TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-5192
miRNA Sequence: AGGAGAGUGGAUUCCAGGUGGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr52855 64 ------
NM_000024chr5----1435 --
NM_000034chr162167 56 ------
NM_000037chr842194 2168 925 759 --22514 2455 --
NM_000038chr521283 194 ------
NM_000045chr62411 325 ------
NM_000046chr562459 1117 702 449 243 66 12524 22638 1916 --
NM_000051chr1173293 3227 2820 2559 768 682 204 ------
NM_000061chrX2152 59 2131 39 ----
NM_000063chr62266 99 ------
NM_000067chr81684 ------
NM_000074chrX6773 672 655 633 619 591 2779 359 ----
NM_000081chr111313 21873 25 ----
NM_000084chrX156537 6020 5865 5852 5413 5364 5031 2646 1996 906 722 686 633 393 128 22100 1901 16126 --
NM_000088chr1721170 1160 21129 372 146 11118
NM_000089chr72233 47 ------
NM_000090chr22699 273 --1810 --
NM_000092chr2104499 4121 3991 3943 3409 3115 2980 704 280 226 ------
NM_000110chr13765 395 32 21050 90 1931 --
NM_000114chr202198 128 11061 ----
NM_000115chr1332314 1868 616 11997 ----
NM_000124chr10123 ------
NM_000125chr673597 3521 2710 2697 1219 697 231 23683 279 13362 24065 3377
NM_000129chr63972 323 252 1211 ----
NM_000138chr1552390 2329 1613 903 190 1378 ----
NM_000141chr1031126 1037 499 11096 ----
NM_000142chr421500 504 --11579 --
NM_000158chr31245 ------
NM_000161chr142676 189 21473 1329 1712 --
NM_000163chr511998 12111 12349 --
NM_000165chr621096 299 11487 ----
NM_000166chrX3598 255 65 ------
NM_000167chrX3694 675 645 ------
NM_000168chr7103038 2829 2371 2299 2183 2170 2073 971 767 746 42641 2105 2067 697 1442 --
NM_000170chr93476 429 42 ------
NM_000175chr19145 ------
NM_000176chr551394 1196 632 390 341 23460 347 ----
NM_000188chr10--247 32 ----
NM_000192chr122309 200 ------
NM_000202chrX113303 2672 2635 2533 2488 2450 1527 1479 1046 724 362 22722 2461 --12798
NM_000208chr19104536 4228 3950 3550 1398 1368 788 754 85 49 24027 3178 --12924
NM_000210chr21422 --1768 --
NM_000212chr1761967 1809 1678 545 481 360 11928 ----
NM_000214chr2021542 369 ------
NM_000216chrX53736 3685 3591 3146 482 --1114 --
NM_000217chr12114804 4414 3638 3450 2105 2062 1855 1780 1774 676 655 54970 4940 3790 3406 1960 25221 4176 --
NM_000222chr431671 566 43 31682 307 296 ----
NM_000232chr452671 2351 2055 734 475 --22393 913 12247
NM_000237chr831852 1224 709 11522 ----
NM_000238chr71154 ------
NM_000248chr322395 683 12143 ----
NM_000252chrX41381 409 131 54 ------
NM_000253chr43279 243 76 ------
NM_000259chr15115039 5023 4520 4436 4159 4017 4004 1991 1931 1013 155 25045 4913 36370 4545 2247 --
NM_000264chr963343 2217 1216 1060 500 285 32145 245 64 23091 820 12915
NM_000266chrX2878 263 --1112 --
NM_000267chr1743188 2139 894 79 53292 2393 1133 768 47 1157 --
NM_000268chr2273478 3468 3186 2319 1305 1066 37 12964 42875 2365 1382 127 --
NM_000271chr181222 1233 ----
NM_000278chr10122234 2003 1711 1700 1660 1640 1623 1607 838 805 732 512 2741 674 ----
NM_000284chrX21658 1497 11757 11284 11991
NM_000297chr431964 1950 1627 21559 421 ----
NM_000310chr131244 990 504 --145 --
NM_000314chr1023115 124 23106 915 22424 280 --
NM_000319chr123369 250 68 ------
NM_000332chr6126397 6167 5948 5675 5497 4888 4525 2787 2759 2133 1198 32 2962 611 36903 2304 456 --
NM_000333chr31394 ----31027 450 336
NM_000334chr1792086 1903 1798 1783 1747 1580 879 672 412 --12031 --
NM_000337chr596061 5264 5061 4920 4658 4652 4160 1978 1938 1541 36232 1078 722 15791
NM_000338chr1541113 937 743 176 1314 ----
NM_000340chr331451 599 122 11372 1468 --
NM_000345chr41866 ------
NM_000346chr1761964 1947 1223 547 431 360 1306 ----
NM_000351chrX94072 3759 3478 3459 3342 2936 935 814 669 2828 615 11316 33722 3052 122
NM_000361chr2061784 1662 570 449 439 193 1456 ----
NM_000362chr22133421 2943 2936 2899 2215 1423 1393 1211 1103 817 413 398 277 --23405 67 --
NM_000367chr612180 31722 1569 818 1476 --
NM_000368chr9154366 4099 3707 3279 1911 1905 1405 1117 711 403 375 367 291 282 79 23014 805 34692 4066 517 33811 1159 1133
NM_000369chr1441784 715 263 107 31638 1362 618 --11455
NM_000386chr17121 1146 1228 --
NM_000391chr11101216 1210 1111 668 594 529 517 478 385 254 21670 455 ----
NM_000393chr251906 809 741 564 94 ------
NM_000399chr104817 196 100 89 1150 ----
NM_000408chr252770 1154 1127 806 290 12690 ----
NM_000411chr2183048 2558 2483 2148 1305 710 665 251 22862 2030 12243 --
NM_000412chr32270 103 ------
NM_000421chr172343 308 ------
NM_000423chr12--1173 244 29 --
NM_000425chrX1587 161 ----
NM_000428chr1481852 1776 1629 1017 884 572 257 140 1362 ----
NM_000430chr1763722 3694 3251 3060 2945 2652 --23528 3095 1788
NM_000435chr195861 282 262 102 74 1110 ----
NM_000439chr592124 1829 1763 1613 735 724 321 221 135 --1812 --
NM_000445chr81770 ------
NM_000447chr11103 ------
NM_000448chr1172496 2106 1053 1011 571 147 69 22223 960 --12139
NM_000449chr1----2941 114 1956
NM_000450chr141407 601 221 214 --31464 325 77 --
NM_000461chr344278 790 513 195 44329 3630 3234 1373 11295 11429
NM_000462chr1521292 1224 11687 1408 --
NM_000478chr13650 491 284 --1663 1748
NM_000480chr1131180 1079 209 1359 190 --
NM_000484chr212291 201 ----1772
NM_000489chrX1796 1297 --12255
NM_000492chr721485 475 ------
NM_000493chr62196 46 1241 ----
NM_000495chrX--1260 --1791
NM_000500chr63370 152 40 1482 ----
NM_000503chr8--31470 1387 349 ----
NM_000505chr5122 ------
NM_000516chr202240 115 ------
NM_000522chr71138 ------
NM_000523chr251201 757 473 267 137 ------
NM_000525chr1171501 1482 1414 1235 1206 1033 236 --11228 --
NM_000527chr1952322 2280 822 454 196 31550 278 256 ----
NM_000530chr11267 --1357 --
NM_000533chrX61381 761 440 163 109 82 1477 1174 --
NM_000538chr1321444 298 2262 216 ----
NM_000540chr19147 ------
NM_000554chr1973284 2879 779 219 189 162 50 125 1545 1413
NM_000555chrX197843 7818 7650 7056 7001 6995 6350 6106 5691 5626 5607 5144 4803 2700 2535 2294 1959 1279 175 45821 5582 2899 712 27545 5019 36180 991 510
NM_000560chr11112 3665 575 510 --1703
NM_000572chr11116 ------
NM_000575chr251147 1012 894 432 141 ------
NM_000598chr741507 1352 1255 1066 ----1207
NM_000599chr2134314 3983 3926 3469 3245 2992 2855 2836 639 611 551 407 22 24107 3879 11120 11459
NM_000602chr74438 312 170 94 --21178 599 --
NM_000609chr10103071 2917 2729 2078 1214 707 647 532 455 318 42642 2369 504 274 ----
NM_000611chr11157039 6462 6435 6338 5938 4831 2508 2309 2282 2185 1724 1495 1052 408 23 46415 4794 4345 2262 ----
NM_000615chr1192958 2903 2419 2159 1016 891 595 474 421 --11844 --
NM_000618chr12145818 5786 5642 4657 4527 4255 2616 2464 2330 2058 1924 1717 1263 351 24700 4679 45398 4221 1739 803 --
NM_000618chr12145818 5786 5642 4657 4527 4255 2616 2464 2330 2058 1924 1717 1263 351 24700 4679 45398 4221 1739 803 --
NM_000620chr1272021 1988 503 409 371 256 65 12041 21906 1430 --
NM_000621chr13----1990 --
NM_000627chr21677 --1875 --
NM_000633chr1833726 3398 581 23380 377 15226 --
NM_000635chr1931583 1077 446 11032 11047 --
NM_000660chr192223 213 ------
NM_000678chr201223 ------
NM_000679chr52516 25 ------
NM_000680chr8175 ------
NM_000681chr1061308 1175 918 858 294 223 2905 321 1416 --
NM_000684chr102809 434 1509 1342 --
NM_000685chr31173 ------
NM_000685chr31173 ------
NM_000687chr20157 1202 1119 --
NM_000689chr92358 345 131 ----
NM_000692chr92310 116 --21123 331 1439
NM_000719chr12146224 5706 5672 5199 4561 4445 4419 2630 2521 2378 2135 1371 789 251 44337 2349 2035 1854 36276 5000 4765 --
NM_000721chr182329 2119 2089 2081 1991 1674 388 31 --22703 434 --
NM_000723chr177444 431 367 360 316 273 256 11641 ----
NM_000724chr1011384 1382 --1246
NM_000725chr123951 638 263 ------
NM_000726chr2--21352 1052 ----
NM_000756chr82400 355 1435 ----
NM_000757chr13892 298 37 1762 --1884
NM_000767chr1911423 --1326 11138
NM_000788chr4--21062 981 ----
NM_000789chr172223 176 1214 ----
NM_000793chr14114925 4617 4537 3392 3367 3257 1628 1218 1143 554 206 24631 4095 --14014
NM_000794chr5--21051 128 1915 --
NM_000795chr111917 1112 1893 --
NM_000801chr203755 199 189 ----1783
NM_000806chr531256 713 632 ------
NM_000809chr4157144 6834 6339 6117 6019 3440 3417 3227 2833 2749 2525 2173 2167 1631 1180 43582 3334 1543 758 57654 6008 5693 3410 3198 13248
NM_000810chr151215 ----2392 83
NM_000813chr574859 4331 3944 3725 2127 1771 527 22115 1169 ----
NM_000814chr1584071 3939 3842 3717 3399 1675 1116 147 23028 2723 --13641
NM_000817chr22995 983 2459 242 --11251
NM_000818chr10--1529 --1217
NM_000820chr132240 103 ------
NM_000824chr4--1277 ----
NM_000826chr432487 1860 958 --12027 --
NM_000827chr541802 968 428 422 52168 1835 1600 558 466 42497 1841 1613 1021 21886 545
NM_000831chr165532 5118 4614 4155 264 167 1767 2908 295 --
NM_000833chr1651541 1281 1265 1204 1009 --11386 --
NM_000834chr1241154 800 208 188 ----11055
NM_000838chr632389 1092 563 2967 631 --12681
NM_000840chr71168 ------
NM_000842chr111516 2657 276 1679 --
NM_000844chr32992 75 11062 ----
NM_000849chr123139 3101 12233 12143 --
NM_000855chr111337 ------
NM_000861chr362610 1965 1030 574 436 368 22591 599 1317 --
NM_000864chr12823 21 ------
NM_000870chr581516 629 558 518 426 247 237 110 21339 97 --11162
NM_000872chr1021416 146 ------
NM_000875chr15166832 5841 4992 4571 4417 2800 2631 1721 1581 1523 1392 1336 957 606 334 324 --12155 --
NM_000876chr631231 375 112 21399 921 ----
NM_000883chr72626 249 2122 111 ----
NM_000883chr72626 249 2122 111 ----
NM_000891chr1751277 1140 1049 993 587 ------
NM_000898chrX2774 165 --130 --
NM_000899chr1274425 3825 3091 2718 1543 607 29 23773 1434 ----
NM_000901chr411031 11925 ----
NM_000917chr10375 38 23 ------
NM_000919chr5157 ------
NM_000921chr12----154 --
NM_000922chr112179 95 ------
NM_000933chr2011650 --1314 --
NM_000935chr3------11095
NM_000944chr421547 509 22214 679 ----
NM_000945chr251700 1386 541 176 82 144 ----
NM_000949chr51778 1153 ----
NM_000950chrX43336 2603 107 56 ------
NM_000956chr144762 750 348 284 ------
NM_000958chr51538 --1998 --
NM_000959chr173794 3222 3187 1590 1377 1154 429 23566 2922 --11506
NM_000961chr2093662 3094 2780 2732 1149 1056 1007 269 131 33851 3740 228 23185 2890 --
NM_000964chr171502 11376 ----
NM_000965chr321201 383 ------
NM_000983chr161646 1591 524 468 412 195 ------
NM_001001132chr2151368 1336 1288 1178 275 --1297 --
NM_001001323chr1232872 2652 171 1244 ----
NM_001001330chr1031057 497 129 ------
NM_001001331chr372525 2216 1843 434 345 190 58 11912 21929 1835 --
NM_001001395chr1232764 694 460 1964 12557 --
NM_001001396chr1113982 3824 3672 3110 2982 2711 947 870 811 617 303 41516 1369 837 259 23459 602 --
NM_001001419chr555193 4306 1021 396 195 11210 11623 11963
NM_001001420chr555193 4306 1021 396 195 11210 11623 11963
NM_001001436chr165870 733 610 73 55 ------
NM_001001481chr832671 2231 1296 12236 22698 2401 --
NM_001001484chr1042481 1964 625 297 ----11711
NM_001001502chr5190 ------
NM_001001523chr141231 847 85 27 --11077 --
NM_001001549chr742808 2005 1840 333 22023 1912 ----
NM_001001550chr742808 2005 1840 333 22023 1912 ----
NM_001001552chr11314 ------
NM_001001555chr742808 2005 1840 333 22023 1912 ----
NM_001001556chr1541164 494 301 59 2596 158 ----
NM_001001557chr842226 2179 1675 278 1319 11519 --
NM_001001560chr221126 --1157 --
NM_001001664chr232589 2561 38 --23619 1113 --
NM_001001701chr472268 2192 2184 2138 657 240 91 --11475 --
NM_001001702chr571658 1643 1444 1420 1334 746 378 11567 --1411
NM_001001740chr1196 ----1201
NM_001001740chr1196 ----1201
NM_001001787chr1----1184 --
NM_001001872chr142610 534 ------
NM_001001875chr91289 ------
NM_001001890chr2184251 4173 3992 3841 2981 2851 2825 2795 14088 13062 --
NM_001001924chr831353 682 324 11413 21386 27 --
NM_001001925chr831353 682 324 11413 21386 27 --
NM_001001931chr831353 682 324 11413 21386 27 --
NM_001001936chr1031142 785 26 1483 1908 --
NM_001001938chr973998 3474 3442 1531 1090 324 291 23119 3078 ----
NM_001001971chr1031166 532 27 ------
NM_001001977chr201165 ------
NM_001001995chrX21511 1443 21589 681 ----
NM_001002009chr73179 99 27 1172 ----
NM_001002010chr73179 99 27 1172 ----
NM_001002031chr12130 ------
NM_001002032chr173506 75 62 ------
NM_001002233chr862123 1863 1442 739 460 45 22002 868 --1654
NM_001002245chr171262 1368 ----
NM_001002246chr171262 1368 ----
NM_001002247chr171262 1368 ----
NM_001002248chr171262 1368 ----
NM_001002249chr171262 1368 ----
NM_001002255chr62354 63 ------
NM_001002257chr211435 1667 12478 --
NM_001002269chr9--1164 ----
NM_001002296chr821037 147 3459 359 83 ----
NM_001002762chr1032939 2509 2035 2524 381 21185 655 --
NM_001002814chr873794 3627 1442 1288 739 460 45 1868 --1654
NM_001002837chr22172 ----1272
NM_001002838chrX1612 --3692 439 402 1322
NM_001002860chr1474249 3836 3750 3543 1862 1498 519 11246 14287 21548 1195
NM_001002906chrY1458 --131 --
NM_001002909chr1782263 1897 1849 1662 1641 1591 342 227 ------
NM_001002919chr22402 388 --1126 --
NM_001003406chr2293178 3050 2875 2858 2852 2257 2063 1253 699 ------
NM_001003407chr10144791 4547 4435 4141 4070 3985 3898 3663 3550 3178 1929 1738 974 728 23596 3422 ----
NM_001003408chr10144791 4547 4435 4141 4070 3985 3898 3663 3550 3178 1929 1738 974 728 23596 3422 ----
NM_001003652chr18128494 6602 6351 6294 5708 2663 2551 2303 2207 1641 1093 572 25975 727 47401 7162 205 48 17499
NM_001003674chr18125910 5620 4472 2488 2308 2220 2061 1628 1146 1138 902 448 22295 1756 ----
NM_001003675chr18125910 5620 4472 2488 2308 2220 2061 1628 1146 1138 902 448 22295 1756 ----
NM_001003681chr2251762 1575 1488 1448 259 ------
NM_001003688chr421151 805 ----1832
NM_001003694chr33576 480 46 ------
NM_001003698chr611746 1330 ----
NM_001003699chr611746 1330 ----
NM_001003712chr1263479 3098 2891 2764 2702 1121 ------
NM_001003786chr174614 583 553 475 1666 --127
NM_001003787chr174614 583 553 475 1666 --127
NM_001003788chr174614 583 553 475 1666 --127
NM_001003792chr321134 437 ------
NM_001003793chr321134 437 ------
NM_001003794chr382220 2187 1026 1002 746 661 414 303 12022 32934 2298 2062 --
NM_001003799chr72645 127 1562 ----
NM_001003800chr983557 3263 2760 1484 1309 1224 1106 226 33293 1513 776 ----
NM_001003891chr222280 112 ------
NM_001003943chr1583857 3589 3411 2393 1259 1033 864 142 2504 23 ----
NM_001004051chrX1131 ------
NM_001004065chr943133 1570 557 338 33478 519 488 23348 2858 --
NM_001004127chr13--2849 638 ----
NM_001004317chr664454 1642 1223 569 354 25 ------
NM_001004323chr7140 ------
NM_001004342chr1246040 5845 5814 5350 5195 2144 1871 1478 1413 1314 1048 1031 848 827 784 773 758 733 723 701 671 608 480 65 15554 22101 792 --
NM_001004356chr421546 1367 --21266 1047 --
NM_001004358chr421546 1367 --21266 1047 --
NM_001004419chr1284433 4368 4314 4028 3451 1329 988 271 13578 24332 1532 --
NM_001004720chr22714 116 ------
NM_001004722chr22883 285 ------
NM_001005271chr1751125 1079 1064 196 139 31092 179 155 11166 --
NM_001005273chr1751125 1079 1064 196 139 31092 179 155 11166 --
NM_001005335chr192294 50 ------
NM_001005354chr123571 519 46 ------
NM_001005366chr123942 770 121 ------
NM_001005375chrY2407 198 1479 --1226
NM_001005386chr231937 514 100 ------
NM_001005404chr17124544 4265 4192 3668 3582 3361 1555 1075 643 540 225 178 11146 --12832
NM_001005463chr1032088 1842 651 --21046 714 --
NM_001005473chr5106308 5323 5176 5001 2598 2432 2288 1105 837 375 45196 4892 2438 2294 --1174
NM_001005476chr22185 28 ------
NM_001005505chr33378 55 47 11224 ----
NM_001005527chr341038 326 232 170 ------
NM_001005609chrX53847 1055 737 601 416 22450 838 33631 3463 3443 32610 278 176
NM_001005739chr21242 1648 ----
NM_001005741chr11392 --1156 --
NM_001005742chr11392 --1156 --
NM_001005743chr1431175 253 98 ------
NM_001005744chr1431175 253 98 ------
NM_001005745chr1431175 253 98 ------
NM_001005746chr2--21352 1052 ----
NM_001005747chr2--21352 1052 ----
NM_001005782chr22381 217 ----1328
NM_001005845chr831687 1306 693 1203 ----
NM_001005849chr17160 ------
NM_001005861chr3----1790 --
NM_001005910chr32507 62 ------
NM_001005911chr32507 62 ------
NM_001005920chr162727 331 --1994 --
NM_001006115chr362637 2624 2357 2126 1750 684 32239 459 36 1405 --
NM_001006600chr531822 430 379 ----21684 542
NM_001006605chr1----11127 1822
NM_001006605chr1----11127 1822
NM_001006610chr1631019 756 89 ------
NM_001006612chrX1381 ------
NM_001006613chrX1381 ------
NM_001006614chrX1381 ------
NM_001006617chr92413 139 11085 1472 --
NM_001006619chr92413 139 11085 1472 --
NM_001006620chr92413 139 11085 1472 --
NM_001006621chr92413 139 11085 1472 --
NM_001006623chr262104 1909 1834 1719 670 176 12056 21864 131 12070
NM_001006636chr2--1887 --156
NM_001006657chr292963 2336 2259 2248 2108 2083 1038 639 244 12073 22839 2400 --
NM_001006665chr11167 --1187 --
NM_001006684chrX2544 194 ------
NM_001006933chrX157 ------
NM_001006945chr1------1269
NM_001006946chr241821 1391 298 58 2280 234 11459 --
NM_001007023chr14114925 4617 4537 3392 3367 3257 1628 1218 1143 554 206 24631 4095 --14014
NM_001007024chr17113913 3736 3519 3115 3090 1556 844 447 441 435 22 43388 2724 467 352 24216 548 --
NM_001007025chr17113913 3736 3519 3115 3090 1556 844 447 441 435 22 43388 2724 467 352 24216 548 --
NM_001007067chr84935 343 221 151 --1241 --
NM_001007068chr84935 343 221 151 --1241 --
NM_001007069chr84935 343 221 151 --1241 --
NM_001007070chr84935 343 221 151 --1241 --
NM_001007075chr411070 ------
NM_001007097chr9104931 4416 4078 3874 3823 3504 1957 325 268 217 33881 3723 3557 --13647
NM_001007098chr11317 ------
NM_001007102chr641428 1331 389 356 ------
NM_001007156chr1551684 747 676 430 325 31644 1582 739 21222 398 --
NM_001007214chr11252 ----1140
NM_001007237chr192022 1938 994 531 460 440 348 305 48 ----1814
NM_001007245chr71183 ------
NM_001007246chr213702 332 119 11379 ----
NM_001007257chr121546 607 ------
NM_001007277chr112427 254 ------
NM_001007471chr9177 156 ----
NM_001007538chr1341563 1539 1459 58 --1639 --
NM_001007544chr11351 ------
NM_001007553chr111010 21192 83 ----
NM_001007559chr1831724 836 196 ------
NM_001007565chr31267 ------
NM_001008220chr593785 3131 2735 883 545 232 153 141 122 12518 11032 --
NM_001008222chrX31183 998 296 1259 1500 --
NM_001008225chr72600 579 ------
NM_001008239chr18113393 2754 2503 2353 1411 1007 787 684 660 215 146 33234 2899 1392 12562 --
NM_001008272chr3192 1294 1288 --
NM_001008273chr3192 1294 1288 --
NM_001008392chr382665 1346 1280 947 831 799 386 186 1953 13377 --
NM_001008401chr1911510 11304 ----
NM_001008407chr751808 1501 1471 1334 555 --1653 --
NM_001008408chr7126204 5619 5516 5494 5487 4039 3938 2267 1455 1372 221 101 25608 130 25580 4730 34468 3907 1109
NM_001008495chr851737 1516 819 720 360 1439 ----
NM_001008541chr1042112 2025 1772 635 1709 ----
NM_001008541chr1042112 2025 1772 635 1709 ----
NM_001008564chr132220 142 --11447 --
NM_001008660chr1121555 395 1447 2977 108 --
NM_001008701chr19152916 2899 2862 2828 2742 2026 1197 1062 1020 876 847 615 599 437 323 12505 2316 110 --
NM_001008707chr1431891 1525 1287 1698 1550 1308
NM_001008738chr552425 1834 1158 1031 1019 --11908 --
NM_001008777chr171232 ------
NM_001008801chr1912127 --11566 --
NM_001008895chr1321285 546 ------
NM_001008925chr453145 2789 601 237 58 --1862 --
NM_001008938chr114387 355 323 175 ------
NM_001009185chr52582 569 ------
NM_001009554chr454060 3425 1762 1504 101 13986 13972 13849
NM_001009554chr454060 3425 1762 1504 101 13986 13972 13849
NM_001009566chr141117 1065 224 59 1195 ----
NM_001009571chr731556 1354 642 11599 --11638
NM_001009814chr13------195
NM_001009899chr3106022 5737 5392 5021 4616 4433 2345 1978 869 551 25201 875 21434 748 --
NM_001009955chr12227 159 ------
NM_001009955chr12227 159 ------
NM_001009958chr71464 2396 222 ----
NM_001009959chr272638 2575 1977 901 532 437 24 1853 1122 --
NM_001009993chr273795 3734 3664 2839 1303 109 95 11665 ----
NM_001010852chr61145 ------
NM_001010861chr142773 2683 862 714 ------
NM_001010867chr195939 5798 5658 5476 5172 2638 2230 1389 201 21599 1218 36578 5244 4071 15606
NM_001010888chrX44544 3749 3738 1574 11264 13641 13201
NM_001010891chr576507 5634 4521 2529 2309 559 126 26446 2008 15187 --
NM_001010895chr91389 12002 1455 11977
NM_001010908chr102646 512 ------
NM_001010911chr104942 329 211 167 ------
NM_001010924chr101331 1925 11198 --
NM_001010926chr13658 163 116 ------
NM_001010934chr7--11169 --11134
NM_001010942chr121835 --1110 1178
