428 ----
NM_016436chr2032671 2012 532 --1959 --
NM_016441chr232131 866 681 ------
NM_016442chr542277 2182 2171 41 21816 753 ----
NM_016448chr121626 502 ------
NM_016463chr5--1167 ----
NM_016470chr201118 127 ----
NM_016480chr51730 --1720 --
NM_016485chr632022 1902 447 ----2766 651
NM_016492chr17--1144 ----
NM_016496chr192424 360 ------
NM_016507chr1733107 2656 577 ------
NM_016516chr21351 ------
NM_016519chr42357 173 ------
NM_016522chr1111327 11401 ----
NM_016525chr9--1813 ----
NM_016530chr151240 --13142 --
NM_016531chr4--11195 ----
NM_016542chrX2252 159 ------
NM_016545chr1----1745 --
NM_016561chr161122 1635 ----
NM_016575chr1285293 5266 4517 3933 1872 1551 1018 85 ------
NM_016598chr311479 ------
NM_016603chr5190 ------
NM_016605chr5--12227 ----
NM_016607chrX1212 ------
NM_016612chr82492 237 ------
NM_016618chr21172 ------
NM_016620chr111437 ------
NM_016621chr1134524 1843 1701 12984 ----
NM_016623chr81105 ------
NM_016631chr211940 ------
NM_016644chr51384 ------
NM_016651chr142981 109 ------
NM_016654chr1511013 21257 1234 ----
NM_016823chr171471 --11034 --
NM_016824chr1031823 1710 1361 1454 ----
NM_016834chr1723617 143 --13749 --
NM_016835chr1723617 143 --13749 --
NM_016836chr22675 492 ----186
NM_016839chr22675 492 ----186
NM_016841chr1723617 143 --13749 --
NM_016929chr624489 855 1347 ----
NM_016930chr41818 --159 --
NM_016936chr161136 11949 ----
NM_016946chr113009 12812 ----
NM_016950chr42326 184 1434 ----
NM_016954chrX1651 ------
NM_017409chr122583 576 ------
NM_017412chr83321 147 101 ------
NM_017413chrX1593 ------
NM_017415chr5104295 3929 3643 3350 3055 2892 1340 1282 673 485 --11224 --
NM_017420chr1413720 23049 1096 --13283
NM_017423chr452051 2025 1410 511 202 ------
NM_017440chr12199 ------
NM_017447chr2163394 3182 1774 1610 582 92 14173 ----
NM_017449chr1--11748 11062 --
NM_017450chr172322 68 ------
NM_017452chr2031174 557 65 ------
NM_017453chr2031174 557 65 ------
NM_017454chr2031174 557 65 ------
NM_017455chr152679 238 ------
NM_017459chr11290 --173 --
NM_017481chr11129 ------
NM_017491chr41755 ----1998
NM_017514chrX1177 ------
NM_017519chr6------1443
NM_017522chr121447 428 ------
NM_017544chrX----1838 --
NM_017548chr31832 --21618 791 --
NM_017551chr1012607 ------
NM_017577chr32377 339 11601 ----
NM_017580chr1021676 484 ------
NM_017582chr131468 554 378 11552 ----
NM_017583chr1141128 342 285 187 ------
NM_017590chr2211779 ------
NM_017593chr41459 ------
NM_017610chr1511490 1320 ----
NM_017623chr222232 411 1113 ----
NM_017628chr422057 797 11027 25113 4879 --
NM_017629chr11783 ------
NM_017631chr4161 1578 ----
NM_017632chr41101 ------
NM_017633chr633752 3099 2508 --1531 --
NM_017634chr821768 308 11564 ----
NM_017637chr9109267 8756 8460 8338 7567 3684 3436 2423 1080 77 22466 760 26085 191 13395
NM_017641chr122317 181 1233 ----
NM_017643chr171977 ------
NM_017644chr345066 5024 3655 1336 14993 24710 1084 --
NM_017650chr775879 5595 5530 5092 4244 2033 1312 --11917 --
NM_017658chr1471114 1045 899 617 501 325 97 21836 397 ----
NM_017661chr1521148 822 --11206 --
NM_017662chr9130 21703 283 ----
NM_017672chr1511335 11120 ----
NM_017673chr11801 ------
NM_017684chr1512004 171 11991 --
NM_017700chr41124 ------
NM_017709chr153652 3329 2795 1065 123 21635 1164 ----
NM_017714chr201157 ----1330
NM_017715chr72181 165 ------
NM_017719chr31341 ------
NM_017724chr31276 1627 ----
NM_017737chr131875 435 56 11550 ----
NM_017742chr182635 175 --1268 --
NM_017744chr12958 739 ------
NM_017745chrX1239 ------
NM_017757chr182834 749 ------
NM_017758chr171373 ------
NM_017762chr1531744 568 78 ------
NM_017770chr622882 178 ------
NM_017772chr621245 354 ------
NM_017776chrX21142 1048 ------
NM_017778chr821327 1087 1171 ----
NM_017779chr132275 2010 1103 11725 ----
NM_017780chr82939 269 ------
NM_017784chr311188 ------
NM_017786chr81102 ------
NM_017798chr2031103 360 65 ------
NM_017799chr1421675 1357 ------
NM_017811chr91998 ------
NM_017812chr71159 ------
NM_017813chr841238 1055 1040 187 ------
NM_017822chr122778 516 ------
NM_017830chr4175 ------
NM_017831chr1824357 3430 1161 ----
NM_017845chr41656 ------
NM_017848chrX33318 1657 884 --14410 --
NM_017873chr9----1630 --
NM_017880chr21299 --1139 --
NM_017915chr121323 ------
NM_017916chr19121 ------
NM_017919chr965822 5427 4073 3621 1412 1122 11689 13589 --
NM_017923chr42514 283 ------
NM_017925chr921204 232 ------
NM_017926chr142905 304 ------
NM_017933chr221463 591 11573 ----
NM_017938chrX12180 32073 2056 1971 ----
NM_017944chr1122199 1189 11933 ----
NM_017952chr224380 3936 ------
NM_017972chr142905 304 ------
NM_017987chr1051937 1801 1786 892 579 ------
NM_017994chr732605 1007 894 --32827 657 203 13007
NM_017998chr91939 11309 ----
NM_018010chr311438 --2391 307 --
NM_018015chrX1143 21023 47 ----
NM_018018chr121764 1278 ----
NM_018027chr1053235 2195 2041 1169 1053 12112 ----
NM_018030chr181270 ------
NM_018061chr1155 --1406 --
NM_018062chr21150 --1415 --
NM_018070chr11442 ------
NM_018084chr242547 2521 2082 357 12419 --1809
NM_018085chr157227 7186 7108 842 459 ------
NM_018086chr211553 21670 1398 --1368
NM_018087chr11212 ------
NM_018092chr16--2450 316 ----
NM_018100chr643231 2652 1345 50 ------
NM_018105chr821035 783 ------
NM_018112chr9--1210 ----
NM_018120chr82453 203 21218 144 1430 --
NM_018121chr1073209 2694 2670 2502 2469 2230 962 ------
NM_018131chr101841 ------
NM_018133chr321729 310 ------
NM_018137chr121232 229 11188 ----
NM_018144chr102306 58 ------
NM_018157chr1253247 2344 2208 1217 97 134 ----
NM_018171chr12----1215 --
NM_018178chr121534 1361 --1289 --
NM_018179chr12--1237 ----
NM_018181chr1811490 ------
NM_018184chr331850 1549 658 ------
NM_018195chr1111393 --1474 --
NM_018200chr1542602 2002 1924 452 ------
NM_018211chr132207 1657 730 1602 ----
NM_018217chr20158 ------
NM_018241chr4171 1280 ----
NM_018243chr473575 3451 3377 300 245 145 40 ------
NM_018247chr62847 252 ------
NM_018254chr131870 862 569 --12135 --
NM_018270chr20--1744 ----
NM_018287chr1021222 181 ------
NM_018293chr342854 2308 2266 1898 --1664 --
NM_018303chr631366 611 469 ------
NM_018307chr17--162 ----
NM_018313chr3----1565 --
NM_018320chr111108 ------
NM_018328chr21519 ------
NM_018330chr101567 ------
NM_018335chr141369 ------
