TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-5191
miRNA Sequence: AGGAUAGGAAGAAUGAAGUGCU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000044chrX1372 ------
NM_000051chr1132977 680 352 1712 --1803
NM_000052chrX13477 ------
NM_000081chr121614 747 1134 --11525
NM_000084chrX76670 6329 5178 2200 2174 1319 529 16478 --17011
NM_000089chr71764 ------
NM_000092chr284020 3921 3790 3463 3365 3104 2935 1183 ------
NM_000112chr595012 4718 4226 3461 1871 1413 854 775 507 45266 4252 4140 1724 1565 --
NM_000125chr644280 3803 3104 1665 ----13368
NM_000138chr1571785 1670 1003 858 548 415 134 ------
NM_000151chr1721761 1408 ------
NM_000163chr522195 201 ------
NM_000167chrX21251 1134 191 ----
NM_000176chr532418 949 931 11450 ----
NM_000202chrX33292 1219 569 --32683 2545 2498 --
NM_000216chrX31550 745 499 ------
NM_000217chr1265384 3598 3286 2000 1662 1123 ------
NM_000223chr171104 ----1139
NM_000238chr71396 ------
NM_000252chrX11129 ------
NM_000264chr963277 3264 3105 2246 1143 1124 ------
NM_000267chr1733286 2816 420 --168 1732
NM_000321chr1341313 1219 494 333 ----1448
NM_000332chr676580 6285 6207 6107 4440 1111 39 21896 1580 --15820
NM_000337chr586236 4837 4277 4265 2651 2495 695 98 --24667 2169 --
NM_000340chr331188 1074 617 11223 ----
NM_000361chr2041991 734 492 137 ------
NM_000362chr2283661 3492 3441 3087 2994 2694 1219 172 22966 923 11241 --
NM_000368chr944808 4122 4094 1415 14266 24056 3792 --
NM_000379chr231181 349 299 11335 ----
NM_000386chr171655 1222 ----
NM_000388chr33817 483 290 --1925 --
NM_000393chr221682 757 11717 1158 --
NM_000397chrX22131 1779 22182 1940 ----
NM_000408chr243477 2692 485 417 --13456 --
NM_000428chr1422472 2403 ----22675 247
NM_000430chr1752493 1455 870 605 360 13470 11124 --
NM_000439chr561856 893 759 518 420 225 ------
NM_000448chr1132387 2153 2054 ------
NM_000449chr141125 1070 247 90 ------
NM_000461chr354130 3942 1454 1188 832 44534 3797 901 488 33445 1481 1226 --
NM_000533chrX21964 547 11425 ----
NM_000534chr21192 ------
NM_000538chr131210 ------
NM_000544chr6_cox_hap1113131 3119 2979 2930 2580 2234 2176 1342 910 694 667 --1407 --
NM_000555chrX97418 6110 5667 5237 2583 2015 839 317 46 16531 17295 --
NM_000586chr42194 97 ------
NM_000594chr6--1766 ----
NM_000599chr21996 23132 125 ----
NM_000618chr1225659 5327 56146 2194 2077 1799 1510 25079 2155 --
NM_000618chr1225659 5327 56146 2194 2077 1799 1510 25079 2155 --
NM_000633chr1894620 3834 3763 3731 3457 1463 1266 1152 289 --13642 --
NM_000693chr1531449 1390 1236 --11570 --
NM_000719chr1231977 1385 1012 35405 4241 2001 46038 4477 4425 4206 --
NM_000724chr1021588 1410 --1744 --
NM_000793chr1443419 1034 121 91 ------
NM_000800chr511613 --1379 --
NM_000807chr4----1281 --
NM_000809chr4139012 7139 6889 6343 6231 6166 6131 5771 5679 2582 2101 1956 1545 --48421 7481 6928 2194 --
NM_000810chr15199 ------
NM_000813chr553609 1937 1637 1072 809 11914 1131 --
NM_000826chr442379 2045 1811 115 --1782 --
NM_000829chr1132273 2038 1960 22123 1953 ----
NM_000831chr185833 5598 5087 4875 4395 4237 1762 1636 13861 46003 5494 5255 79 --
NM_000842chr111152 ------
NM_000860chr431485 1270 1171 --2640 62 --
NM_000865chr61206 ------
NM_000868chrX42621 2294 2276 619 12595 ----
NM_000875chr1596612 6469 6309 4569 2394 1957 1424 416 305 --1311 --
NM_000891chr1753635 3318 3133 3065 987 1310 13289 --
NM_000899chr1254231 4067 3660 3162 412 --12716 --
NM_000902chr353167 1071 1012 694 201 12731 22761 2391 --
NM_000917chr103978 715 27 ------
NM_000925chr31254 188 ----
NM_000944chr432164 757 692 11982 --11875
NM_000945chr21578 --11311 --
NM_000956chr142771 270 ------
NM_000983chr1170 ------
NM_001001323chr1242796 2391 2355 1039 ------
NM_001001342chr1081492 1147 1116 1056 1007 477 318 167 ------
NM_001001395chr1252262 633 608 521 245 ------
NM_001001396chr143443 337 321 312 24041 2853 13464 --
NM_001001433chr2023014 1201 13122 ----
NM_001001481chr823375 683 ------
NM_001001483chr111337 ------
NM_001001484chr104408 307 243 206 1575 --1583
NM_001001549chr71436 ------
NM_001001550chr71436 ------
NM_001001555chr71436 ------
NM_001001664chr253737 2613 1574 1054 413 1636 ----
NM_001001890chr2163900 2834 2771 2720 1561 507 34132 3046 947 11439 --
NM_001001974chr1022092 388 ----1757
NM_001001995chrX41788 1583 1473 419 11818 ----
NM_001002244chr17--1121 ----
NM_001002245chr17--1156 ----
NM_001002246chr17--1156 ----
NM_001002247chr17--1156 ----
NM_001002248chr17--1156 ----
NM_001002249chr17--1156 ----
NM_001002255chr62325 126 1297 ----
NM_001002838chrX31301 385 235 11497 ----
NM_001002860chr1444683 3989 3791 1107 ------
NM_001002909chr1731761 684 526 --1201 --
NM_001002919chr2174 ------
NM_001003652chr18118667 7634 6358 6215 3465 3247 2981 2677 1614 1013 934 22349 92 ----
NM_001003674chr1876910 5464 5196 4809 4775 1709 589 16723 ----
NM_001003675chr1876910 5464 5196 4809 4775 1709 589 16723 ----
NM_001003681chr2231927 1557 416 --132 --
NM_001003712chr1283993 3358 2932 1549 1172 1113 784 180 --12961 --
NM_001003792chr321199 1170 ------
NM_001003793chr321199 1170 ------
NM_001003810chr4----123 1529
NM_001003895chrY151 ------
NM_001003945chr91753 11922 1537 --
NM_001004065chr973925 2978 2949 2701 1563 656 445 ------
NM_001004304chr1253057 2283 2246 1101 1063 1394 33068 2172 101 --
NM_001004317chr634260 4114 785 --11651 --
NM_001004360chr251835 691 378 370 290 ------
NM_001004419chr1274469 3581 3416 3261 1504 635 443 11399 ----
NM_001005242chr1241295 545 103 54 1485 ----
NM_001005375chrY11837 21590 105 --1627
NM_001005404chr1754284 4210 4190 3322 1280 ------
NM_001005473chr545420 4518 2633 64 45440 5405 4709 2450 44685 4535 1361 88 --
NM_001005732chr21--2213 189 ----
NM_001005733chr21--2213 189 ----
NM_001005861chr34951 343 62 41 ------
NM_001006600chr522297 375 ------
NM_001006636chr22779 363 ------
NM_001007023chr1443419 1034 121 91 ------
NM_001007067chr831078 1044 123 --1197 --
NM_001007068chr831078 1044 123 --1197 --
NM_001007069chr831078 1044 123 --1197 --
NM_001007070chr831078 1044 123 --1197 --
NM_001007246chr2121269 520 ------
NM_001007257chr111282 ------
NM_001007792chr11204 ------
NM_001007794chr12263 153 --1517 --
NM_001008220chr553662 3414 2819 2632 335 23538 1369 1475 2900 874
NM_001008225chr71743 ------
NM_001008392chr361392 1364 819 347 313 293 --3585 338 67 --
NM_001008393chr442597 871 856 783 197 --12274
NM_001008405chr731293 1164 145 1238 ----
NM_001008529chr17171 21237 376 ----
NM_001008541chr1031678 761 426 --1670 --
NM_001008541chr1031678 761 426 --1670 --
NM_001008564chr1322242 1605 ------
NM_001008783chr61904 ------
NM_001008925chr443244 2925 1389 359 --12857 --
NM_001009552chr82579 414 ------
NM_001009554chr454028 3161 1287 776 666 ----1345
NM_001009554chr454028 3161 1287 776 666 ----1345
NM_001009894chr121554 ----1151
NM_001009899chr366253 5654 5082 4698 2402 1078 ------
NM_001009909chr1113953 23405 275 ----
NM_001009955chr1--187 ----
NM_001009955chr1--187 ----
NM_001009993chr273979 3891 3343 3090 3083 583 269 1798 23530 3472 --
NM_001010000chr1842533 2438 2407 1262 43534 3119 956 928 ----
NM_001010861chr132699 2059 1802 2604 414 1145 --
NM_001010862chrX62966 2871 2595 2258 1256 550 2919 179 ----
NM_001010870chr61519 ------
NM_001010888chrX23024 475 24349 4059 24118 1414 11586
NM_001010891chr555371 4404 2608 1265 467 --16687 --
NM_001010908chr101235 ------
NM_001010924chr10--21233 1177 ----
NM_001010927chr6--1508 ----
NM_001010971chr11131 ------
NM_001011513chr454013 3999 3592 1246 445 11010 ----
NM_001011537chr332342 1900 201 11918 ----
NM_001011546chr202132 46 ------
NM_001011553chr7--1101 ----
NM_001011645chrX1372 ------
NM_001011666chr7105169 4959 4738 4200 1564 1432 1364 640 305 204 34486 1085 649 ----
NM_001012393chr11144930 4874 4512 4188 4170 4133 3731 3610 1224 952 922 883 547 443 21533 808 13787 11162
NM_001012398chr163864 799 167 ------
NM_001012410chr31483 ------
NM_001012423chr1522695 325 --22025 1171 12622
NM_001012446chr9178 ------
NM_001012512chr181114 ------
NM_001012755chrX74752 3781 3401 3181 1723 1035 882 ------
NM_001012968chrX62432 2142 2077 925 492 392 22759 785 ----
NM_001012971chr20170 ------
NM_001012974chr6136 ------
NM_001013406chr751766 1747 1388 504 197 11270 ----
NM_001013659chr1994068 1983 1519 1447 1433 1183 469 372 355 ----14055
NM_001013734chr61690 ------
NM_001014342chr11132 ----11634
NM_001015048chr1412961 22787 132 13142 --
NM_001015049chr1412961 22787 132 13142 --
NM_001015877chrX157 13105 ----
NM_001015882chr911089 ------
NM_001017368chr1752317 581 467 302 158 ----1938
NM_001017371chr221281 497 ------
NM_001017395chr322483 2390 22413 185 1423 --
NM_001017415chr1187 1254 ----
NM_001017416chr1187 1254 ----
NM_001017423chr10159 ------
NM_001017424chr12482 141 ------
NM_001017425chr12482 141 ------
NM_001017926chr82582 398 ------
NM_001017962chr103978 715 27 ------
NM_001018009chr31407 ------
NM_001018056chr91381 ------
NM_001018067chr125146 1608 ------
NM_001018068chr125146 1608 ------
NM_001018069chr125146 1608 ------
NM_001018074chr532418 949 931 11450 ----
NM_001018075chr532418 949 931 11450 ----
NM_001018076chr532418 949 931 11450 ----
NM_001018077chr532418 949 931 11450 ----
NM_001024094chr532418 949 931 11450 ----
NM_001024372chr842251 1443 654 296 11607 1790 --
NM_001024596chr19123679 3521 3409 3304 2855 2567 2443 2408 1025 687 584 310 11222 ----
NM_001024649chr52890 461 11111 --12210
NM_001024808chr1221823 219 --11105 --
NM_001024934chr61194 ------
NM_001024935chr61194 ------
NM_001024936chr61194 ------
NM_001025076chr1095840 4912 4688 3834 2410 1540 1456 1245 664 14295 1953 --
NM_001025077chr10127198 6270 6046 5192 4779 2898 2814 2603 2022 1048 915 68 15653 22311 1169 --
NM_001025105chr511532 ------
NM_001025108chr254041 3311 1447 514 360 --13611 --
NM_001025201chr2--1598 1261 --
NM_001025233chr1252726 2284 1708 502 323 ------
NM_001025266chr334699 4317 3683 34146 1499 1406 2694 427 --
NM_001025366chr631759 1642 1443 ------
NM_001025366chr631759 1642 1443 ------
NM_001025367chr631759 1642 1443 ------
NM_001025367chr631759 1642 1443 ------
NM_001025368chr631759 1642 1443 ------
NM_001025368chr631759 1642 1443 ------
NM_001025369chr631775 1658 1459 ------
NM_001025369chr631775 1658 1459 ------
NM_001025370chr631759 1642 1443 ------
NM_001025370chr631759 1642 1443 ------
NM_001025580chrX53354 2873 704 316 81 ------
NM_001025595chr421543 1289 ----11274
NM_001025603chr141125 1070 247 90 ------
NM_001025780chr941390 1252 1235 577 --1371 --
NM_001029858chr632088 867 624 13326 ----
NM_001029863chr632775 2588 973 --13167 --
NM_001029875chr542824 1886 519 469 12304 ----
NM_001029891chrX124 ----2782 256
NM_001029989chr15----1689 --
NM_001030006chr1772519 2119 1739 936 853 735 240 --22193 558 --
NM_001030007chr1632736 1042 29 13058 1890 --
NM_001030055chr1484539 4471 4009 3512 1742 1646 1637 622 44755 4371 3985 3826 ----
NM_001031690chr762496 2104 2084 1984 1166 666 1167 1958 --
NM_001031695chr2265268 1888 1292 1272 615 319 23893 1249 ----
NM_001031709chr101342 ------
NM_001031716chr221011 320 ------
NM_001031723chr41464 ------
NM_001031732chr433565 3252 2397 21171 588 --1804
NM_001031803chr171322 ------
NM_001031804chr1633470 3195 3033 ------
NM_001031812chr521964 1953 11761 ----
NM_001032282chr81209 ------
NM_001032296chr1332742 2225 680 ----12730
NM_001032380chr1021726 490 21560 766 ----
NM_001033002chr171236 ------
NM_001033045chr264428 3868 2733 1490 1006 624 --24148 2716 --
NM_001033047chr422279 40 12564 ----
NM_001033085chr21118 ------
NM_001033087chr2052087 1219 934 335 248 22711 2067 ----
NM_001033117chr354897 4433 4057 3324 1273 13721 24760 3276 --
NM_001033503chr5----1407 --
NM_001033566chr171939 ------
NM_001033568chr171939 ------
NM_001033578chr81262 ------
NM_001033659chr172564 319 11617 11391 --
NM_001033756chr631693 1576 1377 ------
NM_001033756chr631693 1576 1377 ------
NM_001033910chr131455 393 178 12109 ----
NM_001033925chr1021497 319 12176 ----
NM_001034845chr42533 344 ------
NM_001034954chr1073041 3015 2655 2531 2239 493 158 11223 1903 --
NM_001034955chr1073041 3015 2655 2531 2239 493 158 11223 1903 --
NM_001034956chr1073041 3015 2655 2531 2239 493 158 11223 1903 --