NM_001010980chr143414 2260 734 289 146 23181 73 --
NM_001010986chrX31979 125 77 ------
NM_001011513chr453979 2856 2776 1113 345 12705 ----
NM_001011537chr342398 2079 1674 117 ------
NM_001011553chr72613 223 --1754 --
NM_001011658chrX21809 108 --31392 688 357 --
NM_001011666chr7135865 5566 4954 4758 4731 4717 2444 2096 1330 1282 806 573 490 76096 5590 4449 1793 613 566 235 25140 1631 14204
NM_001011708chr262806 1191 1128 1102 794 270 ------
NM_001011885chr1511322 ------
NM_001012267chr921435 148 ------
NM_001012300chr12131 1230 1297 --
NM_001012329chr131733 342 293 --12093 --
NM_001012333chr112319 66 ------
NM_001012334chr112319 66 ------
NM_001012338chr15144 ------
NM_001012393chr11114920 4145 3911 1606 1395 1256 1141 1014 954 294 281 64576 4091 1757 1724 893 40 ----
NM_001012398chr161959 --133 11101
NM_001012420chr1552217 875 797 571 212 1456 11884 --
NM_001012423chr1552217 875 797 571 212 1456 11884 --
NM_001012426chr683419 2842 1331 1297 961 887 794 323 43078 1375 1363 1179 22647 441 23025 495
NM_001012427chr683419 2842 1331 1297 961 887 794 323 43078 1375 1363 1179 22647 441 23025 495
NM_001012446chr91296 ------
NM_001012478chr194577 489 444 46 --1585 --
NM_001012614chr4----1240 --
NM_001012642chr1552000 1789 1750 1552 153 31545 1416 34 1752 --
NM_001012732chr421006 159 2351 301 ----
NM_001012751chr1041315 1295 710 424 --11669 11585
NM_001012755chrX85078 4444 4390 1877 985 921 523 419 53173 1378 1041 808 215 34568 1289 1007 14356
NM_001012756chr1933207 2442 741 22665 2303 --32078 1249 556
NM_001012761chr592360 2314 953 913 709 642 581 557 410 1585 2830 536 --
NM_001012968chrX92686 825 565 559 543 527 517 487 331 1817 1550 --
NM_001012977chrX111316 1160 493 479 319 283 207 188 176 156 132 ------
NM_001012989chrX134 1472 ----
NM_001013031chr1082972 2404 2203 1339 814 696 251 233 1668 1545 1466
NM_001013398chr741507 1352 1255 1066 ----1207
NM_001013399chr61356 11162 ----
NM_001013415chr42441 272 1314 --11358
NM_001013438chr32701 262 ------
NM_001013439chr32547 108 ------
NM_001013620chr12178359 8276 7994 7975 7362 6843 6690 6499 5909 5219 3331 3123 2930 1971 1419 1019 254 31595 1176 353 12336 --
NM_001013635chr1261181 1053 1047 831 804 288 ------
NM_001013690chr12132398 2362 2047 1742 1619 875 570 463 408 394 385 362 311 2529 487 2934 372 11581
NM_001013693chr172239 2155 1831 873 732 257 209 ------
NM_001013693chr172239 2155 1831 873 732 257 209 ------
NM_001014283chr1331876 1450 710 ------
NM_001014434chr1140 ------
NM_001014435chr162510 428 1248 ----
NM_001014797chr10137728 7495 7445 3150 3025 2768 2338 2176 1665 1215 1046 511 502 12206 48177 5645 2941 2100 --
NM_001014809chr43995 324 134 ------
NM_001014811chr111118 ------
NM_001014812chr152308 180 ------
NM_001014839chr121021 908 ------
NM_001014841chr121021 908 ------
NM_001015045chr461927 1586 784 460 387 288 1532 ----
NM_001015048chr1453149 2935 2364 1243 932 ------
NM_001015049chr1453149 2935 2364 1243 932 ------
NM_001015053chr1761452 1261 1123 1027 556 518 1425 31491 1227 414 2510 325
NM_001015072chr7127 ------
NM_001015508chr81303 --2699 628 --
NM_001015877chrX63129 2667 2155 640 521 115 1666 ----
NM_001015880chr1041650 1419 1369 423 --1377 --
NM_001015881chrX31062 901 450 158 --11193
NM_001015882chr93946 794 726 2799 738 ----
NM_001015887chr331514 620 442 --1513 --
NM_001017395chr373638 3079 2712 2479 801 522 417 13011 11433 --
NM_001017405chr43354 245 142 --1266 --
NM_001017415chr1--1120 ----
NM_001017416chr1--1120 ----
NM_001017424chr161501 578 525 272 209 176 1506 ----
NM_001017425chr161501 578 525 272 209 176 1506 ----
NM_001017440chr7177910 7523 7448 7393 6832 6742 6421 6411 5758 2493 2094 2011 1916 1628 1061 735 655 47647 7000 3242 490 67531 6515 2146 1736 425 68 15782
NM_001017923chr1421093 46 --11063 --
NM_001017926chr821818 304 --11761 --
NM_001017962chr10375 38 23 ------
NM_001017995chr5104815 4298 4006 3628 3048 2952 1809 1482 1429 1275 ----2318 86
NM_001017999chr132274 377 181 1646 21888 248 --
NM_001017999chr132274 377 181 1646 21888 248 --
NM_001018000chr132274 377 181 1646 21888 248 --
NM_001018000chr132274 377 181 1646 21888 248 --
NM_001018001chr132274 377 181 1646 21888 248 --
NM_001018005chr153162 58 21 ------
NM_001018009chr31358 21132 399 ----
NM_001018050chr2243399 2693 2525 2488 11154 ----
NM_001018052chr2243399 2693 2525 2488 11154 ----
NM_001018054chr1------11246
NM_001018057chr1111362 2452 178 ----
NM_001018064chr931996 143 99 1221 ----
NM_001018065chr985904 5858 5684 3963 2347 1423 574 417 4865 845 734 171 15295 --
NM_001018066chr985904 5858 5684 3963 2347 1423 574 417 4865 845 734 171 15295 --
NM_001018067chr153958 2106 1246 866 165 13501 14888 --
NM_001018068chr153958 2106 1246 866 165 13501 14888 --
NM_001018069chr153958 2106 1246 866 165 13501 14888 --
NM_001018074chr551394 1196 632 390 341 23460 347 ----
NM_001018075chr551394 1196 632 390 341 23460 347 ----
NM_001018076chr551394 1196 632 390 341 23460 347 ----
NM_001018077chr551394 1196 632 390 341 23460 347 ----
NM_001018090chr1552584 581 541 164 55 --12780 --
NM_001018091chr1552694 691 651 274 165 --12890 --
NM_001018102chr1552584 581 541 164 55 --12780 --
NM_001018108chr1581826 1818 1564 904 684 358 336 174 32157 1584 866 ----
NM_001020658chr151642 1364 1072 439 334 ------
NM_001020658chr151642 1364 1072 439 334 ------
NM_001023567chr155878 800 574 457 310 --11905 --
NM_001023587chr32985 844 ------
NM_001024071chr14--1351 ----
NM_001024094chr551394 1196 632 390 341 23460 347 ----
NM_001024218chr141592 ------
NM_001024226chr12938 47 ------
NM_001024227chr12938 47 ------
NM_001024228chr12938 47 ------
NM_001024401chr16102083 2073 2016 2003 1985 1929 1894 1878 1039 773 ------
NM_001024455chrX102694 2456 2446 1900 1025 970 946 764 388 351 11771 22027 833 --
NM_001024460chr64984 393 200 146 ------
NM_001024601chr1135 ------
NM_001024649chr552479 1920 1835 913 36 32891 1979 1047 --12181
NM_001024666chrX1540 ------
NM_001024680chr261538 1520 1455 1350 631 57 11471 1706 --
NM_001024688chr822122 2053 21879 374 ----
NM_001024808chr1272129 1107 1100 979 863 730 535 31907 825 384 ----
NM_001024809chr171502 11376 ----
NM_001024847chr382404 2173 1625 973 931 908 689 614 11646 1747 --
NM_001024855chr341895 1791 1212 154 --11903 1599
NM_001024934chr61472 ------
NM_001024935chr61472 ------
NM_001024936chr61472 ------
NM_001024937chr176695 586 199 182 80 43 1291 --1644
NM_001024947chr53759 95 60 --11117 --
NM_001024948chr133431 3212 326 12489 ----
NM_001025068chr361745 1617 1333 721 135 92 ------
NM_001025069chr361745 1617 1333 721 135 92 ------
NM_001025076chr10155924 5739 5001 4917 4403 4274 3960 2471 2216 2137 2010 1290 579 167 27 35023 4423 4342 14384 15494
NM_001025077chr10167282 7097 6359 6275 5761 5632 5318 4775 2648 1937 1525 1326 1224 1209 1161 27 56381 5781 5700 1213 551 45742 1386 1126 246 16852
NM_001025079chr363729 2921 2706 2653 2527 779 12559 12542 --
NM_001025081chr1821143 336 ------
NM_001025090chr1821143 336 ------
NM_001025092chr1821143 336 ------
NM_001025101chr1821143 336 ------
NM_001025105chr521282 58 ------
NM_001025108chr273594 3192 1220 1078 628 496 355 2954 215 --14011
NM_001025109chr171021 815 733 473 387 329 51 11063 1800 --
NM_001025201chr22542 135 1548 ----
NM_001025233chr1242672 2379 1771 456 22708 1852 12087 --
NM_001025266chr3154399 4312 3655 3560 3043 1955 1899 1512 1323 1277 939 501 385 222 159 44326 1653 1393 1327 54884 4835 3819 1686 1245 11348
NM_001025366chr651704 1412 1364 1354 605 1699 ----
NM_001025366chr651704 1412 1364 1354 605 1699 ----
NM_001025367chr651704 1412 1364 1354 605 1699 ----
NM_001025367chr651704 1412 1364 1354 605 1699 ----
NM_001025368chr651704 1412 1364 1354 605 1699 ----
NM_001025368chr651704 1412 1364 1354 605 1699 ----
NM_001025369chr651720 1428 1380 1370 621 1715 ----
NM_001025369chr651720 1428 1380 1370 621 1715 ----
NM_001025370chr651704 1412 1364 1354 605 1699 ----
NM_001025370chr651704 1412 1364 1354 605 1699 ----
NM_001025389chr1131180 1079 209 1359 190 --
NM_001025390chr1131180 1079 209 1359 190 --
NM_001025579chr174982 865 477 291 ------
NM_001025580chrX62870 1702 995 539 46 34 --13629 --
NM_001025596chr111142 1119 ----
NM_001025603chr1----2941 114 1956
NM_001025780chr921374 53 --21558 1019 --
NM_001029835chr71354 ------
NM_001029858chr653012 2843 2563 2121 337 1857 22908 1298 --
NM_001029860chr81304 ------
NM_001029863chr652626 2590 2491 1160 801 12010 21128 1008 --
NM_001029864chr2062448 2022 1975 1607 369 275 ------
NM_001029871chr20131878 1807 1747 1730 438 318 268 243 217 115 85 75 67 2124 103 2205 22 --
NM_001029875chr562184 2035 2013 1924 1844 1025 --12591 --
NM_001029976chr8--145 ----
NM_001029998chr441352 458 285 236 11129 --1914
NM_001030006chr1772487 2309 2195 1809 868 774 57 2648 263 --12230
NM_001030007chr1693714 2980 2835 2819 2544 1283 759 237 185 32720 1186 258 21448 231 --
NM_001030019chr7158 ------
NM_001030055chr1454350 3747 1601 1479 1075 14730 ----
NM_001030287chr121100 871 ----1804
NM_001031677chr51397 ------
NM_001031679chr1263359 3157 2724 2495 2269 555 63481 2732 2427 2242 2228 1250 13151 13301
NM_001031690chr783069 2691 2338 2256 2099 1115 426 134 32830 2071 416 12460 --
NM_001031692chr71275 ------
NM_001031694chr13694 615 222 1702 ----
NM_001031694chr13694 615 222 1702 ----
NM_001031695chr22155078 4923 4467 4457 3915 3904 3850 3592 1871 1514 880 827 710 621 596 14004 --15349
NM_001031702chr3188 ------
NM_001031709chr10----1286 --
NM_001031712chr6169 ------
NM_001031732chr453631 3608 2439 1430 1178 1274 ----
NM_001031738chr2--159 ----
NM_001031804chr1684165 3758 3641 3252 1282 877 637 594 ----1294
NM_001031812chr551977 1430 556 129 106 --1943 --
NM_001032221chr991494 1443 1417 1198 593 519 303 161 140 ----11206
NM_001032280chr641546 1179 633 201 --11475 --
NM_001032282chr8--1508 ----
NM_001032283chr121407 ------
NM_001032284chr121407 ------
NM_001032288chr202989 380 11330 11074 --
NM_001032289chrX3686 336 192 1278 ----
NM_001032296chr1372801 2295 2277 964 854 839 663 1915 --11045
NM_001032363chr161876 1788 494 477 329 181 11595 ----
NM_001032363chr161876 1788 494 477 329 181 11595 ----
NM_001032380chr1031227 442 212 ------
NM_001032393chrX3715 168 135 ------
NM_001032394chr632680 620 597 --32442 1049 747 --
NM_001032395chr632547 487 464 --32309 916 614 --
NM_001033025chr161281 1249 1230 1222 529 504 157 11112 --
NM_001033045chr264186 3950 3831 1662 119 100 --33489 2736 700 --
NM_001033049chr2162195 1974 1585 609 559 235 ------
NM_001033057chr342043 1831 1749 334 --1663 --
NM_001033059chr682003 1441 800 655 463 232 222 202 2338 92 ----
NM_001033081chr171803 719 692 453 196 189 65 11587 ----
NM_001033082chr171803 719 692 453 196 189 65 11587 ----
NM_001033087chr2042156 721 674 27 1138 22082 783 --
NM_001033117chr3104788 4304 3547 1615 1569 1482 1456 1268 320 291 1334 24111 3470 --
NM_001033507chr141487 725 710 275 ------
NM_001033518chr722415 2314 1571 22281 783 1340
NM_001033519chr722415 2314 1571 22281 783 1340
NM_001033520chr722415 2314 1571 22281 783 1340
NM_001033561chr172830 799 --1898 --
NM_001033566chr171925 --1354 --
NM_001033568chr171925 --1354 --
NM_001033576chr17142733 2515 2493 2343 1823 1801 1751 1743 923 833 765 441 162 68 --1196 --
NM_001033602chr1342736 2513 1072 271 22403 1031 1595 --
NM_001033659chr1721459 345 --1399 --
NM_001033723chr852568 2477 1993 1741 764 22184 954 --1797
NM_001033756chr651638 1346 1298 1288 539 1633 ----
NM_001033756chr651638 1346 1298 1288 539 1633 ----
NM_001033910chr141758 1507 211 200 ------
NM_001033925chr10----21874 1745 --
NM_001034025chr124879 861 788 62 --1914 --
NM_001034837chr56824 623 149 135 98 27 --1196 --
NM_001034838chr56824 623 149 135 98 27 --1196 --
NM_001034845chr42461 448 ------
NM_001034850chr521374 1304 ------
NM_001034852chr1481916 1844 758 733 633 411 233 144 11385 ----
NM_001035chr14826 71 55 45 ------
NM_001035254chr932393 827 588 1394 2226 77 --
NM_001035260chr1041265 486 457 29 ------
NM_001035267chr121281 ------
NM_001035511chr192140 2126 2032 1445 791 753 719 165 144 31887 346 171 1660 --
NM_001035512chr1102247 2233 2139 1552 898 860 826 272 251 95 31994 453 278 1767 --
NM_001035513chr1102247 2233 2139 1552 898 860 826 272 251 95 31994 453 278 1767 --
NM_001037131chr251166 439 140 106 59 --1371 --
NM_001037132chr752141 2036 1880 616 446 ------
NM_001037133chr752141 2036 1880 616 446 ------
NM_001037164chr741908 1785 787 198 ------
NM_001037165chr7148926 8107 6749 6728 6250 5532 2213 2062 1426 1042 501 273 253 242 21884 151 48365 7086 5779 3477 --
NM_001037172chr331336 1083 1006 --1309 --
NM_001037317chr142773 2683 862 714 ------
NM_001037332chr582250 2082 1976 584 520 481 258 168 2301 196 ----
NM_001037333chr582250 2082 1976 584 520 481 258 168 2301 196 ----
NM_001037334chr1841772 1657 627 479 ------
NM_001037339chr161623 1265 1204 677 664 511 ------
NM_001037340chr161623 1265 1204 677 664 511 ------
NM_001037341chr161623 1265 1204 677 664 511 ------
NM_001037341chr161623 1265 1204 677 664 511 ------
NM_001037535chrX21197 1077 ------
NM_001037536chrX21197 1077 ------
NM_001037540chrX21197 1077 ------
NM_001037553chr21105187 5159 5107 4293 1651 1265 762 628 383 312 33334 735 270 11894 --
NM_001037582chr431256 189 69 --2614 309 --
NM_001037631chr22260 155 ------
NM_001037954chr1162991 2304 1375 857 729 648 1127 13396 --
NM_001038493chr2------173
NM_001038707chr182222 2018 1700 1691 820 572 451 358 1782 1646 --
NM_001038707chr182222 2018 1700 1691 820 572 451 358 1782 1646 --
NM_001039091chrX3895 315 280 1177 ----
NM_001039350chr741225 1100 689 78 1697 ----
NM_001039459chr73882 463 156 1473 ----
NM_001039465chr141478 ------
NM_001039479chr1462077 2043 1655 969 470 36 1229 21835 627 --
NM_001039538chr272717 2639 2599 1331 1032 924 665 33065 2795 749 23409 2912 --
NM_001039547chr3127269 6191 6165 2700 2016 1699 1651 1300 1130 587 293 169 36649 5964 5010 16913 --
NM_001039550chr22749 87 1725 1177 --
NM_001039570chr22144693 4673 3631 1730 1668 1228 485 475 432 259 249 121 103 66 31207 697 576 33420 1100 92 13909
NM_001039571chr22144693 4673 3631 1730 1668 1228 485 475 432 259 249 121 103 66 31207 697 576 33420 1100 92 13909
NM_001039574chr12686 247 ------
NM_001039577chr154039 3521 3140 1768 1339 64490 3527 3387 1759 779 79 13762 --
NM_001039580chr454525 4509 4446 3475 1826 --24419 3845 12036
NM_001039585chr174051 3479 3444 1634 1411 686 47 23823 3179 ----
NM_001039590chrX43206 3140 2878 1090 --23835 1028 --
NM_001039591chrX43206 3140 2878 1090 --23835 1028 --
NM_001039618chr1195851 4851 4835 4592 1107 539 481 305 204 ------
NM_001039690chr1662166 2063 1515 960 333 255 22222 1975 ----
NM_001039693chr253989 3944 3573 518 184 --11591 1534
NM_001039711chr11778 1784 ----
NM_001039712chr11778 1784 ----
NM_001039762chr1011950 1645 ----
NM_001039771chr1471058 1031 953 947 895 59 46 1193 1976 --
NM_001039802chr121310 1219 11191 11233 --
NM_001039840chrX166010 6001 5923 5873 5481 5065 4162 4134 4015 3664 2344 1556 1464 1158 623 203 ------
NM_001039888chr13726 616 165 1796 2559 313 --
NM_001039916chr122136 66 21027 60 1169 --
NM_001039917chr122136 66 21027 60 1169 --
NM_001039918chr122136 66 21027 60 1169 --
NM_001039919chr122136 66 21027 60 1169 --
NM_001039920chr122136 66 21027 60 1169 --
NM_001039937chr1384180 3560 3172 2970 2752 2602 530 272 23056 2863 11495 11143
NM_001040001chr672063 1687 1406 1308 651 482 337 12052 ----
NM_001040002chr1781494 1064 342 229 203 125 116 81 21017 107 ----
NM_001040033chr11112 3665 575 510 --1703
NM_001040057chr731251 990 205 ------
NM_001040110chr721472 178 --1596 11532
NM_001040113chr165972 834 826 273 150 1793 ----
NM_001040114chr164831 693 685 132 1652 ----
NM_001040135chr73722 232 210 ------
NM_001040144chr1662166 2063 1515 960 333 255 22222 1975 ----
NM_001040146chr1662166 2063 1515 960 333 255 22222 1975 ----
NM_001040151chr11103933 3771 3681 3594 3229 3121 1103 598 312 270 63631 2990 2909 1599 1120 559 --1395
NM_001040152chr761867 1853 1793 1766 1272 696 35098 5081 772 --21439 458
NM_001040153chr132200 98 1367 ----
NM_001040157chr452640 2625 879 404 160 1532 1565 12340
NM_001040167chr71381 1735 ----
NM_001040172chr581516 629 558 518 426 247 237 110 21339 97 --11162
NM_001040173chr581516 629 558 518 426 247 237 110 21339 97 --11162
NM_001040181chr32961 731 1737 ----
NM_001040182chr32961 731 1737 ----
NM_001040183chr32961 731 1737 ----
NM_001040199chr32961 731 1737 ----
NM_001040200chr32961 731 1737 ----
NM_001040272chr932339 458 405 ------
NM_001040273chr1021762 1537 22085 362 ----
NM_001040284chr1675275 4735 3733 3710 3693 2189 1313 1749 --25670 5023
NM_001040409chr22990 674 ------
NM_001040429chr1362733 2532 2310 2258 364 42 22297 160 --12384
NM_001040432chr32366 129 ------
NM_001040439chr1651309 1141 1120 222 100 --11426 --
NM_001040441chr193956 2054 1936 1622 1597 1281 625 256 62 1764 11148 13868
NM_001040446chr552418 1853 844 344 151 12177 ----
NM_001040450chr1532497 2071 182 ----12032
NM_001040453chr1532497 2071 182 ----12032
NM_001040619chr131550 1321 112 --11138 11254
NM_001040624chr832345 2339 533 --12079 --
NM_001040625chr832345 2339 533 --12079 --
NM_001040626chr832345 2339 533 --12079 --
NM_001040627chr832345 2339 533 --12079 --
NM_001040628chr832345 2339 533 --12079 --
NM_001040629chr832345 2339 533 --12079 --
NM_001040630chr832345 2339 533 --12079 --
NM_001040653chr33413 276 190 12568 1599 --
NM_001040665chr7114942 4248 4103 3410 3368 1839 1825 1729 1477 1463 1453 14047 ----
NM_001040666chr71644 ------
NM_001040708chr831017 378 113 ------
NM_001040709chr132439 2145 76 42350 2284 2155 45 22101 1785 22194 777
NM_001040712chr953391 3178 3007 2528 60 21039 810 --22289 619
NM_001042353chr205553 472 410 80 67 ----1179
NM_001042355chr16104964 4575 2146 1890 1870 1336 1204 1192 1160 458 1710 --14330
NM_001042388chr185791 603 353 111 25 ------
NM_001042404chr12756 285 --11588 1503
NM_001042406chr631238 828 258 ------
NM_001042412chr16104964 4575 2146 1890 1870 1336 1204 1192 1160 458 1710 --14330
NM_001042413chr983516 2603 2572 1135 1089 501 201 70 21105 570 1266 13191
NM_001042424chr492466 2289 1073 854 717 690 650 417 270 12298 11273 12693
NM_001042425chr641546 1179 633 201 --11475 --
NM_001042437chr22373 152 2840 77 ----
NM_001042453chrX2657 361 --1533 --
NM_001042473chr1031670 1536 571 11410 ----
NM_001042486chr2061370 1220 994 529 414 123 ------
NM_001042492chr1743188 2139 894 79 53292 2393 1133 768 47 1157 --
NM_001042494chr1543806 1073 901 129 --22612 1108 --
NM_001042495chr1543806 1073 901 129 --22612 1108 --
NM_001042496chr1543806 1073 901 129 --22612 1108 --
NM_001042497chr1543806 1073 901 129 --22612 1108 --
NM_001042498chrX3823 329 126 1415 ----
NM_001042506chrX101441 493 479 319 283 207 188 176 156 132 ------
NM_001042510chr811346 12113 139 1358
NM_001042511chr811346 12113 139 1358
NM_001042517chr13----1657 --
NM_001042537chrX3829 488 235 11716 32024 1659 1533 --
NM_001042539chr166985 943 367 356 242 151 ------
NM_001042543chr431541 1320 1115 ------
NM_001042555chr1254167 3516 1844 1465 780 12985 24772 1210 11091
NM_001042599chr2207620 7589 7571 7061 6906 6186 5977 5754 5507 5444 5379 5042 2806 2525 1425 992 583 537 354 62 25162 896 ----
NM_001042601chr353016 2981 2469 2172 36 12177 ----
NM_001042603chr1264768 3280 1787 1602 1544 174 --25324 458 --
NM_001042604chr374327 4315 4255 3756 1719 1328 1072 23835 39 11639 --
NM_001042616chr41169 --1563 --
NM_001042632chr2062315 1922 1901 1662 1652 532 1887 ----
NM_001042633chr2062315 1922 1901 1662 1652 532 1887 ----
NM_001042646chr381709 1670 1378 515 315 261 69 45 ------
NM_001042681chr142249 2041 915 875 22619 924 ----
NM_001042682chr142249 2041 915 875 22619 924 ----
NM_001042682chr142249 2041 915 875 22619 924 ----
NM_001042683chr641566 725 717 47 11438 ----
NM_001042723chr19147 ------
NM_001042749chrX21723 346 ------
NM_001042750chrX21723 346 ------
NM_001042751chrX21723 346 ------
NM_001042762chr71877 1179 --1916
NM_001043318chr1473166 3004 1263 946 885 703 664 --32943 2711 1094 --
NM_001043351chr142012 776 175 120 1422 11500 --
NM_001044722chr551977 1430 556 129 106 --1943 --
NM_001044723chr551977 1430 556 129 106 --1943 --
NM_001046chr522488 429 ------
NM_001049chr1482226 1764 679 630 610 603 536 259 21599 1564 ----