NM_018339chr921725 1239 --11484 --
NM_018351chr1234616 3171 420 ------
NM_018354chr20--129 ----
NM_018364chr112732 23619 1381 14023 --
NM_018371chr831047 610 183 ------
NM_018374chr754926 4236 3185 1955 943 ------
NM_018375chr1421621 1342 ----2458 255
NM_018383chr221672 426 11778 ----
NM_018387chr92370 82 ------
NM_018388chrX21426 582 ------
NM_018403chr343878 3719 3634 326 --14079 --
NM_018413chr12132 ------
NM_018416chr1232631 2562 1641 ------
NM_018419chr20133 ------
NM_018426chr62391 116 ------
NM_018429chr52593 233 ------
NM_018433chr21550 ------
NM_018440chr888315 7302 6582 5578 2176 2154 1527 555 2737 103 ----
NM_018442chr11371 ------
NM_018444chr812390 ------
NM_018452chr6_random23483 1515 12608 --1541
NM_018454chr151676 1669 ----
NM_018476chrX147 ------
NM_018482chr812597 ------
NM_018553chr1731558 581 436 ------
NM_018569chr451487 1257 1092 205 77 ------
NM_018571chr22569 54 --1471 --
NM_018590chr1011710 ------
NM_018593chr63692 509 35 ----1705
NM_018602chr1521561 297 180 ----
NM_018638chr1255215 5065 4490 4283 1930 53702 3611 1540 847 117 ----
NM_018640chr1262339 2299 2187 810 422 250 ------
NM_018644chr1122220 1666 ------
NM_018649chr10162 --1441 --
NM_018650chr121959 337 ------
NM_018653chr17--1397 ----
NM_018667chr1632599 2585 87 ------
NM_018682chr71150 ------
NM_018685chr7--194 ----
NM_018686chr12156 --1269 --
NM_018695chr511588 ------
NM_018700chr521312 1212 ------
NM_018704chr11505 ------
NM_018715chr152127 1449 526 494 188 1147 ----
NM_018841chr143908 3397 3234 2933 11464 13621 --
NM_018847chr911931 --11212 --
NM_018890chr721290 52 --31099 1065 963 --
NM_018898chr521838 1467 --12285 --
NM_018899chr521838 1467 --12285 --
NM_018900chr521838 1467 --12285 --
NM_018901chr521838 1467 --12285 --
NM_018902chr521838 1467 --12285 --
NM_018903chr521838 1467 --12285 --
NM_018904chr521838 1467 --12285 --
NM_018905chr521838 1467 --12285 --
NM_018906chr521838 1467 --12285 --
NM_018907chr521838 1467 --12285 --
NM_018908chr521838 1467 --12285 --
NM_018909chr521838 1467 --12285 --
NM_018910chr521838 1467 --12285 --
NM_018911chr521838 1467 --12285 --
NM_018912chr511678 --11532 --
NM_018913chr511678 --11532 --
NM_018914chr511678 --11532 --
NM_018915chr511678 --11532 --
NM_018916chr511678 --11532 --
NM_018917chr511678 --11532 --
NM_018918chr511678 --11532 --
NM_018919chr511678 --11532 --
NM_018920chr511678 --11532 --
NM_018921chr511678 --11532 --
NM_018922chr511678 --11532 --
NM_018923chr511678 --11532 --
NM_018924chr511678 --11532 --
NM_018925chr511678 --11532 --
NM_018926chr511678 --11532 --
NM_018927chr511678 --11532 --
NM_018928chr511678 --11532 --
NM_018929chr511678 --11532 --
NM_018945chr643559 3451 371 363 ------
NM_018947chr754637 3395 1762 891 635 13821 1773 --
NM_018948chr131103 1030 940 ------
NM_018953chr121577 --1143 --
NM_018959chr193762 716 581 ------
NM_018976chr1221854 496 ------
NM_018979chr1262654 2594 2570 1833 371 249 12086 12588 1572
NM_018981chr23907 478 280 ------
NM_018992chr1631084 99 40 --11165 --
NM_019004chr711661 ------
NM_019024chr21120 ------
NM_019027chr41475 12538 11650 --
NM_019028chr111427 ------
NM_019030chr5--127 ----
NM_019036chr6----1918 --
NM_019048chr2--174 ----
NM_019049chr11267 --1195 --
NM_019050chr412157 1519 ----
NM_019063chr221426 568 ------
NM_019074chr15189 ------
NM_019080chr13--21509 1092 ----
NM_019091chr2----1820 --
NM_019094chr1253054 2987 2815 1266 149 13313 ----
NM_019114chr922244 2092 ------
NM_019116chr1633540 3296 1197 13070 ----
NM_019555chr321575 355 ------
NM_019558chr2--1341 1144 --
NM_019590chr1031371 1246 168 1989 ----
NM_019593chr2042806 2709 2374 942 1760 --1892
NM_019594chr91221 21479 1408 ----
NM_019605chr1--1129 ----
NM_019610chr131584 712 210 11546 ----
NM_019613chr171146 ------
NM_019842chr61364 ------
NM_019854chr121613 ------
NM_019857chrX11732 --11640 --
NM_019860chr10----1339 --
NM_019891chr11439 --11019 --
NM_019895chr3----1765 --
NM_019903chr1031823 1710 1361 1454 ----
NM_020062chr202719 122 ------
NM_020116chr4--21682 261 --136
NM_020122chr265346 5320 5033 4227 4208 949 ------
NM_020123chr101188 11249 ----
NM_020134chr22750 167 ------
NM_020144chr712060 11608 ----
NM_020147chr15--11084 ----
NM_020148chr1822539 23 --11082 --
NM_020151chr231538 525 32 --1367 --
NM_020159chr411316 1302 ----
NM_020177chr511266 ----1521
NM_020178chr1721062 368 ------
NM_020182chr2043403 2274 646 59 --11135 --
NM_020193chr111893 ------
NM_020194chr21633 ------
NM_020198chr171377 11227 1314 --
NM_020199chr52484 442 11264 1128 11163
NM_020205chr11978 12734 12345 --
NM_020226chr42766 489 ------
NM_020234chr15----163 --
NM_020235chr32253 112 ----132
NM_020245chr664566 3179 2039 1947 1657 1128 ----14908
NM_020337chr432879 2533 192 23028 632 1216 --
NM_020340chr621851 1812 --1288 --
NM_020342chr21154 1951 ----
NM_020346chr1111641 ------
NM_020354chr101758 ------
NM_020362chr12319 276 ------
NM_020381chr621704 146 11751 171 --
NM_020382chr123627 553 273 ------
NM_020390chr344701 4521 3647 790 1830 ----
NM_020401chr122182 170 ------
NM_020403chr1311762 --1371 --
NM_020420chrY--157 11608 --
NM_020436chr202183 58 ------
NM_020438chr9----11214 --
NM_020440chr162967 2232 2149 1256 1081 607 --11337 --
NM_020443chr1107012 6485 6471 5765 4250 2768 2483 947 907 204 14970 15195 --
NM_020449chrX--1139 ----
NM_020452chr112043 --11344 --
NM_020453chr451610 1457 1450 587 239 1363 ----
NM_020456chr1372318 2177 1637 1461 569 558 512 1707 ----
NM_020457chr161438 ------
NM_020463chr211024 ------
NM_020465chr1611462 ------
NM_020466chr613285 ------
NM_020474chr182673 312 11681 1100 --
NM_020475chr832326 2204 1844 ------
NM_020476chr832326 2204 1844 ------
NM_020477chr832326 2204 1844 ------
NM_020478chr832389 2267 1907 ------
NM_020480chr832326 2204 1844 ------
NM_020532chr21606 ------
NM_020546chr52924 199 ------
NM_020630chr103649 277 44 ------
NM_020640chr351766 1594 817 695 428 ------
NM_020642chr111555 --1150 --
NM_020647chr851971 1811 1784 765 438 1586 21633 204 --
NM_020651chr211714 ------
NM_020654chr32634 392 ------
NM_020655chr1621380 449 ------
NM_020689chr2011316 --1662 --
NM_020697chr83504 324 167 ------
NM_020699chr123303 963 --12156 14810
NM_020708chr2022220 457 12472 --1689
NM_020715chr1412236 ------