NM_001034957chr1073041 3015 2655 2531 2239 493 158 11223 1903 --
NM_001035260chr10------11527
NM_001037132chr741916 1391 1369 46 ------
NM_001037133chr741916 1391 1369 46 ------
NM_001037277chr13609 358 269 1335 ----
NM_001037278chr13609 358 269 1335 ----
NM_001037317chr132699 2059 1802 2604 414 1145 --
NM_001037334chr1852065 549 434 374 367 1505 ----
NM_001037339chr1133 11363 1321 --
NM_001037340chr1133 11363 1321 --
NM_001037341chr1133 11363 1321 --
NM_001037341chr1133 11363 1321 --
NM_001037954chr1142421 1256 697 251 1193 11328 --
NM_001038640chr152648 393 ------
NM_001038707chr14725 691 528 317 --31900 1537 123 --
NM_001038707chr14725 691 528 317 --31900 1537 123 --
NM_001039538chr231190 929 368 1319 12586 --
NM_001039547chr3117802 7483 7274 6917 6444 6299 4883 3078 3015 2161 1703 13140 ----
NM_001039580chr434537 1083 680 23571 1425 ----
NM_001039585chr161508 1211 706 580 519 111 ----23661 838
NM_001039590chrX53064 2912 1348 141 101 --11392 --
NM_001039591chrX53064 2912 1348 141 101 --11392 --
NM_001039649chr131278 ------
NM_001039693chr263951 3859 3454 3222 3071 2804 --21104 499 1577
NM_001039762chr1011978 ------
NM_001039840chrX55122 4147 3848 936 34 --12248 14441
NM_001039916chr121444 --31036 352 337 --
NM_001039917chr121444 --31036 352 337 --
NM_001039918chr121444 --31036 352 337 --
NM_001039919chr121444 --31036 352 337 --
NM_001039920chr121444 --31036 352 337 --
NM_001039937chr1374128 3841 3129 2670 2612 1518 35 11136 12701 --
NM_001039938chr1341516 1509 982 442 ------
NM_001040001chr621950 1512 1441 ----
NM_001040020chr721317 1079 ------
NM_001040057chr721505 510 1130 ----
NM_001040092chr8130 ------
NM_001040100chr3192 --1429 --
NM_001040142chr262299 2281 2249 1820 942 666 ------
NM_001040143chr262299 2281 2249 1820 942 666 ------
NM_001040152chr775008 4771 3207 1157 674 410 347 33724 838 509 --1861
NM_001040159chr4162 ------
NM_001040214chr611924 ------
NM_001040272chr921916 371 ------
NM_001040284chr1633684 2073 1308 15166 ----
NM_001040440chr52582 212 ------
NM_001040441chr164953 3380 1464 1180 523 246 ------
NM_001040450chr1562803 2755 2302 2241 1142 687 ------
NM_001040451chr52461 302 ------
NM_001040452chr52461 302 ------
NM_001040453chr1562803 2755 2302 2241 1142 687 ------
NM_001040458chr521316 133 --11811 --
NM_001040619chr121636 1618 1419 ----
NM_001040624chr872636 2512 2311 2216 2006 713 489 --12290 --
NM_001040625chr872636 2512 2311 2216 2006 713 489 --12290 --
NM_001040626chr872636 2512 2311 2216 2006 713 489 --12290 --
NM_001040627chr872636 2512 2311 2216 2006 713 489 --12290 --
NM_001040628chr872636 2512 2311 2216 2006 713 489 --12290 --
NM_001040629chr872636 2512 2311 2216 2006 713 489 --12290 --
NM_001040630chr872636 2512 2311 2216 2006 713 489 --12290 --
NM_001040665chr784936 4674 4373 4325 1606 1008 963 762 13132 23496 1319 --
NM_001040712chr913036 23318 2378 ----
NM_001042367chr15194 ------
NM_001042388chr181202 ------
NM_001042404chr141931 1585 1545 120 ------
NM_001042414chr13--125 ----
NM_001042424chr443054 2721 877 783 --1760 --
NM_001042430chr14--148 ----
NM_001042437chr21171 1813 ----
NM_001042453chrX21706 271 ------
NM_001042473chr1022007 1782 ------
NM_001042486chr2031212 424 332 ------
NM_001042492chr1733286 2816 420 --168 1732
NM_001042510chr831360 760 535 --11471 --
NM_001042511chr831360 760 535 --11471 --
NM_001042537chrX22255 1547 ------
NM_001042548chr22772 332 ------
NM_001042550chr93831 750 141 11344 ----
NM_001042555chr1274568 4172 4138 3208 1322 1292 240 ----23509 1668
NM_001042599chr266712 6307 5553 695 553 403 26018 1546 21916 413 22532 2294
NM_001042603chr1294724 4595 4397 4182 3704 1455 854 643 178 23726 1852 ----
NM_001042646chr311245 1111 1354 --
NM_001042749chrX--11355 1693 --
NM_001042750chrX--11355 1693 --
NM_001042751chrX--11355 1693 --
NM_001043351chr112175 ------
NM_001044385chr253352 2776 1573 784 260 11584 --13613
NM_001044722chr521964 1953 11761 ----
NM_001044723chr521964 1953 11761 ----
NM_001046chr563048 2951 2265 1887 970 833 12415 ----
NM_001079874chr121727 622 ------
NM_001083620chr442377 2043 1809 115 --1781 --
NM_001095chr122502 174 1306 21626 1287 --
NM_001099678chr355568 5307 5010 632 91 1525 ----
NM_001100108chr1107035 6975 6920 6020 5942 2863 2337 1779 767 595 --1581 --
NM_001106chr389362 8858 6798 6391 3799 3306 1164 389 37745 6497 24 26922 313 --
NM_001113490chrX43233 2866 1338 444 12239 23654 2707 --
NM_001128chr1632736 1042 29 13058 1890 --
NM_001128144chr2--1193 ----
NM_001135chr151813 ------
NM_001144chr161934 11212 165 --
NM_001148chr441655 802 731 606 ------
NM_001149chr1011031 ------
NM_001151chr4184 ------
NM_001167chrX66781 6122 5285 1679 1110 960 2507 198 ----
NM_001173chr1484539 4471 4009 3512 1742 1646 1637 622 44755 4371 3985 3826 ----
NM_001186chr2153002 2410 1249 758 466 1289 ----
NM_001200chr2021129 1068 ------
NM_001204chr296700 5997 5381 5207 1764 1334 691 97 90 26249 1810 ----
NM_001219chr731551 1465 493 --12280 --
NM_001233chr722129 594 ------
NM_001259chr794995 4629 4579 4154 1966 1904 1491 1123 100 ------
NM_001270chr52152 106 ------
NM_001274chr11178 1133 183 --
NM_001278chr1031129 940 21 ------
NM_001282chr1772519 2119 1739 936 853 735 240 --22193 558 --
NM_001304chr1753317 1498 1456 1321 775 ----12673
NM_001305chr7--1804 ----
NM_001310chr1242202 698 651 216 12911 ----
NM_001331chr1142787 2718 2671 727 --31025 965 951 --
NM_001332chr521279 1156 ------
NM_001351chr341816 635 530 330 ------
NM_001389chr211374 ------
NM_001390chr1823306 301 --12606 22740 1424
NM_001396chr21--1294 1648 11871
NM_001401chr91437 11560 ----
NM_001412chrX23256 2829 ----12961
NM_001417chr1221799 410 176 ----
NM_001418chr112741 668 ------
NM_001418chr112741 668 ------
NM_001419chr1944385 3868 3568 1629 1777 23704 3574 --
NM_001420chr1922486 2442 ----1993
NM_001421chrX1339 --11393 --
NM_001426chr21233 1277 ----
NM_001427chr732053 1448 427 11640 ----
NM_001429chr2221095 410 ------
NM_001430chr221908 182 2329 286 ----
NM_001431chr6190 --1977 --
NM_001438chr132427 789 642 12712 ----
NM_001453chr641677 1197 648 416 ----11691
NM_001493chrX1710 --1189 --
NM_001497chr942488 2067 1842 1041 --22806 660 --
NM_001530chr141303 ------
NM_001543chr564510 3703 3293 1125 324 300 24764 3440 21867 394 --
NM_001553chr4--1167 ----
NM_001554chr11479 ------
NM_001609chr1031563 1134 670 23723 729 ----
NM_001616chr223510 1222 23205 2864 12351 --
NM_001629chr131216 --1247 --
NM_001650chr1893379 2995 1473 1327 702 337 246 183 45 12521 11062 --
NM_001660chr31334 ------
NM_001663chr141419 22113 1838 ----
NM_001668chr12874 600 ------
NM_001681chr122779 289 ------
NM_001682chr1242510 2105 2069 753 ------
NM_001684chr143160 54 38 29 23758 2570 13181 --
NM_001690chr312099 --22548 1824 --
NM_001704chr6297 79 ------
NM_001730chr13163 1543 ----
NM_001730chr13163 1543 ----
NM_001731chr121943 ------
NM_001743chr22156 73 1434 ----
NM_001746chr52890 461 11111 --12210
NM_001754chr2163900 2834 2771 2720 1561 507 34132 3046 947 11439 --
NM_001759chr1255218 3875 3489 3458 200 1752 24784 4630 --
NM_001769chr121366 ------
NM_001773chr111372 --21208 546 --
NM_001788chr7--1101 ----
NM_001789chr341281 545 303 197 ------
NM_001802chr163366 41 34 ----1890
NM_001819chr20--1117 ----
NM_001822chr2--1598 1261 --
NM_001825chr5----1115 --
NM_001829chr42392 258 ------
NM_001830chrX63878 3842 3758 1330 991 75 ----1610
NM_001839chr1----1744 --
NM_001844chr121371 ------
NM_001854chr121018 263 ------
NM_001856chr11154 1288 ----
NM_001858chr6105011 3805 3749 3193 1960 1870 927 534 401 276 --25159 156 --
NM_001892chr511532 ------
NM_001895chr2011097 ------
NM_001904chr311013 ------
NM_001918chr1179126 9035 8254 6865 6856 6723 6577 5961 3126 3104 3072 2878 2223 2206 2036 1137 641 ------
NM_001920chr12----1661 --
NM_001935chr22215 153 ------
NM_001938chr121177 77 ------
NM_001939chrX43637 1388 836 743 11228 ----
NM_001942chr1811480 --11316 --
NM_001965chr2------2391 163
NM_001967chr31189 ------
NM_001968chr41212 ----1322
NM_001977chr421693 1593 ------
NM_002009chr1532298 1980 822 --1358 12709
NM_002010chr131443 ------
NM_002025chrX88328 7812 7552 6303 3653 1140 793 656 37573 5843 1508 38765 6686 2524 --
NM_002031chr6199 ------
NM_002033chr1143814 1489 774 588 --23326 600 --
NM_002072chr91229 1177 ----
NM_002077chr941577 536 503 192 21355 1348 ----
NM_002091chr181114 ------
NM_002092chr444035 3789 3655 726 23416 241 24866 4798 1679
NM_002126chr1774024 3547 1635 1535 861 737 53 1633 33857 3586 3130 --
NM_002135chr12----1208 --
NM_002137chr732403 1524 112 ------
NM_002138chr4----123 1529
NM_002139chrX160 1517 ----
NM_002141chr72155 29 ------
NM_002145chr171290 ------
NM_002146chr1741202 1111 885 446 ------
NM_002156chr21316 ------
NM_002158chr21666 21002 801 23613 2877 --
NM_002182chr352221 2035 1059 282 154 1699 21844 737 11068
NM_002192chr71495 ------
NM_002196chr201969 11126 1946 --
NM_002196chr201969 11126 1946 --
NM_002199chr4189 ------
NM_002203chr543367 2848 1023 222 --23471 2876 13092
NM_002210chr221439 624 ------
NM_002214chr775313 4770 3882 2014 1890 919 322 --11926 --
NM_002223chr1243764 3477 3234 94 ------
NM_002232chr12554 286 ------
NM_002234chr123768 195 167 ------
NM_002239chr2--1716 ----
NM_002264chr343774 3764 3071 1138 24329 3682 ----
NM_002266chr17----1209 --
NM_002267chr1332149 730 248 21864 1496 ----
NM_002268chr3--11876 ----
NM_002270chr525020 1999 1294 ----
NM_002285chr254041 3311 1447 514 360 --13611 --
NM_002345chr121166 ------
NM_002356chr632860 1075 680 --12363 --
NM_002374chr231190 929 368 1319 12586 --
NM_002379chr12390 119 ------
NM_002397chr51583 ----12057
NM_002398chr211388 1564 ----
NM_002408chr141335 ------
NM_002480chr121134 --11003 --
NM_002500chr21493 ------
NM_002505chr641171 500 419 217 ------
NM_002518chr211099 ------
NM_002519chr1111456 1444 ----
NM_002524chr11753 ------
NM_002543chr1221020 63 ------
NM_002545chr11144930 4874 4512 4188 4170 4133 3731 3610 1224 952 922 883 547 443 21533 808 13787 11162
NM_002552chr241274 1239 870 453 1431 ----
NM_002577chr343508 3021 259 133 ------
NM_002581chr9105546 5352 5229 4887 3614 2256 1854 1208 859 456 24903 4264 21220 1214 11582
NM_002600chr1133 11363 1321 --
NM_002609chr541866 113 105 87 1453 1720 --
NM_002620chr4167 ------
NM_002628chr331019 176 103 ------
NM_002634chr171167 1214 ----
NM_002635chr121102 1320 ----
NM_002645chr1142680 2216 854 320 1462 12854 --
NM_002655chr875014 4985 3812 3364 3252 955 758 14517 11426 --
NM_002657chr2063258 2900 2728 2555 2499 2457 --11156 11278
NM_002709chr222539 1289 1237 ----
NM_002710chr121280 21030 852 ----
NM_002716chr1183556 3324 3271 3218 2239 1131 1085 970 1266 23108 2284 --
NM_002726chr61331 ------
NM_002731chr153035 2788 2734 573 522 12218 ----
NM_002734chr172312 117 2790 688 ----
NM_002736chr72520 375 22105 1796 1888 --
NM_002745chr2274281 2833 1657 1544 1295 1143 83 31489 1414 1225 --1106
NM_002748chr1521222 1103 2910 824 1812 --
NM_002776chr1922043 1906 --21396 185 --
NM_002808chr31156 ------
NM_002823chr2------155
NM_002828chr181341 ------
NM_002836chr201135 ------
NM_002839chr913036 23318 2378 ----
NM_002851chr7--1780 ----
NM_002858chr12375 350 ------
NM_002860chr10159 ------
NM_002869chr113508 419 138 --1428 --
NM_002873chr5--1348 ----
NM_002890chr51188 ----1898
NM_002893chrX1122 ------
NM_002897chr2----1586 --
NM_002907chr122332 135 ------
NM_002918chr192972 887 --2760 404 --
NM_002956chr1211094 ------
NM_002958chr34951 343 62 41 ------
NM_002971chr3--1873 ----
NM_002973chr121209 ------
NM_002994chr441841 1292 652 584 ------
NM_003010chr1742428 2354 718 152 12025 11813 --
NM_003011chr941594 1359 245 236 ----11626
NM_003014chr721411 1078 ----11235
NM_003016chr174604 421 226 103 21739 260 ----
NM_003017chr6----1971 --
NM_003026chr931160 420 345 11118 ----
NM_003030chr331416 1384 143 11568 132 --
NM_003032chr342052 671 556 295 12592 42012 1873 1836 1096 --
NM_003034chr1277953 6258 5094 3053 2600 2376 417 32754 1264 949 --15984
NM_003036chr121006 123 ------
NM_003071chr31168 ------
NM_003076chr1221600 164 --1182 --
NM_003099chr15116089 5684 5031 2111 1874 1861 1501 841 735 140 55 11834 44553 4176 674 124 --
NM_003108chr266921 6659 5860 4618 2270 2074 17041 25363 256 --
NM_003111chr221281 497 ------