NM_001077628chr11486 165 ----
NM_001078chr11554 --1670 --
NM_001080418chr14546 539 213 147 143 ----
NM_001083620chr432485 1858 957 --12025 --
NM_001083621chr144459 3271 784 656 1733 14604 --
NM_001087chr23322 251 151 1131 --1122
NM_001095chr1271518 1491 1267 1222 259 163 118 11711 1550 --
NM_001096chr172840 46 ------
NM_001100108chr1178237 7891 7764 7469 6817 6003 5853 5338 2211 2199 1795 1612 1536 1191 1096 706 336 11157 11151 --
NM_001106chr368211 8000 6611 3643 2201 497 37173 1766 1197 37475 7225 2959 --
NM_001113490chrX43205 2233 1174 773 ----12448
NM_001116chr1652317 2128 2044 1960 1243 2482 78 1614 --
NM_001117chr1861841 815 759 740 683 546 1676 2703 651 --
NM_001119chr441303 445 336 238 11499 11358 --
NM_001121chr1021612 158 1299 --11629
NM_001122631chr112573 554 ----1439
NM_001122679chr52855 64 ------
NM_001126chr13934 234 53 ------
NM_001128chr1693714 2980 2835 2819 2544 1283 759 237 185 32720 1186 258 21448 231 --
NM_001135chr153758 666 84 1283 ----
NM_001140chr174231 214 198 97 ------
NM_001144chr1651161 545 241 197 179 11042 ----
NM_001147chr8193 ------
NM_001148chr421500 1423 1504 ----
NM_001149chr101221 ----11441
NM_001156chr10------1508
NM_001160chr1242759 1095 471 439 --1679 --
NM_001163chr93953 878 761 --3156 90 38 --
NM_001167chrX106407 4908 1957 1787 1759 1665 1438 1352 832 772 34892 2540 1339 ----
NM_001173chr1454350 3747 1601 1479 1075 14730 ----
NM_001177chr1231511 847 46 1407 --11532
NM_001179chr41202 ------
NM_001186chr2173295 3217 2917 1135 643 156 38 42759 2163 1142 649 2701 279 --
NM_001190chr191276 ------
NM_001191chr2041179 1121 477 378 11108 1452 --
NM_001192chr161210 ------
NM_001200chr201800 21114 1086 --1980
NM_001204chr2137240 5857 5754 5596 5367 2874 2089 1530 1301 1185 1043 679 552 26933 2206 14800 --
NM_001206chr972785 2404 2198 1969 1217 306 151 --2541 230 --
NM_001218chr15122574 2557 2398 2055 1715 1097 1016 609 452 331 209 66 22563 389 1417 --
NM_001219chr782203 1843 1401 1395 900 378 346 156 ------
NM_001221chr41104 1113 ----
NM_001222chr1041807 1657 1319 392 ------
NM_001232chr11109 ----1935
NM_001241chr22919 879 ------
NM_001241chr22919 879 ------
NM_001253chr61305 ------
NM_001256chr1782171 2122 1173 744 618 249 135 85 11035 11051 --
NM_001259chr7106358 5464 5137 3880 2203 2083 1937 1080 995 366 54627 1559 1508 1027 145 15986 --
NM_001262chr14355 250 229 57 ------
NM_001263chr43465 431 129 ------
NM_001268chr131844 133 ----
NM_001270chr5--1132 ----
NM_001271chr1542519 2315 2226 1067 --12778 --
NM_001273chr123382 70 52 ------
NM_001277chr1131053 908 809 1878 ----
NM_001280chr191110 ------
NM_001282chr1772487 2309 2195 1809 868 774 57 2648 263 --12230
NM_001288chr6--140 ----
NM_001293chr11162 ------
NM_001294chr19188 ------
NM_001299chr192482 87 ------
NM_001300chr101129 ------
NM_001304chr1763301 3200 2955 2350 643 139 13595 190 12363
NM_001310chr1263027 2441 2099 535 514 181 52672 2345 2021 1233 350 ----
NM_001313chr43995 324 134 ------
NM_001315chr662141 906 785 779 386 265 --11891 168
NM_001328chr4----1240 --
NM_001331chr11152506 2287 1962 1871 1861 1852 1791 1754 1069 940 742 670 621 499 227 22232 152 ----
NM_001332chr5181 11251 1407 --
NM_001343chr581210 693 643 618 597 540 174 149 ----1236
NM_001346chr362400 1960 1914 670 568 495 --1117 --
NM_001351chr3--2441 380 --1138
NM_001356chrX32146 2027 1980 ----1121
NM_001358chr4--180 ----
NM_001364chr11134470 4373 3867 3705 3340 3312 3300 3263 3217 3173 1087 955 337 24487 1827 23121 854 13071
NM_001380chr103992 383 57 --11033 --
NM_001381chr21412 ------
NM_001386chr862299 1601 1584 823 765 735 21787 785 1772 --
NM_001387chr592924 2624 2443 2270 2100 1035 1010 790 743 32872 1215 142 22048 923 12298
NM_001389chr213574 543 445 --1165 --
NM_001394chr82569 126 ------
NM_001395chrX1194 1244 ----
NM_001396chr2122654 697 --1643 --
NM_001397chr172258 2019 1968 1037 985 500 160 11846 ----
NM_001399chrX53847 1055 737 601 416 22450 838 33631 3463 3443 32610 278 176
NM_001406chr17111623 1475 1304 1241 665 533 499 413 407 388 277 11247 ----
NM_001407chr351679 1643 1466 1060 375 --11546 --
NM_001408chr181496 1306 1296 1101 1066 599 402 356 --21484 1382 1305
NM_001412chrX73779 3707 3049 2996 2869 2527 1423 --13195 --
NM_001415chrX51600 1350 769 506 141 --2754 394 --
NM_001417chr1251779 1467 463 433 25 41962 1729 1219 38 11741 --
NM_001419chr1974728 4111 3146 1865 1748 1588 834 11091 ----
NM_001420chr1962577 2555 2521 2493 2078 1207 --22146 254 --
NM_001421chrX101683 1669 1634 1627 1443 1395 1373 1336 1267 545 --11677 --
NM_001423chr1251591 1566 1321 755 161 ------
NM_001426chr23589 496 228 ------
NM_001429chr221971 ------
NM_001430chr23556 309 299 1448 159 --
NM_001431chr671253 911 804 471 442 239 164 1884 ----
NM_001438chr192879 481 469 456 441 367 357 249 209 31328 508 196 1307 --
NM_001439chr161281 1249 1230 1222 529 504 157 11112 --
NM_001447chr53378 319 148 11036 ----
NM_001448chrX41649 1544 1497 502 ------
NM_001449chrX4443 132 117 63 --1263 --
NM_001451chr162970 121 ------
NM_001455chr654087 3927 1482 409 88 44845 3150 1461 909 14876 --
NM_001461chr13637 251 79 --3388 213 140 --
NM_001463chr23333 209 170 ------
NM_001478chr126971 958 794 609 256 220 --1129 1287
NM_001482chr152633 377 2726 329 169 1198
NM_001493chrX4687 227 211 47 ------
NM_001497chr932291 2148 2059 1141 --11106
NM_001518chr71357 1808 ----
NM_001530chr141715 ------
NM_001533chr192294 50 ------
NM_001542chr192022 1938 994 531 460 440 348 305 48 ----1814
NM_001546chr661242 1234 1218 478 222 178 1235 --11113
NM_001550chr71183 ------
NM_001555chrX246 27 ------
NM_001560chrX62298 1763 1700 1658 498 209 22129 627 --21906 58
NM_001584chr1141031 1024 873 75 ------
NM_001609chr1074286 4176 3238 3201 2800 1176 371 --13993 --
NM_001614chr171608 ------
NM_001614chr171608 ------
NM_001616chr242963 2621 2531 2377 2985 271 --13130
NM_001617chr281289 1124 1018 890 476 366 57 37 ------
NM_001621chr751868 928 715 523 331 1839 12533 --
NM_001621chr751868 928 715 523 331 1839 12533 --
NM_001634chr682003 1441 800 655 463 232 222 202 2338 92 ----
NM_001635chr73879 425 257 1299 ----
NM_001649chrX52106 1936 1683 637 111 42500 1860 1778 966 1840 --
NM_001650chr1863625 3470 3408 2695 1618 1076 23850 1359 13545 --
NM_001654chrX2418 309 ------
NM_001655chr1141887 1881 1539 130 1272 ----
NM_001656chr51612 ------
NM_001658chr12938 47 ------
NM_001659chr12152538 2504 2229 2206 2091 2077 1018 858 675 447 415 400 361 315 273 31883 749 84 1743 --
NM_001660chr3----1200 --
NM_001662chr73254 154 91 ------
NM_001663chr1431892 1851 92 2898 835 ----
NM_001664chr32986 922 1994 ----
NM_001665chr115546 422 365 221 152 2433 109 ----
NM_001668chr15866 590 257 132 95 21974 166 ----
NM_001670chr22--1633 ----
NM_001674chr121100 871 ----1804
NM_001677chr1----1822 --
NM_001678chr1761776 559 493 204 191 27 31637 1470 568 1304 --
NM_001681chr12--1238 ----
NM_001682chr1222586 2366 ------
NM_001683chr372525 2216 1843 434 345 190 58 11912 21929 1835 --
NM_001686chr12129 ------
NM_001690chr362094 1662 929 592 313 211 --2726 357 --
NM_001695chr853592 3583 665 280 118 13331 1132 --
NM_001699chr1941727 1640 1371 1232 11460 180 --
NM_001701chr911281 31510 558 248 11294 --
NM_001702chr81555 ------
NM_001703chr12100 93 147 ----
NM_001706chr31232 --1934 --
NM_001709chr1122548 858 12707 ----
NM_001711chrX3722 248 168 11078 ----
NM_001720chr141465 874 261 143 1411 ----
NM_001731chr122664 275 1924 1746 --
NM_001742chr711206 ----178
NM_001743chr2189 ------
NM_001746chr552479 1920 1835 913 36 32891 1979 1047 --12181
NM_001753chr741509 462 166 138 --1590 --
NM_001754chr2184251 4173 3992 3841 2981 2851 2825 2795 14088 13062 --
NM_001755chr1632301 1589 685 12106 --1910
NM_001759chr12115046 4928 4848 4632 3420 3371 3324 1262 1042 551 51 44120 4027 3524 1420 24092 1086 13980
NM_001760chr64916 805 338 242 ------
NM_001773chr181387 1181 1099 1080 1060 417 120 84 11429 11166 --
NM_001777chr363729 2921 2706 2653 2527 779 12559 12542 --
NM_001788chr72613 223 --1754 --
NM_001789chr331464 1216 192 ------
NM_001791chr121310 1219 11191 11233 --
NM_001797chr161571 ------
NM_001798chr123732 234 40 ------
NM_001799chr51225 ------
NM_001800chr19287 72 ------
NM_001802chr162745 49 ------
NM_001810chr204771 700 691 220 2607 547 165 --
NM_001822chr22542 135 1548 ----
NM_001825chr5----1132 --
NM_001826chr1------1410
NM_001829chr4165 ------
NM_001833chr9--162 ----
NM_001839chr15784 660 561 267 165 ------
NM_001842chr9--1119 ----
NM_001844chr122155 148 ----160
NM_001854chr12335 245 --1253 --
NM_001859chr923497 3071 23528 271 ----
NM_001862chr2182 ------
NM_001865chr6--148 ----
NM_001873chr41191 --1136 --
NM_001881chr10------1377
NM_001891chr4--1344 ----
NM_001892chr521282 58 ------
NM_001893chr17--1121 ----
NM_001895chr202276 54 1427 11150 --
NM_001896chr16134 ------
NM_001901chr6------1423
NM_001904chr31309 ------
NM_001914chr18124 ------
NM_001920chr121655 ------
NM_001921chr421006 159 2351 301 ----
NM_001923chr112199 102 170 ----
NM_001924chr11449 ------
NM_001931chr1131292 432 392 --126 --
NM_001932chr171652 --1824 1109
NM_001933chr1461410 1012 293 192 185 57 --2540 461 --
NM_001935chr221002 359 ------
NM_001936chr741225 1100 689 78 1697 ----
NM_001937chr141007 705 117 106 --2958 904 11048
NM_001938chr121747 745 ------
NM_001945chr521048 1002 --11099 --
NM_001946chr122998 184 ----11104
NM_001949chr663045 2747 2149 1174 529 428 --122 --
NM_001951chr81139 --1555 --
NM_001954chr62195 176 1271 ----
NM_001964chr52964 444 2923 138 ----
NM_001965chr22472 77 ------
NM_001968chr4123 177 ----
NM_001973chr12271 154 ------
NM_001977chr441276 683 378 46 --21403 614 --
NM_001978chr87866 826 789 276 202 168 110 2995 913 ----
NM_001980chr1241912 1498 710 700 --22224 467 --
NM_001981chr132188 1876 1778 11501 1410 --
NM_001982chr1271284 437 245 206 196 83 70 ----1304
NM_001987chr1284021 3921 3493 3254 1698 1116 613 602 33313 2956 263 23908 1500 1357
NM_001990chr15150 140 132 120 98 ------
NM_001993chr11129 ------
NM_001995chr42991 48 21167 582 --1223
NM_001999chr52116 106 ------
NM_002006chr465739 5436 5322 4691 4098 464 25500 804 1197 --
NM_002009chr1542294 1818 547 84 --12511 --
NM_002010chr133507 496 188 ------
NM_002013chr14----1201 --
NM_002015chr1353060 2499 2401 2351 417 --12189 12837
NM_002019chr131761 1107 ----
NM_002023chr15523 477 393 207 134 11609 1506 --
NM_002024chrX31941 1683 339 1684 ----
NM_002025chrX228784 8437 8349 8042 7557 7535 7519 7441 7048 6972 6944 6172 3404 2363 1704 1155 1126 1101 644 626 591 424 37378 6995 2678 46813 6067 5691 3390 11265
NM_002026chr231033 900 38 3875 158 131 ----
NM_002028chr141133 2291 199 1890 --
NM_002037chr61318 ------
NM_002040chr2183054 3007 2747 2585 2145 1271 400 147 12270 ----
NM_002044chr1541164 494 301 59 2596 158 ----
NM_002045chr35150 126 68 57 42 --1346 --
NM_002048chr921066 198 ------
NM_002061chr141521 391 203 181 ----1529
NM_002062chr661574 1534 1155 424 211 147 --21589 1006 --
NM_002063chrX1981 ----1970
NM_002069chr7--11196 ----
NM_002071chr184681 636 256 228 --1646 --
NM_002072chr94817 785 319 274 1227 ----
NM_002074chr131643 1619 553 21663 1518 ----
NM_002076chr1292705 2533 2181 2121 2010 1315 1096 875 222 22173 1028 --1723
NM_002077chr952061 2006 1915 1635 1509 32151 1795 1533 ----
NM_002086chr1742008 1881 284 248 31837 1794 377 22043 1782 --
NM_002087chr171304 --195 --
NM_002092chr464789 4255 3931 3791 3282 1024 --13753 --
NM_002094chr161102 ------
NM_002103chr193991 931 38 --1751 --
NM_002107chr1258 32 ------
NM_002111chr483511 2785 2567 1133 700 605 543 283 1905 22445 534 --
NM_002114chr6169 ------
NM_002126chr1752661 2578 1249 557 547 23201 2800 2388 377 --
NM_002128chr1311745 12085 ----
NM_002129chr41141 ------
NM_002135chr122396 37 1379 ----
NM_002137chr732021 801 109 ----1771
NM_002139chrX2606 194 ----1258
NM_002141chr7149 ------
NM_002145chr172265 71 ------
NM_002146chr1721450 1378 --1511 --
NM_002147chr174921 800 305 169 --1353 --
NM_002148chr21608 ------
NM_002158chr272965 2872 2411 1359 738 436 27 ------
NM_002166chr21494 ------
NM_002167chr12437 73 ------
NM_002168chr15195 1283 ----
NM_002182chr352584 2174 846 731 339 12687 ----
NM_002187chr52330 216 1959 11309 --
NM_002192chr7----1450 --
NM_002193chr211390 ------
NM_002196chr201869 1407 1178 --
NM_002196chr201869 1407 1178 --
NM_002199chr4179 ------
NM_002202chr5--1820 ----
NM_002203chr541556 1000 853 351 23952 1006 1950 --
NM_002205chr122928 119 1225 ----
NM_002207chr31123 188 ----
NM_002211chr103985 851 217 ------
NM_002214chr7115728 5532 4813 4618 2217 1268 1193 1072 1043 642 518 11847 23559 1468 --
NM_002221chr1102887 2865 2718 2666 2631 2623 2494 2187 1159 42 21096 588 ----
NM_002222chr331341 1168 468 ------
NM_002223chr1263939 3658 3081 3051 1369 1327 --1319 --
NM_002226chr142760 207 1720 ----
NM_002227chr121305 47 ------
NM_002228chr131137 844 489 ------
NM_002229chr191370 ------
NM_002230chr172984 338 2831 51 ----
NM_002232chr161279 381 227 206 197 145 31270 993 950 1139 --
NM_002234chr123703 135 121 1173 ----
NM_002235chr1261599 1467 1435 1201 691 669 --1107 --
NM_002240chr215169 83 64 49 28 ------
NM_002241chr1122606 2267 2138 1209 1112 1021 983 945 936 633 120 45 2404 191 1434 1738
NM_002247chr10--22245 2106 180 --
NM_002249chr12444 415 --159 --
NM_002250chr19----133 --
NM_002252chr2297 36 ------
NM_002253chr421016 206 177 11089 --
NM_002254chr2102119 2054 2046 2038 1726 882 828 441 408 160 ----1534
NM_002264chr384570 4209 3705 3587 1593 567 178 148 --1229 --
NM_002265chr1731052 856 304 ------
NM_002266chr17177 ------
NM_002267chr1321814 25 --32071 742 225 --
NM_002268chr331777 1584 762 1536 ----
NM_002270chr554039 4012 3796 2175 2001 54602 4553 3886 1853 1576 15097 --
NM_002271chr13156 1575 ----
NM_002274chr172272 252 --1225 --
NM_002285chr273594 3192 1220 1078 628 496 355 2954 215 --14011
NM_002293chr1112707 2411 2389 2173 2162 1775 1733 1710 496 393 216 --1247 --
NM_002309chr2293197 2729 2593 2441 2244 2054 1130 846 713 33015 2819 2067 ----
NM_002310chr575882 5419 5218 4143 2256 1884 252 24014 1976 25793 503 --
NM_002313chr10144791 4547 4435 4141 4070 3985 3898 3663 3550 3178 1929 1738 974 728 23596 3422 ----
NM_002317chr51271 ------
NM_002332chr12--1182 ----
NM_002334chr1182040 1961 1720 1605 1511 798 315 39 --11988 --
NM_002336chr1284349 4198 4100 1803 1424 1308 1056 935 1881 12034 14467
NM_002350chr821157 181 1295 --1195
NM_002355chr1241431 569 529 27 2911 121 ----
NM_002356chr652747 2358 345 175 40 ----1864
NM_002359chr17103938 3892 3135 2949 2913 2824 120 103 94 87 --1433 --
NM_002373chr152479 269 1979 ----
NM_002374chr272717 2639 2599 1331 1032 924 665 33065 2795 749 23409 2912 --
NM_002375chr351827 623 539 225 68 12110 ----
NM_002382chr1451063 177 170 117 100 ------
NM_002383chr168808 766 365 348 300 190 179 65 ------
NM_002385chr1821143 336 ------
NM_002387chr5134176 3977 3589 3506 3165 1264 920 751 732 422 415 303 208 14498 1292 15027
NM_002391chr112319 66 ------
NM_002397chr511824 11790 ----
NM_002399chr1521073 379 --1969 --
NM_002401chr1742264 740 645 84 11837 11867 --
NM_002404chr173238 134 27 --1335 --
NM_002408chr143752 585 325 ------
NM_002430chr22132449 2356 2192 2058 1748 1739 1724 993 826 750 724 351 42 --12112 --
NM_002442chr1281723 1572 1324 1293 1111 452 242 210 11729 ----
NM_002448chr44677 647 595 226 --2204 153 --
NM_002451chr963555 3369 2836 1277 363 270 --21198 325 --
NM_002455chr1138 ------
NM_002457chr11--1130 ----
NM_002465chr122233 29 ------
NM_002469chr121412 127 ----
NM_002470chr17189 ------
NM_002474chr164831 693 685 132 1652 ----
NM_002479chr1--1234 ----
NM_002480chr123573 395 388 ----1512
NM_002485chr822122 2053 21879 374 ----
NM_002486chr93597 270 242 22289 504 ----
NM_002487chr151636 ------
NM_002499chr1541827 915 867 689 1457 ----
NM_002500chr22423 213 ------
NM_002501chr19164057 3926 3603 3207 3110 1604 1594 1390 1277 1140 875 868 831 596 549 185 14130 24118 1213 --
NM_002505chr62571 201 11313 169 11029
NM_002506chr1----142 --
NM_002508chr151953 1619 1605 1570 1467 127 11550 --
NM_002514chr831124 805 455 --1236 --
NM_002515chr1431605 1273 1262 2709 608 11638 11669
NM_002516chr19359 52 34 ------
NM_002519chr112973 105 --21301 1231 --
NM_002520chr5----1103 --
NM_002522chr1763060 2884 2759 976 671 76 1588 1225 --
NM_002526chr621465 539 1586 ----
NM_002530chr15144 ------
NM_002537chr151735 ------
NM_002539chr2------1216
NM_002545chr11114920 4145 3911 1606 1395 1256 1141 1014 954 294 281 64576 4091 1757 1724 893 40 ----
NM_002547chrX103560 2967 2960 2881 2778 1643 1132 938 742 130 23084 43 31657 338 139 --
NM_002553chr7--1402 ----
NM_002556chr11101988 1450 1339 1314 866 820 301 294 112 96 1673 2730 81 --
NM_002569chr1521408 1282 21183 437 ----
NM_002575chr181112 ------
NM_002576chr1141122 1048 104 86 ------
NM_002577chr3133713 3119 2591 1540 1529 1514 1493 987 904 411 135 76 26 ------
NM_002578chrX--1330 ----
NM_002581chr955061 4706 1656 1477 433 22271 97 ----
NM_002582chr162627 287 --1859 1709
NM_002585chr13307 139 72 ------
NM_002586chr691571 1448 376 327 319 304 238 214 35 --2394 145 --
NM_002588chr5111717 1684 1667 1395 1299 644 493 483 389 58 38 ------
NM_002594chr2042082 1593 706 308 ------
NM_002595chr1221869 411 1122 ----
NM_002600chr161623 1265 1204 677 664 511 ------
NM_002607chr73889 129 45 ------
NM_002608chr2211579 --11509 --
NM_002613chr16104970 4609 3664 3423 2007 1909 1861 1417 1259 230 24131 972 12103 1463
NM_002616chr174368 115 64 49 ------
NM_002622chr54632 621 83 23 1297 1216 --
NM_002623chr20196 ------
NM_002628chr321142 782 --1439 --
NM_002633chr12471 400 ------
NM_002635chr121127 ----1177
NM_002636chr62387 67 ------
NM_002645chr11------1985
NM_002646chr11182 21362 598 31497 855 63 --
NM_002648chr661209 980 972 435 427 29 1513 1234 1196
NM_002649chr721539 255 --1142 --
NM_002651chr13865 673 320 1349 ----
NM_002655chr893665 3634 3236 1961 1734 1619 1343 1233 1152 ----14470
NM_002657chr20103691 3655 3417 3232 2864 2509 2465 2371 1299 286 63610 3244 1347 951 781 293 43183 3164 1544 1367 --
NM_002661chr161197 ------
NM_002669chr4123 ------
NM_002670chr311460 11244 1579 --
NM_002687chr1421112 71 ----1285
NM_002697chr11265 ------
NM_002698chr19132605 2531 2378 2339 2325 2299 2280 2261 1184 1031 1014 187 76 21969 202 --11868
NM_002699chr1101460 1373 537 528 495 427 270 158 126 73 21093 417 ----
NM_002705chr163186 81 46 --121 --
NM_002710chr121217 ----1182
NM_002713chr14884 289 282 252 ----189
NM_002714chr62983 972 2299 58 ----
NM_002715chr521123 815 ------
NM_002716chr1193501 3399 3321 2836 2778 2279 2235 724 375 23347 407 33494 2494 460 13461
NM_002717chr81470 2189 105 ----
NM_002718chr352383 2198 1864 260 214 1105 ----
NM_002719chr1431857 1759 316 32280 1707 581 11918 --
NM_002721chr9141 ------
NM_002726chr62170 51 ------
NM_002729chr101110 ------
NM_002731chr1102960 2629 772 681 659 557 493 441 255 228 ----12239
NM_002734chr1741938 1536 1526 29 1657 ----
NM_002736chr73883 751 182 11632 ----
NM_002739chr194709 696 594 534 --4680 670 651 233 --
NM_002745chr2231691 1332 326 14110 ----
NM_002746chr163189 145 58 ------
NM_002747chr1831507 646 92 --2667 232 --
NM_002748chr152273 149 ------
NM_002752chr5142 ------
NM_002755chr152776 149 ------
NM_002765chrX3895 315 280 1177 ----
NM_002776chr1941646 360 193 82 --1105 --
NM_002791chr141103 ------
NM_002794chr1184 ------
NM_002796chr1----177 --
NM_002806chr141373 ------
NM_002809chr17147 1373 ----
NM_002821chr66812 560 308 248 162 154 ------
NM_002824chr125396 311 135 128 36 1161 --182
NM_002827chr20--11717 41453 1370 1192 728 1389
NM_002828chr181168 --1780 --
NM_002829chr9270 31 ------
NM_002830chr22327 43 ------
NM_002833chr1551201 413 371 324 152 1630 ----
NM_002834chr1283325 3056 2992 1625 999 975 53 44 ------
NM_002835chr72671 300 ------
NM_002837chr1294514 4169 3627 3539 2869 2832 1848 615 601 ------
NM_002839chr953391 3178 3007 2528 60 21039 810 --22289 619
NM_002840chr131376 369 263 ------
NM_002843chr1173268 2485 2421 2216 1232 1142 492 1760 1770 --
NM_002844chr62367 349 ------
NM_002845chr18--1472 ----
NM_002847chr731090 366 119 11508 --11371
NM_002849chr1231096 872 824 ----1687
NM_002850chr1941174 1056 455 242 ------
NM_002854chr22134 ------
NM_002855chr11113599 3455 3280 3200 2559 1033 827 816 764 571 197 ------
NM_002858chr111214 ------