NM_020718chr1666336 5492 4670 2059 2046 507 16539 46293 1490 1474 84 --
NM_020728chr712239 12105 --1302
NM_020732chr6------1443
NM_020734chr1241288 1133 791 327 ------
NM_020739chr1554208 3328 3086 2717 1668 1987 --21350 76
NM_020742chrX--1263 1730 --
NM_020747chr51919 ----154
NM_020752chr10--12622 ----
NM_020754chr31449 ------
NM_020760chr231520 1246 528 1689 ----
NM_020762chr12198 ------
NM_020766chrX43833 3755 2982 768 22968 556 ----
NM_020769chrX1803 ------
NM_020772chr1735762 2508 898 47601 7109 5449 5434 16764 --
NM_020774chr1815515 24846 4177 ----
NM_020777chr412535 ------
NM_020796chr522822 2143 ------
NM_020801chr511796 22502 156 --11941
NM_020805chr1821763 642 --1757 --
NM_020806chr141245 ------
NM_020808chr111127 11083 184 --
NM_020809chr1112143 12130 1697 --
NM_020810chr1443189 2237 794 496 ------
NM_020813chr1942353 2323 1025 401 --1195 --
NM_020815chr42378 363 ------
NM_020819chr6----1151 --
NM_020821chr1512004 171 11991 --
NM_020854chr1821198 149 ------
NM_020856chr19136 ------
NM_020858chr1522129 1511 12227 ----
NM_020860chr41273 ------
NM_020868chr221686 772 ------
NM_020870chr42448 321 ------
NM_020871chrX22522 1816 ------
NM_020872chr3----2710 58 --
NM_020873chr3147 154 1350 --
NM_020899chr171151 ------
NM_020914chr1742542 1675 1038 996 ------
NM_020918chr1032339 2268 1317 ----1536
NM_020921chr1453043 2721 2259 1431 1034 1674 13175 --
NM_020922chrX1559 1280 ----
NM_020947chr1621959 677 ------
NM_020948chr121302 1076 ------
NM_020952chr91126 196 ----
NM_020959chr19183 ------
NM_020961chr4--1110 ----
NM_020962chr153941 623 131 --12427 --
NM_020975chr101131 ------
NM_020983chr1221455 143 ------
NM_020987chr1011041 21068 1010 ----
NM_020988chr1611044 --1249 --
NM_020993chr1252357 859 747 409 368 --11098 --
NM_021003chr14--1332 ----
NM_021007chr242214 1802 1727 654 ------
NM_021012chr17--1132 --1123
NM_021033chr1332999 1030 696 --23104 2897 --
NM_021038chr343239 2624 1077 49 ------
NM_021072chr5----1523 --
NM_021076chr221575 ------
NM_021083chrX13057 --12766 13388
NM_021090chr2224628 769 --11338 --
NM_021111chr91974 --1949 --
NM_021120chrX22796 2290 1648 --12774
NM_021132chr101122 ------
NM_021140chrX--11013 ----
NM_021148chr722241 2102 ------
NM_021149chr1631156 1063 390 ------
NM_021155chr1932498 2304 1998 ------
NM_021156chr20----11041 --
NM_021159chr41435 ------
NM_021165chr1----1268 --
NM_021183chrX2465 70 ------
NM_021188chr142449 122 ------
NM_021189chr11148 ------
NM_021190chr11259 ------
NM_021194chr1--136 ----
NM_021215chr2052160 2117 2111 1833 1784 ------
NM_021219chr21173 ------
NM_021224chr92449 114 --1400 --
NM_021227chr4----1445 --
NM_021238chr1211596 ------
NM_021239chr1421196 574 ------
NM_021240chr91121 --147 --
NM_021252chr1031772 1475 322 ------
NM_021255chr1433466 1534 1151 ------
NM_021619chr92947 418 --11096 --
NM_021622chr1031627 1496 940 21524 703 ----
NM_021627chr311218 ------
NM_021629chr333969 3764 599 --15117 --
NM_021637chrX11204 --11245 --
NM_021638chr484959 3648 1600 859 756 623 588 312 ------
NM_021639chr11160 1190 ----
NM_021643chr221555 636 11599 11870 --
NM_021644chr10----1992 --
NM_021647chr431408 450 364 14754 ----
NM_021648chr642733 2379 203 93 ------
NM_021729chr112300 269 ------
NM_021785chrX----1306 --
NM_021813chr645214 3745 3703 941 ------
NM_021814chr611658 11434 ----
NM_021830chr101695 ------
NM_021911chr521661 1562 --11379 --
NM_021912chr152639 595 12666 ----
NM_021914chr1421647 1520 12117 ----
NM_021940chr621516 522 ------
NM_021943chr611750 ------
NM_021956chr611076 ------
NM_021961chr1146911 2407 1781 1770 16345 27259 6128 --
NM_021964chr335425 4607 4163 35881 4448 873 24538 1395 16502
NM_021965chr921342 122 ------
NM_021970chr41634 ------
NM_021976chr621069 23 ------
NM_021980chr101972 --168 --
NM_021984chrX----1409 --
NM_021987chrX----1409 --
NM_021990chrX----1409 --
NM_021991chr172542 171 1776 ----
NM_021998chrX21103 365 ------
NM_022036chr17--1397 ----
NM_022049chr111677 ----1300
NM_022051chr11642 ------
NM_022060chr141855 --11348 --
NM_022062chr1121972 1779 ------
NM_022075chr11268 ------
NM_022079chr10------1826
NM_022080chr2042497 685 527 369 --2387 235 --
NM_022085chr6150 ------
NM_022114chr121673 561 --24805 4057 --
NM_022118chr13--1563 ----
NM_022123chr141228 ------
NM_022133chr821274 184 ------
NM_022170chr761586 1391 425 404 367 333 --1215 --
NM_022346chr431406 1212 125 152 1965 --
NM_022351chr822833 227 --1424 --
NM_022465chr12192 1436 ----
NM_022474chr1422598 444 ------
NM_022475chr41683 ------
NM_022476chr16--1781 ----
NM_022477chr2031666 389 377 ------
NM_022482chr2011803 22438 817 ----
NM_022491chr1233085 554 67 ------
NM_022552chr2----1870 --
NM_022574chr71657 ------
NM_022650chr52820 693 ------
NM_022652chr12178 ------
NM_022658chr1231141 1030 96 153 11131 --
NM_022716chr132209 1111 264 13142 ----
NM_022726chr611115 ------
NM_022730chr211073 ------
NM_022735chr121467 548 ------
NM_022739chr1721114 206 ------
NM_022744chr1611004 ------
NM_022745chr12652 127 12045 12597 --
NM_022748chr72427 228 --12268 --
NM_022753chr122588 1857 --186 --
NM_022755chr921864 106 1684 2922 824 --
NM_022758chr642790 2166 824 457 ------
NM_022763chr3--1780 ----
NM_022765chr6122 ------
NM_022771chr12--199 ----
NM_022780chr251664 752 734 539 348 ----11478
NM_022781chr911257 13258 1329 --
NM_022784chr151240 ------
NM_022810chrX1283 ------
NM_022817chr242085 440 115 51 ------
NM_022818chr1621553 1154 ------
NM_022831chr131623 1279 461 ------
NM_022838chrX------1268
NM_022841chr1522559 116 1807 --12599
NM_022844chr161960 ------
NM_022845chr1622209 1785 ------
NM_022893chr21170 22838 1111 12640 12781
NM_022894chr221122 529 ------
NM_022898chr1443537 3439 3431 440 13248 11032 --
NM_022900chr721119 1011 ------
NM_022910chr1611462 ------
NM_022912chr252876 2802 2681 957 636 --1160 --
NM_022918chr1131726 618 519 ------
NM_022970chr1041341 1238 1031 585 ------
NM_022977chrX1683 22257 1064 11625 --
NM_023000chr1421268 461 ------
NM_023001chr1421268 461 ------
NM_023010chrX2821 201 ------
NM_023033chr121558 ------
NM_023035chr191574 ------
NM_023037chr133807 748 730 ------
NM_023076chr162435 162 ------
NM_023105chr842240 1638 526 449 12061 ----
NM_023106chr842240 1638 526 449 12061 ----
NM_023110chr842240 1638 526 449 12061 ----