NM_003112chr733019 2497 2288 ------
NM_003128chr212002 --11067 --
NM_003137chr642027 1937 1735 394 11569 ----
NM_003144chr612090 --12251 --
NM_003155chr841994 878 118 111 1592 ----
NM_003157chr3139 ------
NM_003161chr1783488 3398 3099 2521 2204 748 359 259 --13467 --
NM_003178chr312149 ------
NM_003189chr132643 743 329 1440 42829 2077 1300 1010 --
NM_003203chr272405 1837 1684 1648 561 479 345 ------
NM_003204chr1721340 1109 ----1108
NM_003221chr633840 3606 1589 --14114 --
NM_003246chr1511719 22010 1354 ----
NM_003250chr171351 ------
NM_003253chr211382 --1220 --
NM_003257chr15169 ------
NM_003262chr355069 3922 3798 2057 1673 31981 212 109 23601 1072 --
NM_003268chr1125 ------
NM_003270chrX2868 259 11086 124 --
NM_003298chr365276 4686 4650 434 132 117 35865 4511 3821 --14451
NM_003299chr121215 ------
NM_003319chr211012 1715 ----
NM_003338chr1011640 1735 ----
NM_003340chr431314 1176 95 --180 --
NM_003342chr1762261 1024 995 946 413 89 11281 --1401
NM_003344chr7----11680 --
NM_003348chr1221270 1123 11242 ----
NM_003368chr1187 1254 ----
NM_003369chr1132690 522 315 12471 ----
NM_003374chr51181 ------
NM_003376chr631759 1642 1443 ------
NM_003376chr631759 1642 1443 ------
NM_003383chr91381 ------
NM_003385chr2--2659 63 ----
NM_003392chr332864 1315 991 21298 419 ----
NM_003400chr21736 ------
NM_003403chr142570 202 ------
NM_003406chr841754 1631 1231 70 --11697 --
NM_003410chrX12885 1188 12262 --
NM_003412chr34881 819 724 33 1905 12857 --
NM_003413chrX21287 1274 41486 1308 1297 1230 ----
NM_003418chr31851 1691 ----
NM_003463chr672416 2255 2169 928 318 300 186 12294 12673 --
NM_003471chr342374 2067 1455 209 --1230 1706
NM_003473chr10288 72 ------
NM_003478chr1153190 3125 3016 2695 2520 11221 ----
NM_003489chr211596 2477 437 ----
NM_003496chr7--1836 ----
NM_003503chr121315 246 ------
NM_003557chr151387 1303 1292 1144 422 --1621 --
NM_003566chr1221137 190 ------
NM_003573chr192270 263 ------
NM_003574chr1834854 3975 1840 --45602 1235 562 514 11619
NM_003575chr721111 483 1492 1511 --
NM_003576chr1332742 2225 680 ----12730
NM_003580chr82411 179 1566 ----
NM_003590chr253553 3206 3188 2951 201 ----13344
NM_003603chr431946 1631 1594 22008 343 ----
NM_003615chr3--1213 ----
NM_003620chr171142 ----1991
NM_003642chr21118 ------
NM_003663chr373292 3232 2790 1201 1160 563 379 32728 1174 911 ----
NM_003679chr133407 3015 560 14643 639 635 631 627 623 619 615 611 600 596 592 581 577 12413 --
NM_003692chr9--1822 1674 --
NM_003713chr131186 571 453 1440 ----
NM_003725chr121293 ------
NM_003749chr1342299 2020 1921 1495 ------
NM_003758chr152507 262 ------
NM_003758chr152507 262 ------
NM_003759chr433672 2988 785 11452 1425 --
NM_003763chr2023014 1201 13122 ----
NM_003783chr131051 768 468 ------
NM_003787chr1831389 1211 220 1273 11128 --
NM_003796chr191230 1490 ----
NM_003822chr122897 2351 ------
NM_003858chr14--1716 ----
NM_003861chr1422925 2071 21897 151 ----
NM_003872chr212877 --2519 23 1647
NM_003895chr2121847 808 ------
NM_003896chr21171 1813 ----
NM_003902chr11162 ------
NM_003916chrX11216 ----11476
NM_003931chr61194 ------
NM_003934chr9156 ------
NM_003948chr441743 969 665 220 12682 --1616
NM_003958chr643876 3646 475 444 13886 ----
NM_003972chr10----2949 308 --
NM_003994chr1254231 4067 3660 3162 412 --12716 --
NM_004024chr121545 1527 1328 ----
NM_004028chr1893379 2995 1473 1327 702 337 246 183 45 12521 11062 --
NM_004040chr211118 ------
NM_004081chrY11837 21590 105 --1627
NM_004087chr31477 11644 ----
NM_004093chr1343162 2641 1270 1140 ------
NM_004098chr1011139 11048 11029 --
NM_004100chr632639 2002 467 ------
NM_004114chrX61187 931 907 777 159 135 1476 ----
NM_004124chr1443048 3012 2743 961 ------
NM_004130chr33480 218 120 --1544 --
NM_004136chr1563126 3054 2955 1004 544 110 2929 597 12960 --
NM_004156chr82579 414 ------
NM_004161chr221066 493 ------
NM_004170chr91504 --1467 11335
NM_004171chr11167741 7008 5963 5953 3443 3280 2942 2920 2666 2526 2051 1686 1445 1114 1002 529 28158 1083 ----
NM_004203chr16138 ------
NM_004215chr81599 ------
NM_004229chrX21634 1609 ------
NM_004232chr1821479 1235 23783 313 1880 11436
NM_004236chr151171 ------
NM_004261chr12755 40 --125 --
NM_004274chr1432168 1265 393 --1274 --
NM_004277chr62312 79 --1109 --
NM_004293chr933691 3005 114 11105 1952 13670
NM_004323chr91897 31798 882 221 2500 186 12449
NM_004331chr842510 2049 1800 1647 ------
NM_004338chr1876910 5464 5196 4809 4775 1709 589 16723 ----
NM_004354chr44661 331 166 153 ------
NM_004380chr1622373 1845 1587 ----
NM_004384chr521964 1953 11761 ----
NM_004385chr5169 --1575 1235
NM_004388chr1198 ------
NM_004405chr21307 --146 1754
NM_004411chr72699 206 ------
NM_004415chr61670 ------
NM_004438chr22838 738 --12247 --
NM_004440chr62734 409 ------
NM_004447chr121275 ------
NM_004459chr172501 95 ------
NM_004464chr454264 4008 3975 3775 1011 21089 952 13384 1575
NM_004475chr175857 457 167 158 104 2392 173 11190 --
NM_004482chr21735 ------
NM_004483chr161452 ------
NM_004484chrX2326 104 ------
NM_004503chr12------1674
NM_004505chr171110 21985 1630 ----
NM_004516chr1921235 205 ------
NM_004521chr102283 263 ------
NM_004524chr171294 ------
NM_004540chr212699 74 ----1720
NM_004571chr211570 ------
NM_004575chr411387 ------
NM_004580chr1541679 1621 1605 254 ----11650
NM_004598chr563256 3191 2983 2116 1317 1032 12974 22535 56 --
NM_004612chr964598 4516 3317 1790 812 514 ------
NM_004619chr131455 393 178 12109 ----
NM_004655chr1711117 ------
NM_004660chrY1624 ----1185
NM_004680chrY151 ------
NM_004686chr83535 431 304 11728 ----
NM_004687chr1721925 807 --21428 439 122
NM_004697chr92872 88 ------
NM_004703chr1732337 2200 546 12006 ----
NM_004719chr121608 12651 ----
NM_004723chr1----1769 --
NM_004726chrX45318 1663 1599 822 1936 25279 240 --
NM_004734chr1322815 2183 1203 --1670
NM_004740chr17----1122 --
NM_004744chr412754 --11587 --
NM_004745chr856899 5562 1940 933 545 36574 5583 2213 34895 2580 1382 --
NM_004748chr1531438 1149 408 1545 ----
NM_004755chr142242 151 ------
NM_004768chr13827 798 241 1781 1788 --
NM_004772chr5--1459 ----
NM_004774chr1732882 2379 171 --22442 1986 --
NM_004781chr121726 1088 ------
NM_004781chr121726 1088 ------
NM_004788chr1131804 1680 453 ------
NM_004796chr1432314 1759 550 148 --1939
NM_004797chr333102 2745 586 23692 1266 --12674
NM_004837chr13609 358 269 1335 ----
NM_004844chr31407 ------
NM_004857chr1423020 1906 13475 ----
NM_004859chr1732587 2244 30 ------
NM_004860chr172365 97 ------
NM_004863chr1455023 4079 1195 1059 305 24636 4026 ----
NM_004866chr543947 3052 1090 413 21541 769 ----
NM_004867chrX1607 ------
NM_004869chr1841672 1514 409 183 ------
NM_004873chr1412961 22787 132 13142 --
NM_004874chr81325 ------
NM_004884chr1521338 118 ------
NM_004896chr101606 ----11442
NM_004898chr452778 1972 1954 1137 368 --12411 --
NM_004904chr7105169 4959 4738 4200 1564 1432 1364 640 305 204 34486 1085 649 ----
NM_004912chr751766 1747 1388 504 197 11270 ----
NM_004932chr521525 305 31446 550 70 ----
NM_004938chr921107 456 1403 ----
NM_004947chr322244 833 ------
NM_004949chr1842040 1740 1665 420 1429 ----
NM_004956chr773896 3807 3716 3515 1741 1648 446 11422 ----
NM_004976chr1154094 3667 1874 1018 508 13349 13290 14144
NM_004985chr1224143 3757 11578 1359 --
NM_004992chrX138524 8464 8180 7780 6057 5431 5384 5190 2876 2107 2013 1454 636 25676 2089 --12689
NM_004992chrX138524 8464 8180 7780 6057 5431 5384 5190 2876 2107 2013 1454 636 25676 2089 --12689
NM_004993chr14146 --11350 --
NM_005006chr23952 293 141 ------
NM_005010chr741916 1391 1369 46 ------
NM_005014chr92742 703 ------
NM_005025chr31236 ------
NM_005037chr3152 ------
NM_005045chr7----1704 --
NM_005056chr1294968 4839 4641 4426 3948 1699 1098 887 422 23970 2096 ----
NM_005066chr12713 92 ------
NM_005097chr10183 ------
NM_005102chr22772 332 ------
NM_005121chr1722933 1305 13183 ----
NM_005126chr322320 128 11437 ----
NM_005134chr181202 ------
NM_005151chr1852065 549 434 374 367 1505 ----
NM_005156chr944106 1521 910 683 14191 23710 637 --
NM_005188chr1157855 5708 5203 1835 873 25641 1601 37792 6050 5514 --
NM_005197chr1445443 3873 2008 994 ------
NM_005201chr31999 1372 ----
NM_005215chr181627 ------
NM_005233chr352034 866 495 474 176 ------
NM_005235chr266712 6307 5553 695 553 403 26018 1546 21916 413 22532 2294
NM_005249chr142735 286 ------
NM_005252chr141120 ------
NM_005256chr112826 186 1220 ----
NM_005257chr1821113 487 ------
NM_005259chr221365 527 ------
NM_005261chr81991 ------
NM_005277chr41616 ----1219
NM_005311chr71436 ------
NM_005337chr122355 294 ------
NM_005339chr444125 4080 1036 901 ----1556
NM_005349chr41557 1125 ----
NM_005375chr61103 ------
NM_005398chr1021443 1137 ------
NM_005407chr1431586 1279 482 --21315 453 --
NM_005433chr1822681 2198 22702 795 ----
NM_005436chr1043207 2993 2670 712 23881 132 ----
NM_005439chr12------1423
NM_005455chr1--1663 --1424
NM_005479chr1021471 208 ------
NM_005487chr2231927 1557 416 --132 --
NM_005497chr1741933 1166 849 418 25426 931 ----
NM_005502chr933015 1068 579 1136 ----
NM_005504chr1255713 4268 4222 2125 1148 45351 4619 2515 436 25720 429 --
NM_005506chr452724 2395 2323 1849 40 1960 --11799
NM_005522chr731003 995 79 --1123 --
NM_005544chr21719 21023 168 ----
NM_005565chr52173 129 ------
NM_005574chr111704 ------
NM_005578chr394844 3926 3683 3465 2058 1956 1732 880 416 ------
NM_005584chr13----1248 --
NM_005596chr944738 4636 2370 497 24846 4176 ----
NM_005599chr131523 1164 421 11429 131 --
NM_005613chr132154 1928 827 198 ----
NM_005625chr831078 1044 123 --1197 --
NM_005638chrX31561 599 169 21410 335 ----
NM_005655chr81209 ------
NM_005665chr154143 1939 1900 1530 159 13209 14782 --
NM_005667chr21273 1365 1331 --
NM_005668chr513498 13052 ----
NM_005688chr31408 1834 1965 --
NM_005708chr13141 ------
NM_005721chr2--1290 ----
NM_005725chr11303 --11922 --
NM_005746chr732720 2566 2142 ------
NM_005749chr171487 ------
NM_005751chr71431 ------
NM_005776chr142555 322 169 --184
NM_005808chr361392 1364 819 347 313 293 --3585 338 67 --
NM_005813chr242497 2463 1624 1007 11880 ----
NM_005819chr133197 434 416 --2490 99 1252
NM_005822chr622104 779 11799 1433 1556
NM_005826chr1--1663 ----
NM_005832chr321266 994 ------
NM_005840chrX86862 6452 5205 4708 2378 636 548 192 --26874 671 --
NM_005853chr161423 1597 --1117
NM_005859chr531356 1207 1136 1226 ----
NM_005862chr3----1247 --
NM_005868chr71207 1934 12257 --
NM_005871chr1031024 976 55 1172 ----
NM_005877chr2222494 47 2901 892 --1458
NM_005880chr162444 83 ----11502
NM_005888chr121102 1320 ----
NM_005896chr21800 ------
NM_005898chr1132021 1027 210 1822 ----
NM_005901chr18118667 7634 6358 6215 3465 3247 2981 2677 1614 1013 934 22349 92 ----
NM_005902chr1524560 4442 14329 11521 --
NM_005906chr631613 651 151 ------
NM_005907chr63517 243 178 1473 ----
NM_005909chr554167 3606 3247 3138 2818 --12909 14174
NM_005911chr23433 305 185 --2490 97 1551
NM_005924chr711126 --1841 --
NM_005933chr1162950 2528 739 657 512 299 ------
NM_005935chr463409 2134 1719 1590 1463 871 ------
NM_005941chr834182 3079 1466 ------
NM_005955chr155115 4936 935 749 177 13817 ----
NM_005962chr1031678 761 426 --1670 --
NM_005962chr1031678 761 426 --1670 --
NM_005966chr212053 11995 ----
NM_005967chr121531 --1666 --
NM_005977chr13--1197 ----
NM_006000chr2------123
NM_006016chr632187 99 68 ------
NM_006017chr44901 344 333 245 1221 ----
NM_006036chr23785 500 174 ------
NM_006037chr234042 3298 1838 74535 4531 4527 4523 4519 4515 4511 ----
NM_006047chr202284 206 --1925 --
NM_006055chr252640 2560 2491 971 582 21131 1059 ----
NM_006080chr712913 ------
NM_006090chr12263 153 --1517 --
NM_006091chr1521829 1170 ------
NM_006095chr434134 3794 3328 ------
NM_006106chr1123235 3195 ------
NM_006108chr11--31819 1815 1506 ----
NM_006113chr121727 622 ------
NM_006135chr121438 293 11421 21260 389 --
NM_006139chr232839 699 543 --11960 --
NM_006153chr3----1203 --
NM_006154chr1532957 2540 763 12363 12561 --
NM_006157chr111278 ------
NM_006158chr841821 1536 1395 1388 ------
NM_006161chr5--1544 ----
NM_006166chr1222632 2225 ------
NM_006195chr91957 1217 1482 --
NM_006197chr852082 1910 881 304 31 --1522 21691 1655
NM_006203chr564595 4276 4081 1934 1532 341 13909 11664 11314