NM_002859chr1251746 1663 1240 332 217 1639 --1237
NM_002865chr8162 ------
NM_002866chr194498 230 28 21 ------
NM_002868chr1282412 2255 2171 2104 1992 413 311 262 22063 1681 --1729
NM_002869chr1161953 1758 1425 857 381 58 ------
NM_002874chr942055 2001 1981 298 --1873 --
NM_002880chr3--178 ----
NM_002886chr324600 243 24672 1439 --21576 60
NM_002890chr51309 ------
NM_002892chr1431638 395 152 ------
NM_002893chrX1140 ------
NM_002895chr204963 852 615 33 1912 ----
NM_002897chr21618 ------
NM_002902chr152241 96 ------
NM_002906chr1122021 409 31520 385 155 --11632
NM_002911chr1931417 506 321 11595 1599 --
NM_002912chr62792 82 ------
NM_002918chr1931060 781 304 ------
NM_002924chr12233 205 --2504 160 --
NM_002928chr161309 1059 621 305 264 174 ------
NM_002930chr182100 30 189 ----
NM_002938chr461941 1913 1659 1601 1288 345 156 ----
NM_002942chr331324 316 205 1943 1271 --
NM_002945chr171646 ------
NM_002953chr11167 --1187 --
NM_002955chr611746 1330 ----
NM_002958chr3----1790 --
NM_002959chr1134116 3603 3348 3332 3072 2914 1586 1433 1110 893 785 568 399 33104 1267 503 24058 2850 --
NM_002965chr11179 ------
NM_002968chr1621007 883 ------
NM_002970chrX2346 268 ------
NM_002971chr32901 368 ------
NM_002977chr262684 1271 1183 909 108 65 12452 11203 --
NM_002994chr41525 ------
NM_002997chr241821 1391 298 58 2280 234 11459 --
NM_003001chr1102247 2233 2139 1552 898 860 826 272 251 95 31994 453 278 1767 --
NM_003010chr1741818 788 703 499 ------
NM_003011chr951382 1326 658 586 470 147 11135 --
NM_003014chr711183 1122 --21294 1248
NM_003016chr1761854 1687 1575 712 655 586 ------
NM_003017chr62508 170 ----11235
NM_003026chr941334 1240 1076 952 3958 916 384 ----
NM_003027chr154128 94 63 30 ------
NM_003028chr983127 2631 2625 1541 1469 1062 986 234 33769 3589 365 ----
NM_003029chr14558 253 195 64 146 11019 11484
NM_003030chr361773 1530 559 351 112 76 21821 1414 ----
NM_003031chr1631019 756 89 ------
NM_003034chr1287922 6461 6277 5611 3249 2606 2577 153 37984 7278 6551 1720 --
NM_003037chr12499 26 ------
NM_003042chr362030 1389 619 536 414 31 11804 ----
NM_003043chr3123850 3758 3750 3445 3379 3241 2802 1202 1179 944 58 33 11377 ----
NM_003045chr13105012 4866 4245 3659 3177 1045 555 409 339 183 44671 3283 3157 1533 ----
NM_003047chr131092 904 274 21349 981 143 --
NM_003051chr131952 1698 1547 ------
NM_003060chr52876 399 ------
NM_003063chr11--1175 --1102
NM_003068chr8185 2280 206 ----
NM_003069chrX1761 ------
NM_003070chr92857 745 ------
NM_003071chr321691 1381 11625 ----
NM_003074chr382281 1998 1883 1760 1477 339 160 79 ------
NM_003075chr12122 ------
NM_003076chr1271690 1678 1405 1042 448 186 169 21160 401 21035 504 --
NM_003077chr171585 1648 --1122
NM_003081chr204960 269 179 21 1196 ----
NM_003085chr5190 ------
NM_003091chr201275 ------
NM_003093chr61214 ------
NM_003098chr202505 492 1480 ----
NM_003106chr3------1836
NM_003107chr6--11863 ----
NM_003108chr2196808 6573 6541 6348 5640 5413 5212 5085 4968 4786 4650 4437 2858 2581 1873 1807 1766 1368 1024 24410 1821 15061 --
NM_003112chr752936 2867 2338 2155 1014 1651 ----
NM_003128chr272221 2076 2004 1938 440 433 399 1405 21902 84 --
NM_003131chr662287 1964 1767 674 653 524 ------
NM_003137chr65905 735 274 94 72 12002 ----
NM_003139chr112219 35 --1676 --
NM_003144chr641967 843 618 324 11398 ----
NM_003145chr17414 307 148 126 103 48 26 170 ----
NM_003146chr113364 124 78 --1261 --
NM_003150chr1711679 11925 --11938
NM_003153chr124834 383 314 37 --11073 --
NM_003155chr872423 2326 2230 1729 1065 556 225 12301 12074 1324
NM_003156chr11158 1248 21176 1145 --
NM_003161chr1733462 1199 212 --11068 --
NM_003173chrX21377 187 --1267 --
NM_003174chr101781 1204 ----
NM_003178chr362248 2236 2156 1592 407 271 1598 1447 --
NM_003179chrX61383 1361 1198 268 246 230 --21444 371 --
NM_003183chr21170 2621 597 ----
NM_003184chr83915 109 23 ------
NM_003185chr2051288 1119 1107 489 197 21233 139 ----
NM_003189chr163342 2838 674 358 334 254 12297 43215 2568 924 121 --
NM_003194chr6--1489 ----
NM_003199chr18105095 4992 4639 3658 1965 1848 808 715 228 89 2924 307 ----
NM_003200chr1942077 2017 1608 932 11564 ----
NM_003203chr222183 80 --11912 --
NM_003204chr1741437 1333 596 243 11457 ----
NM_003205chr1551966 1861 644 569 52 22192 303 --11688
NM_003214chr6--149 ----
NM_003216chr22103168 3046 2687 2261 2152 2112 2084 1191 1116 310 3851 780 769 31071 468 339 --
NM_003217chr1291903 1698 1581 1440 620 527 324 248 38 ----11681
NM_003220chr641546 1179 633 201 --11475 --
NM_003221chr6143890 3637 3537 3459 3428 3369 3346 3242 3074 2894 2862 2847 984 456 ----33941 3196 3096
NM_003223chr163645 285 23 --1581 --
NM_003234chr33508 326 276 52308 2051 1687 459 438 ----
NM_003242chr382404 2173 1625 973 931 908 689 614 11646 1747 --
NM_003247chr6--191 1636 --
NM_003253chr2151342 1242 646 473 253 ------
NM_003255chr1732363 2053 149 22318 2106 ----
NM_003257chr1521213 1059 1351 ----
NM_003262chr374260 3656 3611 3603 3389 1205 684 13678 13701 1275
NM_003269chr621008 356 ----1998
NM_003270chrX2993 972 131 1791 --
NM_003274chr2142702 2513 1838 336 11200 22406 70 --
NM_003275chr911483 --1377 --
NM_003286chr2031107 442 332 ------
NM_003289chr9131 259 50 ----
NM_003290chr1941170 289 223 59 ------
NM_003292chr11527 11711 ----
NM_003298chr3126014 5711 5261 4359 3833 1631 1406 796 422 264 179 127 24071 1057 14146 --
NM_003304chr321245 1204 ----11027
NM_003319chr21747 ------
NM_003320chr11114156 4131 4088 3255 2972 2769 1599 1015 983 840 723 63978 3648 3331 682 316 235 12752 --
NM_003322chr62341 153 ------
NM_003336chrX1161 ------
NM_003337chr5--21196 487 ----
NM_003338chr1021918 613 ------
NM_003339chr521589 615 ------
NM_003340chr4--11195 ----
NM_003342chr1772694 2256 2022 965 953 513 395 1858 --12314
NM_003345chr161195 1419 ----
NM_003347chr2292357 2067 1994 1520 837 601 382 215 135 --1529 --
NM_003348chr1261578 1572 1417 1064 405 34 11429 ----
NM_003349chr202989 380 11330 11074 --
NM_003352chr22381 217 ----1328
NM_003359chr41916 --1206 11378
NM_003363chr33554 522 457 ------
NM_003368chr1--1120 ----
NM_003369chr113664 583 528 12575 ----
NM_003370chr194738 216 62 29 ------
NM_003372chrX2350 250 1712 ----
NM_003373chr1061949 1749 1282 368 214 166 31810 472 143 1388 --
NM_003374chr51724 ------
NM_003376chr651704 1412 1364 1354 605 1699 ----
NM_003376chr651704 1412 1364 1354 605 1699 ----
NM_003379chr641096 1008 226 214 ------
NM_003385chr22863 271 ----1925
NM_003387chr251877 1857 946 404 372 1297 --1198
NM_003390chr114811 730 310 88 2891 243 ----
NM_003392chr393937 3277 3156 2689 1311 1040 727 592 458 22935 1025 1626 --
NM_003394chr124648 221 178 92 --1542 --
NM_003403chr14175 ------
NM_003404chr2051443 766 702 311 110 11390 ----
NM_003405chr221671 ------
NM_003406chr831756 1650 1418 ------
NM_003409chr181246 ------
NM_003410chrX--11029 1328 --
NM_003411chrY1591 --1313 11350
NM_003412chr352718 2673 1172 1063 324 32679 1098 920 ----
NM_003418chr32241 161 167 ----
NM_003420chr31260 1733 ----
NM_003427chr6160 1581 1283 --
NM_003439chr763441 1136 722 596 320 312 1771 ----
NM_003442chr112254 187 1575 ----
NM_003458chr3153849 3841 3829 3811 3448 3243 3209 1526 1301 1018 975 948 934 722 279 53738 3198 2804 333 265 ----
NM_003463chr632667 994 258 13232 ----
NM_003466chr242257 1558 960 474 32490 2014 553 ----
NM_003468chr273645 1567 1400 1303 1132 699 497 1175 --13260
NM_003469chr2127 166 ----
NM_003470chr1651893 1418 540 500 434 --31871 1268 1162 --
NM_003471chr342344 2325 1474 912 ------
NM_003473chr10--1110 1149 --
NM_003478chr1173121 2371 1106 624 458 351 200 12377 ----
NM_003482chr1292645 2489 1779 1731 774 754 391 198 50 3927 728 557 11117 --
NM_003483chr1292773 2236 2191 2068 1062 1056 1042 1026 537 1100 1700 --
NM_003487chr173200 87 74 ------
NM_003489chr2163192 2629 1294 885 562 420 11075 22191 1115 --
NM_003525chr6143 ------
NM_003532chr6138 ------
NM_003543chr6122 ------
NM_003549chr33387 77 27 ------
NM_003557chr171235 1188 443 387 358 182 173 ------
NM_003558chr9167 ------
NM_003559chr17173538 3434 3192 3111 3098 2985 2903 2752 2735 2498 2413 1037 1019 843 607 434 246 13835 ----
NM_003564chr15428 238 232 170 98 ------
NM_003566chr1252699 1121 857 453 361 1923 32230 488 165 --
NM_003569chr61590 ------
NM_003574chr1845654 5132 4062 1694 --31977 1213 959 --
NM_003575chr751462 1081 1033 974 622 11557 11339 --
NM_003576chr1372801 2295 2277 964 854 839 663 1915 --11045
NM_003580chr84465 374 181 138 ------
NM_003581chr22714 116 ------
NM_003583chr1253573 1254 1067 794 205 --12873 --
NM_003589chr1321285 546 ------
NM_003590chr264085 3796 3702 2971 633 96 --142 --
NM_003591chr101279 ------
NM_003603chr441901 1626 1609 388 --11978 --
NM_003607chr1133850 3791 3459 3450 2652 1609 1563 1377 395 158 69 61 30 --1204 --
NM_003613chr15124 ------
NM_003615chr362486 1141 925 884 830 180 12570 ----
NM_003617chr1104555 4389 4244 4079 3618 3270 1511 1493 196 145 24454 4096 24287 1958 13248
NM_003624chr1931214 560 364 ------
NM_003628chr22185 28 ------
NM_003629chr132857 434 375 12869 ----
NM_003631chr101139 ------
NM_003632chr172758 59 1836 ----
NM_003633chr572615 2441 2213 2171 2156 1024 408 11759 2635 525 11869
NM_003637chr121265 490 --1417 --
NM_003644chr17196052 5858 5672 5594 5558 5084 4955 4815 4348 4291 4188 4176 2466 2118 1483 1346 1255 352 93 45421 2521 1264 811 21137 956 22478 1379
NM_003654chr11194 ------
NM_003657chr203333 52 31 ------
NM_003660chr195742 638 537 257 65 1676 ----
NM_003663chr343056 2126 905 273 1449 ----
NM_003670chr32423 32 1439 --1381
NM_003671chr973130 3092 2910 2797 1071 458 211 12766 12296 13157
NM_003677chr122745 418 --1539 11741
NM_003680chr11120 2680 55 1501 --
NM_003684chr14785 413 406 318 1267 ----
NM_003685chr193949 800 394 --1177 --
NM_003688chrX1214 ------
NM_003704chr4--1448 ----
NM_003705chr22845 793 --1118 --
NM_003713chr11631 166 ----
NM_003714chr532767 2457 29 21098 270 12195 --
NM_003716chr31717 1953 ----
NM_003726chr172109 28 ------
NM_003735chr5111717 1684 1667 1395 1299 644 493 483 389 58 38 ------
NM_003736chr5111717 1684 1667 1395 1299 644 493 483 389 58 38 ------
NM_003740chr6140 21271 191 21630 1222 --
NM_003743chr21580 12215 ----
NM_003744chr1431175 253 98 ------
NM_003749chr133912 275 188 ------
NM_003750chr101811 ------
NM_003756chr8263 40 ------
NM_003758chr1521277 72 1606 ----
NM_003758chr1521277 72 1606 ----
NM_003759chr4104047 4025 3219 3143 2842 2657 1621 363 282 269 33597 2850 599 ----
NM_003760chr13700 691 98 ------
NM_003766chr171243 ----1172
NM_003768chr181826 1574 1559 1436 732 593 314 198 ------
NM_003774chr1253291 2831 2724 881 250 --22339 960 --
NM_003778chr31676 ------
NM_003779chr14445 338 309 137 1191 156 --
NM_003783chr11806 ------
NM_003787chr1821084 619 1627 ----
NM_003794chr3--2772 24 ----
NM_003796chr192227 207 ------
NM_003800chr662364 2052 1844 1728 1532 778 --11826 --
NM_003816chr821301 307 ------
NM_003822chr142604 784 493 452 12026 ----
NM_003825chr1521389 98 11145 ----
NM_003829chr92455 161 ------
NM_003831chr1841459 1303 693 417 ------
NM_003850chr131244 ------
NM_003861chr1442741 2520 2106 2028 32712 912 379 12898 --
NM_003862chr5--1255 ----
NM_003864chr41167 ------
NM_003870chr1552007 1987 1975 1503 74 ------
NM_003872chr231194 1023 973 32367 2227 479 22750 425 --
NM_003873chr1042470 2293 1000 298 ------
NM_003884chr311688 ------
NM_003885chr1762018 1912 1696 766 126 114 12346 1422 11984
NM_003887chr241882 548 444 63 --12302 12059
NM_003888chr1571496 1307 1255 419 365 74 49 21335 1264 1340 --
NM_003899chr1382331 2273 2148 1885 1872 1744 751 121 1416 ----
NM_003902chr12847 312 ------
NM_003906chr21131 ------
NM_003913chr654172 3338 2691 2674 1057 34214 1639 97 14031 --
NM_003916chrX1361 21283 957 ----
NM_003919chr7174 ------
NM_003922chr15132 ------
NM_003924chr441406 661 649 325 ------
NM_003927chr1831050 911 21 --133 1867
NM_003930chr732221 1023 93 ----12318
NM_003931chr61472 ------
NM_003932chr2241937 1800 1365 143 ------
NM_003934chr911166 --126 --
NM_003936chr25773 426 410 395 379 2437 271 1244 --
NM_003938chr193987 207 76 --1199 --
NM_003939chr10104033 3279 2970 2676 1393 868 853 653 371 283 23715 1522 33143 1528 887 12696
NM_003941chr732442 1937 56 ----12316
NM_003947chr341355 1231 1212 90 2417 243 ----
NM_003948chr412410 --1842 --
NM_003951chrX--1286 ----
NM_003953chr162634 2564 1018 874 263 52 32686 939 917 11036 --
NM_003955chr1761484 604 538 226 152 54 --1277 1370
NM_003966chr5207579 7267 7171 6576 6023 5752 5712 5324 5309 2715 2642 2563 2512 2344 2332 1733 1260 1039 892 387 36423 1937 1349 27690 6162 1498
NM_003968chr31129 ------
NM_003971chr173528 522 40 ------
NM_003972chr101166 ------
NM_003980chr621102 67 ------
NM_003987chr10122234 2003 1711 1700 1660 1640 1623 1607 838 805 732 512 2741 674 ----
NM_003988chr10122311 2080 1788 1777 1737 1717 1700 1684 915 882 809 589 2818 751 ----
NM_003989chr10132170 1939 1647 1636 1596 1576 1559 1543 873 774 741 668 448 2677 610 ----
NM_003990chr10132170 1939 1647 1636 1596 1576 1559 1543 873 774 741 668 448 2677 610 ----
NM_003994chr1274425 3825 3091 2718 1543 607 29 23773 1434 ----
NM_003995chr92214 187 ------
NM_004016chrX11632 ----1845
NM_004018chrX11632 ----1845
NM_004019chrX4456 334 96 27 --1164 --
NM_004021chrX11632 ----1845
NM_004022chrX11632 ----1845
NM_004023chrX11632 ----1845
NM_004028chr1863625 3470 3408 2695 1618 1076 23850 1359 13545 --
NM_004034chr10------1508
NM_004035chr1765185 4410 3936 3231 552 413 --13615 13864
NM_004037chr13867 615 344 1291 ----
NM_004050chr142872 611 22470 687 22311 2286 12026
NM_004061chr52558 84 --1524 --
NM_004075chr121434 ------
NM_004077chr1231232 1107 474 ------
NM_004081chrY2407 198 1479 --1226
NM_004082chr21110 ------
NM_004083chr122211 49 ------
NM_004085chrX2515 112 ------
NM_004086chr142640 63 ------
NM_004087chr351347 1335 551 450 66 ------
NM_004089chrX31062 901 450 158 --11193
NM_004093chr1322376 29 22360 952 ----
NM_004097chr22266 207 1746 ----
NM_004098chr102975 936 ------
NM_004100chr642570 784 535 302 --12538 --
NM_004102chr11583 1590 ----
NM_004109chr1142209 1554 873 735 --12260 --
NM_004113chr342027 1965 1589 28 ------
NM_004114chrX31260 498 332 ------
NM_004116chr22407 137 ------
NM_004117chr64822 410 362 58 11400 ----
NM_004124chr1453043 2645 1181 630 252 1234 ----
NM_004126chr71112 ------
NM_004128chr131413 ------
NM_004130chr31239 --1457 --
NM_004133chr892713 2177 2146 1826 748 628 537 184 88 ------
NM_004161chr22990 260 ----1406
NM_004162chr321004 467 21130 327 ----
NM_004171chr11179280 9092 9032 8594 8241 7831 7380 6585 6425 3862 3523 2805 2491 2463 1707 1644 299 37924 2031 419 12047 16027
NM_004187chrX3457 451 364 11341 31006 417 352 --
NM_004200chr1152291 2076 1093 1063 790 52800 2067 1185 1037 389 --11028
NM_004202chrY1174 ------
NM_004203chr16149 ------
NM_004205chr112182 24 1479 ----
NM_004206chr3----142 --
NM_004215chr81165 --1146 --
NM_004229chrX21901 847 ----11488
NM_004230chr1922088 451 --21944 1682 1771
NM_004231chr72206 47 1269 ----
NM_004232chr1842920 2898 979 71 --1276 --
NM_004236chr152477 373 ------
NM_004241chr101116 ------
NM_004254chr112280 21 ------
NM_004263chr251519 1483 1242 724 150 11413 11635 --
NM_004264chr121160 ------
NM_004272chr5--152 ----
NM_004274chr1462702 1026 346 299 259 143 2304 178 1389 --
NM_004283chr193372 314 33 1273 ----
NM_004293chr9123753 3460 3134 3000 2806 2687 2401 2333 1436 1391 177 27 13018 12863 --
NM_004296chr1473814 3425 3030 2886 1449 1086 236 32767 1605 626 22974 896 --
NM_004301chr3--1268 ----
NM_004302chr1272790 2632 2460 2284 857 776 475 22864 1789 12571 --
NM_004308chr1191733 1631 1463 635 611 298 261 214 122 2742 242 21180 54 --
NM_004311chr10102944 2758 2550 2254 2086 2028 1257 1199 811 610 32911 899 850 12562 --
NM_004313chr173332 181 97 --2366 145 --
NM_004316chr12----1899 --
NM_004319chr182561 2534 2523 2437 2426 2390 2070 978 32009 865 179 22892 1993 12039
NM_004323chr992471 2285 2201 2166 2069 2047 2016 195 130 --12253 --
NM_004326chr171148 1035 996 963 839 762 356 ------
NM_004327chr2292493 2292 2154 1851 1676 963 773 474 365 32273 721 580 ----
NM_004329chr1051256 960 417 157 107 ------
NM_004330chr151957 ------
NM_004331chr852706 1762 391 369 138 12029 ----
NM_004338chr18125910 5620 4472 2488 2308 2220 2061 1628 1146 1138 902 448 22295 1756 ----
NM_004342chr712131 ------
NM_004343chr194464 441 362 94 --2221 158 --
NM_004346chr421150 95 11023 ----
NM_004349chr811302 11024 ----
NM_004370chr641832 1660 1409 165 1822 ----
NM_004371chr13622 144 112 1232 --1100
NM_004379chr241428 653 483 198 11282 ----
NM_004380chr162689 196 12212 ----
NM_004383chr151160 1449 ----
NM_004384chr551977 1430 556 129 106 --1943 --
NM_004385chr5165 --1663 --
NM_004389chr22591 241 ------
NM_004391chr371685 1633 1593 1453 1418 185 150 11826 41694 1500 602 375 --
NM_004392chr1342190 556 386 350 1171 --2584 540
NM_004393chr361850 1829 736 471 363 157 11802 11542 --
NM_004395chr51227 ------
NM_004397chr11143751 3223 3038 2998 2669 1669 1641 938 598 535 528 400 382 75 12811 --23900 369
NM_004399chr122810 704 1267 ----
NM_004403chr71170 ------
NM_004405chr23404 179 107 ------
NM_004408chr9--136 ----
NM_004411chr71580 1175 ----
NM_004414chr2131176 632 623 ----1393
NM_004416chr1241084 739 689 669 2764 662 ----
NM_004417chr5--126 ----
NM_004419chr101697 1996 1712 --
NM_004420chr1172210 2100 1951 1874 1529 840 425 22201 2091 ----
NM_004423chr392701 2593 2456 2246 2143 1097 1082 838 369 32601 1017 61 22168 1008 --
NM_004427chr15495 459 284 162 112 2783 426 1443 --
NM_004429chrX2942 56 ------
NM_004430chr861756 1696 1066 977 961 585 1112 1620 --
NM_004431chr14532 333 202 112 ------
NM_004432chr922196 2049 1744 ----
NM_004434chr1431891 1525 1287 1698 1550 1308
NM_004436chr11145 ------
NM_004437chr1123269 2965 2623 2416 2408 1112 639 435 383 309 101 37 1743 13235 --
NM_004438chr252015 1127 1005 351 28 31064 545 357 12529 12959
NM_004440chr611225 1273 ----
NM_004441chr341273 451 415 306 ------
NM_004442chr161590 1556 635 405 265 27 1360 21362 1150 --
NM_004443chr33608 70 62 3265 190 147 ----
NM_004446chr1--125 ----
NM_004449chr211153 11024 ----
NM_004454chr351810 663 611 508 229 --22238 1725 --
NM_004457chr241401 1143 1083 187 11268 ----
NM_004458chrX32571 1681 466 12083 ----
NM_004459chr1721545 1512 1345 11969 --
NM_004463chrX3473 464 120 ------
NM_004464chr463326 2732 1355 1139 656 35 24020 3033 11004 --
NM_004468chr12250 27 ------
NM_004472chr51140 ------
NM_004474chr14914 688 390 47 1958 ----
NM_004475chr1791214 1127 462 276 218 206 192 186 163 --2328 22 --
NM_004480chr142700 126 ----1634
NM_004481chr162660 2411 1820 501 408 255 --189 --
NM_004484chrX3335 307 71 --1265 --
NM_004487chr351149 857 427 400 48 1113 --1121
NM_004494chr191239 1182 1172 1037 343 241 190 115 98 41207 1197 957 818 1351 --
NM_004496chr144457 317 302 151 --1281 11102
NM_004497chr193683 607 538 ------
NM_004498chr151348 ------
NM_004499chr5194 --1150 --
NM_004500chr1431924 119 86 --12028 --
NM_004501chr1103894 3298 2953 2893 2796 2774 1081 1067 847 490 136 ----
NM_004504chr242822 1922 943 514 22137 57 ----
NM_004505chr1731358 649 205 ------
NM_004506chr61161 1259 ----
NM_004513chr1563678 3567 3376 1424 571 68 11472 13558 --
NM_004514chr173994 516 495 12615 12085 --
NM_004516chr192958 142 1848 ----
NM_004519chr83246 160 63 ------
NM_004520chr51156 ------
NM_004525chr211256 --21342 1315 --
NM_004527chr1781494 1064 342 229 203 125 116 81 21017 107 ----
NM_004529chr921109 341 21416 238 1232 1552
NM_004543chr21146 ----172
NM_004556chr62275 95 31049 207 41 1353 --
NM_004569chr143736 285 49 ------
NM_004574chr17139 ------
NM_004575chr431038 54 34 11474 ----
NM_004576chr51436 ------
NM_004583chr174504 489 276 249 1134 ----
NM_004586chrX84951 4799 4515 3654 1948 1105 670 151 45374 5156 4686 2145 14452 --
NM_004588chr11143903 3711 3454 3243 3203 3196 3176 3098 2733 2646 1629 1086 404 48 33716 2842 837 2941 179 23400 2763
NM_004593chr31765 ------
NM_004598chr533277 2921 867 2114 101 --12501
NM_004602chr2041376 1300 563 282 ------
NM_004606chrX163 142 ----
NM_004612chr974750 4041 911 829 511 414 215 24552 1470 125 13935
NM_004619chr141758 1507 211 200 ------
NM_004630chr114941 282 258 212 21106 1061 21033 350 --
NM_004631chr1------11246
NM_004634chr33576 480 46 ------