NM_023111chr842240 1638 526 449 12061 ----
NM_023929chr8--12046 12267 --
NM_023940chr41976 ------
NM_024007chr5----11121 --
NM_024019chr41260 --1250 --
NM_024028chr54940 930 283 181 ------
NM_024046chr311086 ------
NM_024050chr191249 ------
NM_024052chr1742827 2432 870 417 ------
NM_024056chr121642 ------
NM_024057chr121132 ------
NM_024076chr19134 ------
NM_024086chr1753369 3349 1096 170 44 13078 13461 --
NM_024090chr431871 1777 512 ------
NM_024092chr1121212 778 ------
NM_024095chr1211235 11347 ----
NM_024293chr21275 ------
NM_024294chr642790 2166 824 457 ------
NM_024295chr821411 812 --1580 --
NM_024315chr71178 ------
NM_024329chr131432 1283 1144 ------
NM_024337chr52252 143 ------
NM_024408chr112672 --2538 473 --
NM_024411chr2021165 226 1565 ----
NM_024423chr1853794 3230 1621 1152 1072 ------
NM_024424chr113343 144 57 ------
NM_024425chr113343 144 57 ------
NM_024426chr113343 144 57 ------
NM_024429chr72172 60 ------
NM_024430chr1821849 36 ------
NM_024496chr141730 1712 ----
NM_024511chr412515 23111 3014 2889 179 --
NM_024524chr321039 671 ------
NM_024529chr12121 115 ------
NM_024539chrX3421 314 276 1501 ----
NM_024551chr1211799 ------
NM_024551chr1211799 ------
NM_024561chr1331007 955 353 --1316 --
NM_024567chr81289 ------
NM_024572chr2141 ------
NM_024582chr421118 795 --1337 --
NM_024586chr11639 ------
NM_024612chr17153 --11113 --
NM_024616chr321351 318 ------
NM_024624chr221532 393 --11359 --
NM_024636chr742063 2019 894 562 --12770 --
NM_024639chr62969 636 22909 1001 ----
NM_024646chr123874 267 ------
NM_024659chr21358 ------
NM_024665chr384684 3818 3300 1788 1354 1017 770 484 24060 472 ----
NM_024692chr221520 1378 11334 --1444
NM_024699chr82311 105 ------
NM_024702chr171200 ------
NM_024704chr2031097 936 260 ------
NM_024713chr1511664 ------
NM_024719chr13183 ------
NM_024721chr852147 2047 1686 206 24 ------
NM_024725chr112821 542 1643 ----
NM_024740chr1133764 1498 706 ------
NM_024749chr12305 40 --1491 --
NM_024751chr4--1184 ----
NM_024755chr152262 140 ------
NM_024769chr11128 --1352 --
NM_024770chr234555 4531 121 --1195 --
NM_024798chr1512354 ------
NM_024811chr1141697 1285 772 595 --1299 --
NM_024824chr1441581 1353 508 109 11089 ----
NM_024828chr9--11185 ----
NM_024834chr1031859 1255 386 ------
NM_024837chr152586 486 ------
NM_024852chr11218 ------
NM_024863chrX------136
NM_024920chr41370 ------
NM_024940chr83577 406 386 ------
NM_024945chr9----11172 --
NM_024947chr358769 5814 2513 1829 627 22898 517 ----
NM_024971chr91126 196 ----
NM_024993chr23255 170 106 ------
NM_025027chr191961 ------
NM_025054chr813863 ----14208
NM_025076chr2--1140 ----
NM_025115chr81117 ------
NM_025133chr21392 ------
NM_025134chr1642484 948 703 140 1468 ----
NM_025146chr331831 652 319 ------
NM_025154chr741501 1474 560 344 ------
NM_025160chr143460 2769 867 830 --11403 --
NM_025164chr1152085 1905 873 766 125 ------
NM_025179chr174165 3246 3238 3145 1229 833 310 24235 1887 ----
NM_025187chr16------1930
NM_025191chr11547 13225 ----
NM_025208chr1132496 1918 148 ----1675
NM_025209chr10198 ------
NM_025222chr332742 2095 1984 --11036 --
NM_025235chr1032133 1900 447 21514 69 11687 --
NM_025236chr62584 52 ------
NM_025263chr61719 --2617 193 --
NM_030594chr151953 --1390 --
NM_030621chr1433316 2824 247 22919 1684 --22851 270
NM_030625chr1022608 407 11849 --1292
NM_030627chr5--23609 1369 23192 452 --
NM_030629chr1641874 1515 779 398 11525 ----
NM_030634chr142322 2129 393 87 ----11604
NM_030637chr141605 1566 ----
NM_030647chr765803 5680 4453 2149 2019 651 --11288 --
NM_030648chr455287 3693 1828 1732 1620 21597 764 1369 11977
NM_030650chr233741 1230 62 --13552 --
NM_030661chr7165 --2454 173 --
NM_030674chr1234904 3660 3619 1456 ----
NM_030751chr10166 ------
NM_030751chr10166 ------
NM_030756chr102266 27 ------
NM_030758chr221528 --1463 --
NM_030771chr11124 ------
NM_030773chr2031535 1335 466 11835 --11676
NM_030780chr82524 169 31583 364 279 ----
NM_030799chr511869 11690 ----
NM_030810chr6150 ------
NM_030816chr143386 3329 2921 86 ------
NM_030820chr62969 961 --139 --
NM_030881chr22--12155 21760 513 1450
NM_030885chr342137 819 521 101 ------
NM_030914chr92956 844 --1910 --
NM_030915chr222404 567 --1760 --
NM_030920chr121746 509 ------
NM_030922chr15--2739 306 ----
NM_030923chr2----1250 --
NM_030926chr231082 827 105 ------
NM_030938chr171385 ------
NM_030939chr621159 222 ------
NM_030949chr631177 304 105 ------
NM_030964chr543475 2953 2445 2394 ------
NM_030979chr13135 1449 ----
NM_031216chr1841871 1855 1844 396 22137 511 ----
NM_031231chr201162 ------
NM_031232chr201162 ------
NM_031243chr71434 ------
NM_031262chr91292 1412 ----
NM_031263chr91349 1469 ----
NM_031266chr5140 ------
NM_031267chr71487 ------
NM_031268chr1663697 1604 1302 1025 517 220 ----15350
NM_031287chr64303 254 139 45 --1121 --
NM_031296chr432134 1086 134 ------
NM_031305chr451549 1526 645 609 336 ------
NM_031309chr81877 1943 ----
NM_031369chr42871 196 --1655 --
NM_031370chr42871 196 --1655 --
NM_031371chr121415 184 --11336 --
NM_031371chr121415 184 --11336 --
NM_031372chr41285 11177 ----
NM_031407chrX1423 ------
NM_031411chr521838 1467 --12285 --
NM_031427chr1434908 3846 1491 ------
NM_031431chr13--11824 ----
NM_031435chr1242681 2330 1019 796 11361 ----
NM_031438chr51776 ------
NM_031442chrX4739 630 579 253 ------
NM_031445chr222452 1335 ------
NM_031453chr1032404 726 454 --12308 --
NM_031461chr8----1310 --
NM_031468chr777269 7068 5249 5180 3310 2780 1081 ----1217
NM_031469chr622831 522 1178 ----
NM_031476chr162986 56 --22742 2671 --
NM_031477chr161367 ------
NM_031483chr2043515 3387 2599 172 1987 23552 1067 --
NM_031844chr164042 1642 1619 1417 875 314 --23817 1146 --
NM_031845chr232467 1068 979 ------
NM_031847chr232467 1068 979 ------
NM_031849chr521838 1467 --12285 --
NM_031857chr521838 1467 --12285 --
NM_031858chr172578 308 11431 ----
NM_031860chr521838 1467 --12285 --
NM_031862chr172578 308 11431 ----
NM_031885chr162240 69 ------
NM_031890chr2232679 2069 276 --1792 --
NM_031892chrX1932 ------
NM_031899chr33307 192 100 ------
NM_031942chr221252 1200 ------
NM_031953chr41409 ------
NM_031992chr761586 1391 425 404 367 333 --1215 --
NM_032013chr2031666 389 377 ------
NM_032042chr532687 912 204 11105 22801 147 --