NM_006206chr432591 550 402 11887 --12091
NM_006209chr8130 ------
NM_006226chr22323 35 ------
NM_006237chr1332161 177 104 ----12091
NM_006252chr187560 6367 6330 5183 4995 2813 1569 897 ----15228
NM_006275chr2012503 --12177 --
NM_006281chr8130 ----1363
NM_006281chr8130 ----1363
NM_006282chr2034764 4123 1828 ------
NM_006283chr863679 1829 1420 619 449 372 13902 1143 175
NM_006284chr11125 ------
NM_006306chrX44816 2019 44 26 15209 24348 987 14370
NM_006313chr122544 522 11736 ----
NM_006315chr433686 1779 1537 21709 985 ----
NM_006357chr21125 ------
NM_006359chrX22255 1547 ------
NM_006378chr941464 1335 1184 430 11076 ----
NM_006379chr722150 1847 ------
NM_006380chr1753760 1666 1418 1210 131 --1148 --
NM_006382chr17------1222
NM_006386chr2212418 ------
NM_006400chr12133 ------
NM_006420chr2033153 893 239 1817 ----
NM_006422chr12----152 1183
NM_006430chr21490 ------
NM_006434chr1073041 3015 2655 2531 2239 493 158 11223 1903 --
NM_006449chr211629 11972 32049 1462 197 --
NM_006451chr51153 --1306 --
NM_006454chr462822 2425 2005 1931 847 462 2452 436 --13051
NM_006457chr454013 3999 3592 1246 445 11010 ----
NM_006459chr1031690 1457 203 --11547 --
NM_006469chr111348 21605 1363 ----
NM_006476chr112461 78 ------
NM_006496chr11618 ------
NM_006516chr131105 438 345 21597 213 ----
NM_006520chrX21691 512 ------
NM_006526chr2011666 ------
NM_006538chr243293 3191 2920 2675 --1410 --
NM_006544chr1485812 5311 4407 3909 2190 1342 1185 287 ------
NM_006546chr17106200 5897 5858 4668 4491 4115 2635 2508 2435 865 --25992 5920 --
NM_006561chr1095840 4912 4688 3834 2410 1540 1456 1245 664 14295 1953 --
NM_006572chr1763132 1366 971 960 463 410 31067 491 240 1894 1977
NM_006577chr241264 957 389 269 1419 ----
NM_006595chr11--11371 11893 --
NM_006599chr16108189 6980 5804 5641 5499 5292 2817 2590 2064 1610 16714 ----
NM_006602chr201705 ----1190
NM_006603chrX--11355 1693 --
NM_006609chr22801 345 146 ----
NM_006614chr353225 3126 2784 581 320 12649 ----
NM_006618chr11127 1514 21461 1078 --
NM_006620chr654351 4335 3799 1842 780 14160 ----
NM_006621chr111692 21404 143 ----
NM_006625chr111088 ------
NM_006625chr111088 ------
NM_006625chr111088 ------
NM_006628chr1564016 3198 1681 1607 1409 63 13004 ----
NM_006650chr553662 3414 2819 2632 335 23538 1369 1475 2900 874
NM_006654chr1274568 4172 4138 3208 1322 1292 240 ----23509 1668
NM_006690chr2061644 952 706 696 483 226 124 --22006 1784
NM_006691chr1131002 962 198 --1210 --
NM_006698chr2041426 506 232 145 --11290 1480
NM_006699chr131077 444 125 --32464 560 554 --
NM_006703chr6----1334 --
NM_006706chr52555 92 133 ----
NM_006717chr923378 2652 --13384 --
NM_006727chr51498 ------
NM_006729chrX85250 4544 3783 3687 3547 1900 1129 616 35117 4583 403 25601 1698 --
NM_006738chr1554453 3096 861 437 64 33398 3183 1685 --12846
NM_006750chr1677662 7605 7494 7335 5460 584 503 17033 2938 614 --
NM_006751chr22921 174 ----1214
NM_006766chr832481 2204 1857 12181 ----
NM_006772chr661690 1672 1393 1218 504 297 ------
NM_006775chr662791 2722 2675 1983 859 97 ------
NM_006790chr51147 ------
NM_006802chr12945 329 ------
NM_006818chr12811 159 ------
NM_006827chr1473296 2850 2814 2547 2396 2194 823 13220 ----
NM_006832chr141175 1331 ----
NM_006838chr1221282 227 1121 ----
NM_006852chr1732546 2349 552 1921 ----
NM_006857chr2--1338 ----
NM_006870chr202132 46 ------
NM_006884chr331416 1384 143 11568 132 --
NM_006885chr1653348 2811 2738 1324 440 ----1169
NM_006888chr1443171 2355 1245 1074 21154 151 1191 1394
NM_006895chr211370 21499 467 31926 194 189 --
NM_006914chr92402 245 ------
NM_006915chrX1310 ------
NM_006922chr242357 932 631 478 ------
NM_006924chr1763770 3688 3653 1626 1604 265 ----14411
NM_006939chr141183 ------
NM_006941chr2231136 1039 293 ------
NM_006948chr2131990 831 817 --1207 --
NM_006965chr182967 101 ------
NM_006981chr962681 886 828 744 305 82 1821 193 --
NM_006999chr532071 1750 534 ------
NM_007011chr1586250 5770 1875 1806 1500 561 307 143 1258 ----
NM_007036chr5--1944 ----
NM_007038chr2196037 5536 4202 2307 2263 1824 1596 1263 978 ------
NM_007039chr1441635 631 362 250 22354 616 ----
NM_007043chr1242165 1598 330 31 1236 ----
NM_007106chr1332455 2353 2033 ------
NM_007111chr131824 ------
NM_007114chr352834 2548 2354 278 209 ----1683
NM_007124chr621837 1709 1162 ----
NM_007146chr1732847 843 186 ----11938
NM_007157chrX42346 2308 1949 894 1554 1207 --
NM_007159chr321104 442 ------
NM_007175chr883673 2706 2566 2505 2469 2438 1360 274 23192 1037 ----
NM_007195chr1853241 3040 2731 437 202 23740 2609 13154 --
NM_007200chr1554453 3096 861 437 64 33398 3183 1685 --12846
NM_007203chr973925 2978 2949 2701 1563 656 445 ------
NM_007212chr142054 495 343 45 1142 ----
NM_007214chr641250 911 840 527 1270 ----
NM_007222chr82582 398 ------
NM_007249chr1389200 8660 8144 8087 6421 5772 2653 789 38101 7247 5706 16598 --
NM_007250chrX1593 1200 --1393
NM_007275chr3----1783 --
NM_007276chr71957 11074 ----
NM_007285chr161100 1374 ----
NM_007287chr353167 1071 1012 694 201 12731 22761 2391 --
NM_007288chr353167 1071 1012 694 201 12731 22761 2391 --
NM_007289chr353167 1071 1012 694 201 12731 22761 2391 --
NM_007294chr171107 21240 321 1311 --
NM_007295chr171107 21240 321 1311 --
NM_007296chr171107 21240 321 1311 --
NM_007297chr171107 21240 321 1311 --
NM_007298chr171107 21240 321 1311 --
NM_007299chr171107 21240 321 1311 --
NM_007300chr171107 21240 321 1311 --
NM_007302chr171107 21240 321 1311 --
NM_007303chr171107 21240 321 1311 --
NM_007304chr171107 21240 321 1311 --
NM_007305chr171107 21240 321 1311 --
NM_007347chr152868 690 11154 --13083
NM_007358chr12156 86 21899 1315 ----
NM_007363chrX11069 --1959 --
NM_007373chr102399 59 ------
NM_007375chr12696 305 ------
NM_012072chr2054217 4171 3757 3366 877 --24571 3585 --
NM_012081chr552814 2619 1056 901 426 12582 ----
NM_012089chr11117 1964 ----
NM_012090chr131233 389 295 2822 31 ----
NM_012104chr1173615 3481 2995 1524 1164 883 783 23699 1089 22395 1433 --
NM_012104chr1173615 3481 2995 1524 1164 883 783 23699 1089 22395 1433 --
NM_012117chr122116 86 ------
NM_012120chr632053 1023 525 ------
NM_012141chr1374128 3841 3129 2670 2612 1518 35 11136 12701 --
NM_012158chr1311562 ------
NM_012199chr184584 4447 3650 3025 1610 1538 1491 745 33471 2970 644 --13248
NM_012208chr53687 501 194 ------
NM_012210chr921134 1015 --11282 --
NM_012214chr265802 4793 2393 1366 1164 187 15203 16246 --
NM_012223chr231331 1021 191 ------
NM_012224chr431109 380 56 ------
NM_012234chr323397 3107 ------
NM_012242chr101280 ------
NM_012247chr102277 55 1240 ----
NM_012249chr232527 2468 428 23147 32 1127 --
NM_012250chr111885 --1427 --
NM_012257chr721093 250 ------
NM_012259chr62972 938 ------
NM_012262chr164100 3980 3357 3184 1742 47 ------
NM_012281chr731990 1852 1664 ------
NM_012287chr354114 3960 1578 405 218 14037 ----
NM_012288chr674984 4598 3664 1384 370 359 124 --3429 258 246 --
NM_012290chr211249 ----1587
NM_012296chr1133840 3112 392 --53408 3237 2693 2655 297 12895
NM_012297chr432434 1827 1687 1254 ----
NM_012302chr11437 --11045 --
NM_012309chr1143598 1912 1173 212 13159 --14623
NM_012325chr20181 ----11286
NM_012327chr1841540 1108 620 551 11011 1556 --
NM_012330chr1031463 1264 625 ----1387
NM_012333chr141282 590 332 122 --11318 --
NM_012338chr73962 450 133 ------
NM_012341chr10--1442 ----
NM_012383chr91427 ------
NM_012413chr21106 --1124 --
NM_012425chr1032109 2024 70 ----1577
NM_012446chr51594 ------
NM_012454chr6--1508 ----
NM_012464chr432466 1827 1103 ------
NM_012479chr722013 415 --1131 1691
NM_012482chr13565 505 92 ------
NM_013227chr151813 ------
NM_013231chr1463394 3205 2730 1122 463 178 ------
NM_013233chr21391 1381 ----
NM_013254chr121527 1599 ----
NM_013257chr81262 ------
NM_013261chr452872 2829 2700 2403 743 1484 ----
NM_013262chr611193 ------
NM_013269chr1274396 3508 3343 3188 1431 562 370 11326 ----
NM_013281chr202619 526 ------
NM_013309chr1552397 2192 903 497 36 --12352 --
NM_013316chr71753 ------
NM_013354chr8----1161 --
NM_013372chr1522537 230 --13416 --
NM_013377chr121687 ------
NM_013396chr2141440 1404 1170 65 ------
NM_013444chrX1833 ------
NM_013450chr21841 ------
NM_013989chr1443419 1034 121 91 ------
NM_014010chr93616 242 208 ----1597
NM_014011chr262575 1746 1644 1604 234 174 11784 ----
NM_014016chr321325 220 1111 ----
NM_014028chr623158 300 12997 ----
NM_014043chr31621 11107 ----
NM_014048chr1653550 3518 3387 1997 1908 34740 3758 563 ----
NM_014089chr1322242 1605 ------
NM_014106chr1521144 952 ------
NM_014109chr831098 353 42 ------
NM_014112chr834627 4255 84 24162 1206 --1116
NM_014141chr765377 4506 3853 3481 542 284 --14711 --
NM_014155chr1166255 6216 5649 5034 2894 98 ------
NM_014181chr242596 2231 2125 46 12518 ----
NM_014217chr12482 141 ------
NM_014232chr1731609 1374 620 ----1490
NM_014232chr1731609 1374 620 ----1490
NM_014250chr2231927 1557 416 --132 --
NM_014251chr71753 --1806 --
NM_014267chr112880 810 ------
NM_014268chr181341 ------
NM_014289chrX11197 ----1226
NM_014294chr811291 ------
NM_014309chr2265258 1878 1282 1262 605 309 23883 1239 ----
NM_014315chr141147 ------
NM_014317chr10131 ------
NM_014319chr1221485 1466 ------
NM_014325chr121803 ----11744
NM_014331chr467757 5624 5061 2221 2141 254 36901 1093 855 ----
NM_014335chr1531256 933 59 11169 ----
NM_014342chr1111435 ------
NM_014361chr11------1166
NM_014368chr911912 2795 448 ----
NM_014372chr11691 11326 ----
NM_014382chr321605 1461 31402 326 106 ----
NM_014393chr852172 2039 736 296 212 1191 ----
NM_014415chr321562 554 11173 ----
NM_014423chr533976 1701 1406 35224 4965 4095 11149 14308
NM_014432chr621383 143 ------
NM_014437chr11155 ------
NM_014447chr421542 1288 ----11273
NM_014454chr61412 ------
NM_014458chr1----1249 --
NM_014470chr121820 ------
NM_014494chr165912 863 445 311 106 1267 1918 --
NM_014516chr191233 ------
NM_014517chr321841 1335 ------
NM_014520chr17154 ------
NM_014548chr1521654 1272 11049 1386 --
NM_014572chr1321651 1401 2486 360 ----
NM_014574chr1431260 616 118 ------
NM_014584chr1411518 ------
NM_014585chr261180 496 482 341 264 22 ------
NM_014602chr3--1365 ----
NM_014612chr921318 1256 ------
NM_014633chr113230 207 125 ------
NM_014634chr2232951 2335 264 --13584 --
NM_014636chr933579 1259 183 43930 3906 3879 737 13434 1615
NM_014647chr1621847 137 22015 2003 1474 --
NM_014660chr72285 255 ------
NM_014667chr321904 891 --12199 --
NM_014680chr17--188 ----
NM_014682chr821699 426 ------
NM_014690chr762496 2104 2084 1984 1166 666 1167 1958 --
NM_014700chr1621325 1263 ------
NM_014701chr1531382 975 24 21188 88 ----
NM_014707chr761749 1623 1490 687 253 46 ------
NM_014717chr193856 549 25 ------
NM_014720chr1011700 --11343 --
NM_014721chr667383 6841 6572 6161 4891 4837 12635 35719 5282 887 --
NM_014726chr17144 ----11216
NM_014730chr1234986 3382 555 35279 1334 654 44322 3737 2032 1317 --
NM_014730chr1234986 3382 555 35279 1334 654 44322 3737 2032 1317 --
NM_014735chrX41670 584 417 378 ------
NM_014736chr15----1714 --
NM_014747chr185001 2101 1959 1606 1412 1124 800 209 --31941 1462 1456 --
NM_014752chr112387 141 --11273 --
NM_014760chr311531 11830 21466 490 --
NM_014766chr7------33786 1365 717
NM_014774chr132615 2366 306 1819 1724 --
NM_014776chr1253089 3052 2510 2158 202 --1635 --
NM_014779chr33348 318 45 11088 ----
NM_014787chr132692 2052 914 12705 ----
NM_014795chr2128 1493 ----
NM_014810chr133000 2325 2297 22770 192 11412 11051
NM_014812chr141931 1585 1545 120 ------
NM_014828chr1472351 1843 885 842 691 670 566 ------
NM_014829chr53354 157 104 1346 ----
NM_014830chr1241143 1065 553 194 13802 --13675
NM_014832chr1321910 1394 ------
NM_014836chr1021726 490 21560 766 ----
NM_014841chr621213 193 ------
NM_014850chr354897 4433 4057 3324 1273 13721 24760 3276 --
NM_014859chr1721468 1119 ------
NM_014860chr251637 956 618 520 259 22662 773 ----
NM_014864chr163770 3097 2791 1566 1113 459 ------
NM_014873chr173226 1131 670 478 299 234 136 ------
NM_014877chr1747531 7293 6539 5175 12065 15836 --
NM_014885chr4145 ------
NM_014888chr721317 1079 ------
NM_014902chr2031212 424 332 ------
NM_014905chr261767 1291 792 705 79 37 1369 ----
NM_014912chr10--1733 ----
NM_014913chr1841489 1290 1153 583 ------