NM_004637chr341285 979 442 77 1865 ----
NM_004639chr6--1103 ----
NM_004654chrY41136 995 478 61 ------
NM_004655chr1731206 991 244 ------
NM_004656chr33937 397 33 --11262 --
NM_004657chr2167 11034 ----
NM_004660chrY31493 1481 654 --2232 119 --
NM_004664chr121242 ------
NM_004670chr1041650 1419 1369 423 --1377 --
NM_004671chr182267 211 ------
NM_004673chr111141 11486 ----
NM_004677chrY1458 --131 --
NM_004684chr41375 --1268 129
NM_004685chr1342458 997 596 392 12322 ----
NM_004686chr851733 1559 636 439 350 11385 1725 --
NM_004687chr1741470 840 389 275 ------
NM_004694chr172294 104 --1237 --
NM_004696chr13836 793 597 --1233 --
NM_004703chr1752497 2346 1950 793 80 21832 296 ----
NM_004709chrX31296 597 223 2566 182 21547 432 --
NM_004713chr141818 ------
NM_004714chr19180 ------
NM_004716chr114809 802 281 33 --1782 --
NM_004717chr731504 431 109 --1568 --
NM_004719chr1222861 766 ----1602
NM_004723chr11856 ------
NM_004725chr1021075 558 ------
NM_004726chrX65166 4700 3836 2238 1227 397 --11736 --
NM_004727chr1521726 862 --1737 --
NM_004730chr562120 2005 1789 577 530 473 11793 ----
NM_004731chr1221654 293 --11425 --
NM_004734chr1333050 2920 876 1925 ----
NM_004736chr13456 128 54 184 ----
NM_004738chr2042442 949 466 339 --12049 --
NM_004739chr112669 536 --1478 --
NM_004742chr321674 621 21486 458 11863 --
NM_004744chr443590 2972 2687 317 ------
NM_004745chr8156851 6692 6490 6203 6166 6066 5998 5753 5733 5016 4292 2032 920 278 41 2641 610 26919 5172 --
NM_004755chr142872 207 ------
NM_004757chr4----1109 --
NM_004758chr1711063 1165 --1401
NM_004759chr1102017 1327 728 450 431 417 357 290 257 225 21634 1568 --1673
NM_004760chr731795 744 309 2629 269 ----
NM_004762chr1771857 1678 1297 593 519 234 51 ------
NM_004768chr11857 ------
NM_004772chr541404 1272 573 468 ------
NM_004774chr1792851 2732 2670 2490 2469 2149 1027 864 340 22324 1121 ----
NM_004779chr55528 495 411 340 240 --1880 --
NM_004781chr121423 508 143 ----
NM_004781chr121423 508 143 ----
NM_004784chr4--199 ----
NM_004786chr18168 ------
NM_004788chr1172263 2203 1924 913 718 353 69 1276 ----
NM_004789chr91363 ------
NM_004794chrX151 ------
NM_004796chr1432298 1888 334 1188 ----
NM_004797chr3113572 3306 3275 3234 3003 2686 2453 2375 842 660 267 --43378 3098 2858 313 --
NM_004798chr2053099 2977 626 335 308 12553 12408 1802
NM_004799chr12427 311 ------
NM_004800chr13------147
NM_004801chr241565 1444 1162 418 --179 --
NM_004807chr252142 906 621 488 283 ------
NM_004811chr113224 218 211 2230 25 ----
NM_004815chr113886 44361 4016 3693 2991 1282 --
NM_004818chr122658 95 182 ----
NM_004821chr53655 602 583 --1320 --
NM_004822chr1784024 3911 3404 2786 1505 528 447 103 33832 1336 1254 11601 --
NM_004830chr63753 310 301 ----1704
NM_004831chr196752 722 427 180 167 158 ----1329
NM_004834chr263098 2986 2807 2529 306 142 12893 ----
NM_004835chr31173 ------
NM_004835chr31173 ------
NM_004839chr152499 454 ------
NM_004841chr11877 --2920 47 --
NM_004844chr31358 21132 399 ----
NM_004845chrX134172 4152 3910 3719 3378 2884 2843 2824 1631 1439 845 695 161 13916 23204 169 --
NM_004856chr153569 489 159 1394 ----
NM_004857chr1444044 3563 1917 1310 11228 24181 3452 --
NM_004860chr171226 130 ----
NM_004863chr1453923 1858 1247 807 337 13268 31872 1120 32 --
NM_004865chr61107 ------
NM_004866chr534790 3920 1471 34338 4008 49 11478 1236
NM_004869chr18195 ------
NM_004871chr17113913 3736 3519 3115 3090 1556 844 447 441 435 22 43388 2724 467 352 24216 548 --
NM_004873chr1453149 2935 2364 1243 932 ------
NM_004874chr82525 119 ------
NM_004879chr112305 132 1333 ----
NM_004884chr1561669 1577 1266 568 446 48 ------
NM_004887chr541002 885 296 235 ------
NM_004888chr91386 ------
NM_004896chr1031180 401 372 ------
NM_004897chr103930 195 146 ------
NM_004898chr492753 2275 2136 1086 649 626 535 509 475 ------
NM_004902chr201817 --1174 --
NM_004904chr7135865 5566 4954 4758 4731 4717 2444 2096 1330 1282 806 573 490 76096 5590 4449 1793 613 566 235 25140 1631 14204
NM_004905chr1----2874 178 --
NM_004922chr102846 110 31007 793 667 ----
NM_004923chr112575 147 1722 ----
NM_004924chr196873 849 842 758 344 153 --1102 --
NM_004926chr144557 160 129 68 2574 414 ----
NM_004930chr13589 211 146 1222 1529 --
NM_004939chr21121 ------
NM_004947chr342588 551 425 254 32088 2002 691 ----
NM_004952chr13949 324 303 172 ----
NM_004953chr31325 ------
NM_004955chr61584 3618 465 120 1436 --
NM_004956chr764471 3494 1134 973 886 629 13214 13125 --
NM_004961chrX71406 1350 1296 553 520 243 169 134 ----
NM_004968chr74644 455 249 163 ------
NM_004973chr611334 21070 631 11599 --
NM_004976chr11124850 4762 3882 3595 3570 3562 2008 1854 1577 1400 1371 845 34829 3577 1827 1910 --
NM_004977chr193562 385 57 ------
NM_004978chr141349 660 502 384 1224 1179 --
NM_004979chrX51087 1056 1009 806 322 254 34 1285 --
NM_004984chr124225 211 62 34 --1518 --
NM_004985chr1274421 4100 3930 1783 1613 1209 828 1556 32796 1798 581 --
NM_004992chrX257686 7658 7161 7048 6807 6535 6172 5775 5767 5719 5279 3247 3179 3097 3004 2432 2368 1507 1489 1308 1267 1218 747 341 60 47692 7078 3374 3063 47836 2618 2566 953 27406 946
NM_004992chrX257686 7658 7161 7048 6807 6535 6172 5775 5767 5719 5279 3247 3179 3097 3004 2432 2368 1507 1489 1308 1267 1218 747 341 60 47692 7078 3374 3063 47836 2618 2566 953 27406 946
NM_004993chr1441243 992 504 330 --1459 21361 37
NM_004994chr202184 136 ------
NM_004995chr1431028 480 129 1239 ----
NM_004998chr151950 2212 107 1941 --
NM_004999chr6104302 4271 3694 3222 3134 1592 1227 1123 233 224 ------
NM_005006chr21928 ------
NM_005010chr752141 2036 1880 616 446 ------
NM_005011chr721472 178 --1596 11532
NM_005020chr73531 123 80 1557 171 --
NM_005022chr17152 ------
NM_005026chr142019 1308 310 246 1506 ----
NM_005028chr101775 --21465 618 --
NM_005030chr161269 ------
NM_005032chrX4999 342 188 94 2824 399 2819 254 --
NM_005045chr7--152 1153 --
NM_005056chr1265012 3524 2031 1846 1788 418 --25568 702 --
NM_005057chr151745 587 478 463 219 ------
NM_005060chr141231 847 85 27 --11077 --
NM_005063chr1093539 3274 3244 2671 1390 953 679 266 212 53632 3362 1531 1424 1202 1380 --
NM_005065chr14114873 3889 3757 3486 1965 1857 1766 638 531 234 182 24082 3574 22028 1643 --
NM_005068chr611483 --11372 --
NM_005077chr9----1365 --
NM_005078chr1571743 1472 1175 1169 1146 600 412 21710 1522 ----
NM_005080chr225830 739 349 301 278 1946 ----
NM_005087chr32547 108 ------
NM_005088chrX2270 81 2813 183 ----
NM_005095chr12873 246 ------
NM_005096chrX31083 1015 120 --1447 --
NM_005097chr10----178 --
NM_005099chr12514 135 --1878 --
NM_005103chr111307 ------
NM_005109chr352037 1967 985 629 604 1633 ----
NM_005110chr52527 277 5803 671 533 281 250 ----
NM_005116chr20104605 3299 3121 3080 1768 966 764 670 377 341 33846 3444 1712 24228 1001 --
NM_005117chr112877 354 125 ----
NM_005119chr131206 1167 1041 ------
NM_005121chr1731277 437 194 --22993 1521 --
NM_005126chr321855 1660 ----1168
NM_005134chr185791 603 353 111 25 ------
NM_005135chr1543806 1073 901 129 --22612 1108 --
NM_005140chrX3869 844 128 125 1115 1755
NM_005151chr1841772 1657 627 479 ------
NM_005153chr164748 711 101 74 ------
NM_005156chr994778 4708 3795 3645 3570 1707 1527 1461 21 --25411 3512 --
NM_005157chr941923 1331 753 372 3718 417 321 ----
NM_005159chr152892 780 12008 --1589
NM_005164chr1232672 2452 1058 --11067 --
NM_005168chr221375 1145 ------
NM_005176chr12130 ------
NM_005180chr10----1363 --
NM_005182chr162510 428 1248 ----
NM_005184chr19111409 1226 1156 1145 1097 993 327 231 212 174 44 2196 70 165 --
NM_005187chr16111372 1342 1317 703 523 407 382 358 346 336 165 3413 389 259 ----
NM_005188chr11218123 7868 7365 7315 6912 6637 5970 5691 3265 3143 3130 3078 2831 2562 2462 1620 1369 1361 1045 615 117 107989 6791 5662 3056 2970 2904 2856 1755 1644 1386 47582 6647 5721 1408 --
NM_005190chr61356 11162 ----
NM_005197chr14115536 5503 5417 4994 4945 4378 4276 1740 1714 1468 168 ------
NM_005202chr161798 1760 894 723 199 147 32187 1617 704 1885 --
NM_005203chr101162 ------
NM_005206chr1721012 893 1983 ----
NM_005214chr22223 118 ------
NM_005219chr5111427 1347 1278 730 495 488 364 351 290 147 133 11396 ----
NM_005220chr172962 113 --11128 --
NM_005221chr7----124 --
NM_005227chr11154 ----1475
NM_005229chrX4878 805 158 52 156 ----
NM_005230chr122546 99 1480 ----
NM_005233chr372321 2185 970 885 725 509 162 ------
NM_005235chr2207620 7589 7571 7061 6906 6186 5977 5754 5507 5444 5379 5042 2806 2525 1425 992 583 537 354 62 25162 896 ----
NM_005238chr1173099 3038 2658 2432 1396 891 742 32871 2581 2349 12477 --
NM_005239chr212398 308 --12038 --
NM_005240chr11596 1576 1560 --
NM_005241chr341313 882 388 185 ------
NM_005244chr20----1252 1481
NM_005252chr143667 311 197 ------
NM_005254chr1541121 979 493 453 ------
NM_005256chr11--154 ----
NM_005257chr181112 ----11357
NM_005259chr2----1298 --
NM_005261chr81234 ------
NM_005263chr121116 918 ----2232 107
NM_005264chr103951 813 618 --1733 --
NM_005271chr1031003 124 96 135 ----
NM_005274chr12158 133 ------
NM_005276chr1241524 1161 624 587 2255 237 1705 11497
NM_005276chr1241524 1161 624 587 2255 237 1705 11497
NM_005277chr421284 488 ------
NM_005281chr12657 300 274 61 ----
NM_005296chrX2297 38 --1216 --
NM_005311chr742808 2005 1840 333 22023 1912 ----
NM_005313chr151933 --137 --
NM_005316chr111943 ------
NM_005324chr1711300 11900 ----
NM_005328chr83756 701 554 1706 ----
NM_005329chr1662380 2016 1717 933 874 384 --12066 --
NM_005334chrX71151 586 570 411 244 147 130 21498 33 ----
NM_005336chr2112020 2001 1945 1924 1796 1736 1494 842 409 403 112 127 ----
NM_005337chr122338 76 ------
NM_005339chr441633 1614 764 39 ------
NM_005342chrX52516 2011 1930 266 257 --22850 861 1706
NM_005347chr941698 1667 1482 1445 ------
NM_005349chr41485 --1566 --
NM_005354chr192534 252 --1524 --
NM_005358chr131314 ------
NM_005359chr1876194 5958 5058 4310 4303 1854 641 1188 24482 2185 15178
NM_005374chr1752284 2262 2104 2093 387 3842 702 692 11773 --
NM_005378chr2197 ------
NM_005382chr8185 ------
NM_005386chr203695 588 573 ------
NM_005387chr113260 238 182 ------
NM_005392chr961834 1728 1184 505 492 113 ------
NM_005398chr1021082 481 --11432 --
NM_005399chr1103580 3557 3382 2798 2788 1584 1446 1325 1316 358 32804 618 406 ----
NM_005400chr282677 2361 955 724 586 480 195 96 22651 961 ----
NM_005402chr721744 1521 ------
NM_005406chr1841240 1074 361 355 ------
NM_005407chr1481579 1506 1423 1393 1141 315 302 237 1266 ----
NM_005410chr5----1617 --
NM_005413chr26362 341 95 88 79 27 1433 ----
NM_005415chr21234 ------
NM_005417chr2051797 1751 1272 249 101 21810 421 11429 --
NM_005429chr41124 ------
NM_005433chr1832709 1904 474 ----12151
NM_005435chr71571 --1545 --
NM_005436chr1064063 1635 1433 1182 702 553 1658 22567 323 --
NM_005437chr102344 118 21343 1128 ----
NM_005439chr124387 170 131 24 --1459 --
NM_005440chr1772934 2791 2571 2481 773 417 395 2325 192 1643 --
NM_005443chr4--2497 477 ----
NM_005445chr102267 52 ------
NM_005455chr121509 560 11438 ----
NM_005458chr942186 1881 1668 905 21706 465 ----
NM_005460chr52585 432 --173 --
NM_005461chr2031476 1438 534 1289 ----
NM_005465chr151868 1730 1634 794 408 ------
NM_005474chr1761452 1261 1123 1027 556 518 1425 31491 1227 414 2510 325
NM_005475chr126509 432 376 287 205 83 12275 22992 2604 --
NM_005476chr92166 151 132 ----
NM_005477chr1552426 866 795 40 23 22110 748 11044 --
NM_005477chr1552426 866 795 40 23 22110 748 11044 --
NM_005483chr191363 ------
NM_005487chr2251762 1575 1488 1448 259 ------
NM_005494chr7199 ------
NM_005497chr1735833 4887 4493 35239 2292 1518 --13962
NM_005499chr191411 ------
NM_005502chr972529 2342 2140 1262 775 337 217 --151 --
NM_005505chr122931 79 1282 2732 89 --
NM_005507chr112443 174 ------
NM_005509chr52392 76 --1428 --
NM_005512chr1192035 1480 1284 1268 1258 755 740 579 570 1818 11760 --
NM_005515chr72622 58 1216 ----
NM_005520chr51145 ------
NM_005522chr71377 189 ----
NM_005523chr71260 3596 485 409 1159 --
NM_005530chr1541197 1190 1172 995 1316 1453 --
NM_005542chr711712 ----1143
NM_005544chr23970 348 56 ------
NM_005552chr142148 39 193 ----
NM_005561chr135915 393 341 265 85 ------
NM_005563chr14837 670 195 22 ------
NM_005565chr52513 134 ------
NM_005574chr11175 ------
NM_005575chr52701 116 ------
NM_005578chr394824 4811 4798 4766 4134 1214 1136 1085 990 ----14833
NM_005584chr131109 1233 ----
NM_005587chr151964 --1341 --
NM_005595chr1----1303 --
NM_005596chr975079 4930 2464 1284 813 419 89 22195 1443 12281 14139
NM_005599chr151376 1045 483 336 156 --21310 526 --
NM_005603chr1841861 1421 1249 62 ------
NM_005604chr642181 819 582 63 185 --1677
NM_005607chr811004 ------
NM_005609chr11----2255 48 --
NM_005610chr1------1898
NM_005611chr161919 ----2830 27
NM_005618chr61143 ------
NM_005625chr84935 343 221 151 --1241 --
NM_005627chr6----1176 --
NM_005629chrX4870 505 217 90 1327 ----
NM_005637chr1831724 836 196 ------
NM_005639chr121726 --1211 --
NM_005644chr12406 352 ------
NM_005647chrX112748 2507 1143 845 836 789 779 763 637 526 461 1673 --177
NM_005648chr8132 ------
NM_005652chr1631199 1168 827 --1191 --
NM_005654chr51198 ------
NM_005655chr8--1508 ----
NM_005656chr213980 192 81 2461 307 21141 146 --
NM_005665chr164458 3562 3525 1615 1608 1474 11832 --14370
NM_005668chr511745 13027 1763 --
NM_005669chr552275 959 822 332 32 ------
NM_005670chr641579 367 147 131 --21498 349 --
NM_005686chr131547 1209 30 21454 1429 1284 --
NM_005688chr311049 1889 ----
NM_005707chr152439 139 142 ----
NM_005708chr13174 ------
NM_005715chr662732 2078 1005 719 265 212 11774 ----
NM_005717chr121245 847 ------
NM_005722chr231937 514 100 ------
NM_005724chr151174 ----1201
NM_005725chr161827 1807 1562 806 641 548 32066 1874 885 1875 --
NM_005730chr12103457 3287 2744 1179 1172 979 790 730 422 347 33671 2724 508 32581 324 45 --
NM_005731chr22356 272 190 1109 --
NM_005736chr10126 --11420 --
NM_005737chr252878 2817 1064 524 219 --11832 --
NM_005738chr741908 1785 787 198 ------
NM_005739chr1531735 1523 870 11890 --1852
NM_005746chr752697 2469 2224 2072 459 1427 ----
NM_005748chr1233300 2913 316 23381 2322 11236 --
NM_005749chr171209 ------
NM_005756chrX2295 103 ------
NM_005759chr253635 1138 1039 559 357 --24168 1115 --
NM_005765chrX1574 ------
NM_005779chr543294 2417 773 27 ----11266
NM_005783chr23419 225 109 ------
NM_005786chr185961 888 157 112 90 21121 955 ----
NM_005789chr1781926 1918 1894 464 438 310 145 116 1710 2302 196 --
NM_005795chr242141 759 459 39 ------
NM_005796chr16147 ------
NM_005807chr11227 ------
NM_005808chr382665 1346 1280 947 831 799 386 186 1953 13377 --
NM_005811chr12----195 --
NM_005814chr131269 90 71 21096 528 149 1350
NM_005822chr632409 822 373 --31843 1694 721 --
NM_005828chr17104973 4236 4152 3753 1854 1316 854 581 445 236 --44749 3729 3667 530 --
NM_005832chr321033 251 ------
NM_005834chrX1183 ------
NM_005839chr13994 823 657 ------
NM_005840chrX226524 6412 5237 4788 4715 2494 2157 1947 1715 1592 1079 915 846 590 584 540 529 496 483 463 115 33 46296 1438 664 205 16271 --
NM_005843chr261939 1889 1327 623 255 136 ------
NM_005851chr115447 378 318 293 62 ------
NM_005852chr1751125 1079 1064 196 139 31092 179 155 11166 --
NM_005853chr161477 ------
NM_005857chr151438 1187 1154 538 435 ------
NM_005859chr51185 ------
NM_005862chr32864 843 ------
NM_005864chr144284 161 117 110 ------
NM_005877chr2242346 2308 172 43 --1213 1882
NM_005880chr16--31646 1233 38 ----
NM_005882chr43354 245 142 --1266 --
NM_005885chr541073 428 167 61 ------
NM_005888chr121127 ----1177
NM_005895chr1283957 3081 1533 1085 1068 304 230 211 --83708 3627 3578 3216 2978 2965 654 613 --
NM_005896chr22810 649 1634 ----
NM_005898chr1132829 936 92 --11294 --
NM_005900chr421151 805 ----1832
NM_005901chr18128494 6602 6351 6294 5708 2663 2551 2303 2207 1641 1093 572 25975 727 47401 7162 205 48 17499
NM_005902chr15124592 4090 3944 3089 2891 1426 1083 1074 478 454 312 114 13264 ----
NM_005903chr555193 4306 1021 396 195 11210 11623 11963
NM_005904chr1841173 596 473 102 --11041 --
NM_005909chr574257 4091 3593 2925 2709 1449 772 34036 3465 2832 ----
NM_005910chr1763547 3221 3003 1507 1356 864 43888 3794 3029 210 12878 12836
NM_005911chr2----1342 --
NM_005920chr1173858 3705 3585 3507 3491 3406 2521 2467 2435 2418 2372 1163 1152 738 266 217 194 --13224 13604
NM_005922chr62142 32 ------
NM_005923chr62705 217 ----1206
NM_005924chr7127 ------
NM_005927chr55922 468 297 178 44 11170 ----
NM_005928chr152532 155 136 ----
NM_005930chr141120 ------
NM_005933chr11112837 2764 2478 2248 1942 757 733 701 379 224 135 32797 714 343 12195 12715
NM_005934chr19132577 2391 2248 2055 1969 1781 1726 1659 947 941 851 233 75 2719 548 3739 169 145 --
NM_005935chr475277 5000 3773 1528 1122 561 148 35186 4164 1770 11664 1844
NM_005937chr1793746 3648 3531 3454 2575 1313 946 822 206 23861 3277 ----
NM_005941chr854196 3325 1264 554 254 1828 13590 --
NM_005943chr661411 1318 1243 1152 1141 60 1109 ----
NM_005955chr1105102 4836 4378 4339 3903 3842 3396 3370 1533 1488 33991 2038 1201 11622 13656
NM_005962chr1042112 2025 1772 635 1709 ----
NM_005962chr1042112 2025 1772 635 1709 ----
NM_005964chr1731046 486 380 21231 131 ----
NM_005966chr212316 ----12367
NM_005967chr121115 168 ----
NM_005984chr223507 475 440 ------
NM_005990chr592190 2061 733 634 543 363 335 60 51 21083 557 21859 240 --
NM_005996chr1221543 623 ----11235
NM_005997chr1269 31 ------
NM_006007chr944149 3947 3616 519 21767 101 13733 --
NM_006011chr15144118 3884 3829 3724 3474 3457 3366 3319 3194 2962 2892 2826 1314 1197 13100 21209 1130 13387
NM_006015chr14354 157 146 127 ------
NM_006022chr1331079 416 348 1306 ----
NM_006030chr33378 55 47 11224 ----
NM_006032chr141206 ------
NM_006033chr1832184 585 203 1678 1562 --
NM_006036chr242391 1024 921 848 3707 180 131 --1978
NM_006037chr284824 4047 3091 1880 1828 1429 1305 101 24844 3003 168 --
NM_006038chr2031926 1660 486 2571 252 ----
NM_006040chr1631393 922 453 ------
NM_006041chr173390 209 144 1335 ----
NM_006043chr165764 111 47 34 23 --2646 254 --
NM_006047chr2052747 2530 2513 1209 399 ------
NM_006048chr141190 1105 498 427 ------
NM_006054chr112150 140 ----11368
NM_006060chr7104287 3884 3530 3364 3242 2797 1743 1547 1113 956 24100 304 ----
NM_006068chr42280 197 1269 ----
NM_006070chr31267 ------
NM_006079chr62589 289 1302 ----
NM_006080chr732749 2197 1178 --1170 --
NM_006088chr9144 ------
NM_006089chrX21288 34 11427 11362 --
NM_006091chr15101627 1497 1181 644 562 492 415 225 65 36 1608 ----
NM_006094chr862223 907 684 406 319 280 12109 ----
NM_006095chr443667 1521 1401 404 21696 38 --24031 636
NM_006099chr12898 361 1688 ----
NM_006106chr1163473 2631 1244 916 542 152 11004 --13274
NM_006107chr171469 ------
NM_006133chr1141864 974 415 370 --22359 2344 --
NM_006134chr2171468 1342 1200 1186 624 322 314 11378 ----
NM_006135chr121094 493 --11041 --
NM_006136chr721172 919 ------
NM_006141chr1622450 307 ------
NM_006143chr12------195
NM_006145chr193978 805 722 139 ----
NM_006147chr1192 ----1127
NM_006148chr17122955 2649 2597 2574 779 765 540 502 316 249 224 128 --22265 2207 --
NM_006154chr1521904 638 ------
NM_006156chr141221 --167 --
NM_006158chr821619 627 --137 --
NM_006159chr121132 ------
NM_006160chr174268 238 212 133 1257 ----
NM_006161chr54531 248 236 189 188 126 --
NM_006162chr18--2206 27 11182 --
NM_006166chr1232590 2305 842 ------
NM_006177chr1431014 991 716 1748 ----
NM_006180chr931996 143 99 1221 ----
NM_006183chr121105 ------
NM_006186chr21287 ------
NM_006187chr12113199 2992 2471 1977 1068 1025 947 413 374 346 174 22721 832 ----
NM_006191chr121714 186 1310 --
NM_006195chr931269 1260 982 ------
NM_006196chr2142 ------
NM_006197chr832218 1835 138 11767 ----
NM_006201chrX4823 816 438 211 --192 --
NM_006202chr1961887 1283 797 600 162 88 31833 1245 349 --1787
NM_006206chr442479 2472 2084 983 --12237 --
NM_006216chr2163 ------
NM_006218chr3161 ------
NM_006224chr1752138 869 735 684 127 1277 --1768
NM_006228chr81289 1430 ----
NM_006237chr1372146 2114 1638 702 154 136 65 1769 ----
NM_006238chr661971 538 293 283 193 170 1316 21803 831 --
NM_006239chr4--1501 1297 179
NM_006241chr362359 2251 2227 1875 821 647 1833 1912 --
NM_006243chr11734 1764 --1662
NM_006244chr113594 411 60 ------
NM_006245chr62383 174 1111 --1974
NM_006246chr1411070 ------