NM_032047chr32808 335 --11947 --
NM_032088chr511678 --11532 --
NM_032092chr511678 --11532 --
NM_032102chr111186 ----11173
NM_032121chrX32824 2562 1860 ------
NM_032139chr192962 92 ------
NM_032142chr18180 ------
NM_032144chr231262 643 485 1224 11769 1609
NM_032145chr631710 1534 479 1568 ----
NM_032146chr31384 ------
NM_032151chr51495 ------
NM_032153chr33690 443 419 ------
NM_032154chr103953 669 146 --1408 --
NM_032160chr1864264 3801 3521 3481 2899 409 1390 ----
NM_032174chr11508 1581 ----
NM_032177chr52345 81 1351 ----
NM_032182chr10192 ------
NM_032186chr111437 ------
NM_032189chr1314183 --11763 --
NM_032192chr17----3605 598 499 --
NM_032199chr1033806 951 666 12705 ----
NM_032205chr8175 ------
NM_032208chr233654 2914 2885 ------
NM_032217chr421126 102 1198 ----
NM_032221chr2011507 ------
NM_032229chr131343 1844 ----
NM_032236chr11697 ------
NM_032239chr42467 213 1312 ----
NM_032246chr1511012 ------
NM_032256chr122221 142 --1389 --
NM_032271chr161307 ------
NM_032288chr332118 1692 537 ----12294
NM_032289chr521805 1610 ------
NM_032312chr2----1136 --
NM_032320chr111704 ------
NM_032373chr1035412 4901 1352 11241 13825 --
NM_032377chr191628 ------
NM_032379chr111150 ------
NM_032380chr5--2173 76 ----
NM_032387chr17176 ------
NM_032389chr11174 ------
NM_032403chr511678 --11532 --
NM_032408chr7--1468 ----
NM_032410chr831135 1058 846 ------
NM_032429chr101587 ------
NM_032437chr11175 ------
NM_032438chr641446 1440 1163 174 138 ----
NM_032439chr1011572 1314 ----
NM_032440chr1022276 305 ------
NM_032445chr1522008 943 ------
NM_032446chr523785 1371 12980 1170 --
NM_032449chr122294 2126 --1281 --
NM_032457chr423877 2918 --12602 --
NM_032458chrX33222 1314 1077 1212 1957 --
NM_032491chr121310 ------
NM_032505chr321954 1077 ------
NM_032521chr2022730 2227 --1236 --
NM_032523chr21119 ------
NM_032539chrX2579 160 ------
NM_032547chr411421 ------
NM_032550chr10160 1298 ----
NM_032557chr42212 133 ------
NM_032560chr141339 ------
NM_032569chr1611906 ------
NM_032578chr1031034 607 270 --1133 --
NM_032582chr172577 296 ------
NM_032595chr1711278 ------
NM_032626chr16----1333 --
NM_032632chr1421962 1922 11635 ----
NM_032646chr1741449 1363 235 70 ------
NM_032682chr373323 3137 2583 2437 831 599 125 23257 3153 ----
NM_032717chr42298 240 --1867 --
NM_032777chr81536 ------
NM_032784chr61219 ----1672
NM_032801chr112712 127 ------
NM_032804chr101271 --12206 --
NM_032811chr1121584 30 1172 ----
NM_032812chr101299 ------
NM_032813chr132833 806 1727 ----
NM_032826chr755170 2055 674 630 75 --23404 544 11397
NM_032833chr1----1249 12421
NM_032840chr122370 272 ------
NM_032846chr14180 ------
NM_032866chr1513123 23103 2914 12649 --
NM_032870chr61452 ------
NM_032871chr1131535 1529 679 ------
NM_032883chr201888 ------
NM_032900chr1023622 204 ----13482
NM_032905chr1031064 488 292 ------
NM_032926chrX155 188 ----
NM_032932chr1745351 2048 1343 1053 ------
NM_032943chr111150 ------
NM_032951chr7147 ------
NM_032953chr7147 ------
NM_032978chr182124 45 ------
NM_032979chr182124 45 ------
NM_032981chr182124 45 ------
NM_032982chr752356 2203 1783 1047 369 1996 ----
NM_033018chrX1436 ------
NM_033020chr123686 3140 ------
NM_033023chr71417 1879 1391 21153 79
NM_033025chr191299 ------
NM_033027chr321145 46 ------
NM_033030chr24525 500 335 180 ------
NM_033044chr11977 1336 ----
NM_033055chr111068 ------
NM_033056chr102613 135 --1717 --
NM_033081chr203372 255 179 ------
NM_033089chr2051422 1404 526 259 88 ------
NM_033121chr1211385 --21489 383 --
NM_033132chr131490 --1861 --
NM_033135chr1132496 1918 148 ----1675
NM_033138chr721932 737 ------
NM_033139chr721932 737 ------
NM_033140chr721932 737 ------
NM_033141chr14--11691 11996 --
NM_033143chr421313 325 1575 122 --
NM_033157chr721932 737 ------
NM_033161chr932023 1986 1449 11918 11400 --
NM_033211chr531317 794 764 ----11852
NM_033222chr931323 1285 245 ------
NM_033225chr842670 2582 2026 952 --1200 --
NM_033227chr5--1540 ----
NM_033260chr61806 ------
NM_033267chr54797 714 639 45 ------
NM_033272chr21317 --141 --
NM_033290chrX23207 25 --12677 --
NM_033300chr121447 428 ------
NM_033305chr931459 1323 1010 ------
NM_033326chr1112346 ------
NM_033331chr922671 107 ----1571
NM_033360chr1223321 1306 11526 14441 --
NM_033375chr17139 1318 ----
NM_033380chrX2936 450 ------
NM_033381chrX2936 450 ------
NM_033389chr1774569 4452 4186 3936 1771 1632 542 21097 548 ----
NM_033401chr161403 1376 ----
NM_033425chr1133369 2230 423 ------
NM_033426chr1441894 733 568 258 ------
NM_033427chr72856 180 ------
NM_033480chr633018 2886 2710 ------
NM_033481chr633018 2886 2710 ------
NM_033495chrX11033 ------
NM_033505chr264417 4238 1834 1442 1277 309 ------
NM_033512chr852638 2631 2340 435 173 22213 539 ----
NM_033515chr621372 420 ------
NM_033535chr41930 21080 266 11074 --
NM_033540chr31383 ------
NM_033549chr51957 ------
NM_033551chr533459 3388 693 13429 ----
NM_033631chr153426 3411 3109 3039 785 --11247 --
NM_033637chr1024049 377 --13712 --
NM_033644chr552415 1780 829 737 369 ------
NM_033645chr552415 1780 829 737 369 ------
NM_033656chr2145627 5589 4209 1763 ------
NM_037370chr15165 ------
NM_044472chr11514 1587 ----
NM_052818chr131173 11850 ----
NM_052840chr1541336 1225 1212 363 ------
NM_052854chr11--1633 ----
NM_052867chr1321061 44 ------
NM_052869chr1741449 1363 235 70 ------
NM_052876chr1942380 1891 788 456 ------
NM_052879chr1223168 955 ------
NM_052880chr2221307 116 ----1351
NM_052885chr1274644 3576 3340 1811 1758 1442 1183 ----23771 1885
NM_052897chr121864 ------
NM_052898chr811383 --11414 --
NM_052900chr831836 241 221 ----1323
NM_052904chr621219 1127 198 11046 --
NM_052905chr211259 ------
NM_052907chr1214305 --1964 --
NM_052910chr1311508 ------
NM_052911chr181854 ------
NM_052917chr222448 38 42910 2061 396 264 ----
NM_052918chr1053479 3276 3225 3111 733 ------
NM_052925chr193954 182 144 ------
NM_052927chr5--12086 1410 --
NM_052932chr1122217 912 --1425 1529
NM_052937chr841959 1022 600 437 12289 ----
NM_052962chr651803 1703 1696 1254 454 ------
NM_052971chr5--1143 ----
NM_053001chr81325 ------
NM_053002chr3--130 1291 --
NM_053016chr967847 1685 534 213 190 131 ------
NM_053023chr1153251 2591 2064 1325 1311 11331 11086 --