NM_014923chr1342382 1904 1645 781 ------
NM_014935chr123190 402 --42368 1248 1240 490 --
NM_014948chr2082498 2062 1725 925 667 625 545 526 --12366 22157 332
NM_014951chr1032517 1628 735 ------
NM_014961chr432112 831 566 ------
NM_014962chr2032367 2090 192 ------
NM_014966chr3166 ------
NM_014982chr1444731 4334 1774 175 13850 ----
NM_014988chr41500 11880 ----
NM_014989chr61191 --1778 --
NM_014990chr1411350 --11361 --
NM_014991chr443310 2086 962 916 13167 159 --
NM_014992chr141327 ------
NM_015000chr1243013 2003 931 488 ----22455 2292
NM_015002chr1251494 1482 514 346 41 21695 1500 --12298
NM_015008chr322483 2390 22413 185 1423 --
NM_015009chr31196 ------
NM_015017chr11117 ------
NM_015020chr1652379 808 738 215 191 23361 3357 ----
NM_015025chr221040 827 ------
NM_015032chr1332249 1834 790 ------
NM_015035chr2036418 4867 1848 15042 22570 1779 11445
NM_015039chr154073 3518 3327 2835 2793 --1168 --
NM_015045chr1032143 1438 45 ------
NM_015049chr232717 2420 603 12584 23284 2949 --
NM_015051chr932215 790 250 11360 1233 --
NM_015071chr5136183 5950 5186 4882 4649 4635 4508 4493 1896 1840 1467 594 124 15732 ----
NM_015074chr124644 3452 24937 3634 14561 --
NM_015075chrX21964 111 --11662 1799
NM_015076chr674262 2981 2936 1577 1563 1204 526 ------
NM_015087chr1342551 2487 2236 1024 21014 925 ----
NM_015090chr1125796 5160 4982 4851 4673 2434 2130 2025 1784 1417 1355 303 ----21031 1011
NM_015092chr1633705 3537 866 11338 --13671
NM_015093chr611841 ------
NM_015097chr332302 1829 165 ------
NM_015100chr121887 1326 31820 712 445 ----
NM_015101chr132639 2250 962 2582 64 22504 834 --
NM_015107chrX32391 1744 658 22216 818 183 --
NM_015129chrX31411 648 58 --1113 --
NM_015138chr1512115 1249 ----
NM_015141chr322701 477 11909 11822 --
NM_015144chr1673362 3236 1456 1348 1081 1046 994 --1850 --
NM_015147chr241070 324 289 34 13283 --13374
NM_015153chr62748 675 ------
NM_015156chr1453683 3525 3216 1324 45 13055 --12796
NM_015163chr1441751 1697 1285 555 ------
NM_015172chr121616 106 ------
NM_015173chr431653 1417 591 142 ----
NM_015176chr151560 1466 1214 419 232 11624 ----
NM_015191chr1172530 2507 2394 2386 2297 1018 54 ------
NM_015199chr332439 2229 903 --12764 11158
NM_015203chr11198 1169 ----
NM_015206chr1551346 1149 950 843 185 72706 1191 1187 1183 1171 1167 1163 12650 12638
NM_015208chr181937 ------
NM_015215chr122848 2304 ------
NM_015225chr953042 2960 2144 2086 193 ------
NM_015230chr451807 1752 1169 374 106 11231 ----
NM_015252chr21711 ------
NM_015263chr1531061 909 234 ------
NM_015265chr262614 2230 2069 616 319 261 --1670 --
NM_015267chr121365 21778 1463 ----
NM_015271chr424153 2811 13389 --1167
NM_015272chr1641316 590 399 183 --11609 --
NM_015285chr182231 67 2769 48 12362 1861
NM_015310chr868151 7712 6254 3318 2278 866 12458 ----
NM_015313chr1144054 3720 1739 934 34669 3803 588 14414 --
NM_015326chr142337 1928 1054 68 --12009 --
NM_015327chr1------1873
NM_015328chr752384 2257 1972 1922 830 --22707 363 --
NM_015332chr763582 2378 1364 1261 961 361 11251 150 --
NM_015336chr1242380 1051 593 57 1780 ----
NM_015344chr841930 857 225 39 11975 ----
NM_015365chrX53354 2873 704 316 81 ------
NM_015384chr5--1172 ----
NM_015385chr1073041 3015 2655 2531 2239 493 158 11223 1903 --
NM_015387chr231578 793 731 ----1704
NM_015393chr443432 2584 1065 691 13236 --32820 2767 58
NM_015397chr951791 733 296 267 220 ------
NM_015415chr11193 ------
NM_015435chr811238 ------
NM_015455chr52259 230 1760 2931 926 --
NM_015457chr111431 ------
NM_015461chr18------1267
NM_015470chr23835 369 42 ----1849
NM_015475chr2176 ------
NM_015483chr72784 105 ------
NM_015488chr211648 ------
NM_015508chr321360 526 ----1455
NM_015509chr1281525 1430 1293 1175 1106 531 400 245 ------
NM_015517chr111479 ------
NM_015526chr19----31472 578 243 11097
NM_015534chr111049 ------
NM_015548chr61613 1916 ----
NM_015550chr743585 2547 2252 2218 33473 1311 1157 13598 --
NM_015560chr341101 667 486 209 ------
NM_015564chr542864 2187 415 43 --13551 --
NM_015565chr2121516 806 ------
NM_015567chr1311212 ------
NM_015569chr144821 4113 965 473 23783 324 13595 11143
NM_015570chr731741 1482 1469 ------
NM_015575chr262650 2388 1397 1244 769 35 12853 --11091
NM_015640chr125146 1608 ------
NM_015652chr10187 ------
NM_015676chr142292 143 ------
NM_015684chr141224 ------
NM_015687chr61412 ------
NM_015691chrX42170 1863 1106 788 32646 802 33 1834 --
NM_015713chr842301 1424 1370 339 12646 1134 --
NM_015723chr71747 1580 ----
NM_015726chr151788 1500 1192 523 284 1382 169 --
NM_015866chr111282 ------
NM_015869chr3152 ------
NM_015874chr41557 1125 ----
NM_015879chr1866646 3106 2791 2367 561 484 1462 33328 1928 473 16240
NM_015885chr11--1312 ----
NM_015886chr8115702 5215 4808 3999 3519 1833 1516 1282 1242 1157 468 14089 ----
NM_015906chr144091 3771 1130 1065 23317 1238 ----
NM_015939chr20--1676 ----
NM_015975chrX2679 280 ------
NM_016021chr642687 2083 2057 917 ------
NM_016041chr17167 ------
NM_016071chr7177 ------
NM_016072chr1222168 1899 ------
NM_016075chr1353173 3150 2635 2117 881 1557 ----
NM_016076chr1--2919 219 ----
NM_016083chr683519 3366 3180 3070 3019 1107 370 141 13393 ----
NM_016094chr33686 186 126 ------
NM_016096chr831360 760 535 --11471 --
NM_016097chr182405 327 --1994 --
NM_016103chr5----1407 --
NM_016107chr52545 283 ------
NM_016125chr171223 1396 ----
NM_016129chr4165 ------
NM_016131chr261536 1482 724 322 285 132 3923 121 75 11494 --
NM_016132chr1532854 2199 657 ------
NM_016173chr353747 3523 2752 880 691 --13465 13196
NM_016206chr3108578 7931 7811 5822 5677 3049 2965 2765 1650 542 28730 6274 58630 3599 2590 1781 1127 --
NM_016213chr15--159 ----
NM_016248chr1333374 3108 904 ----13368
NM_016255chr642555 1104 624 358 --13061 --
NM_016260chr286661 6225 5917 5135 4710 2127 1989 1147 11094 16304 --
NM_016275chr322016 652 ------
NM_016289chr212315 2487 55 ----
NM_016322chr932992 2385 626 12194 ----
NM_016338chr5----2394 187 --
NM_016374chr11421 ------
NM_016374chr11421 ------
NM_016396chr1532524 171 122 12481 ----
NM_016399chr121907 ------
NM_016422chr1142549 2410 221 129 --12824 --
NM_016424chr171305 ------
NM_016436chr2021062 383 12498 ----
NM_016441chr232227 1510 411 ------
NM_016448chr131847 1353 348 21438 1294 ----
NM_016468chr142186 79 ------
NM_016476chr17--1156 ----
NM_016485chr641715 658 73 62 --11531 --
NM_016488chr1231860 645 412 ------
NM_016519chr41531 ------
NM_016530chr1564013 3934 3103 981 740 318 ------
NM_016542chrX21706 271 ------
NM_016577chr364537 4232 3811 3130 3063 58 13311 22767 443 --
NM_016587chr71957 11074 ----
NM_016589chr3----1197 --
NM_016603chr54806 763 301 217 ------
NM_016604chr52960 498 11046 1239 --
NM_016612chr81449 ------
NM_016620chr11527 1533 ----
NM_016621chr1164464 4100 3625 3487 3033 755 --24039 3023 13333
NM_016622chr222118 736 1532 ----
NM_016623chr8189 ------
NM_016827chr3264 28 ------
NM_016836chr2----1586 --
NM_016839chr2----1586 --
NM_016929chr674341 4162 3564 3367 3311 663 154 24292 3932 13261 --
NM_016950chr4162 ------
NM_016952chr1144092 2920 2790 1156 --13607 12988
NM_016954chrX1150 ------
NM_017420chr1432934 2634 1292 11065 --12923
NM_017440chr121200 ------
NM_017447chr2133747 891 302 1995 12689 --
NM_017519chr6--2427 80 ----
NM_017548chr331357 449 132 12126 1533 --
NM_017551chr1052641 2224 2180 1752 595 --1600 --
NM_017558chr161299 ----1376
NM_017563chr356091 5802 5196 5073 456 --11802 --
NM_017580chr101913 1498 ----
NM_017582chr12152 131 ------
NM_017583chr1141675 1568 1287 399 1606 ----
NM_017596chr164544 4353 4312 3783 827 21 23768 3100 43507 1420 167 136 --
NM_017612chr122455 145 1117 ----
NM_017628chr4104918 4419 4117 4029 3666 3384 3249 1431 1150 208 45236 4150 3696 1898 23263 1870 --
NM_017633chr652953 2412 948 259 236 ----23055 2734
NM_017637chr977056 6140 5735 3194 3109 1651 871 28431 659 26666 1327 18361
NM_017640chr61298 ------
NM_017641chr122968 172 ----1272
NM_017643chr1742812 985 855 690 ------
NM_017650chr765689 4547 3914 3870 2065 726 11402 15001 --
NM_017651chr6----11371 11243
NM_017658chr1423501 644 24183 3174 --1722
NM_017666chrX21910 180 ------
NM_017709chr153859 2648 1651 654 555 13486 14037 1245
NM_017736chr1622377 939 22224 1116 22276 747 --
NM_017747chr5------1157
NM_017748chr172775 335 ------
NM_017778chr831452 1181 1161 ------
NM_017780chr81203 ------
NM_017786chr82714 93 --1271 --
NM_017791chr1431618 1062 197 --1141 21193 373
NM_017801chr332039 1041 220 ----11946
NM_017811chr932967 2449 2235 ----199
NM_017813chr825788 3720 ------
NM_017822chr123692 547 215 --1506 --
NM_017824chr1032715 2563 923 ------
NM_017842chr121680 ------
NM_017848chrX84683 4395 4262 4252 4192 1764 767 130 --13858 --
NM_017849chr232381 2185 685 12516 ----
NM_017902chr1095465 5378 4014 3623 2234 1886 1559 181 41 11493 21068 414 --
NM_017919chr9104921 4680 3663 2096 1570 1293 738 701 509 39 ------
NM_017938chrX22209 1790 --1407 11553
NM_017943chr1411030 ------
NM_017944chr1133142 2382 787 ------
NM_017952chr254105 3222 1286 683 331 43942 3379 3237 1338 11388 11377
NM_017958chr221147 366 12777 ----
NM_017994chr732516 1205 662 31908 942 175 ----
NM_017998chr9----1341 --
NM_018011chr131195 ------
NM_018014chr211070 ----11313
NM_018027chr1042792 2729 1139 232 145 ----
NM_018030chr18188 1991 ----
NM_018048chr1231836 748 157 11847 ----
NM_018056chr11177 ------
NM_018061chr111168 ------
NM_018070chr1--187 ----
NM_018092chr1631051 444 131 1201 ----
NM_018112chr9145 ------
NM_018145chr152483 476 ------
NM_018155chr333308 1118 117 23357 354 ----
NM_018157chr1232920 2395 675 ------
NM_018159chrX31685 537 153 1444 ----
NM_018181chr1821283 722 ----133
NM_018200chr1531934 1785 925 ----12399
NM_018206chr161303 ------
NM_018214chr631086 320 58 ------
NM_018221chr23145 66 55 ------
NM_018222chr1141793 1200 556 91 ------
NM_018241chr4----1746 --
NM_018247chr623094 2890 1545 --154
NM_018257chr2032424 1765 1024 1175 ----
NM_018270chr201668 ------
NM_018287chr101227 ------
NM_018293chr321067 970 ------
NM_018299chr823375 683 ------
NM_018307chr171939 ------
NM_018313chr312498 ------
NM_018325chr92384 258 --124 --
NM_018327chr2021755 1201 ------
NM_018339chr911659 --1750 --
NM_018340chr1674906 3792 3529 3181 3164 344 243 --1158 --
NM_018351chr1294420 4235 4169 3622 3594 3106 2900 311 284 44104 3631 1593 1444 14150 --
NM_018362chr1142885 753 225 144 1833 12453 13619
NM_018364chr122645 913 1688 23595 191 --
NM_018367chr1131579 988 567 ------
NM_018371chr82578 406 11235 ----
NM_018373chr1456075 1301 1052 302 66 26329 2526 ----
NM_018374chr721949 1103 14752 22076 246 --
NM_018375chr1441486 1304 1246 771 1415 1276 --
NM_018387chr9276 25 ------
NM_018398chr31299 ------
NM_018409chr442598 1085 292 106 11030 ----
NM_018412chr71136 ------
NM_018416chr1231927 617 553 2838 269 1282 --
NM_018429chr532818 2351 551 ------
NM_018434chr5156 ------
NM_018440chr8118684 6984 6246 5573 3394 3342 3214 3029 2335 1547 134 16016 17688 --
NM_018441chr21145 ------
NM_018449chr9----138 --
NM_018482chr822261 2057 ------
NM_018489chr13918 711 439 1188 1424 --
NM_018490chr1131232 480 319 --165 --
NM_018534chr22628 145 ------
NM_018557chr221514 1437 ----11069
NM_018566chr134983 4379 1151 13237 11093 --
NM_018638chr1221474 194 ----1963
NM_018640chr1252262 633 608 521 245 ------
NM_018650chr131944 584 562 ------
NM_018652chr152648 393 ------
NM_018689chr1541926 1860 1661 528 --1271 --
NM_018695chr522297 375 ------
NM_018698chrX41962 1765 287 123 ------
NM_018710chr82997 83 ------
NM_018717chr412255 1959 ----
NM_018844chr731535 1406 387 1480 ----
NM_018963chr2131009 488 264 ------
NM_018970chr72776 163 11953 --13182
NM_018976chr1242349 2182 781 184 12392 ----
NM_018999chr1054043 3298 1819 1067 194 1992 13053 --
NM_019004chr722236 1834 22153 1607 ----
NM_019006chr151215 ------
NM_019008chr2253720 2377 331 190 168 --11195 23120 365
NM_019024chr21320 ------
NM_019027chr432375 2365 1851 --22355 777 --
NM_019028chr111337 ------
NM_019035chr43825 692 616 1320 ----
NM_019045chrX--1676 ----
NM_019058chr101534 ------
NM_019063chr232281 1816 684 ------
NM_019072chr532895 1010 286 33708 3548 3523 ----
NM_019080chr13--11465 ----
NM_019087chr53553 448 44 ------
NM_019106chr2283204 2778 2170 1313 720 661 104 92 32966 2877 2383 --1273