NM_006251chr523184 2213 --1599 --
NM_006252chr166920 6325 6253 6176 5344 1540 15442 12639 15812
NM_006255chr143806 395 152 1768 --156
NM_006256chr122380 73 1649 ----
NM_006265chr8--1445 1482 --
NM_006267chr231840 1614 518 ------
NM_006268chr115943 246 92 76 47 1254 ----
NM_006275chr2052031 1881 837 190 83 --261 41 --
NM_006277chr22179 70 --1545 --
NM_006279chr11933 1302 ----
NM_006281chr81223 ------
NM_006281chr81223 ------
NM_006282chr2094714 3425 1651 1537 887 833 680 317 152 21345 105 33391 3140 760 --
NM_006290chr661774 1224 722 568 258 141 11735 11684 --
NM_006292chr113175 52 33 ------
NM_006300chr1952283 1904 1805 1672 217 --11509 --
NM_006305chr152213 65 ------
NM_006306chrX54610 4580 4552 4363 50 --11464 --
NM_006307chrX1314 133 ----
NM_006310chr1731163 972 270 1947 ----
NM_006313chr12----135 --
NM_006315chr473879 3304 1183 909 856 788 225 31447 1351 325 ----
NM_006317chr56784 638 115 93 78 50 3610 83 71 ----
NM_006320chr441118 992 308 288 ------
NM_006321chr331846 1646 317 1502 11420 --
NM_006322chr131678 ------
NM_006323chr42709 636 ------
NM_006327chr10178 ------
NM_006333chr23660 593 245 1155 1149 --
NM_006334chr91314 ------
NM_006335chr11387 ------
NM_006336chr941347 1335 1116 284 ------
NM_006337chr12131 1230 1297 --
NM_006345chr43490 327 78 1517 1559 --
NM_006350chr52320 42 ----1353
NM_006352chr121878 531 --11289 --
NM_006359chrX3829 488 235 11716 32024 1659 1533 --
NM_006363chr204637 584 450 131 ------
NM_006371chr395246 4604 4132 3348 2003 775 433 243 171 2818 138 13412 1110
NM_006373chr174449 355 269 144 ------
NM_006375chrX--1465 --11745
NM_006378chr931070 1032 70 ------
NM_006379chr741998 1849 1778 346 ------
NM_006380chr1714289 --23546 2753 --
NM_006383chr151488 1236 ----
NM_006386chr2252232 1656 638 78 62 12311 22083 1904 --
NM_006389chr1171291 1012 895 860 500 412 212 --1379 --
NM_006390chr1261595 1588 1487 1407 665 152 ------
NM_006393chr1063980 3470 3221 3156 2833 385 13233 --24273 636
NM_006401chr92505 340 ------
NM_006403chr641803 1573 538 146 1419 ----
NM_006405chr14275 33 --160 --
NM_006411chr66881 333 224 201 108 92 --1121 --
NM_006420chr2043130 2354 1335 1208 12588 1344 --
NM_006421chr811190 ------
NM_006422chr12228 21 ------
NM_006430chr22398 203 ------
NM_006440chr221105 ------
NM_006449chr252112 1943 1578 1546 429 ----32175 1982 468
NM_006457chr453979 2856 2776 1113 345 12705 ----
NM_006458chr111140 ------
NM_006459chr1051647 1614 1533 1383 119 124 --179
NM_006460chr171173 ------
NM_006461chr171132 ------
NM_006464chr294535 4479 4344 2916 1620 1589 1490 451 58 52992 1782 1744 1667 592 11038 --
NM_006465chr1582002 1996 1978 868 801 776 721 420 32352 2188 814 21939 34 --
NM_006469chr12548 290 11408 1331 --
NM_006471chr182221 113 ------
NM_006472chr141185 1023 828 52 ------
NM_006482chr1253573 1254 1067 794 205 --12873 --
NM_006483chr19180 ------
NM_006484chr19180 ------
NM_006489chr1431605 1273 1262 2709 608 11638 11669
NM_006496chr16692 566 519 505 322 133 ------
NM_006497chr173794 759 280 ------
NM_006504chr1032884 2358 813 12580 52473 2208 2189 821 404 --
NM_006510chr61249 2860 671 ----
NM_006517chrX101983 1970 1497 1464 622 579 278 216 38 29 32076 615 269 1181 --
NM_006519chr64110 91 80 28 --1285 --
NM_006520chrX31542 454 343 160 ----
NM_006521chrX----130 --
NM_006527chr43587 239 148 ------
NM_006529chr431532 1311 1106 ------
NM_006532chr1951772 1461 585 574 428 ----22069 1944
NM_006534chr2073282 3262 3204 2605 2389 2127 561 --12216 --
NM_006538chr274206 3923 1510 1015 728 550 412 13020 ----
NM_006540chr82267 187 ------
NM_006544chr1485677 5076 4914 4244 2040 1306 538 260 15688 ----
NM_006546chr17196620 5958 5951 5815 5214 5169 5162 5119 5111 4643 4388 4379 4199 2644 2145 2093 1417 788 63 46226 5320 1518 278 --25686 1879
NM_006548chr31287 ------
NM_006557chr941420 1126 1103 279 ------
NM_006559chr11137 ------
NM_006560chr111142 1119 ----
NM_006561chr10155924 5739 5001 4917 4403 4274 3960 2471 2216 2137 2010 1290 579 167 27 35023 4423 4342 14384 15494
NM_006563chr191125 171 126 --
NM_006565chr162815 71 ------
NM_006566chr1861011 857 421 390 377 37 1338 ----
NM_006572chr1723170 839 13400 1323 1310
NM_006574chr31107 ------
NM_006575chr141405 ------
NM_006577chr221226 323 ------
NM_006589chr11133 ------
NM_006593chr26753 661 649 626 581 63 --1251 --
NM_006599chr16137571 7556 7413 7290 6491 5729 3052 2574 2540 1789 1153 579 392 15143 17546 --
NM_006601chr122355 243 ------
NM_006603chrX21723 346 ------
NM_006608chr12503 118 --124 --
NM_006609chr242017 798 288 60 ------
NM_006614chr362673 2559 2255 362 158 76 --22745 1306 23675 2288
NM_006621chr131607 1298 92 --1242 --
NM_006624chr10138 ----11389
NM_006626chr951791 1710 985 928 257 22604 795 11699 11682
NM_006628chr1553540 3468 1249 354 46 24014 1811 --23984 3957
NM_006629chr1832581 2249 37 --21003 519 1325
NM_006633chr53775 620 545 ------
NM_006636chr22990 674 ------
NM_006644chr132566 198 ------
NM_006650chr593785 3131 2735 883 545 232 153 141 122 12518 11032 --
NM_006651chr451508 1299 959 555 496 ------
NM_006654chr1254167 3516 1844 1465 780 12985 24772 1210 11091
NM_006658chr75861 835 175 128 86 ------
NM_006662chr161125 129 ----
NM_006670chr63409 216 82 1477 ----
NM_006675chr1273337 2880 2850 2543 998 983 712 53011 2953 2535 1115 86 23158 1137 --
NM_006680chr111118 ------
NM_006690chr2052026 1970 1831 594 395 --12198 --
NM_006694chr13289 271 79 ------
NM_006698chr2051316 1252 562 447 425 123 ----
NM_006699chr142502 2079 1063 25 22620 456 22359 2071 --
NM_006703chr61462 180 ----
NM_006709chr62107 22 ------
NM_006713chr51532 188 ----
NM_006717chr943032 2276 1127 1067 23066 78 1322 --
NM_006720chr10144791 4547 4435 4141 4070 3985 3898 3663 3550 3178 1929 1738 974 728 23596 3422 ----
NM_006722chr322395 683 12143 ----
NM_006724chr62142 32 ------
NM_006726chr421133 63 ------
NM_006727chr51158 ------
NM_006732chr1962123 1797 1780 1544 1357 287 1416 ----
NM_006734chr631229 346 22 ------
NM_006735chr71296 --1359 --
NM_006736chr261759 1509 541 527 512 438 21735 102 11187 --
NM_006742chr1661835 1410 784 439 421 79 22011 715 ----
NM_006744chr103172 93 46 ------
NM_006746chrX21197 1077 ------
NM_006749chr841167 886 122 107 --1980 --
NM_006750chr16147469 7457 7328 5340 5237 3177 3163 1479 988 817 371 235 90 83 66737 5570 3187 3101 2820 2746 12066 14949
NM_006754chr72188 160 1890 ----
NM_006756chr81262 1965 21290 354 --
NM_006761chr171700 --1627 --
NM_006763chr172004 1931 1626 1603 1300 562 423 1648 21682 859 11723
NM_006766chr892671 2628 2401 1802 1755 1644 604 444 303 12588 ----
NM_006772chr6131646 1615 1453 1406 1204 694 675 574 561 380 225 34 28 11701 11270 --
NM_006775chr641999 1000 431 328 ----130
NM_006777chrX62419 2237 1842 775 386 353 ------
NM_006778chr641495 422 186 163 --123 --
NM_006783chr132283 111 152 1265 --
NM_006788chr183451 115 82 --2558 126 --
NM_006790chr51157 ------
NM_006795chr1171570 1449 1408 1383 1044 563 494 ------
NM_006801chr194649 574 74 22 1233 ----
NM_006802chr13372 286 69 1981 ----
NM_006805chr551447 1075 672 189 180 148 ----
NM_006807chr1721116 979 ------
NM_006813chr62656 56 ------
NM_006814chr204877 832 629 482 2265 181 142 --
NM_006815chr1241275 1016 529 494 181 ----
NM_006818chr13248 96 75 166 ----
NM_006819chr111272 2388 112 ----
NM_006822chr171246 136 ----
NM_006826chr231248 1083 28 --1420 --
NM_006827chr1483197 2868 2846 2265 1299 590 466 347 --22898 2590 --
NM_006828chr6144 ------
NM_006838chr1231466 684 190 ------
NM_006851chr1262803 2267 2081 644 495 131 --1700 --
NM_006852chr1762563 1893 941 691 594 167 32681 2367 825 ----
NM_006854chr732021 353 107 1758 11555 --
NM_006856chr1261157 1129 1075 1037 764 366 21042 266 ----
NM_006861chr1231387 545 492 1115 --11514
NM_006873chr253343 879 599 372 331 12788 --12929
NM_006874chr421211 1071 ------
NM_006875chrX3879 755 320 ------
NM_006884chr361773 1530 559 351 112 76 21821 1414 ----
NM_006885chr16154134 3863 3509 3441 3166 3111 1512 1104 1098 1091 1064 1041 820 733 502 ------
NM_006886chr201165 ------
NM_006888chr1483457 3129 3030 2900 2836 2571 2287 1193 33299 2714 1356 23068 721 --
NM_006892chr203252 162 91 2905 369 11197 --
NM_006892chr203252 162 91 2905 369 11197 --
NM_006895chr221810 1432 ------
NM_006896chr72830 23 ------
NM_006906chr112858 167 ------
NM_006908chr721101 435 11068 ----
NM_006914chr931442 1096 581 11451 ----
NM_006915chrX21741 39 --31816 714 348 --
NM_006920chr211526 ------
NM_006922chr262526 2520 2248 871 838 157 1766 12598 --
NM_006924chr1713762 12808 --1238
NM_006925chr141478 ------
NM_006931chr1241579 815 206 48 11408 ----
NM_006937chr17160 ------
NM_006939chr141913 ------
NM_006940chr1261596 1403 1249 485 355 86 3573 565 556 ----
NM_006943chr2083309 3300 2850 2622 1176 800 373 287 22399 672 2740 590 --
NM_006955chr1023415 2731 11350 ----
NM_006958chr8--145 ----
NM_006965chr1811148 1269 ----
NM_006981chr952808 2161 347 137 35 12154 1654 --
NM_006983chr1122 ------
NM_006987chr173488 482 176 21231 1057 11306 --
NM_006990chr1122432 2081 1874 1794 1780 1622 797 449 244 186 127 36 ------
NM_006991chr33875 415 98 ------
NM_006997chr102450 368 ------
NM_006999chr52595 397 ------
NM_007005chr9131 11074 11032 --
NM_007007chr1284728 3458 3173 3034 2949 2942 1692 1551 --13667 --
NM_007011chr1596552 6469 6112 5847 1983 1439 1110 722 162 1208 25868 1888 14744
NM_007013chr81415 ------
NM_007017chr5157 ------
NM_007023chr21895 ------
NM_007026chr173567 465 103 170 176 --
NM_007034chr11220 ------
NM_007039chr1442253 1579 1553 302 12069 181 --
NM_007040chr191909 1925 2421 362 --
NM_007042chr362524 2493 444 402 211 39 1462 --1783
NM_007045chr61590 1100 ----
NM_007050chr20127765 7143 6639 6503 3153 2732 2008 1770 1612 1505 907 385 --15992 11347
NM_007054chr553633 3615 3188 640 43 --12746 1230
NM_007067chr1731557 1160 306 21222 417 ----
NM_007068chr221284 --2427 415 --
NM_007078chr1041069 709 492 302 11976 ----
NM_007084chr1311199 1359 ----
NM_007096chr9--162 ----
NM_007100chr4121 ------
NM_007106chr1352834 2115 2051 1720 691 12655 ----
NM_007107chr362320 2190 943 928 811 430 ----1876
NM_007114chr342411 2201 1187 856 23004 2996 ----
NM_007118chr5127 ------
NM_007125chrY1407 142 1364 --
NM_007126chr9------1114
NM_007129chr133373 317 25 ------
NM_007137chrX104925 4919 4357 4187 3823 3628 1700 895 814 443 44438 4087 3662 1625 25068 170 --
NM_007144chr1751325 483 471 97 79 140 187 --
NM_007145chr1911041 21400 539 ----
NM_007146chr1731774 1097 933 1142 1376 --
NM_007147chr1921074 252 21136 1108 ----
NM_007158chr111010 21192 83 ----
NM_007159chr311083 --11777 1687
NM_007166chr1121555 395 1447 2977 108 --
NM_007170chr12665 340 1262 1914 --
NM_007172chr2252154 427 329 317 83 11125 33141 2291 186 11326
NM_007174chr1271563 780 628 609 418 253 183 21681 829 ----
NM_007184chr31556 ------
NM_007185chr17808 796 752 431 174 75 51 ------
NM_007187chr132893 749 ------
NM_007190chr102152 26 --188 --
NM_007191chr121474 --1155 --
NM_007192chr1421113 277 ------
NM_007195chr1863146 3131 2894 1137 899 73 23272 2995 21271 679 --
NM_007197chr121862 1945 ----
NM_007202chr171680 --1771 --
NM_007203chr943133 1570 557 338 33478 519 488 23348 2858 --
NM_007204chr1--1131 ----
NM_007207chr11275 134 1793 --
NM_007212chr132295 510 212 ------
NM_007214chr641326 1246 549 123 ------
NM_007219chr205964 943 925 665 132 187 1285 --
NM_007221chr1--1407 ----
NM_007222chr821818 304 --11761 --
NM_007236chr1542103 948 810 99 1630 11580 --
NM_007238chr2054775 4632 1213 896 317 14599 --1269
NM_007246chr41967 188 ----
NM_007249chr13249202 9173 8789 8083 7754 7457 7409 7278 7067 6966 6949 6804 6685 6627 6211 5821 5756 3173 2400 1357 1289 894 848 593 38947 7550 6980 59289 8221 2793 1269 1028 26022 1385
NM_007250chrX2388 42 2193 172 ----
NM_007271chr651366 1233 1216 395 71 ------
NM_007275chr31441 --1243 --
NM_007276chr7--1265 ----
NM_007278chr171152 1144 ----
NM_007279chr194577 489 444 46 --1585 --
NM_007283chr382220 2187 1026 1002 746 661 414 303 12022 32934 2298 2062 --
NM_007285chr161501 188 ----
NM_007292chr1765185 4410 3936 3231 552 413 --13615 13864
NM_007313chr941923 1331 753 372 3718 417 321 ----
NM_007322chr191560 ------
NM_007324chr12427 311 ------
NM_007345chr183891 528 489 1590 ----
NM_007349chr71110 ------
NM_007350chr1273438 3317 3245 1731 511 493 102 --11616 14322
NM_007358chr111683 ------
NM_007365chr182057 2042 1915 1662 862 820 728 557 21710 44 ----
NM_007371chr92614 220 ------
NM_007372chr17--1898 ----
NM_007373chr1021218 323 ------
NM_007374chr141370 ------
NM_007375chr152149 2106 1130 705 290 ------
NM_009585chr31173 ------
NM_009585chr31173 ------
NM_012069chrX3899 229 130 ----11928
NM_012074chr14----1821 --
NM_012081chr563668 3020 3013 2297 1224 453 ------
NM_012084chrX2124 96 135 ----
NM_012090chr11445 ------
NM_012092chr24694 665 428 69 --2786 547 --
NM_012095chr1042671 2440 592 318 1483 --12719
NM_012096chr31584 --23336 3023 11115
NM_012099chr1921174 186 --2793 501 --
NM_012102chr142249 2041 915 875 22619 924 ----
NM_012104chr11113767 3398 3338 3224 3113 3081 2688 1083 1017 810 237 22417 1231 --22383 321
NM_012104chr11113767 3398 3338 3224 3113 3081 2688 1083 1017 810 237 22417 1231 --22383 321
NM_012110chr4168 145 --128
NM_012115chr6123 ----1150
NM_012120chr642879 2472 2132 949 12525 ----
NM_012137chr162205 2160 923 539 496 114 12744 22052 1930 --
NM_012141chr1384180 3560 3172 2970 2752 2602 530 272 23056 2863 11495 11143
NM_012154chr8----1133 --
NM_012156chr20113406 3350 2915 2551 2180 2077 1272 686 660 620 355 33103 2929 464 2803 81 12435
NM_012158chr1331528 1209 348 11509 ----
NM_012160chr6--1200 ----
NM_012161chr411179 ------
NM_012164chr9147488 6986 6835 6694 6679 6471 6458 5695 5394 5219 4730 2577 1189 791 46286 6001 1655 1555 46921 6134 2312 446 14829
NM_012174chr1252298 2219 868 766 484 179 12787 --
NM_012175chr112799 223 ------
NM_012183chr13422 140 126 1240 1446 --
NM_012193chr11165251 4995 4902 4803 4696 4630 3577 3455 3352 1907 1877 1623 1115 821 706 687 --24032 3683 13605
NM_012197chr92634 265 ------
NM_012199chr1144112 4079 4052 2955 2932 1500 1218 1152 1138 1120 1075 1005 670 639 21056 43 14340 --
NM_012207chr102805 56 ------
NM_012210chr921226 420 11005 ----
NM_012214chr295909 5728 5342 5007 2421 2389 2151 1975 1151 --25449 883 --
NM_012215chr1011635 11299 ----
NM_012216chrX--134 ----
NM_012224chr41125 ------
NM_012234chr343119 1504 1065 187 11432 1674 --
NM_012238chr1021236 264 ------
NM_012242chr102818 211 ------
NM_012243chr12380 300 2755 639 ----
NM_012244chr1461424 1316 1163 574 510 100 2626 317 126 --
NM_012245chr14131 ------
NM_012249chr263220 2891 2343 2273 925 826 11114 ----
NM_012250chr1131145 976 59 ------
NM_012252chr744722 3722 860 407 43476 1005 462 401 ----
NM_012255chr20--1169 ----
NM_012257chr7150 1172 ----
NM_012259chr64952 342 177 163 1944 ----
NM_012262chr1124580 4284 4051 3843 3758 3711 2004 1937 1592 1270 387 327 33736 1684 776 13180 --
NM_012281chr71283 1982 --1801
NM_012288chr6165183 5114 4894 4670 4539 4521 4152 3931 3875 2305 2024 2018 1255 225 196 156 64970 4048 2263 1916 1829 866 55067 4951 4930 4641 1206 --
NM_012290chr211466 ------
NM_012294chr763889 2769 2643 2557 203 76 22580 193 11432 11021
NM_012296chr1173376 2916 846 419 291 74 67 23005 103 11526 1315
NM_012297chr411975 21680 771 ----
NM_012300chr542555 2177 1658 186 --1478 1151
NM_012301chr731771 1552 1427 11414 ----
NM_012302chr131022 902 104 --11085 1304
NM_012306chr1293421 3304 3167 2936 2403 2297 2273 2239 1112 32230 1181 841 23063 2346 --
NM_012307chr18182 ----11020
NM_012308chr11111039 871 809 584 574 455 296 194 118 112 68 22494 715 1470 --
NM_012309chr11154645 4194 4168 3881 3636 3575 3367 1398 1363 1132 497 443 412 401 261 23552 1984 11500 --
NM_012310chrX3486 462 446 1201 1247 --
NM_012316chr1164546 4493 3871 3767 3683 3477 2053 1710 1567 1318 1104 981 943 713 603 431 --1754 --
NM_012322chr72347 76 ------
NM_012323chr2211593 --21076 987 --
NM_012324chr223299 277 147 --1759 --
NM_012325chr201127 11108 11258 --
NM_012326chr22249 79 ------
NM_012329chr1731256 1044 609 --21440 391 --
NM_012330chr1031142 261 242 ------
NM_012333chr151479 1294 612 174 99 ------
NM_012334chr583890 3696 3462 3424 2883 403 358 232 --11582 1904
NM_012338chr73930 915 487 21038 975 ----
NM_012382chr574340 4061 3853 2844 1560 1456 831 1896 ----
NM_012392chr13655 81 42 --1111 --
NM_012395chr793300 3240 3163 3109 2808 2373 2326 2292 2264 --12354 --
NM_012398chr193789 733 359 22965 848 ----
NM_012399chr2231821 1801 500 1309 11692 --
NM_012402chr112416 366 ----1299
NM_012405chr193636 3554 1346 1058 950 923 900 877 751 13853 43783 3662 2750 120 --
NM_012408chr202620 95 --1269 --
NM_012412chr73826 222 25 ------
NM_012416chr94819 453 246 97 2135 125 ----
NM_012417chr171407 ----1397
NM_012421chr1--1176 ----
NM_012428chr152145 87 ------
NM_012448chr17112162 2143 1924 1880 1676 1021 687 673 546 240 54 ------
NM_012461chr145636 465 205 194 77 --1538 --
NM_012463chr1241342 1289 148 61 --1599 --
NM_012464chr421028 900 --12361 1517
NM_012465chr1022247 479 12872 2641 302 --
NM_012471chrX51840 1574 182 122 58 ----21899 154
NM_012478chr176873 677 296 287 249 100 138 1313 --
NM_012479chr741928 790 411 389 12189 11750 --
NM_012486chr11103 ------
NM_013227chr153758 666 84 1283 ----
NM_013229chr1242759 1095 471 439 --1679 --
NM_013230chrY31688 1325 700 --1586 --
NM_013231chr1454290 2812 1199 218 43 --23301 3236 1692
NM_013233chr251251 1132 967 396 208 ------
NM_013236chr221389 1480 ----
NM_013242chr16----144 --
NM_013245chr162231 215 ------
NM_013246chr113715 701 120 ------
NM_013252chr742747 2668 475 39 ------
NM_013253chr1111362 2452 178 ----
NM_013255chr7168601 8466 8455 7493 6971 6872 6259 3268 2868 2799 1572 1433 873 627 180 152 37571 3090 1005 --1231
NM_013259chr3192 1294 1288 --
NM_013261chr441352 1063 748 100 --32773 1028 115 --
NM_013269chr1284360 4295 4241 3955 3378 1256 915 198 13505 24259 1459 --
NM_013275chr163813 611 194 1325 ----
NM_013277chr121176 1244 --1107
NM_013279chr1172219 2056 1620 902 611 543 498 1277 1360 --
NM_013282chr1921326 364 ------
NM_013283chr52324 108 ------
NM_013293chr71180 ------
NM_013302chr1663749 3482 2959 1498 780 148 11161 24103 395 --
NM_013305chr183915 115 42 ------
NM_013314chr10155 --143 --
NM_013316chr73799 133 54 ------
NM_013320chr12----1188 --
NM_013323chr1741071 963 821 171 --1259 --
NM_013341chr262806 1191 1128 1102 794 270 ------
NM_013346chrX269 31 ------
NM_013351chr171731 ------
NM_013354chr831076 374 99 ------
NM_013357chr81150 ----1747
NM_013363chr3------1137
NM_013364chrX21947 1365 21996 1970 ----
NM_013365chr221126 --1157 --
NM_013372chr1562820 2806 2414 1037 495 469 --1980 --
NM_013374chr342416 2032 513 304 1804 22392 105 --
NM_013377chr121108 ------
NM_013381chr123955 515 228 1217 ----
NM_013382chr1452109 1816 1772 1603 460 1829 1873 --
NM_013390chr921107 605 11167 11387 1258
NM_013392chr22175 163 ------
NM_013396chr21137 1319 ----
NM_013400chr71992 1849 ----
NM_013401chr113724 606 210 ------
NM_013411chr152479 1847 1736 726 641 1780 ----
NM_013423chrX21237 288 ------
NM_013427chrX21237 288 ------
NM_013433chr1931944 1929 1877 11470 ----
NM_013434chr231741 1721 798 1399 3767 695 467 --
NM_013434chr231741 1721 798 1399 3767 695 467 --
NM_013437chr811112 ------
NM_013438chr951435 1417 583 535 89 --11604 --
NM_013443chr921110 303 --1360 --
NM_013444chrX41052 1000 186 92 ------
NM_013446chr731013 163 86 1999 ----
NM_013448chr141127 ------
NM_013449chr1262260 2132 2115 641 340 175 12302 ----
NM_013450chr22349 106 ------
NM_013951chr242257 1558 960 474 32490 2014 553 ----
NM_013952chr242334 1635 1037 551 32567 2091 630 ----
NM_013953chr242334 1635 1037 551 32567 2091 630 ----
NM_013960chr81518 ------
NM_013989chr14114925 4617 4537 3392 3367 3257 1628 1218 1143 554 206 24631 4095 --14014
NM_013992chr242334 1635 1037 551 32567 2091 630 ----
NM_013993chr62195 176 1271 ----
NM_013994chr62195 176 1271 ----
NM_013999chr1781531 1101 379 266 240 162 153 118 31054 144 25 ----
NM_014000chr1061949 1749 1282 368 214 166 31810 472 143 1388 --
NM_014001chr171173 11464 --182
NM_014005chr562797 2266 2249 2230 924 824 1656 32409 1965 635 --
NM_014007chr931148 1126 789 ------
NM_014010chr93554 510 152 1444 161 138
NM_014011chr232343 965 572 ------
NM_014015chr162619 25 ------