NM_053043chr7186173 6040 5967 5948 5514 5276 5081 4817 4713 4110 4053 4026 1621 1558 1547 1066 275 255 11445 ----
NM_053053chr11897 ------
NM_053056chr1143105 2934 2268 320 --1513 --
NM_053064chr1421066 968 --1737 --
NM_053067chr91305 173 ----
NM_053281chrX1265 ------
NM_054025chr1122220 1666 ------
NM_054033chr22612 212 ------
NM_057158chr82920 802 ------
NM_057159chr921366 473 ------
NM_057164chr21114 ------
NM_057165chr21114 ------
NM_057166chr21114 ------
NM_057167chr21114 ------
NM_057175chr41140 --11814 --
NM_057178chr1722180 1833 12824 --1460
NM_058172chr421434 154 ------
NM_058237chr14------1287
NM_058241chr2--1133 ----
NM_058241chr2--1133 ----
NM_058243chr191738 ------
NM_078485chr62642 488 ------
NM_078626chr11335 ------
NM_080546chr942226 1547 919 481 ------
NM_080552chr203195 93 28 ------
NM_080591chr931111 749 42 ------
NM_080597chr181270 ------
NM_080599chr1021041 929 ------
NM_080607chr201334 ------
NM_080629chr11942 ------
NM_080630chr11942 ------
NM_080632chrX2821 201 ------
NM_080645chr632127 760 79 ------
NM_080651chr8193 125 ----
NM_080676chr2042921 2306 2296 341 12341 ----
NM_080678chr2--1607 ----
NM_080702chr6196 ------
NM_080703chr6196 ------
NM_080738chr121726 633 ------
NM_080759chr1312340 12111 ----
NM_080760chr1312340 12111 ----
NM_080862chr311314 1514 ----
NM_080867chr1444764 3903 1532 1260 --11868 --
NM_080872chr843603 1227 347 73 33976 3011 53 ----
NM_080927chr333048 2983 589 32272 167 33 ----
NM_130391chr933396 538 414 13201 23511 2708 --
NM_130392chr933396 538 414 13201 23511 2708 --
NM_130393chr933396 538 414 13201 23511 2708 --
NM_130435chr101168 ------
NM_130436chr2172665 2092 1954 1127 1108 1072 901 ----12451
NM_130438chr2133242 2669 2531 ----13028
NM_130797chr731661 1499 546 ------
NM_130798chr1541282 554 374 293 ------
NM_130808chr31125 ------
NM_130809chr533159 2386 401 ------
NM_130811chr202887 59 ------
NM_130831chr332630 2490 1081 11955 --22718 155
NM_130832chr332630 2490 1081 11955 --22718 155
NM_130833chr332630 2490 1081 11955 --22718 155
NM_130834chr332630 2490 1081 11955 --22718 155
NM_130835chr332630 2490 1081 11955 --22718 155
NM_130836chr332630 2490 1081 11955 --22718 155
NM_130837chr332630 2490 1081 11955 --22718 155
NM_130838chr1531818 1684 521 ----11869
NM_130839chr1531818 1684 521 ----11869
NM_130846chr12--1392 ----
NM_133170chr2047252 1794 700 306 12497 ----
NM_133172chr5--161 ----
NM_133173chr5--161 ----
NM_133174chr5--161 ----
NM_133177chr1----21112 939 --
NM_133178chr1----21112 939 --
NM_133264chr1723539 1458 1545 ----
NM_133265chrX62965 1003 725 304 294 42 --1630 --
NM_133334chr422126 1075 --25567 5503 11170
NM_133443chr1631867 1722 1614 ------
NM_133494chr1----1112 --
NM_133496chr151644 1476 1158 435 151 ------
NM_133499chrX1857 --1379 --
NM_133631chr321269 121 --21058 266 --
NM_133638chr51154 ------
NM_133642chr222342 97 ------
NM_133646chr255607 5570 5241 4917 957 ----1965
NM_133647chr1523281 22 ------
NM_134265chr1721149 289 ------
NM_134270chr22----1135 --
NM_134442chr21245 11274 2577 155 --
NM_134447chr191424 ------
NM_138270chrX43409 2425 1088 315 1528 12297 --
NM_138328chr1733011 1054 214 12987 ----
NM_138346chr1121 ------
NM_138350chr141159 461 308 87 ------
NM_138357chr1011231 --1104 --
NM_138370chr21680 ------
NM_138423chr1512305 11946 ----
NM_138426chr732297 2157 2096 --12202 --
NM_138437chrX----161 --
NM_138440chr161480 1463 ----
NM_138473chr1254958 3911 3354 625 235 --14491 --
NM_138479chr121373 379 --11542 11420
NM_138492chr51384 ------
NM_138494chr722809 860 --12827 --
NM_138558chr1--11024 ----
NM_138565chr112175 148 11293 ----
NM_138576chr1443537 3439 3431 440 13248 11032 --
NM_138609chr5------1374
NM_138610chr5------1374
NM_138638chr1421647 1520 12117 ----
NM_138693chr7161 ------
NM_138713chr1656942 5727 5668 2651 1817 16020 --11198
NM_138714chr1656942 5727 5668 2651 1817 16020 --11198
NM_138727chr12958 739 ------
NM_138728chr12958 739 ------
NM_138730chr6----1370 --
NM_138731chr1453909 3711 2823 1208 974 ------
NM_138736chr1634245 1313 267 ------
NM_138768chr112828 710 ------
NM_138771chr73458 370 188 ------
NM_138782chr531931 1915 1732 ------
NM_138792chr15193 ------
NM_138795chr121545 612 ------
NM_138931chr3121 ------
NM_138970chr1442379 2202 776 148 11640 ----
NM_138971chr11--22521 481 --11312
NM_138971chr11--22521 481 --11312
NM_138972chr11--22521 481 --11312
NM_138972chr11--22521 481 --11312
NM_138973chr11--22521 481 --11312
NM_138973chr11--22521 481 --11312
NM_138994chr161403 1376 ----
NM_139012chr621634 368 ------
NM_139035chrX3728 576 297 ------
NM_139045chr91770 --1855 --
NM_139057chr1552598 355 332 155 142 ------
NM_139072chr22856 232 ------
NM_139076chr421464 192 ------
NM_139167chr8--1507 ----
NM_139168chr51440 11791 ----
NM_139207chr1211912 --11932 --
NM_139215chr17172 ------
NM_139244chr6--1356 ----
NM_139279chr232928 2595 1039 ------
NM_139283chr122997 650 ------
NM_139312chr1031272 126 81 ------
NM_139318chr14192 ------
NM_139319chr12------1441
NM_139321chr201904 ------
NM_139323chr2041859 1795 1473 746 ------
NM_144498chr2021841 1598 ------
NM_144567chr162751 2738 2349 2205 531 130 ------
NM_144568chr142676 204 ------
NM_144570chr1642067 779 747 537 --12365 --
NM_144571chr496866 6411 6155 5632 5057 4483 2746 1386 1135 16660 ----
NM_144578chr1465430 4867 3444 1173 774 29 14795 ----
NM_144586chr231051 870 390 11184 ----
NM_144595chr132928 306 ------
NM_144599chr15--25432 747 25245 2139 --
NM_144628chr2052816 1016 691 612 302 21213 888 ----
NM_144632chr241915 1702 1638 593 1947 ----
NM_144635chr331113 448 416 ------
NM_144664chr11----22355 508 --
NM_144721chr432592 824 104 12511 --2479 382
NM_144723chr51287 ------
NM_144726chr52162 26 1786 ----
NM_144732chr1921072 771 ------
NM_144767chr1562814 1511 1444 1418 1291 1285 --23658 3410 --
NM_144775chr1754920 4265 3133 1976 1462 11651 ----
NM_144778chr1332452 2312 1774 ------
NM_144949chr232324 714 39 ----1697
NM_144963chr822634 2068 1905 1195 --
NM_144967chrX1367 1729 ----
NM_144973chr1225346 269 13592 ----
NM_144979chr41626 ------
NM_144982chr122758 296 ------
NM_145008chr112857 339 ------
NM_145012chr102758 659 ------
NM_145037chr32600 560 11483 1658 --
NM_145049chr5157 1997 ----
NM_145055chr1833707 3132 3018 ------
NM_145056chr19198 1331 ----