NM_019116chr1643762 2311 1493 1105 1517 ----
NM_019556chrX21410 445 --1544 --
NM_019593chr2033182 2611 927 --12066 --
NM_019600chr152567 114 --1681 --
NM_019610chr131360 851 65 1525 1300 11412
NM_020039chr122502 174 1306 21626 1287 --
NM_020116chr42577 368 21355 1164 --1446
NM_020122chr2116029 6017 5849 5714 4617 4211 3810 1424 671 627 68 --11444 --
NM_020150chr1042067 1924 562 421 ----153
NM_020151chr22174 43 ----1704
NM_020168chr15--11222 11031 --
NM_020184chr242058 603 517 107 1193 ----
NM_020226chr42748 715 ------
NM_020231chr31131 ------
NM_020239chr14725 691 528 317 --31900 1537 123 --
NM_020244chr12296 25 ------
NM_020307chr3------147
NM_020336chr2033888 3310 1240 23163 176 11245 --
NM_020337chr472963 2568 2229 1180 1118 879 734 23194 885 ----
NM_020341chr201566 --1654 --
NM_020342chr21893 21853 1849 ----
NM_020347chr342026 1777 1433 147 --1298 --
NM_020357chr33649 553 84 ------
NM_020390chr334284 4256 1653 --23528 1736 --
NM_020403chr1331749 626 473 ------
NM_020420chrY11837 21590 105 --1627
NM_020423chr11491 1132 ----
NM_020429chr752937 2928 2274 468 410 1743 ----
NM_020432chr7--1913 ----
NM_020443chr186843 5844 5364 4656 1294 1036 868 54 16960 12418 15573
NM_020457chr161587 ------
NM_020640chr351877 838 830 779 724 11711 ----
NM_020645chr111271 1520 ----
NM_020648chr1852859 2775 2548 2064 2038 21070 455 1655 --
NM_020651chr211456 --1297 --
NM_020653chr171154 --1295 --
NM_020654chr331562 1356 434 ------
NM_020673chr2097445 6257 5120 4990 4771 3005 1983 1559 1315 ------
NM_020696chr3172 ------
NM_020699chr144444 981 893 43 --33904 1220 1156 --
NM_020704chr73800 557 418 ----172
NM_020708chr2011985 ------
NM_020715chr1412289 ------
NM_020717chrX44284 4142 3250 3234 11525 34791 4547 679 13457
NM_020718chr1655380 3996 1894 1124 744 --35485 2173 717 15591
NM_020727chr211512 23958 3732 ----
NM_020728chr732211 1207 497 --12541 --
NM_020732chr6--2427 80 ----
NM_020734chr1222869 2077 ------
NM_020739chr1531438 1149 408 1545 ----
NM_020742chrX42029 2022 940 179 12538 22597 25 --
NM_020747chr5--1825 ----
NM_020752chr101432 2660 625 22536 945 --
NM_020766chrX34282 3219 2911 2885 460 ----
NM_020772chr1787351 6683 6348 5580 3331 1971 1696 1267 28104 2585 ----
NM_020792chr362482 2146 2127 732 606 130 12779 ----
NM_020794chr111311 ------
NM_020801chr522626 1733 ------
NM_020805chr18--1736 1248 --
NM_020819chr611237 ------
NM_020830chr243254 2656 2187 1191 1203 13023 --
NM_020831chr221811 ------
NM_020841chr1283993 3358 2932 1549 1172 1113 784 180 --12961 --
NM_020850chr1642470 2409 2135 1301 2844 532 22142 908 1393
NM_020853chr1272733 2720 2073 1803 703 645 63 1969 1892 --
NM_020854chr181121 ------
NM_020856chr1911251 ------
NM_020858chr1532200 1788 34 22231 841 139 1942
NM_020860chr43394 261 52 ------
NM_020861chr621330 47 ------
NM_020868chr251835 691 378 370 290 ------
NM_020871chrX22511 1010 ------
NM_020872chr311810 --1648 --
NM_020873chr31228 ------
NM_020898chr122236 91 ------
NM_020899chr17--21943 1939 2843 753 --
NM_020909chr2104081 3976 3673 3372 3198 1403 894 752 683 615 24189 4095 ----
NM_020918chr1063319 2368 1340 586 524 227 13282 1111 11059
NM_020921chr1433592 2704 2276 --13322 --
NM_020922chrX31301 385 235 11497 ----
NM_020935chr274370 3511 3476 1789 1062 454 210 11361 ----
NM_020940chr1052449 1899 1042 464 145 ------
NM_020948chr132896 717 628 11365 --1882
NM_020964chr1873756 3473 3207 1860 1189 827 659 23224 239 --13106
NM_020975chr1031854 1828 1813 --1470 --
NM_020977chr441655 802 731 606 ------
NM_020987chr1011031 ------
NM_020993chr1221823 219 --11105 --
NM_021005chr151248 ------
NM_021007chr262299 2281 2249 1820 942 666 ------
NM_021033chr1323328 3162 ----11349
NM_021061chr843458 1284 1269 324 34367 3976 3554 ----
NM_021069chr431946 1631 1594 22008 343 ----
NM_021072chr52747 75 ------
NM_021076chr221466 --1408 --
NM_021105chr31731 159 ----
NM_021110chr82765 719 2687 504 ----
NM_021116chr7108980 8662 8619 7414 7173 5553 2561 2445 2093 1841 48202 7004 1221 585 31850 1573 442 --
NM_021127chr1811235 ------
NM_021140chrX2767 84 142 ----
NM_021183chrX52399 902 820 474 119 ------
NM_021190chr1155 ------
NM_021202chr2063070 709 411 335 284 48 ----11230
NM_021204chr41901 ----1298
NM_021229chr122146 137 ------
NM_021239chr14----1266 --
NM_021252chr1031814 352 330 22100 296 ----
NM_021614chr52202 99 ------
NM_021622chr1022092 388 ----1757
NM_021627chr3--1930 ----
NM_021629chr344742 4074 3800 3344 ----14799
NM_021637chrX2877 137 ------
NM_021647chr454028 3161 1287 776 666 ----1345
NM_021648chr632502 2253 811 --1321 --
NM_021705chr641171 500 419 217 ------
NM_021813chr644685 4095 883 84 --34009 1652 344 --
NM_021814chr631536 1466 1218 ------
NM_021911chr553609 1937 1637 1072 809 11914 1131 --
NM_021914chr1451875 1862 464 228 162 21542 358 1580 --
NM_021952chr11169 ------
NM_021954chr1382969 2674 2595 1368 1308 807 450 382 ------
NM_021961chr11117057 6619 6554 5432 2786 2577 2198 1912 1756 665 506 15684 21417 743 15933
NM_021964chr3115761 5440 5104 5045 4994 4381 2558 2488 1719 1324 250 21760 1685 15051 --
NM_021970chr42242 30 2296 91 ----
NM_021999chr131125 ------
NM_022037chr21154 ------
NM_022048chr1585273 4689 4494 4453 2276 1414 647 323 --11370 --
NM_022049chr151903 1813 1541 1182 478 ------
NM_022068chr181607 ------
NM_022091chr622017 930 11817 ----
NM_022093chr13965 906 258 ------
NM_022133chr831717 1556 388 31340 201 36 ----
NM_022144chrX--161 ----
NM_022154chr42244 83 ------
NM_022166chr1646035 5621 3922 713 ----1795
NM_022173chr21154 ------
NM_022336chr272119 1829 1782 1465 363 159 22 --1660 --
NM_022373chr71287 ------
NM_022374chr22435 27 ------
NM_022444chr7124 11827 ----
NM_022459chr1325860 2157 36292 2119 1087 24195 83 21479 1209
NM_022461chr321166 40 ------
NM_022462chr1943135 1514 421 291 --12327 13636
NM_022465chr1242387 2124 595 164 12595 3684 152 65 1331
NM_022469chr163254 2172 990 718 706 70 ----1863
NM_022475chr4379 51 28 ------
NM_022476chr163864 799 167 ------
NM_022484chr7--11382 ----
NM_022490chr9------160
NM_022572chr211648 ------
NM_022648chr244144 4126 1182 1103 43595 3058 697 630 44561 1759 1267 877 --
NM_022650chr51188 ----1898
NM_022716chr132985 1071 409 12661 2447 58 --
NM_022726chr621078 403 11742 ----
NM_022739chr172934 915 1344 ----
NM_022753chr12570 507 21914 1841 --137
NM_022763chr332959 2853 1105 ------
NM_022776chr31305 3601 415 269 ----
NM_022781chr932891 2831 1020 163 ----
NM_022782chr122315 126 ------
NM_022784chr15153 ------
NM_022824chr531236 601 102 1551 ----
NM_022836chr151801 1626 1290 563 106 ------
NM_022841chr1512263 1262 ----
NM_022843chr1341450 1041 495 344 ------
NM_022893chr232896 2659 704 12061 ----
NM_022897chr521035 234 ------
NM_022912chr222259 2154 22780 124 ----
NM_023112chr1452481 2006 808 492 30 --12734 1150
NM_023927chr521042 916 ------
NM_023929chr831943 918 871 2983 396 ----
NM_024007chr533186 3034 1066 --1999 --
NM_024019chr42971 811 11131 153 --
NM_024045chr10139 164 --1172
NM_024060chr111304 1320 ----
NM_024421chr181883 ------
NM_024492chr62483 141 11137 11462 --
NM_024501chr22272 229 ----165
NM_024524chr31994 33218 2809 2050 ----
NM_024529chr14906 895 785 140 ------
NM_024586chr1----1120 --
NM_024594chr521778 1394 11610 21414 1323 --
NM_024607chr874120 3879 3430 3196 3119 2862 1057 11372 ----
NM_024613chr841558 495 416 38 ------
NM_024616chr321357 388 ------
NM_024617chr91184 ----149
NM_024645chr8166 1406 ----
NM_024657chrX133 --1666 --
NM_024659chr22779 363 ------
NM_024665chr364623 4547 3726 3432 2904 60 14417 --14217
NM_024674chr153035 2514 901 501 23 22601 197 ----
NM_024740chr1183551 3323 2556 1555 1155 945 813 598 --1587 --
NM_024770chr276739 5120 2020 1902 1206 752 619 146 11722 --
NM_024784chr112289 73 ------
NM_024812chr852145 1337 838 548 190 11501 1684 --
NM_024824chr14------1137
NM_024857chr171295 ------
NM_024893chr201155 ------
NM_024920chr421033 464 ------
NM_024926chr71231 ------
NM_024947chr378750 7186 3542 3454 3070 588 401 23495 2205 17595 --
NM_024948chr101189 ------
NM_024949chr435043 4924 1169 23629 1072 ----
NM_024989chr233046 2894 428 --17855 --
NM_024991chr1073041 3015 2655 2531 2239 493 158 11223 1903 --
NM_025054chr833132 1633 1114 --13423 --
NM_025057chr141880 --1328 1488
NM_025073chr164186 3381 1218 1173 821 34 2159 74 14491 --
NM_025138chr131448 11297 1251 --
NM_025146chr322099 531 11974 ----
NM_025158chr52461 302 ------
NM_025160chr133577 3367 308 ----13795
NM_025164chr1142145 1898 1796 670 1838 ----
NM_025179chr184917 4895 4655 3253 1002 675 500 108 13072 --140
NM_025184chrX1141 1628 ----
NM_025211chr91229 1218 ----
NM_025244chr22276 264 1213 ----
NM_030567chr5----1114 --
NM_030623chr221668 1371 1187 ----
NM_030625chr103718 673 90 ------
NM_030627chr543990 816 657 423 ----11511
NM_030647chr751945 1899 1831 1309 75 1682 ----
NM_030648chr485227 5146 4717 3457 3413 3391 2212 1448 --1572 --
NM_030650chr244118 3047 1233 745 13956 ----
NM_030652chr6--1296 ----
NM_030660chr14146 --11350 --
NM_030661chr71584 ------
NM_030664chr104408 307 243 206 1575 --1583
NM_030670chr1211575 31796 1668 353 ----
NM_030671chr1211575 31796 1668 353 ----
NM_030674chr1284026 2188 1797 1766 902 641 491 402 25779 1343 14287 11648
NM_030751chr1031243 369 59 ------
NM_030751chr1031243 369 59 ------
NM_030753chr171290 ------
NM_030759chr101312 ------
NM_030762chr12----1644 --
NM_030763chrX1901 --2920 860 --
NM_030786chr141801 1729 1349 275 1637 ----
NM_030791chr1451834 1765 1317 1257 695 21477 581 ----
NM_030799chr512173 --11974 --
NM_030802chr172852 720 ------
NM_030806chr1159341 9092 8674 7388 7161 6397 6048 3621 3450 3434 2018 1819 1392 1015 336 36870 1590 88 11639 --
NM_030809chr1241734 1675 897 315 ------
NM_030820chr6----1389 --
NM_030881chr2212418 ------
NM_030885chr341971 1550 917 154 ------
NM_030915chr222307 1935 --22186 1957 --
NM_030920chr142013 1854 147 85 31459 598 561 ----
NM_030945chr522056 300 ------
NM_030954chr8--1362 ----
NM_030958chr8--1151 ----
NM_030962chr1121397 100 1622 ----
NM_031216chr1821596 327 1515 ----
NM_031243chr732403 1524 112 ------
NM_031262chr91443 ------
NM_031296chr431720 1102 722 12481 ----
NM_031369chr4----123 1529
NM_031370chr4----123 1529
NM_031371chr11421 ------
NM_031371chr11421 ------
NM_031418chr1132493 2115 785 ------
NM_031442chrX53021 2471 2233 879 332 --1425 1670
NM_031445chr232163 1070 208 --11282 --
NM_031483chr2053181 3020 2510 848 395 ------
NM_031845chr231190 929 368 1319 12586 --
NM_031847chr231190 929 368 1319 12586 --
NM_031889chr431939 1416 731 11827 1704 --
NM_031892chrX1938 ----1739
NM_031911chr452688 2656 2262 2235 704 --22276 2249 --
NM_031922chr61397 ------
NM_032041chr872636 2512 2311 2216 2006 713 489 --12290 --
NM_032042chr552322 2111 1087 967 438 11805 ----
NM_032121chrX32395 750 209 ----1366
NM_032160chr1872835 2798 1641 1018 753 546 466 24036 348 2800 437 --
NM_032186chr11527 1533 ----
NM_032199chr1093909 3508 3325 2389 2370 1412 1021 1003 718 ------
NM_032208chr23963 905 235 11245 11410 22803 1363
NM_032217chr431379 221 151 ------
NM_032221chr2031713 497 130 1236 147 --
NM_032239chr42932 174 ----11456
NM_032256chr121374 ------
NM_032268chr1632588 2405 217 12162 ----
NM_032281chr1922486 2442 ----1993
NM_032287chr2274189 2871 1460 951 809 423 218 11000 11440 --
NM_032288chr332342 1900 201 11918 ----
NM_032291chr121634 542 21899 1699 ----
NM_032295chr71146 ------
NM_032320chr111533 1655 ----
NM_032321chr272799 1045 963 826 513 347 95 ------
NM_032328chr1174 ------
NM_032352chr141309 ------
NM_032364chr122652 74 ------
NM_032373chr1031651 618 134 25228 1837 ----
NM_032408chr71902 ------
NM_032434chr221264 205 --21130 1018 --
NM_032439chr1021291 658 11280 1177 --
NM_032440chr1022286 798 ------
NM_032445chr1532298 2020 200 --11935 --
NM_032449chr152220 2158 1928 1094 811 52459 215 211 207 203 22430 770 --
NM_032457chr422736 373 11242 ----
NM_032458chrX3387 206 102 13435 ----
NM_032491chr1231148 262 116 ------
NM_032499chr151300 --11131 --
NM_032521chr2042762 2745 906 775 ------
NM_032557chr42313 83 ------
NM_032569chr1631564 1363 373 --1104 --
NM_032574chr21191 ------
NM_032596chr9--160 ----
NM_032622chr411572 21392 252 21463 585 --
NM_032623chr41284 1332 ----