NM_014016chr3--177 ----
NM_014021chr153349 1205 1109 1101 643 23032 1113 ----
NM_014023chr1022571 2233 11052 1844 --
NM_014034chr61260 --1968 11552
NM_014048chr1654925 4120 2114 1180 931 34517 1414 257 11810 --
NM_014057chr981575 1493 997 646 603 365 356 349 ----1582
NM_014059chr133344 272 134 ------
NM_014089chr132220 142 --11447 --
NM_014110chr14884 289 282 252 ----189
NM_014112chr823329 668 13515 ----
NM_014117chr1682528 2507 2264 2199 1773 1056 980 305 11973 21035 764 --
NM_014141chr7104614 4201 3505 3497 3452 1653 1476 584 427 85 --13928 25235 4715
NM_014155chr11136896 6877 6801 5717 5657 4867 2361 2226 2181 1801 1220 867 414 16381 21353 987 --
NM_014166chr132824 158 ------
NM_014171chr22144 43 --1291 --
NM_014178chr14----126 --
NM_014181chr242856 2328 878 826 1780 --1691
NM_014189chr441303 445 336 238 11499 11358 --
NM_014190chr431655 688 590 21851 1159 21710 62 --
NM_014191chr121366 ------
NM_014212chr122182 89 1840 ----
NM_014216chr1421607 137 1229 ----
NM_014217chr161501 578 525 272 209 176 1506 ----
NM_014230chr17139 ------
NM_014231chr1291953 1927 1901 1802 1587 738 472 258 69 2640 119 11699 11547
NM_014232chr1781632 1488 410 403 344 283 263 40 21346 627 2651 422 --
NM_014232chr1781632 1488 410 403 344 283 263 40 21346 627 2651 422 --
NM_014233chr1771973 1893 1634 1404 526 115 74 --11359 --
NM_014234chr61170 ------
NM_014243chr43270 151 52 11957 ----
NM_014245chr33436 430 187 --1810 --
NM_014248chr22----155 --
NM_014250chr2251762 1575 1488 1448 259 ------
NM_014251chr72768 693 --1809 --
NM_014253chrX51924 1592 715 277 177 11663 ----
NM_014258chr202481 42 ------
NM_014264chr4154 ------
NM_014267chr112922 675 1872 ----
NM_014268chr1831381 564 301 21275 290 11444 --
NM_014271chrX1588 1701 ----
NM_014279chr92265 162 --1815 --
NM_014283chr121369 322 ------
NM_014284chr121021 908 ------
NM_014289chrX21204 126 --1120 --
NM_014292chr2261758 612 408 321 91 58 21346 304 ----
NM_014294chr821486 1381 ------
NM_014299chr1982044 1757 1500 650 577 471 385 228 ------
NM_014305chr133220 123 95 --1256 --
NM_014309chr22155068 4913 4457 4447 3905 3894 3840 3582 1861 1504 870 817 700 611 586 13994 --15339
NM_014319chr1211573 1656 ----
NM_014331chr4177655 7433 6459 6241 6089 5993 5855 5429 5309 5168 4926 2938 2686 2345 2314 2176 298 24848 1079 23005 2697 16062
NM_014333chr1141849 1003 621 432 ------
NM_014335chr1521116 1100 --152 --
NM_014342chr1131480 1382 1320 ------
NM_014345chr65952 935 274 177 165 1395 ----
NM_014360chr142711 90 --1630 --
NM_014368chr951899 1793 1616 168 162 1291 1850 --
NM_014372chr142052 764 377 369 ------
NM_014374chr71992 1849 ----
NM_014376chr582250 2082 1976 584 520 481 258 168 2301 196 ----
NM_014388chr1135527 5493 4986 4521 4389 4187 4121 3758 3684 2138 2019 1402 794 35863 2328 1488 ----
NM_014390chr73445 401 49 ------
NM_014393chr842308 1770 370 301 1221 ----
NM_014396chr741723 686 189 37 1193 1351 --
NM_014397chr931422 1321 65 21438 1408 ----
NM_014399chr72172 49 ------
NM_014408chr1192 ----1136
NM_014409chr13972 847 114 1821 ----
NM_014415chr341499 1384 1220 407 ------
NM_014418chr1472016 1889 1502 1459 1452 1334 117 21375 388 ----
NM_014423chr5104690 4527 4503 3640 2186 1838 1657 1134 779 115 21186 35 13466 --
NM_014426chr202531 251 ------
NM_014431chr1071583 1544 1144 577 367 357 348 ------
NM_014432chr631459 588 145 ------
NM_014437chr1153 ------
NM_014445chr322293 436 --2119 31 --
NM_014452chr63973 186 178 2895 299 1213 --
NM_014454chr621100 867 ----1292
NM_014456chr1041703 1677 1350 224 1516 ----
NM_014458chr151279 1273 1118 881 470 ------
NM_014470chr121746 ------
NM_014488chr112526 94 ------
NM_014491chr71762 ------
NM_014494chr1662073 1998 1858 414 348 108 2712 494 21893 797 --
NM_014501chr19140 ------
NM_014517chr311458 --11232 --
NM_014547chr152819 196 ------
NM_014547chr152819 196 ------
NM_014554chr1282250 1784 1694 1674 1664 694 564 163 11431 12293 --
NM_014562chr21293 1102 ----
NM_014563chrX21809 108 --31392 688 357 --
NM_014570chr221184 ------
NM_014572chr1321724 1672 1142 ----
NM_014573chr1721563 721 11244 ----
NM_014574chr1421044 322 ----11587
NM_014577chr221253 ------
NM_014584chr1411103 11412 ----
NM_014585chr231173 1139 386 ------
NM_014586chr2144092 3908 3793 1577 34504 2997 1207 ----
NM_014587chr163591 266 199 11190 ----
NM_014588chr203736 251 92 ------
NM_014591chr1051322 1090 1045 224 78 ------
NM_014592chr56824 623 149 135 98 27 --1196 --
NM_014603chr1751686 1444 663 651 500 11125 ----
NM_014604chr175707 618 196 157 39 --1538 --
NM_014607chr231900 1674 350 --2513 187 12065
NM_014608chr152198 47 ------
NM_014612chr9199 11345 11220 --
NM_014613chr572696 2307 2040 992 953 745 435 31228 1019 944 --1297
NM_014616chr343428 2348 1060 42 --23518 385 --
NM_014620chr125692 657 196 122 66 ------
NM_014621chr22210 27 1216 ----
NM_014630chr15102816 2676 2468 2457 1217 972 801 751 416 343 33856 3463 931 13200 --
NM_014634chr22123515 3205 2664 2592 2414 1339 1107 637 452 387 118 52 22742 2729 ----
NM_014636chr9124176 3458 3299 2736 2711 1362 1355 1335 979 875 261 200 24142 1240 44123 4059 2945 1727 1525
NM_014637chr821370 558 1201 11240 --
NM_014646chr1893192 3035 2998 2490 2458 2085 2034 1286 69 13019 ----
NM_014647chr1622155 1913 --11547 --
NM_014660chr731071 365 87 1954 ----
NM_014661chr1073100 1550 1275 1250 753 505 296 ------
NM_014662chr221462 ------
NM_014666chr52433 356 ------
NM_014667chr332383 1900 1678 22354 688 ----
NM_014671chr731185 508 103 ------
NM_014674chr3133666 3504 3463 3183 3175 2923 2782 2767 1390 1365 1332 964 177 22875 330 ----
NM_014676chr151642 1364 1072 439 334 ------
NM_014677chr861111 1057 1031 1011 912 891 ------
NM_014679chr1111027 1442 21218 989 --
NM_014680chr17------1130
NM_014682chr841726 896 428 261 12272 ----
NM_014683chr1741999 1898 1887 208 1697 ----
NM_014686chr1931850 693 414 12179 --12251
NM_014689chr2139 ------
NM_014690chr783069 2691 2338 2256 2099 1115 426 134 32830 2071 416 12460 --
NM_014700chr1661588 1468 1380 615 413 359 ------
NM_014701chr1553016 2217 2198 1182 896 122 --1841
NM_014702chr643105 2811 2149 91 33296 2726 1291 --1120
NM_014705chr711373 ------
NM_014707chr722287 483 ------
NM_014711chr162478 428 21776 1503 ----
NM_014712chr162411 179 ------
NM_014713chr21366 182 ----
NM_014715chr113953 669 180 ------
NM_014720chr1051745 1731 1481 1345 446 ------
NM_014721chr6127068 6445 5956 5337 5150 5047 1509 881 776 692 563 211 12085 --11325
NM_014723chr20133196 3083 2924 2795 2706 2311 2298 1125 711 697 470 426 74 22005 299 ----
NM_014726chr1761387 1152 285 185 40 31 --11223 --
NM_014729chr8--286 24 1435 --
NM_014730chr12215189 5082 5059 4867 4824 4764 4672 4601 4198 4064 3948 3650 3539 3445 3429 3419 1062 894 813 241 212 44913 4328 3879 1023 14182 --
NM_014730chr12215189 5082 5059 4867 4824 4764 4672 4601 4198 4064 3948 3650 3539 3445 3429 3419 1062 894 813 241 212 44913 4328 3879 1023 14182 --
NM_014731chr2061801 1335 495 477 392 80 --11349 --
NM_014733chr53805 550 202 --11926 --
NM_014735chrX71538 1507 1452 1417 765 729 280 ------
NM_014739chr644010 3306 1402 327 --11636 --
NM_014741chr1191819 1426 806 747 540 527 490 152 125 32107 1825 494 ----
NM_014743chr482533 1185 1114 836 740 648 594 143 42878 422 384 104 --160
NM_014746chr2114061 3681 3327 1698 888 825 783 624 330 288 50 --33218 1547 393 11618
NM_014747chr1175674 5284 5120 5054 4917 4537 4117 3981 3784 3687 3650 2048 1234 1172 697 588 476 54418 4005 1596 1586 806 24437 484 15556
NM_014751chr822091 767 --1383 --
NM_014752chr1151377 536 445 377 28 11787 --11343
NM_014755chr2104122 3365 3154 1511 1451 1400 1382 1298 1286 1105 168 13247 --
NM_014756chr114387 355 323 175 ------
NM_014757chr591804 1761 1665 1644 1620 953 944 914 52 --12362 --
NM_014761chr1651006 988 146 70 37 1177 ----
NM_014764chr121140 21232 466 ----
NM_014765chr112076 1480 1718 --
NM_014767chr1083554 2712 2368 1260 990 700 489 317 13333 12247 --
NM_014772chr1883329 3129 2995 2841 2732 2637 686 287 13601 23434 2211 --
NM_014774chr152559 2241 2202 2062 280 ------
NM_014776chr1282960 2608 2427 1242 1100 1058 766 543 12937 11986 176
NM_014779chr351096 1068 791 304 159 171 ----
NM_014781chr81419 ------
NM_014783chr1521345 1216 --11191 --
NM_014784chr131102 810 381 1400 1975 --
NM_014786chr112191 60 --11260 --
NM_014787chr142067 842 737 630 1176 ----
NM_014791chr91253 ------
NM_014795chr221345 1274 --1481 --
NM_014798chr1761509 1288 1267 734 583 474 --21780 1691 --
NM_014800chr73882 463 156 1473 ----
NM_014803chr1052909 785 725 358 321 22577 2563 22299 645 --
NM_014810chr163438 2608 1447 1358 1270 887 22820 1419 12635 --
NM_014812chr12756 285 --11588 1503
NM_014819chr532336 775 747 21929 1553 1271 --
NM_014820chr311985 2600 51 11901 --
NM_014822chr4------1121
NM_014824chr114596 397 212 96 11531 ----
NM_014826chr1133850 3791 3459 3450 2652 1609 1563 1377 395 158 69 61 30 --1204 --
NM_014827chr11575 21476 257 ----
NM_014828chr141208 --11018 11583
NM_014830chr12103536 3430 2875 2805 2776 2674 2579 1573 1261 734 1314 12830 --
NM_014832chr131604 21380 450 ----
NM_014835chr2042082 2025 873 314 21875 199 ----
NM_014836chr1031227 442 212 ------
NM_014838chr2252667 2593 2142 167 115 42797 2239 1866 129 1623 --
NM_014839chr152273 1980 924 881 490 ----11602
NM_014840chr1272740 2729 1005 837 689 418 180 ----11092
NM_014841chr62201 130 11177 1400 --
NM_014847chr11206 ------
NM_014848chr1552583 1065 955 861 589 32657 1758 609 11803 22015 271
NM_014849chr11279 ------
NM_014850chr3104788 4304 3547 1615 1569 1482 1456 1268 320 291 1334 24111 3470 --
NM_014853chr1711251 --11500 --
NM_014857chr1187 ------
NM_014859chr172268 107 21184 300 ----
NM_014860chr251908 743 735 704 659 1616 ----
NM_014868chr122616 229 127 ----
NM_014870chr144459 3271 784 656 1733 14604 --
NM_014871chr12131 ------
NM_014873chr184539 4153 3375 3300 1186 560 470 46 21610 855 23763 1307 13266
NM_014875chr1--1752 ----
NM_014876chr2241748 1602 675 602 31939 1531 765 --1380
NM_014877chr17107196 6317 5619 5591 5402 4963 2855 2018 1861 1480 47412 2581 959 910 36009 2553 2503 17583
NM_014883chr461927 1586 784 460 387 288 1532 ----
NM_014887chr133720 219 203 ------
NM_014892chr6149 1526 ----
NM_014893chrY41987 1826 881 427 22167 1576 ----
NM_014897chr1762297 2080 2001 551 538 338 126 33099 2568 97 --
NM_014900chr221012 313 ------
NM_014902chr2061370 1220 994 529 414 123 ------
NM_014903chr1222111 314 --11844 --
NM_014904chr1053927 3735 752 683 226 23674 1458 1115 --
NM_014905chr24715 685 517 489 ------
NM_014906chr1773951 3880 2941 1448 1336 581 30 --13608 --
NM_014909chr14103910 3229 3186 3163 2568 2416 918 376 155 35 1465 13941 --
NM_014912chr1033288 2881 310 1564 12603 --
NM_014914chr251166 439 140 106 59 --1371 --
NM_014918chr1511425 1512 ----
NM_014920chr662951 2620 1485 1007 821 27 1956 32530 1341 51 11362
NM_014921chr19152916 2899 2862 2828 2742 2026 1197 1062 1020 876 847 615 599 437 323 12505 2316 110 --
NM_014923chr1342276 282 245 239 1695 ----
NM_014924chr1462750 2715 992 923 614 49 ------
NM_014925chr124754 685 248 200 --2365 234 --
NM_014926chr371151 1034 949 797 743 173 117 1749 ----
NM_014932chr341622 1573 1462 1313 11377 --11333
NM_014934chr1333805 3640 2757 12539 13542 --
NM_014936chr632129 918 715 1721 1978 --
NM_014937chr1011243 ------
NM_014938chr1252435 2167 2015 1935 496 41855 1625 815 112 31916 455 222 --
NM_014939chr1811225 --11191 --
NM_014944chr141117 1065 224 59 1195 ----
NM_014945chr591414 1280 643 597 514 482 326 175 81 21291 57 21889 294 --
NM_014946chr262389 1904 1143 955 475 418 22767 2677 ----
NM_014947chr122957 1135 --22506 1018 --
NM_014949chr11760 --139 --
NM_014952chr1552025 583 553 471 213 ------
NM_014961chr461687 827 568 369 286 189 11611 1460 --
NM_014962chr2031789 508 274 1877 1871 --
NM_014964chr1762058 1749 1536 523 204 60 11875 ----
NM_014969chr12820 454 1255 ----
NM_014974chr1031669 263 52 ------
NM_014978chr103720 695 279 --1371 11202
NM_014982chr1464934 3751 1342 1141 669 150 24324 898 --1325
NM_014988chr472739 2526 2184 1142 979 310 123 --11133 12165
NM_014989chr621355 335 ------
NM_014990chr14--197 ----
NM_014991chr452955 2797 2317 254 239 1105 32292 305 54 --
NM_014992chr142875 290 ------
NM_014996chr32209 146 ----1365
NM_014997chr762892 2843 2145 1948 634 249 --32912 821 178 --
NM_015000chr1232261 2164 1142 --13088 --
NM_015001chr13924 905 268 ------
NM_015002chr1272197 1804 1518 1430 676 193 166 22247 2163 ----
NM_015008chr373638 3079 2712 2479 801 522 417 13011 11433 --
NM_015009chr31312 ------
NM_015013chr1163 ------
NM_015015chr195831 742 657 492 261 --11930 --
NM_015020chr16113702 3523 3294 2858 2676 1388 1218 1132 689 610 330 13557 21472 211 --
NM_015023chr1111552 1522 1464 1452 1424 1214 1133 677 647 615 431 ------
NM_015024chr841376 1334 907 266 1106 11123 --
NM_015032chr1351947 978 515 425 22 11821 ----
NM_015033chr941266 894 510 133 2900 142 21062 811 12223
NM_015035chr20136033 5638 5230 5111 4228 4112 4086 2046 1961 1932 1628 720 246 24057 976 177 --
NM_015039chr184111 3852 3753 3259 2681 1526 72 63 21299 81 23699 194 12971
NM_015042chr15154299 3969 3670 3660 3635 3608 3521 1489 1380 1341 911 879 608 239 195 44289 3854 3215 1504 23717 2892 --
NM_015044chr1632737 2066 803 32865 2555 2284 32674 2571 505 --
NM_015045chr1012281 ----1861
NM_015051chr943377 3120 2982 143 ------
NM_015052chr741213 481 198 75 1495 190 --
NM_015055chr1182883 2658 2032 964 920 712 594 552 2776 447 21029 428 --
NM_015060chr7--1194 ----
NM_015061chr91918 ------
NM_015064chr12103023 2675 2648 2609 2254 1098 989 910 821 610 32704 2613 1087 22698 894 22719 923
NM_015068chr771525 964 719 705 645 618 124 23950 3933 --1291
NM_015069chr16126 --1243 --
NM_015072chr142398 177 ------
NM_015073chr1961725 1471 747 608 305 61 ------
NM_015074chr1114747 3702 3209 3152 1926 1742 1021 179 148 120 89 21680 1517 13448 13678
NM_015075chrX62096 2050 1623 1574 1447 354 42104 1988 1599 184 ----
NM_015076chr653561 3534 3282 1005 164 11078 24004 2842 --
NM_015080chr113935 97 71 ----11014
NM_015082chr552397 2092 1879 655 483 3789 512 316 --11873
NM_015087chr1352654 2251 518 215 130 12307 11999 --
NM_015091chr142757 61 ------
NM_015092chr1674068 3621 2852 2843 1873 995 468 12897 ----
NM_015093chr631611 504 282 ------
NM_015094chr22104333 4135 3897 3337 1807 1694 1220 1116 1016 668 44640 4299 781 553 13602 --
NM_015097chr332304 1521 1473 --11864 --
NM_015099chr174706 466 170 99 ------
NM_015100chr181908 1838 1717 1565 811 803 624 614 21338 635 1603 --
NM_015102chr1188 ------
NM_015107chrX42448 399 183 61 41592 1496 210 49 11516 --
NM_015113chr1732050 334 105 32130 418 280 ----
NM_015116chr1331347 390 300 ----11661
NM_015125chr192486 449 1108 ----
NM_015129chrX41707 718 247 75 ------
NM_015132chr731313 767 159 ----1301
NM_015133chr1651309 1141 1120 222 100 --11426 --
NM_015137chr852528 2333 2300 704 185 --12154 1952
NM_015138chr15112111 2026 1009 937 821 652 494 475 235 66 58 22413 483 1810 --
NM_015143chr431275 1070 564 1327 --1209
NM_015144chr1621345 1077 22459 381 23787 3254 --
NM_015147chr253081 2172 617 382 148 21157 229 12641 --
NM_015149chr171750 1450 1419 894 656 528 213 11690 ----
NM_015150chr32931 127 ------
NM_015151chr211332 --11032 --
NM_015153chr6--1628 ----
NM_015155chr1022329 2175 --2155 60 --
NM_015156chr1483632 3362 2625 858 632 321 284 97 --23427 1152 --
NM_015158chr92834 530 ------
NM_015162chr15157 177 ----
NM_015163chr1431251 508 180 --1385 11833
NM_015170chr822080 1538 1772 1778 --
NM_015171chr161110 ------
NM_015172chr111654 11188 ----
NM_015176chr131165 165 135 11473 ----
NM_015178chr83712 135 65 1427 12376 --
NM_015184chr31190 1691 ----
NM_015185chrX52730 2387 959 910 557 22750 2661 --1529
NM_015187chr41943 2711 23 ----
NM_015192chr2032840 2572 1103 1247 157 --
NM_015197chr1472923 2279 2150 2138 1180 687 596 11068 ----
NM_015199chr321972 1958 22089 945 ----
NM_015200chr431989 234 203 11783 21768 123 --
NM_015206chr1523750 3739 43885 2778 2714 321 ----
NM_015208chr1821515 1363 ----32506 1505 797
NM_015209chr132274 377 181 1646 21888 248 --
NM_015215chr152935 820 492 311 206 ------
NM_015216chr531087 482 61 1443 11290 --
NM_015225chr9102952 2866 2650 2096 2029 1200 926 845 726 158 12587 2423 189 23104 2856
NM_015227chr2193255 2466 2185 980 801 665 411 293 132 22301 708 --23182 3115
NM_015231chr112952 673 ----1323
NM_015233chr1342736 2513 1072 271 22403 1031 1595 --
NM_015234chr621309 1143 ------
NM_015236chr42228 133 ------
NM_015245chr672321 2257 2064 2039 1115 960 765 12131 12574 --
NM_015246chr1641851 1833 822 139 1234 ----
NM_015247chr16104964 4575 2146 1890 1870 1336 1204 1192 1160 458 1710 --14330
NM_015250chr921859 1565 11595 ----
NM_015252chr23977 604 25 1164 ----
NM_015256chr52582 569 ------
NM_015265chr222463 585 12141 ----
NM_015267chr1231654 1425 295 1227 163 --
NM_015268chr3294 81 ------
NM_015270chr1282390 2244 1671 1540 936 930 892 215 1248 ----
NM_015271chr474350 4252 4112 3962 3715 859 477 13385 24089 206 21254 122
NM_015272chr1621644 1481 21727 226 11929 --
NM_015275chr1232044 530 181 ------
NM_015277chr1841282 1147 471 191 ------
NM_015278chr683214 2406 2216 2208 688 377 166 23 23254 2358 11362 --
NM_015282chr262969 2686 2038 1227 662 63 ------
NM_015284chr1102128 2103 2085 2027 1988 1895 1882 1675 564 517 11762 --12075
NM_015286chr151998 1261 ----
NM_015288chr543662 3388 2597 173 11319 13295 --
NM_015289chr1551882 1834 762 598 43 --11940 --
NM_015291chr163399 2486 1190 275 143 116 42363 1075 968 510 --32189 1144 31
NM_015294chr17----11083 --
NM_015296chr132375 278 1185 ----
NM_015299chr14103961 3696 3427 2526 917 892 788 728 373 193 33794 2721 711 23933 3300 --
NM_015305chr1471951 1822 1552 1287 605 207 31 21616 157 ----
NM_015308chr113767 348 229 1847 --1723
NM_015310chr8117340 7154 6598 6225 5473 5269 3108 2736 2489 1230 323 47791 6588 6191 1764 11838 --
NM_015313chr1183891 3682 3633 3430 1906 1457 708 579 11287 1230 --
NM_015314chr731788 1649 273 --1432 --
NM_015315chr5113167 2945 2781 2519 2434 2183 2169 861 640 548 221 33391 747 213 ----
NM_015316chr143979 257 201 1171 ----
NM_015317chr252695 2527 2463 2339 1113 ------
NM_015320chr221001 355 11018 1401 --
NM_015321chr19114759 4304 4294 3759 3030 1892 1748 1486 1347 1277 426 11450 34178 4127 4034 --
NM_015326chr172708 2071 1848 782 730 541 178 52080 1818 1159 742 666 ----
NM_015327chr131253 466 45 ------
NM_015328chr752693 2321 2188 2026 1221 294 56 ----
NM_015332chr751425 1002 408 335 323 33429 3238 1069 12915 11399
NM_015335chr1262298 1724 999 231 40 23 ----1112
NM_015336chr1242709 2421 925 885 ------
NM_015338chr2081847 1514 1429 1262 689 238 116 99 ----1344
NM_015339chr201299 --1694 --
NM_015343chr171126 ------
NM_015347chr12102840 2769 2731 2539 2170 2134 1982 1958 1876 354 ------
NM_015349chr662250 2210 2007 1043 1011 998 ------
NM_015353chr1731929 1130 803 1687 22402 967 --
NM_015355chr17--11533 ----
NM_015361chr2146 1720 1750 --
NM_015365chrX62870 1702 995 539 46 34 --13629 --
NM_015375chr164848 4121 3773 3752 1410 381 14876 24523 3665 129
NM_015381chr2251534 1404 1277 811 462 175 ----
NM_015382chr142703 518 ------
NM_015387chr2--21746 1503 1459 --
NM_015388chr62279 33 ------
NM_015396chr331278 243 201 ------
NM_015397chr981864 1649 1512 1495 391 383 345 44 --21561 292 --
NM_015401chr1231023 240 52 --1255 --
NM_015404chr9--158 ----
NM_015415chr1--1173 ----
NM_015423chr1131509 327 196 ------
NM_015429chr311059 --1386 --
NM_015435chr81443 11027 ----
NM_015436chr442964 2608 420 56 --1681 --
NM_015443chr1761096 950 570 539 517 419 ------
NM_015444chr33258 109 55 ------
NM_015447chr91179 ------
NM_015455chr5123499 3392 3291 3050 2927 1642 1513 907 656 625 603 117 1326 ----
NM_015457chr111355 ------
NM_015458chr894893 4583 4263 4229 3826 3564 1617 560 58 1370 --23753 328
NM_015460chr3----1203 --
NM_015461chr18278 64 ------
NM_015464chr72921 364 ------
NM_015465chr52789 739 1492 1551 --
NM_015469chr93301 280 191 --171 1259
NM_015470chr261200 1001 951 230 125 58 --2287 73 --
NM_015477chr152337 114 --1742 --
NM_015481chr1261087 1027 929 230 224 106 ------
NM_015483chr72973 746 1804 ----
NM_015484chr12810 798 ------
NM_015496chr82302 294 ------
NM_015503chr161585 ------
NM_015508chr341557 1241 250 190 ------
NM_015509chr1231363 1222 1138 2444 136 21354 1149 --