NM_145109chr171877 1673 ----
NM_145117chr111540 12034 2633 611 --
NM_145159chr143683 649 304 --1729 --
NM_145160chr151358 ------
NM_145203chr131360 ------
NM_145206chr1043289 2783 1146 222 --22214 526 --
NM_145246chr1011131 ------
NM_145251chr1411563 21287 242 --11481
NM_145259chr245306 5296 2111 565 15191 1793 --
NM_145284chrX32484 591 473 127 11610 --
NM_145305chrX11044 ------
NM_145307chr1034416 3917 1113 ------
NM_145313chr1021421 213 ------
NM_145320chr782922 2906 2832 1092 835 160 113 45 ------
NM_145321chr782922 2906 2832 1092 835 160 113 45 ------
NM_145322chr782922 2906 2832 1092 835 160 113 45 ------
NM_145341chr1011358 --1438 --
NM_145349chr17----1592 --
NM_145649chr611751 22527 610 ----
NM_145655chr611751 22527 610 ----
NM_145690chr811377 ------
NM_145698chr1042106 1763 343 108 --1821 --
NM_145716chr11442 ------
NM_145735chr1332199 1134 51 ------
NM_145739chr21119 ------
NM_145799chrX33120 3036 2047 --12912 --
NM_145800chrX145 ------
NM_145808chr742375 2161 2070 1146 --13001 --
NM_145810chr221252 1200 ------
NM_145861chr121726 633 ------
NM_145891chr161603 11632 ----
NM_145892chr161603 11632 ----
NM_145893chr162725 110 11754 ----
NM_147147chr624190 4033 23738 97 23698 3321 --
NM_147150chr963931 3080 2636 2498 512 34 ------
NM_147166chr71845 ------
NM_147171chr7----174 --
NM_147175chrX11909 --1763 --
NM_147185chr7----174 --
NM_147189chr831795 591 40 --11616 --
NM_147223chr22976 345 --12133 --
NM_147233chr22793 162 --11950 --
NM_148174chr821576 244 --1470 --
NM_148898chr721083 879 ------
NM_148899chr721083 879 ------
NM_148904chr11639 ------
NM_148905chr11639 ------
NM_148906chr11639 ------
NM_148907chr11639 ------
NM_148908chr11639 ------
NM_148909chr11639 ------
NM_148955chr1565094 5072 1575 1528 914 331 24754 214 14095 --
NM_152222chr1131535 1529 679 ------
NM_152227chr20--1622 ----
NM_152261chr1212128 --11989 --
NM_152277chr522020 605 --12155 1595
NM_152280chr142660 2262 2208 198 11348 ----
NM_152282chr31102 --11200 --
NM_152323chr121158 ------
NM_152327chr14284 72 ------
NM_152330chr1452486 2313 1854 808 316 22165 820 --1259
NM_152346chr1731106 760 39 --1191 --
NM_152375chr112638 ------
NM_152384chr2----1385 --
NM_152388chr212675 23690 2999 ----
NM_152390chr21605 ----1194
NM_152400chr431610 1361 576 ------
NM_152407chr512407 ------
NM_152409chr531254 503 138 1312 ----
NM_152410chr6164 --1479 --
NM_152414chr821233 344 ------
NM_152418chr8----1640 --
NM_152441chr121248 ------
NM_152451chr151637 ------
NM_152470chr1823984 3086 1697 ----
NM_152487chr131322 1128 976 --11346 --
NM_152493chr131386 1164 307 ------
NM_152520chr21479 ------
NM_152523chr21719 ------
NM_152551chr653030 1083 262 143 113 ------
NM_152556chr721924 1866 --11948 --
NM_152581chrX3388 360 105 ------
NM_152588chr121641 --11193 --
NM_152594chr151152 12256 ----
NM_152608chr112122 12535 ----
NM_152609chr121200 388 ------
NM_152622chr521393 1317 ------
NM_152624chr5105144 4983 4591 4548 2721 1708 1645 960 603 236 46548 6192 2089 1474 25839 2626 --
NM_152629chr943990 3609 2790 1058 --1682 --
NM_152636chr1112453 ------
NM_152641chr1212442 12665 12548 --
NM_152653chr32651 461 ------
NM_152663chr11327 ------
NM_152688chr6--1769 ----
NM_152704chr133751 745 81 1289 ----
NM_152716chr1111020 ----11574
NM_152734chr634314 662 88 14210 11157 11833
NM_152736chr61150 1683 ----
NM_152737chr611853 12084 ----
NM_152740chr71109 1704 ----
NM_152742chr71431 ------
NM_152754chr733116 2352 681 ----1341
NM_152756chr523582 526 1831 ----
NM_152758chr8----12614 11913
NM_152774chr732611 2404 2201 --12753 --
NM_152780chrX--1336 11229 --
NM_152787chrX53566 3161 2517 548 448 --1859 --
NM_152789chr71213 ------
NM_152793chr734106 3802 1582 11113 14997 --
NM_152826chr1565094 5072 1575 1528 914 331 24754 214 14095 --
NM_152835chr111988 1171 ----
NM_152836chr821274 184 ------
NM_152837chr821274 184 ------
NM_152860chr121426 ------
NM_152862chr23300 166 114 ------
NM_152868chr221390 ------
NM_152896chr91723 --1554 --
NM_152924chr1596352 5338 4439 1843 944 586 337 279 190 1794 ----
NM_152991chr112721 219 ------
NM_153000chr181187 161 ----
NM_153020chr6--21698 1455 ----
NM_153029chr1654156 4003 3948 2899 384 --13556 --
NM_153035chr132280 183 72 --23028 2795 --
NM_153042chr611165 21486 1198 ----
NM_153047chr6----1316 --
NM_153048chr6----1316 --
NM_153050chr2224628 769 --11338 --
NM_153051chr2224628 769 --11338 --
NM_153184chr341408 746 506 251 ------
NM_153188chr523812 3741 23490 207 11226 --
NM_153207chr1222598 324 33363 1638 315 13581 --
NM_153211chr18----1443 --
NM_153223chr511495 ------
NM_153252chrX1380 --1119 --
NM_153255chr6------1953
NM_153260chr151218 --11222 --
NM_153261chr1611560 --1179 --
NM_153262chr132774 2589 677 1131 12171 --
NM_153273chr362701 2478 2301 2247 2122 91 ------
NM_153331chr31506 --1152 --
NM_153332chr832124 883 781 ------
NM_153347chr11----22474 948 --
NM_153354chr51350 ------
NM_153360chr201554 ------
NM_153365chr422138 307 1820 12310 --
NM_153367chr1022940 1195 ------
NM_153377chr12--1120 ----
NM_153464chr192667 268 ------
NM_153499chr1252062 1221 386 374 163 ------
NM_153500chr1252062 1221 386 374 163 ------
NM_153607chr51409 --140 --
NM_153616chr1522129 1511 12227 ----
NM_153617chr1522129 1511 12227 ----
NM_153618chr1522129 1511 12227 ----
NM_153619chr1543367 2749 356 31 13465 ----
NM_153631chr7165 --2454 173 --
NM_153632chr7165 --2454 173 --
NM_153634chr1231535 555 56 11303 1129 --
NM_153649chr132067 774 116 --1906 --
NM_153686chr41865 12149 ----
NM_153689chr2--1896 ----
NM_153712chr223038 930 2784 715 ----
NM_153756chr121795 1519 ------
NM_153757chr42485 400 ----1800
NM_153759chr2----1870 --
NM_153810chr1064916 3509 2018 1927 552 21 23738 430 24695 1168 --
NM_153827chr172158 100 ------
NM_153828chr21606 ------
NM_153831chr81732 --1246 --
NM_153836chr221857 364 --1615 --
NM_170606chr71248 ------
NM_170607chr1721590 1104 1966 ----
NM_170663chr172158 100 ------
NM_170665chr1233631 3531 143 11355 13895 --
NM_170674chr151930 ------
NM_170677chr151930 ------
NM_170679chr521181 877 ------
NM_170696chr1531604 1261 54 ------
NM_170697chr1531604 1261 54 ------
NM_170706chr124207 3420 14249 11623 --
NM_170711chr193938 892 757 ------
NM_170721chr1731281 1190 927 21299 1235 ----
NM_170731chr1132651 818 458 2515 309 ----