NM_032632chr1421451 1327 --11503 --
NM_032679chr1911090 --1895 --
NM_032682chr363495 3472 3249 2972 576 440 --13459 --
NM_032689chr192515 60 ------
NM_032727chr1011609 21437 348 21542 70 --
NM_032784chr6142 ------
NM_032804chr1042407 805 725 262 ------
NM_032810chr1021120 53 ------
NM_032818chr952605 1956 661 501 291 11735 ----
NM_032826chr743423 1801 1141 1020 31792 667 324 22169 407 12032
NM_032828chr1943983 3734 1106 123 21979 1076 24296 3534 --
NM_032846chr1441393 1088 549 532 --2215 167 11360
NM_032859chr1353280 1216 991 824 91 13352 ----
NM_032871chr1111360 31469 726 669 11193 11217
NM_032876chr1432046 1376 802 11454 11410 --
NM_032900chr1043353 1478 379 214 1253 13782 --
NM_032961chr41434 2911 269 ----
NM_032968chrX54022 3596 1570 683 250 11341 ----
NM_032969chrX54022 3596 1570 683 250 11341 ----
NM_032973chrY64014 3592 1569 1390 683 250 11341 ----
NM_032975chr1823306 301 --12606 22740 1424
NM_032980chr1823306 301 --12606 22740 1424
NM_032982chr74913 850 635 229 12362 1410 --
NM_033020chr144091 3771 1130 1065 23317 1238 ----
NM_033030chr241568 1233 353 21 1278 ----
NM_033044chr131233 389 295 2822 31 ----
NM_033055chr13712 392 28 ------
NM_033089chr201474 11380 143 --
NM_033132chr1332156 1455 129 ------
NM_033136chr511794 --1560 --
NM_033137chr511794 --1560 --
NM_033143chr464595 4339 4306 4106 1342 253 21420 1283 13715 1906
NM_033150chr121371 ------
NM_033181chr683519 3366 3180 3070 3019 1107 370 141 13393 ----
NM_033215chrX1392 ------
NM_033224chr736623 2540 451 27260 5800 --16170
NM_033281chr51249 ------
NM_033285chr843518 2967 798 142 1818 1958 13576
NM_033326chr1162113 1889 1761 1709 891 267 ------
NM_033360chr1224264 3878 11699 1480 --
NM_033389chr1763729 3299 3209 1834 1671 1029 ------
NM_033402chr8145 ------
NM_033425chr1142421 1256 697 251 1193 11328 --
NM_033429chr1512167 1623 ----
NM_033449chr551514 1353 588 196 39 1752 31882 1490 45 1242
NM_033502chr61151 ------
NM_033624chr1251494 1482 514 346 41 21695 1500 --12298
NM_033642chrX61187 931 907 777 159 135 1476 ----
NM_033656chr2185657 4709 4275 2349 2089 1618 1602 1009 35774 4770 789 13863 --
NM_052832chr832636 893 853 ------
NM_052834chr182231 67 2769 48 12362 1861
NM_052885chr12104173 1983 1688 1663 1620 1312 639 556 473 439 ------
NM_052898chr821275 145 ----1583
NM_052900chr841482 1140 471 426 ------
NM_052905chr251924 1762 1553 1246 1179 ------
NM_052932chr11147 --1260 --
NM_052953chr31232 ------
NM_053016chr9127841 7620 7557 7052 6213 5528 2557 2215 2117 1655 830 516 36972 2247 963 37596 2372 1186 --
NM_053024chr331341 498 425 ------
NM_053035chr7177 ------
NM_053064chr144669 554 418 270 32161 1239 997 ----
NM_053279chr852330 1869 455 436 392 12590 --1146
NM_053281chrX--166 ----
NM_054016chr11620 ------
NM_054016chr11620 ------
NM_054016chr11620 ------
NM_054111chr61974 ----1111
NM_054114chr6138 --1733 --
NM_057159chr91437 11560 ----
NM_057169chr1253089 3052 2510 2158 202 --1635 --
NM_057170chr1253089 3052 2510 2158 202 --1635 --
NM_057175chr442364 2311 1840 146 --2256 251 --
NM_057178chr1752317 581 467 302 158 ----1938
NM_058170chr12432 211 ------
NM_058172chr421507 543 1446 ----
NM_078469chr102282 233 1524 ----
NM_078471chr1721096 800 1870 11040 --
NM_080415chr173710 644 186 --2746 93 1872
NM_080491chr1133840 3112 392 --53408 3237 2693 2655 297 12895
NM_080597chr18188 1991 ----
NM_080629chr121018 263 ------
NM_080630chr121018 263 ------
NM_080654chr1131122 78 51 ------
NM_080661chr111335 ------
NM_080669chr1754914 4622 4356 3578 1530 1281 11979 --
NM_080671chr212156 ------
NM_080672chr201414 ------
NM_080676chr2052087 1219 934 335 248 22711 2067 ----
NM_080738chr12525 308 --1744 --
NM_080840chr201135 ------
NM_080841chr201135 ------
NM_080867chr1484983 4231 3489 3383 1891 1240 1115 369 --31556 1317 1121 --
NM_080874chr451851 1741 1217 750 274 ------
NM_130391chr913036 23318 2378 ----
NM_130392chr913036 23318 2378 ----
NM_130393chr913036 23318 2378 ----
NM_130434chr1521219 300 ------
NM_130436chr21--1294 1648 11871
NM_130438chr211261 1871 11225 12448
NM_130439chr1031678 761 426 --1670 --
NM_130439chr1031678 761 426 --1670 --
NM_130808chr33330 143 39 ------
NM_130831chr341101 667 486 209 ------
NM_130832chr341101 667 486 209 ------
NM_130833chr341101 667 486 209 ------
NM_130834chr341101 667 486 209 ------
NM_130835chr341101 667 486 209 ------
NM_130836chr341101 667 486 209 ------
NM_130837chr341101 667 486 209 ------
NM_133265chrX43233 2866 1338 444 12239 23654 2707 --
NM_133329chr241719 1710 612 127 ------
NM_133330chr443054 2721 877 783 --1760 --
NM_133331chr443054 2721 877 783 --1760 --
NM_133334chr456139 5711 1421 525 69 31056 832 288 ----
NM_133335chr443054 2721 877 783 --1760 --
NM_133338chr5--1348 ----
NM_133339chr5--1348 ----
NM_133340chr5--1348 ----
NM_133341chr5--1348 ----
NM_133342chr5--1348 ----
NM_133343chr5--1348 ----
NM_133344chr5--1348 ----
NM_133370chr433565 3252 2397 21171 588 --1804
NM_133378chr211012 1715 ----
NM_133432chr211012 1715 ----
NM_133437chr211012 1715 ----
NM_133445chr933268 3197 2370 33522 3480 3169 --12484
NM_133476chr121444 --31036 352 337 --
NM_133477chr433006 2327 566 13136 ----
NM_133503chr12----1661 --
NM_133504chr12----1661 --
NM_133505chr12----1661 --
NM_133506chr12----1661 --
NM_133507chr12----1839 --
NM_133638chr51310 1353 ----
NM_133645chr6--2629 471 ----
NM_134325chr121755 597 --1553 --
NM_134447chr191230 1490 ----
NM_138285chr24465 445 153 105 ------
NM_138286chr192842 771 --11546 14233
NM_138288chr1411805 1558 11911 --
NM_138292chr1132977 680 352 1712 --1803
NM_138333chr962660 2027 1974 1934 276 100 1492 12342 --
NM_138357chr1041660 1153 1143 389 ------
NM_138381chr322344 1827 --159 22357 2012
NM_138391chr11286 ------
NM_138395chr22790 196 11033 --1169
NM_138423chr15--21460 774 11521 --
NM_138426chr72331 110 ----1166
NM_138459chr642511 1369 1348 336 13194 1564 --
NM_138468chr2125867 5744 4532 2294 2001 1970 1894 1709 975 919 729 124 --21249 952 15427
NM_138473chr1223758 1950 ------
NM_138559chr211060 ----11303
NM_138563chr192557 154 --1164 1257
NM_138571chr62593 254 ------
NM_138615chr3166 ------
NM_138621chr243293 3191 2920 2675 --1410 --
NM_138638chr1451875 1862 464 228 162 21542 358 1580 --
NM_138711chr3152 ------
NM_138712chr3152 ------
NM_138713chr16108189 6980 5804 5641 5499 5292 2817 2590 2064 1610 16714 ----
NM_138714chr16108189 6980 5804 5641 5499 5292 2817 2590 2064 1610 16714 ----
NM_138731chr1484278 4193 3329 3217 2977 2929 1253 821 21319 195 --13512
NM_138771chr731527 1121 565 ------
NM_138774chr191598 ------
NM_138927chr211882 ------
NM_138966chr181543 1116 ----
NM_138969chr831159 461 182 --1122 --
NM_138970chr1432314 1759 550 148 --1939
NM_138971chr1173615 3481 2995 1524 1164 883 783 23699 1089 22395 1433 --
NM_138971chr1173615 3481 2995 1524 1164 883 783 23699 1089 22395 1433 --
NM_138972chr1173615 3481 2995 1524 1164 883 783 23699 1089 22395 1433 --
NM_138972chr1173615 3481 2995 1524 1164 883 783 23699 1089 22395 1433 --
NM_138973chr1173615 3481 2995 1524 1164 883 783 23699 1089 22395 1433 --
NM_138973chr1173615 3481 2995 1524 1164 883 783 23699 1089 22395 1433 --
NM_139048chr31187 ------
NM_139071chr1221600 164 --1182 --
NM_139136chr1211006 ------
NM_139182chr451807 1752 1169 374 106 11231 ----
NM_139207chr1221424 766 11820 ----
NM_139318chr141249 ------
NM_139319chr1221834 60 11828 1491 --
NM_144567chr132397 2152 571 22614 2486 ----
NM_144568chr14----2669 560 --
NM_144571chr446367 5619 2514 726 16267 ----
NM_144578chr1475217 5173 4516 3480 3412 1980 583 12201 14237 --
NM_144582chr252156 2138 2001 863 814 1439 1268 --
NM_144590chr1053011 2090 682 372 54 1503 --12658
NM_144609chr172114 38 ------
NM_144632chr231956 586 193 1119 ----
NM_144633chr321256 527 ------
NM_144723chr52357 325 ------
NM_144767chr1554453 3096 861 437 64 33398 3183 1685 --12846
NM_144778chr134324 306 170 73 11699 1565 11734
NM_144949chr262575 1746 1644 1604 234 174 11784 ----
NM_144963chr8--1626 ----
NM_144979chr41241 ------
NM_144981chr11198 ------
NM_145000chr51465 192 ----
NM_145025chr63298 268 55 81169 47 43 39 35 31 27 23 1355 --
NM_145115chr722291 715 12252 22153 2137 --
NM_145117chr1143202 2620 2057 2026 ------
NM_145176chr663440 3357 3327 2381 1372 1353 2808 500 12238 --
NM_145206chr1032725 1317 165 ------
NM_145207chr445036 4825 4737 1500 13491 14693 --
NM_145243chr1150 ------
NM_145244chr441602 1148 439 354 151 ----
NM_145259chr255377 1790 1654 1042 422 ----14984
NM_145284chrX21896 295 11974 12358 --
NM_145285chr10--3723 719 715 ----
NM_145305chrX2973 106 ----11281
NM_145320chr743585 2547 2252 2218 33473 1311 1157 13598 --
NM_145321chr743585 2547 2252 2218 33473 1311 1157 13598 --
NM_145322chr743585 2547 2252 2218 33473 1311 1157 13598 --
NM_145644chr21360 ------
NM_145690chr841754 1631 1231 70 --11697 --
NM_145698chr1022007 1782 ------
NM_145716chr1--187 ----
NM_145754chr82534 182 ------
NM_145759chr131455 393 178 12109 ----
NM_145808chr752592 2117 2048 81 63 ------
NM_145861chr12525 308 --1744 --
NM_145888chr1922043 1906 --21396 185 --
NM_145913chr123857 735 150 ------
NM_147150chr973925 2978 2949 2701 1563 656 445 ------
NM_147156chr1041245 208 126 94 11114 ----
NM_147168chr9--160 ----
NM_147171chr71431 ------
NM_147185chr71431 ------
NM_148904chr1----1120 --
NM_148905chr1----1120 --
NM_148906chr1----1120 --
NM_148907chr1----1120 --
NM_148908chr1----1120 --
NM_148909chr1----1120 --
NM_148955chr15116089 5684 5031 2111 1874 1861 1501 841 735 140 55 11834 44553 4176 674 124 --
NM_152133chr6138 --1733 --
NM_152222chr1111360 31469 726 669 11193 11217
NM_152265chr11360 ------
NM_152277chr531808 1587 527 1868 ----
NM_152278chrX----1397 --
NM_152305chr332052 1569 131 ------
NM_152365chr12386 319 ------
NM_152387chr231055 708 386 1923 ----
NM_152388chr253352 2776 1573 784 260 11584 --13613
NM_152409chr523293 344 ------
NM_152424chrX43675 763 716 678 1662 33146 609 301 --
NM_152437chr1242085 624 512 353 1332 ----
NM_152464chr171238 1790 ----
NM_152487chr131402 1357 1117 --11123 --
NM_152520chr21496 ------
NM_152529chr264428 3868 2733 1490 1006 624 --24148 2716 --
NM_152549chr52582 212 ------
NM_152556chr722380 455 11026 --1664
NM_152588chr121505 ------
NM_152594chr1511662 ------
NM_152603chr193597 569 191 ------
NM_152605chr191123 21412 161 1900 --
NM_152607chr12431 332 ------
NM_152608chr172513 2453 2133 1863 292 128 24 2281 234 ----
NM_152622chr52881 302 12443 11106 --
NM_152641chr1241969 1161 729 248 12171 --12184
NM_152660chr12279 123 ----1701
NM_152663chr11227 ------
NM_152678chr341913 1854 432 404 ------
NM_152694chrX2824 699 ----1280
NM_152703chr73871 719 69 11161 ----
NM_152716chr1141391 607 376 314 ------
NM_152724chr1032109 2024 70 ----1577
NM_152740chr71185 --1104 --
NM_152745chr72845 294 ------
NM_152756chr564342 3943 3585 3512 3159 463 11136 ----
NM_152758chr832481 839 227 12078 ----
NM_152765chr872002 1900 1821 722 567 261 119 ------
NM_152787chrX33540 3422 711 179 ----
NM_152789chr721505 510 1130 ----
NM_152793chr775012 4847 3962 3328 3287 1667 282 ----15124
NM_152826chr15116089 5684 5031 2111 1874 1861 1501 841 735 140 55 11834 44553 4176 674 124 --
NM_152835chr11557 ------
NM_152836chr831717 1556 388 31340 201 36 ----
NM_152837chr831717 1556 388 31340 201 36 ----
NM_152838chr202284 206 --1925 --
NM_152903chr1342689 2641 2595 2193 ------
NM_152924chr1586250 5770 1875 1806 1500 561 307 143 1258 ----
NM_152999chr784936 4674 4373 4325 1606 1008 963 762 13132 23496 1319 --
NM_153020chr62619 533 ----11242
NM_153029chr1643808 3395 2834 986 13784 33145 1294 1285 --
NM_153035chr1103102 2883 2102 2025 1994 1971 535 477 459 51 ------
NM_153038chr21643 ------
NM_153040chr15--141 ----
NM_153181chr181543 1116 ----
NM_153188chr525020 1999 1294 ----
NM_153208chr162987 213 --1809 --
NM_153255chr6------1195
NM_153262chr153099 2811 2237 2117 472 11066 ----
NM_153347chr1162521 2247 833 791 539 260 --21848 726 --
NM_153354chr5--1262 ----
NM_153365chr412119 ------
NM_153450chr111338 ------
NM_153456chr1396131 5044 4866 4850 4611 2389 1507 589 168 24172 154 --14573
NM_153464chr191828 ------
NM_153487chr694829 4507 4104 3235 1632 978 664 558 262 21540 610 21170 395 --
NM_153607chr522623 2446 153 ----
NM_153616chr1532200 1788 34 22231 841 139 1942
NM_153617chr1532200 1788 34 22231 841 139 1942
NM_153618chr1532200 1788 34 22231 841 139 1942
NM_153619chr1553438 3026 1272 1256 191 23469 987 11277 --
NM_153620chr731394 1386 470 --1514 --
NM_153631chr71584 ------
NM_153632chr71584 ------
NM_153649chr112175 ------
NM_153686chr431545 545 24 11575 ----
NM_153687chr122302 156 1139 192 --
NM_153693chr12------1674
NM_153695chr92108 94 ------
NM_153702chr4----1202 --
NM_153748chr1211006 ------
NM_170706chr154073 3518 3327 2835 2793 --1168 --
NM_170709chr81262 ------
NM_170719chr131448 11297 1251 --
NM_170750chrX1806 ------
NM_170768chr1141331 404 213 35 ------
NM_170775chr52202 99 ------
NM_172057chr71396 ------
NM_172069chr222346 2134 ------
NM_172071chr1107052 7013 6042 5646 5508 5353 4654 2076 591 437 26062 1145 26773 4863 --
NM_172103chr632639 2002 467 ------
NM_172105chr632639 2002 467 ------
NM_172127chr442032 1552 783 193 ------
NM_172128chr441988 1508 739 149 ------
NM_172159chr342374 2067 1455 209 --1230 1706
NM_172160chr342374 2067 1455 209 --1230 1706
NM_172240chr1251380 1172 1136 914 491 ------
NM_172344chr241719 1710 612 127 ------
NM_173054chr7----1704 --
NM_173083chr111303 ------
NM_173157chr12----1208 --
NM_173198chr962681 886 828 744 305 82 1821 193 --
NM_173200chr962681 886 828 744 305 82 1821 193 --
NM_173214chr16108189 6980 5804 5641 5499 5292 2817 2590 2064 1610 16714 ----
NM_173216chr342052 671 556 295 12592 42012 1873 1836 1096 --
NM_173217chr342052 671 556 295 12592 42012 1873 1836 1096 --
NM_173468chr424708 1187 --13776 --
NM_173469chr152257 86 ------
NM_173473chr103728 505 336 1146 --1467
NM_173475chr161705 1658 ----
NM_173495chrX138 --11673 1343
NM_173496chr1062962 2593 1184 874 639 262 21038 498 ----
NM_173508chr121023 45 ------
NM_173554chr10------1313
NM_173563chr61259 1265 ----
NM_173576chr1022263 123 12011 ----
NM_173582chr1165958 1725 1344 691 676 96 ------
NM_173595chr1255328 1850 1822 879 588 11385 23254 1036 --
NM_173631chr1921282 1220 1897 11225 --
NM_173642chr188789 8167 7027 6571 6533 6381 2323 2025 11435 26544 1052 17751
NM_173644chr2011409 ----11669
NM_173653chr33588 355 180 --1896 --
NM_173683chr8----1636 --
NM_173808chr194427 3793 3620 3434 3058 3039 2753 1032 728 13395 ----
NM_173809chr1081492 1147 1116 1056 1007 477 318 167 ------
NM_173822chr241548 780 608 174 --1204 --
NM_173824chr31220 ------
NM_173825chr363098 3065 2919 2675 1147 211 12315 11063 --
NM_173829chr556088 5814 4210 3856 144 ----15982
NM_173872chr42324 190 ------
NM_174909chr51782 ------
NM_174911chr873958 2527 1561 1492 926 606 244 22478 1217 1387 --
NM_174934chr1133384 2626 2278 --32554 602 594 --
NM_175061chr742159 1699 1356 777 1707 ----
NM_175566chr11------1166
NM_175607chr311061 11451 ----
NM_175610chr15169 ------
NM_175612chr311061 11451 ----
NM_175736chr12167800 7746 6341 6099 6077 6003 5973 5887 5835 5649 5148 5096 4884 1955 1716 579 --23002 1877 17061
NM_175747chr621058 722 --1976 --
NM_175748chr1411909 ------
NM_175767chr531895 371 176 21200 118 ----
NM_175863chr6--2427 80 ----
NM_175866chr111200 ----1578
NM_175884chr71985 11453 2926 161 --
NM_175907chr1812791 1519 ----
NM_176787chr1841540 1108 620 551 11011 1556 --
NM_176814chr711059 1255 1197 11223
NM_177401chr1931602 1300 745 --21325 617 1421
NM_177414chr131186 571 453 1440 ----
NM_177424chr12754 576 1495 1487 12109
NM_177454chr21864 ----1188
NM_177553chr112826 186 1220 ----
NM_177559chr2011097 ------
NM_177560chr2011097 ------
NM_177974chr15--21460 774 11521 --
NM_177990chr201566 --1654 --
NM_178011chr1053207 2800 2306 2213 1014 11303 12734 --
NM_178151chrX97418 6110 5667 5237 2583 2015 839 317 46 16531 17295 --
NM_178152chrX97418 6110 5667 5237 2583 2015 839 317 46 16531 17295 --
NM_178153chrX97418 6110 5667 5237 2583 2015 839 317 46 16531 17295 --
NM_178313chr231803 1409 747 11429 ----
NM_178427chr12874 600 ------
NM_178498chr1143985 730 599 135 1704 ----
NM_178505chr1012526 23241 3133 11422 1543
NM_178509chr1744043 2800 865 658 --13614 --
NM_178539chr1232073 392 384 12100 ----
NM_178554chr342612 2257 1114 514 13655 11134 --
NM_178565chr81322 ------
NM_178585chr443310 2086 962 916 13167 159 --
NM_178812chr81267 11387 1312 --
NM_178831chr732603 2364 1818 2264 78 ----
NM_181054chr141449 ------
NM_181077chr1512080 ------
NM_181093chr11491 1132 ----
NM_181291chr141782 ------
NM_181332chrX42029 2022 940 179 12538 22597 25 --
NM_181349chr752937 2928 2274 468 410 1743 ----
NM_181354chr811245 --11113 --
NM_181358chr163719 3200 1392 504 212 166 ------
NM_181361chr321266 994 ------
NM_181425chr951148 1076 1042 475 304 --134 --
NM_181443chr2032367 2090 192 ------
NM_181457chr221281 1137 ------
NM_181458chr221414 1270 ------
NM_181481chr1876910 5464 5196 4809 4775 1709 589 16723 ----
NM_181482chr1876910 5464 5196 4809 4775 1709 589 16723 ----
NM_181483chr1876910 5464 5196 4809 4775 1709 589 16723 ----
NM_181504chr51939 33688 2831 1598 1219 --
NM_181521chr1686273 6047 4613 1821 1779 699 74 42 24891 2426 ----
NM_181523chr51939 33688 2831 1598 1219 --
NM_181524chr51939 33688 2831 1598 1219 --
NM_181672chrX--11399 11475 --
NM_181673chrX--11399 11475 --
NM_181702chr81991 ------
NM_181704chr21178 ------
NM_181706chr1112243 11922 ----
NM_181723chr832303 1871 35 ------
NM_181741chr241274 1239 870 453 1431 ----
NM_181742chr241274 1239 870 453 1431 ----
NM_181782chr642304 1881 1835 1558 ------
NM_181783chr121164 12002 ----
NM_181787chr833430 700 179 1826 --13766
NM_181836chr542670 1074 940 48 1215 1451 12097
NM_181886chr431314 1176 95 --180 --
NM_181887chr431314 1176 95 --180 --
NM_181888chr431314 1176 95 --180 --
NM_181889chr431314 1176 95 --180 --
NM_181890chr431314 1176 95 --180 --
NM_181891chr431314 1176 95 --180 --
NM_181892chr431361 1223 142 --1127 --
NM_181893chr431314 1176 95 --180 --
NM_182484chr21178 ------
NM_182485chr422836 634 13034 ----
NM_182488chr131820 ------
NM_182492chr221335 ------
NM_182493chr1685337 4460 4362 4234 3625 2132 1670 641 ------
NM_182641chr172501 95 ------
NM_182646chr422836 634 13034 ----
NM_182678chr21125 ------
NM_182691chr7--11346 ----
NM_182692chr7--11346 ----
NM_182697chr7----11680 --
NM_182701chr63371 329 36 --2694 298 --
NM_182767chr1241818 1368 284 87 ------
NM_182789chr51153 --1306 --
NM_182830chr1421881 720 1681 1595 --
NM_182898chr7105169 4959 4738 4200 1564 1432 1364 640 305 204 34486 1085 649 ----
NM_182899chr7105169 4959 4738 4200 1564 1432 1364 640 305 204 34486 1085 649 ----
NM_182911chr22276 264 1213 ----
NM_182948chr153035 2788 2734 573 522 12218 ----
NM_182964chr1143202 2620 2057 2026 ------
NM_182972chr132029 1725 247 22112 708 ----
NM_183006chr2031212 424 332 ------
NM_183043chr13--1197 ----
NM_183044chr13--1197 ----
NM_183078chr643782 3552 381 350 13792 ----
NM_183234chr1541679 1621 1605 254 ----11650
NM_183235chr1541679 1621 1605 254 ----11650
NM_183236chr1541679 1621 1605 254 ----11650
NM_183244chr201414 ------
NM_183246chr201414 ------
NM_183323chr51153 --1306 --
NM_183380chr61613 1916 ----
NM_183397chr2053599 3248 1011 643 334 1687 14721 --
NM_183419chr811238 ------
NM_194247chr233245 835 570 ----14316
NM_194250chr21356 ------
NM_194282chr462996 2944 2720 2514 2378 484 32303 2096 2092 ----
NM_194301chr1411178 --11189 --
NM_194314chr144181 3651 3425 569 --25257 445 --
NM_194328chr932891 2831 1020 163 ----
NM_194329chr932891 2831 1020 163 ----
NM_194330chr932891 2831 1020 163 ----
NM_194332chr932891 2831 1020 163 ----
NM_194434chr1834854 3975 1840 --45602 1235 562 514 11619
NM_194454chr751766 1747 1388 504 197 11270 ----
NM_194455chr751766 1747 1388 504 197 11270 ----
NM_194456chr751766 1747 1388 504 197 11270 ----
NM_197941chr5----12550 --
NM_197970chr241568 1233 353 21 1278 ----
NM_198081chr642934 2496 2302 281 ----1434
NM_198086chr1432046 1376 802 11454 11410 --
NM_198120chr81599 ------
NM_198123chr841482 1140 471 426 ------
NM_198124chr841482 1140 471 426 ------
NM_198186chr93616 242 208 ----1597
NM_198187chr93616 242 208 ----1597
NM_198212chr732091 936 556 ------
NM_198225chr1021726 490 21560 766 ----
NM_198240chr1211094 ------
NM_198243chr152683 37 1804 ----
NM_198268chr163719 3200 1392 504 212 166 ------
NM_198269chr163719 3200 1392 504 212 166 ------
NM_198270chrX------1331
NM_198391chr202619 526 ------
NM_198392chr621712 255 1643 --1431
NM_198400chr1532957 2540 763 12363 12561 --
NM_198404chr132345 157 ------
NM_198468chr654314 3949 3438 966 23 34519 4235 858 23848 3411 --
NM_198484chr344709 4344 3966 1549 46119 4766 1414 1279 15255 --
NM_198485chr362431 2162 1693 851 716 241 21657 586 1373 --
NM_198503chr11185 ----1892
NM_198513chr821943 1550 ------
NM_198581chr235834 2828 43 22510 1708 --17205
NM_198715chr165969 5495 4883 1558 1368 932 11001 --24645 4081
NM_198716chr1199 2314 147 ----
NM_198717chr1199 2314 147 ----
NM_198859chr364625 1964 1936 883 320 230 ------
NM_198889chr431379 221 151 ------
NM_198896chr113508 419 138 --1428 --
NM_198900chr12167800 7746 6341 6099 6077 6003 5973 5887 5835 5649 5148 5096 4884 1955 1716 579 --23002 1877 17061
NM_198935chr2053190 2712 2558 2135 628 22501 650 ----
NM_198965chr12--1388 ----
NM_198966chr12--1388 ----
NM_198971chr111479 ------
NM_199000chr731887 1586 362 1652 2768 446 12012
NM_199072chr722929 2779 1394 --1926
NM_199131chr1042364 2239 1012 136 --33593 942 873 12990
NM_199160chr911853 2736 389 ----
NM_199344chr1171 ------
NM_199351chr11487 ------
NM_199415chr2082498 2062 1725 925 667 625 545 526 --12366 22157 332
NM_199421chr1484983 4231 3489 3383 1891 1240 1115 369 --31556 1317 1121 --
NM_199423chr161406 31338 375 330 21280 271 1138
NM_199440chr21316 ------
NM_199461chr1073336 1425 1060 1022 688 634 317 12214 ----
NM_199478chrX21964 547 11425 ----
NM_199482chr231578 793 731 ----1704
NM_201266chr212877 --2519 23 1647
NM_201267chr22628 145 ------
NM_201269chr11527 1533 ----
NM_201279chr212877 --2519 23 1647
NM_201430chr112614 130 2302 271 1409 --
NM_201567chr341281 545 303 197 ------
NM_201570chr1021588 1410 --1744 --
NM_201571chr1021588 1410 --1744 --
NM_201572chr1021588 1410 --1744 --
NM_201590chr1021588 1410 --1744 --
NM_201591chr41616 ----1219
NM_201592chr41616 ----1219
NM_201593chr1021588 1410 --1744 --
NM_201596chr1021588 1410 --1744 --
NM_201597chr1021588 1410 --1744 --
NM_201613chr121840 ------
NM_201624chr11117 ------
NM_203283chr41557 1125 ----
NM_203284chr41557 1125 ----
NM_203301chr1431219 1130 52 ------
NM_203318chr1721096 800 1870 11040 --
NM_203341chr12828 113 --198 --
NM_203349chr152743 629 2887 696 ----
NM_203350chr1--1558 --1319
NM_203364chr1131214 384 78 ------
NM_203391chrX21251 1134 191 ----
NM_203403chr9148 ------
NM_203406chr542903 2829 924 817 --11039 --
NM_203434chr91219 ------
NM_203458chr173805 3691 3660 2781 2720 2703 2526 21420 1056 --1129
NM_203459chr142346 2300 1733 820 ----12519
NM_203463chr224604 156 24922 3957 --24250 1044
NM_203467chr14125 ------
NM_203487chr1331749 626 473 ------
NM_203504chr432434 1827 1687 1254 ----
NM_203505chr432434 1827 1687 1254 ----
NM_205860chr122897 2351 ------
NM_206594chr132427 789 642 12712 ----
NM_206595chr132427 789 642 12712 ----
NM_206853chr633497 2859 2565 ------
NM_206854chr664758 4120 3826 3746 731 538 ------
NM_206855chr665723 5085 4791 4711 1696 1503 ------
NM_206866chr2153002 2410 1249 758 466 1289 ----
NM_206876chr222539 1289 1237 ----
NM_206909chr868151 7712 6254 3318 2278 866 12458 ----
NM_207015chr32318 248 ------
NM_207171chr121887 1326 31820 712 445 ----
NM_207303chr1064067 3249 2720 1538 669 222 1728 ----
NM_207304chr133211 193 57 --1452 11621
NM_207337chr122433 38 ------
NM_207377chr141115 ------
NM_207404chr342030 1925 1848 262 11466 31443 773 383 --
NM_207406chr462342 2258 2107 1116 92 70 15180 15276 --
NM_207422chrX41026 961 132 125 ------
NM_207469chr2041315 623 185 141 1613 ----
NM_207517chr151788 ------
NM_207647chr922489 298 1403 11794 --
NM_207660chr14------1137
NM_207661chr14------1137
NM_207662chr14------1137
NM_212471chr172312 117 2790 688 ----
NM_212472chr172312 117 2790 688 ----
NM_213589chr265584 4231 3684 3461 1592 927 24787 398 1412 --
NM_213594chr1231148 262 116 ------
NM_213609chr351092 962 883 347 264 ------
NM_213611chr121102 1320 ----