NM_170732chr1132651 818 458 2515 309 ----
NM_170733chr1132651 818 458 2515 309 ----
NM_170734chr1132651 818 458 2515 309 ----
NM_170735chr1132651 818 458 2515 309 ----
NM_170751chr611072 ------
NM_170752chr611072 ------
NM_170769chr62584 52 ------
NM_171825chr533168 2396 628 ------
NM_171999chr183663 237 40 ------
NM_172020chr731360 618 557 ------
NM_172037chr831410 459 444 ------
NM_172069chr21767 --1439 --
NM_172070chr21149 ------
NM_172071chr187469 7068 6047 2028 1999 1399 1242 505 14618 1896 --
NM_172110chr20----2666 492 --
NM_172111chr20----2666 492 --
NM_172112chr20----2666 492 --
NM_172113chr20----2666 492 --
NM_172159chr3--2905 647 ----
NM_172160chr3--2905 647 ----
NM_172169chr1021713 1593 ----1281
NM_172170chr1021713 1593 ----1281
NM_172171chr1021713 1593 ----1281
NM_172173chr1021713 1593 ----1281
NM_172193chr14--11298 ----
NM_172200chr102612 459 154 ----
NM_172216chr1251964 1123 288 276 65 ------
NM_172218chr82780 173 ------
NM_172226chr1252062 1221 386 374 163 ------
NM_172315chr151930 ------
NM_172316chr151930 ------
NM_172354chr131627 310 29 11546 ----
NM_172373chr131441 11059 1910 --
NM_173078chrX----1328 --
NM_173082chr641098 1090 1017 452 ------
NM_173156chr141804 802 523 421 ------
NM_173163chr162422 127 1471 1378 --
NM_173165chr161303 1352 ----
NM_173171chr211032 ------
NM_173172chr211340 ------
NM_173173chr211032 ------
NM_173191chr1021306 344 ------
NM_173192chr1021306 344 ------
NM_173193chr1021306 344 ------
NM_173194chr1021306 344 ------
NM_173195chr1021306 344 ------
NM_173198chr932879 1199 374 --11942 --
NM_173199chr91478 ------
NM_173200chr932879 1199 374 --11942 --
NM_173214chr1656942 5727 5668 2651 1817 16020 --11198
NM_173359chr341580 1253 428 207 ------
NM_173468chr445399 5307 548 294 --12392 --
NM_173469chr1511488 139 ----
NM_173473chr1022739 2641 --1584 --
NM_173492chr9189 ------
NM_173494chrX1638 --1806 --
NM_173500chr151985 --11396 --
NM_173508chr12909 271 --1223 --
NM_173510chr2262943 2500 2458 2452 2418 2377 ----1805
NM_173511chr263430 573 272 204 194 79 --2721 527 1817
NM_173513chr2199 ------
NM_173515chr6153 ------
NM_173519chr81196 ------
NM_173552chr342048 1836 1617 428 ------
NM_173554chr101294 ------
NM_173570chr3----12237 --
NM_173576chr1011437 12144 1511 --
NM_173595chr1225028 3259 11650 --1876
NM_173602chr1243733 3447 3248 2526 12534 1216 --
NM_173633chr191238 ------
NM_173642chr188827 8809 8227 7615 7581 2236 658 630 --11152 --
NM_173644chr2012005 11440 ----
NM_173653chr331345 1258 1198 ------
NM_173667chr521765 585 11583 11526 --
NM_173683chr821285 508 --11172 --
NM_173694chrX12515 --1996 --
NM_173698chrX21737 412 ------
NM_173797chr521278 91 ------
NM_173809chr102394 239 ------
NM_173814chr151127 ------
NM_173822chr211765 --11581 --
NM_173825chr312327 --13133 --
NM_173826chr3--1122 11214 --
NM_173851chr853262 935 875 688 558 ------
NM_174916chr151162 --12395 --
NM_175061chr721929 1407 1123 1589 12058
NM_175566chr11123 134 ----
NM_175607chr3--21181 1172 ----
NM_175610chr1521113 247 ------
NM_175612chr3--21181 1172 ----
NM_175624chr1266925 6907 4855 4723 1919 1124 11006 ----
NM_175625chr1266925 6907 4855 4723 1919 1124 11006 ----
NM_175629chr2----1870 --
NM_175630chr2----1734 --
NM_175634chr811236 1346 ----
NM_175635chr811236 1346 ----
NM_175636chr811236 1346 ----
NM_175736chr1266453 5943 5780 2853 2831 186 ------
NM_175747chr631000 806 400 ------
NM_175748chr1422066 45 ------
NM_175767chr521557 245 ------
NM_175852chr122951 2346 ------
NM_175854chr1322655 266 --1403 --
NM_175858chr212318 274 ------
NM_175859chrX11732 --11640 --
NM_175861chr1275825 5727 5583 4840 4517 174 71 --32215 597 303 --
NM_175863chr6------1443
NM_175873chr531346 525 438 ------
NM_175874chr12--1158 ----
NM_175884chr731406 403 324 ------
NM_175921chr532990 2626 428 13377 12923 --
NM_176814chr711471 --11323 --
NM_177422chr11218 ------
NM_177424chr131966 789 48 ------
NM_177438chr1433316 2824 247 22919 1684 --22851 270
NM_177454chr21174 ------
NM_177524chr711152 ------
NM_177525chr711152 ------
NM_177539chr12358 118 --141 --
NM_177553chr111838 1359 ----
NM_177947chrX1212 ------
NM_177948chrX1212 ------
NM_177949chrX182 ------
NM_177952chr14--1332 ----
NM_177968chr252238 2046 729 111 25 ----11504
NM_177972chr1144066 3670 3438 3112 21741 1163 14454 14430
NM_177974chr1512305 11946 ----
NM_177976chr31384 ------
NM_177985chr221930 181 ------
NM_177989chr34347 314 265 251 ------
NM_177996chr20----1932 --
NM_178011chr101487 ------
NM_178014chr61965 ------
NM_178037chr1232280 936 549 22486 375 1817 --
NM_178038chr1232280 936 549 22486 375 1817 --
NM_178039chr122571 184 12121 1452 --
NM_178040chr122571 184 12121 1452 --
NM_178042chr34347 314 265 251 ------
NM_178120chr221344 1219 ------
NM_178123chr2--1250 ----
NM_178135chr421282 237 ----11377
NM_178140chr552011 1961 861 470 132 ------
NM_178151chrX55444 4858 2936 1506 1423 16936 22984 97 --
NM_178152chrX55444 4858 2936 1506 1423 16936 22984 97 --
NM_178153chrX55444 4858 2936 1506 1423 16936 22984 97 --
NM_178313chr222143 1557 ------
NM_178423chr72468 262 ------
NM_178425chr72468 262 ------
NM_178427chr131785 856 744 ------
NM_178498chr1123950 3107 1339 ----
NM_178507chr11--1786 ----
NM_178509chr1721656 542 ------
NM_178517chr171640 --174 --
NM_178544chr1931539 1498 257 11227 ----
NM_178565chr841690 596 485 173 ------
NM_178566chr941299 588 508 250 ------
NM_178585chr422833 2717 ------
NM_178586chr1442261 1664 511 473 1393 11782 --
NM_178812chr8----1443 --
NM_178815chr1031701 926 342 ------
NM_178830chr191697 --1237 --
NM_178835chr4----1678 --
NM_178864chr111585 ------
NM_180976chr61745 ----1967
NM_180977chr61745 ----1967
NM_180989chr1322136 445 1455 ----
NM_181093chr11107 ------
NM_181291chr141251 ------
NM_181310chr651936 1836 1829 1387 587 ------
NM_181332chrX--1263 1730 --
NM_181353chr205577 552 210 136 51 ------
NM_181354chr81667 ----1107
NM_181358chr143972 3884 3532 360 --13997 --
NM_181443chr2032765 2538 183 22419 514 1272 --
NM_181453chr2--1551 ----
NM_181458chr221212 1032 --1917 --
NM_181481chr1866860 6622 5885 1269 442 279 15446 25126 4946 --
NM_181482chr1866860 6622 5885 1269 442 279 15446 25126 4946 --
NM_181483chr1866860 6622 5885 1269 442 279 15446 25126 4946 -