NM_015515chr171245 --1224 --
NM_015520chr362741 2529 2447 1715 1032 361 ------
NM_015526chr19--21478 313 ----
NM_015527chr163775 522 40 ------
NM_015530chr22919 603 ----2872 852
NM_015532chr1552584 581 541 164 55 --12780 --
NM_015534chr1295 87 134 ----
NM_015535chr264128 2878 1678 1201 640 124 12850 33760 3338 983 --
NM_015542chr10--11044 ----
NM_015548chr61306 ------
NM_015549chr14--1461 ----
NM_015550chr792730 2274 2244 1147 1138 770 377 133 38 22716 1414 ----
NM_015553chr6145054 4999 4740 4628 4467 3585 3411 3392 1318 1298 744 682 299 21 34721 1864 315 14140 23561 50
NM_015554chr1532700 2647 2628 ----12611
NM_015564chr552955 1364 984 976 643 33323 2870 394 1548 22546 1157
NM_015565chr2162294 2043 1791 1512 897 203 11629 ----
NM_015567chr135518 510 414 408 217 --1364 --
NM_015569chr194756 4725 4394 4101 3024 1940 1771 925 619 --14597 14706
NM_015570chr7--11309 ----
NM_015571chr632502 48 30 ------
NM_015575chr283134 2773 2422 2309 2284 521 90 31 --32379 2298 2257 --
NM_015576chr352577 2278 2259 2169 917 12243 ----
NM_015578chr1911368 144 ----
NM_015584chr1741429 1207 533 52 1238 178 --
NM_015589chr141128 ------
NM_015601chr1021031 939 ------
NM_015602chr141837 1822 1537 55 ------
NM_015607chr1130 ------
NM_015610chr722415 2314 1571 22281 783 1340
NM_015630chr2----11131 --
NM_015635chr951426 878 707 344 191 ------
NM_015638chr204578 558 236 98 ------
NM_015640chr153958 2106 1246 866 165 13501 14888 --
NM_015642chr31113 ------
NM_015646chr121835 --1110 1178
NM_015651chr93523 348 170 31956 1616 77 21734 531 --
NM_015652chr101489 ------
NM_015657chr21306 ------
NM_015678chr1321197 1076 ------
NM_015680chr25618 603 592 578 274 ------
NM_015686chrX62504 2319 2232 2085 949 401 11923 ----
NM_015690chr22592 172 1263 ----
NM_015691chrX12899 22908 1823 ----
NM_015695chr6132154 1888 1852 1836 1822 1804 1729 536 489 479 177 132 65 --1459 --
NM_015697chr42342 245 ------
NM_015711chr193827 669 656 ------
NM_015716chr176695 586 199 182 80 43 1291 --1644
NM_015719chr192244 149 1155 ----
NM_015726chr191869 1849 1312 1172 1137 745 593 248 64 2649 579 41298 641 573 423 1567
NM_015831chr71332 ------
NM_015833chr2162195 1974 1585 609 559 235 ------
NM_015850chr862264 2133 2120 351 172 98 1188 11843 --
NM_015852chr753461 666 600 516 348 ------
NM_015865chr1821063 106 ------
NM_015866chr121546 607 ------
NM_015872chr151724 1716 1708 1451 1257 ------
NM_015874chr41485 --1566 --
NM_015878chr8195 ------
NM_015879chr18108276 6045 5747 5638 3430 2843 2717 2643 1344 1184 55209 3115 3081 1489 1222 37631 2809 2341 --
NM_015881chr1111362 2452 178 ----
NM_015889chr222280 112 ------
NM_015898chr1972313 1845 1652 940 899 883 214 22485 583 ----
NM_015902chr81800 ------
NM_015906chr154610 3967 3722 3032 278 ------
NM_015912chr852489 2227 1940 943 526 22098 949 --11750
NM_015913chr16658 566 520 214 208 137 ------
NM_015926chr3177 ----268 56
NM_015933chr3--161 ----
NM_015948chr61398 ----163
NM_015955chr22126 37 ------
NM_015980chr531473 1450 643 ------
NM_015981chr5103126 2916 2499 2183 1038 421 410 280 224 76 --1101 12603
NM_015982chr172425 98 ------
NM_015990chr411070 ------
NM_015995chr15145379 4765 4566 4045 3974 3447 2094 1349 1276 1235 815 700 494 56 ------
NM_015999chr12297 148 --1186 1174
NM_016003chr722415 2314 1571 22281 783 1340
NM_016009chr1124925 4564 4247 4222 4001 3756 3628 3321 1736 1651 421 221 ------
NM_016018chr81765 ----11764
NM_016019chr721076 714 ----1419
NM_016021chr652737 2707 2626 2072 1161 12288 1299 --
NM_016022chr15878 774 730 291 92 --1702 --
NM_016025chr1652005 1699 1272 222 201 ----1241
NM_016032chrX31183 998 296 1259 1500 --
NM_016037chr111115 --1885 --
NM_016041chr171315 ------
NM_016048chr54923 635 319 77 1305 --1855
NM_016057chr1251102 1087 993 953 88 31195 34 25 1917 --
NM_016059chr64892 790 182 27 ------
NM_016063chr62770 568 ------
NM_016072chr121259 12183 ----
NM_016073chr152423 152 ------
NM_016075chr1312584 ------
NM_016076chr142342 2068 698 108 32970 2792 589 11954 --
NM_016078chr171769 2720 176 ----
NM_016083chr653636 3048 1182 856 345 --12792 1188
NM_016096chr811346 12113 139 1358
NM_016099chr821037 147 3459 359 83 ----
NM_016107chr51856 11051 ----
NM_016125chr171571 ------
NM_016127chr8157 ------
NM_016129chr4--1325 ----
NM_016131chr252325 2159 794 743 48 ------
NM_016132chr1552719 2427 879 666 510 1307 ----
NM_016141chr32809 777 ------
NM_016147chr113320 268 234 31083 857 88 ----
NM_016152chr321201 383 ------
NM_016156chr1132215 2170 39 2464 135 ----
NM_016162chr124226 212 139 129 1846 1316 --
NM_016169chr10143267 3261 2810 2790 2643 2637 2557 2476 2331 1175 1106 642 614 606 ----11159
NM_016192chr21250 ------
NM_016201chr362357 2301 721 104 61 34 21920 494 ----
NM_016205chr41933 ------
NM_016206chr3197817 7280 7271 6074 3373 3349 2980 2971 2454 2354 1821 1811 1646 1594 1393 872 834 785 506 27346 1608 45673 3358 1859 242 38419 6926 6281
NM_016224chr672111 1915 1679 743 415 288 40 --22077 1511 --
NM_016227chr121369 322 ------
NM_016231chr1711679 144 ----
NM_016248chr1364000 3829 3718 3528 1240 486 --31334 1281 1261 13295
NM_016252chr21884 ------
NM_016255chr643182 2352 278 258 22294 1110 1971 --
NM_016257chr1103256 2696 2330 1058 1021 995 436 328 109 67 11391 13001 --
NM_016260chr2176589 6061 5971 5935 5869 5863 5704 5676 5669 5582 5072 5036 2948 1972 1275 852 80 --34668 2461 1118 14714
NM_016269chr44947 765 321 66 ------
NM_016271chr1842372 1774 804 791 ------
NM_016272chr2292563 2552 2457 2432 2425 1910 1740 770 115 ------
NM_016275chr331987 233 27 ------
NM_016279chr52334 72 ------
NM_016281chr1251033 231 202 125 103 --1110 --
NM_016283chr5132 ------
NM_016284chr164795 732 199 88 --198 --
NM_016287chr122047 1800 21619 521 2821 233 --
NM_016289chr242292 2029 1562 70 ------
NM_016297chr283736 3315 3048 1060 661 606 412 400 13674 ----
NM_016303chrX1381 ------
NM_016315chr2--11822 ----
NM_016320chr1121112 90 ------
NM_016322chr943170 2356 582 213 12938 --12036
NM_016337chr141324 ------
NM_016351chr7--196 ----
NM_016353chr851913 1627 844 740 665 2272 148 11888 --
NM_016358chr53444 434 59 ------
NM_016374chr11567 ------
NM_016374chr11567 ------
NM_016376chr1764220 3460 2956 2726 709 278 33067 3006 2872 ----
NM_016395chr151110 ------
NM_016396chr15142884 2643 2529 2206 2170 2157 2110 2049 1145 1036 818 649 419 366 1959 ----
NM_016410chr91101 170 ----
NM_016422chr113729 693 114 22388 1058 1674 --
NM_016424chr1731974 1475 152 ------
NM_016431chr223299 277 147 --1759 --
NM_016436chr205928 829 536 236 221 ----1549
NM_016441chr222250 1798 ------
NM_016442chr551959 1621 1505 698 569 --12114 --
NM_016451chr11178 ------
NM_016453chr31670 2270 253 ----
NM_016456chr15683 318 305 137 81 ------
NM_016463chr52117 29 ------
NM_016476chr171262 1368 ----
NM_016483chr34323 277 229 221 ------
NM_016484chrX2554 457 ------
NM_016489chr73179 99 27 1172 ----
NM_016492chr17--1128 ----
NM_016499chr11----2525 209 --
NM_016507chr17133101 2280 2218 2160 957 859 846 793 776 754 684 552 35 1558 13065 1980
NM_016513chr662951 2620 1485 1007 821 27 1956 32530 1341 51 11362
NM_016516chr21242 1648 ----
NM_016519chr42484 25 ------
NM_016522chr1131675 1078 335 21332 1286 ----
NM_016525chr92858 781 ------
NM_016526chr1182412 2235 2221 2173 2147 888 526 141 22022 1545 1376 --
NM_016530chr1562995 2884 773 745 313 45 11609 --13914
NM_016531chr464185 3229 645 518 187 48 1328 11116 --
NM_016542chrX2657 361 --1533 --
NM_016544chr2103836 3100 1426 1259 1218 1165 1121 717 605 522 --150 13518
NM_016545chr12881 279 --1337 --
NM_016569chr1221543 623 ----11235
NM_016574chr111917 1112 1893 --
NM_016577chr3134545 4368 4006 3742 3322 2966 1492 1280 708 698 588 182 122 1597 24379 1348 1520
NM_016587chr7--1265 ----
NM_016588chr62148 100 ------
NM_016592chr2021331 1206 --124 --
NM_016596chr1231023 240 52 --1255 --
NM_016598chr351297 963 267 225 106 ------
NM_016603chr5--1223 ----
NM_016604chr531260 833 286 11156 3510 298 143 21071 133
NM_016605chr552534 2128 1946 1874 898 11884 142 --
NM_016607chrX1658 156 ----
NM_016618chr22419 21 1156 ----
NM_016620chr111439 ------
NM_016621chr11104349 3770 3621 3152 1558 1536 1045 656 471 456 64255 4120 3979 3843 3748 771 1281 13826
NM_016623chr82129 116 ------
NM_016625chr3185 ------
NM_016626chr1831598 690 612 ------
NM_016631chr211349 ------
NM_016644chr5171 ------
NM_016652chr2051780 1748 1156 603 58 ------
NM_016654chr1541121 979 493 453 ------
NM_016823chr171882 1853 ----
NM_016824chr1021612 158 1299 --11629
NM_016829chr32307 176 ------
NM_016834chr1763547 3221 3003 1507 1356 864 43888 3794 3029 210 12878 12836
NM_016835chr1763547 3221 3003 1507 1356 864 43888 3794 3029 210 12878 12836
NM_016836chr21618 ------
NM_016839chr21618 ------
NM_016841chr1763547 3221 3003 1507 1356 864 43888 3794 3029 210 12878 12836
NM_016929chr684035 3792 1761 1455 1351 1222 602 386 53391 1845 1616 1116 1074 24320 1363 13357
NM_016936chr1621802 573 ----11754
NM_016946chr133211 401 194 12790 1516 --
NM_017409chr122588 41 2517 313 1139 --
NM_017410chr1241106 962 871 788 2925 804 1465 --
NM_017412chr81334 ------
NM_017413chrX82505 2164 2132 1813 1774 966 139 99 1287 ----
NM_017415chr5103503 3130 3104 1284 1253 1226 703 615 440 125 32779 819 798 11792 --
NM_017420chr1453514 3402 3193 2469 2441 21514 709 ----
NM_017423chr421698 397 1878 ----
NM_017426chr4--1184 ----
NM_017437chr1421704 612 12186 22097 491 --
NM_017440chr121247 ------
NM_017447chr2154214 3949 547 452 209 1585 13832 --
NM_017449chr161590 1556 635 405 265 27 1360 21362 1150 --
NM_017450chr1741444 1067 996 82 ------
NM_017452chr2041376 1300 563 282 ------
NM_017453chr2041376 1300 563 282 ------
NM_017454chr2041376 1300 563 282 ------
NM_017455chr152145 87 ------
NM_017456chr1771857 1678 1297 593 519 234 51 ------
NM_017483chr281289 1124 1018 890 476 366 57 37 ------
NM_017488chr261624 1459 1353 1225 392 372 ------
NM_017519chr61310 ------
NM_017522chr1------11246
NM_017544chrX1869 ----1744
NM_017548chr322149 2037 11880 1561 --
NM_017551chr1031835 364 120 22145 1998 ----
NM_017553chr15----1344 --
NM_017554chr321627 873 22094 1751 --134
NM_017558chr161370 1408 1295 --
NM_017575chr1791587 1535 1523 1182 643 595 302 291 126 1367 ----
NM_017582chr141503 1351 640 272 ------
NM_017586chr962037 1986 770 742 412 35 21724 144 ----
NM_017594chr933276 1120 524 ------
NM_017596chr1174490 4222 4152 4079 3949 3861 3576 2927 2916 1794 1297 985 714 697 126 59 47 53754 3480 3298 1784 341 13557 12838
NM_017610chr1511332 ------
NM_017612chr121188 ------
NM_017617chr92457 34 ------
NM_017622chr173615 196 121 --1269 165
NM_017626chr1051777 1347 364 266 164 ----1449
NM_017628chr455142 4571 4318 2102 425 52124 1386 1251 452 161 13242 13321
NM_017629chr121549 276 ------
NM_017632chr41315 1142 ----
NM_017633chr673793 3722 3044 2863 2523 1366 281 23736 3173 1217 --
NM_017634chr851871 1850 1469 1237 558 166 ----
NM_017635chr1111472 ----1287
NM_017637chr9159034 9028 8825 8712 8462 8251 7507 7353 6276 6229 6180 6033 6016 5747 32 26375 6088 16298 26850 1655
NM_017640chr63852 576 111 ------
NM_017643chr1772967 2657 2522 2421 1979 1252 1235 ------
NM_017644chr373507 1935 1118 1100 748 174 135 24842 773 14882 --
NM_017650chr7125937 5240 4465 3866 1152 932 860 514 259 173 67 54 11136 --11409
NM_017655chr151645 1574 1292 1072 562 1296 ----
NM_017658chr1423423 355 --24444 564 --
NM_017664chr1331090 411 121 --1872 --
NM_017666chrX3875 231 125 3526 235 221 31968 1762 1407 --
NM_017668chr164732 104 93 48 ------
NM_017672chr152916 307 1867 ----
NM_017686chr13756 385 121 1348 --1310
NM_017693chr13--1140 ----
NM_017694chr25831 444 379 244 194 11442 ----
NM_017709chr183403 2819 2782 1627 1312 453 418 53 21098 255 ----
NM_017714chr202936 259 ------
NM_017715chr77706 690 661 540 527 481 185 2246 192 ----
NM_017719chr331831 1597 190 1126 1415 --
NM_017730chr32261 55 ------
NM_017734chr1166 ------
NM_017737chr132140 1921 731 ------
NM_017740chr1621832 178 11181 --1369
NM_017741chr472792 2725 1986 951 914 814 777 --2694 102 --
NM_017742chr1831866 1570 420 ------
NM_017744chr151776 987 880 745 560 21540 779 11663 --
NM_017745chrX1114 ------
NM_017753chr911017 1711 ----
NM_017758chr172951 430 2964 491 ----
NM_017772chr651603 1339 440 433 142 11188 11118 --
NM_017778chr811163 ------
NM_017779chr162770 2725 779 480 458 160 --12503 --
NM_017784chr32918 392 125 ----
NM_017787chr10122454 2317 1116 962 953 819 789 644 188 134 91 81 22678 1765 ----
NM_017789chr21223 --1774 --
NM_017791chr1441187 1105 598 62 ------
NM_017799chr1451969 1806 1683 1540 1238 11830 ----
NM_017801chr342597 2193 2027 1027 ------
NM_017811chr962777 2715 2113 1947 1166 564 22874 2640 --22892 748
NM_017813chr8115836 5724 5250 4912 4595 3626 1971 1754 1531 1112 346 25171 2138 35798 5410 2046 --
NM_017824chr1012192 1278 1876 --
NM_017826chr132694 27 --1281 --
NM_017848chrX94453 4402 3790 3189 3035 1719 1477 1299 493 23759 107 --11269
NM_017851chr1541124 899 351 210 ------
NM_017857chr111238 ------
NM_017860chr13843 598 46 1761 ----
NM_017873chr972719 2386 2377 2312 1186 888 708 11969 ----
NM_017880chr22322 131 ------
NM_017893chr1071321 1169 1000 538 355 115 28 ------
NM_017902chr10165627 5502 5467 5449 4604 4135 3978 2252 1979 1669 1576 808 761 404 229 120 55383 4504 4454 1892 1004 ----
NM_017907chr113366 334 26 137 ----
NM_017910chr21323 ------
NM_017915chr1251041 781 744 300 246 --1392 --
NM_017919chr9124840 4496 4309 4183 1820 1679 1583 1466 808 625 585 262 --34929 2077 613 --
NM_017923chr41110 --1324 --
NM_017935chr43238 162 85 ------
NM_017938chrX51976 1530 411 216 94 11344 11489 --
NM_017944chr1122063 482 ------
NM_017953chr12972 138 --1211 --
NM_017954chr731556 1354 642 11599 --11638
NM_017957chr1731090 343 217 11593 1552 --
NM_017969chr2154 ------
NM_017978chr5--187 ----
NM_017982chr111228 21194 896 127 --
NM_017987chr104851 493 485 83 ------
NM_017988chr12--1222 ----
NM_017994chr762729 2694 1972 992 888 792 2831 524 ----
NM_018008chr31260 ------
NM_018010chr361618 1143 1128 1122 206 200 21045 433 11458 --
NM_018027chr10112724 2290 2244 2202 2043 1281 1107 1055 870 849 228 22021 840 ----
NM_018028chr1961249 912 503 341 268 73 11204 1130 --
NM_018045chr182742 2710 2686 2631 2340 2243 2093 696 11899 12254 --
NM_018061chr11103 ----1571
NM_018062chr24417 406 388 206 1159 ----
NM_018067chr11126 1430 ----
NM_018068chr8163 1118 ----
NM_018070chr12227 159 ------
NM_018072chr11182 ------
NM_018078chr43658 407 61 ------
NM_018079chr2----1138 --
NM_018084chr223277 990 32286 2029 681 12326 --
NM_018085chr1107683 6003 5373 2459 1566 819 774 555 248 83 1531 ----
NM_018086chr231636 1629 1343 31747 1313 83 ----
NM_018087chr11170 ------
NM_018092chr1651574 1328 310 153 91 ------
NM_018094chrX169 ------
NM_018099chr12168 ------
NM_018107chr142367 322 4712 295 257 81 163 --
NM_018116chr11213 1469 ----
NM_018119chr161282 ------
NM_018121chr1063126 2212 2004 1221 1101 518 12556 12159 --
NM_018126chr421577 1193 ------
NM_018128chr171521 ----1227
NM_018133chr322162 450 11732 11948 --
NM_018137chr121180 949 1452 1962 1160
NM_018150chr15903 811 652 612 575 ------
NM_018155chr363142 3042 2976 2666 2147 240 13165 ----
NM_018157chr1263036 2764 2587 2202 621 22 22416 384 12778 --
NM_018159chrX51687 305 207 189 169 --11379 --
NM_018164chr121244 ------
NM_018168chr1421129 54 1425 1237 --
NM_018172chr1131053 100 60 --11354 --
NM_018176chr451370 1181 410 263 43 11455 ----
NM_018178chr191957 1647 702 652 632 558 256 190 21 31803 330 154 ----
NM_018181chr1851762 1645 636 230 119 11930 ----
NM_018182chr17102214 2068 1956 1925 1840 1723 1686 1452 796 310 62125 911 699 537 261 234 --12207
NM_018184chr331998 1852 1599 11555 ----
NM_018195chr1132174 424 77 ------
NM_018200chr1592567 2270 2180 1771 1018 795 716 563 454 --1245 --
NM_018203chr13695 290 49 1156 ----
NM_018206chr161482 130 ----
NM_018216chr1----124 --
NM_018218chr22412 250 1602 2392 38 --
NM_018227chr441245 1100 695 283 12709 11256 --
NM_018231chr166948 935 762 648 258 125 1276 ----
NM_018240chr17874 842 703 697 249 235 214 ------
NM_018243chr443863 3059 1565 1514 33303 1399 466 --12847
NM_018244chr203480 227 211 ------
NM_018247chr642886 1921 1055 675 ------
NM_018254chr121992 1656 22307 347 ----
NM_018263chr251928 1804 1779 1032 773 12375 22101 1769 --
NM_018266chr32995 420 ------
NM_018287chr103392 356 100 ------
NM_018290chr431205 1020 328 ------
NM_018299chr832671 2231 1296 12236 22698 2401 --
NM_018307chr171925 --1354 --
NM_018313chr321973 532 --12462 --
NM_018315chr42441 272 1314 --11358
NM_018325chr941652 1385 380 106 ------
NM_018326chr73746 700 38 ------
NM_018327chr202208 84 ------
NM_018330chr1011552 --11718 --
NM_018351chr1264522 4143 4033 3979 3757 21 23792 3588 1724 --
NM_018360chrX2264 49 ------
NM_018362chr1123323 2573 22505 390 23274 121 --
NM_018364chr1133240 3069 2936 2840 1633 1193 1153 706 584 549 289 266 231 33742 3637 938 ----
NM_018371chr841027 387 145 39 ------
NM_018372chr1------1269
NM_018374chr765216 4169 3976 1804 1412 56 21929 238 23685 1469 1165
NM_018375chr1471915 1534 1188 754 657 580 278 ------
NM_018383chr22109 31 ------
NM_018387chr91129 ------
NM_018388chrX31177 288 69 133 ----
NM_018400chr11103933 3771 3681 3594 3229 3121 1103 598 312 270 63631 2990 2909 1599 1120 559 --1395
NM_018403chr3113918 3902 3893 2716 2635 2592 2552 911 333 316 157 13072 23231 1056 1776
NM_018416chr1272499 1998 1663 1634 1051 194 172 ------
NM_018423chr1221201 80 ------
NM_018424chr941924 1840 197 21 1497 11349 --
NM_018433chr2------149
NM_018439chr1821812 769 32578 1897 948 --11777
NM_018440chr8128459 8086 7948 7659 6865 6498 3191 2027 704 657 401 145 28222 5658 28324 1166 --
NM_018444chr842173 2129 831 27 1795 1690 --
NM_018448chr1211249 ------
NM_018452chr6_random33528 515 91 --13726 11353
NM_018457chr123571 519 46 ------
NM_018462chr35789 724 335 297 90 --1349 --
NM_018464chr101333 ------
NM_018471chr21163 172 ----
NM_018482chr852614 2481 1947 590 383 22158 257 ----
NM_018489chr13532 441 68 1220 ----
NM_018509chr1721451 1192 ------
NM_018534chr27545 532 444 142 117 103 78 ------
NM_018553chr1731697 1564 226 ----11351
NM_018566chr155053 3600 1952 1908 1608 11896 ----
NM_018569chr431094 391 301 ------
NM_018571chr22473 41 --1602 --
NM_018584chr121037 894 11226 ----
NM_018593chr62511 61 ------
NM_018638chr1294710 4503 4377 4358 3471 2147 1895 1526 481 ----123
NM_018640chr1232764 694 460 1964 12557 --
NM_018644chr116736 721 578 537 521 57 1207 11370 --
NM_018649chr10--1210 1155 --
NM_018650chr111700 --12035 --
NM_018652chr151255 ------
NM_018660chr872909 2425 2261 2014 787 777 158 --2828 395 1309
NM_018667chr1681869 997 979 961 937 717 600 529 --1319 --
NM_018683chr202417 173 1304 --11675
NM_018689chr15112408 2287 2059 1953 1933 1803 1656 1029 616 266 51 1282 22239 241 --
NM_018691chr541105 1042 961 442 31046 771 192 --11122
NM_018695chr531822 430 379 ----21684 542
NM_018704chr121983 1658 ----11831
NM_018710chr831109 881 282 ------
NM_018712chr111289 1420 ----
NM_018713chr1--1192 ----
NM_018718chr771800 1475 545 441 348 157 131 12119 ----
NM_018719chr721124 928 11132 ----
NM_018834chr53937 398 109 1791 ----
NM_018837chr203743 344 133 ------
NM_018840chr20------1346
NM_018841chr183985 3695 3406 1334 1016 976 674 30 33423 3071 522 12453 --
NM_018890chr721101 435 11068 ----
NM_018896chr17--133 ----
NM_018898chr54563 261 203 58 22288 211 22058 314 --
NM_018899chr54563 261 203 58 22288 211 22058 314 --
NM_018900chr54563 261 203 58 22288 211 22058 314 --
NM_018901chr54563 261 203 58 22288 211 22058 314 --
NM_018902chr54563 261 203 58 22288 211 22058 314 --
NM_018903chr54563 261 203 58 22288 211 22058 314 --
NM_018904chr54563 261 203 58 22288 211 22058 314 --
NM_018905chr54563 261 203 58 22288 211 22058 314 --
NM_018906chr54563 261 203 58 22288 211 22058 314 --
NM_018907chr54563 261 203 58 22288 211 22058 314 --
NM_018908chr54563 261 203 58 22288 211 22058 314 --
NM_018909chr54563 261 203 58 22288 211 22058 314 --
NM_018910chr54563 261 203 58 22288 211 22058 314 --
NM_018911chr54563 261 203 58 22288 211 22058 314 --
NM_018912chr5111717 1684 1667 1395 1299 644 493 483 389 58 38 ------
NM_018913chr5111717 1684 1667 1395 1299 644 493 483 389 58 38 ------
NM_018914chr5111717 1684 1667 1395 1299 644 493 483 389 58 38 ------
NM_018915chr5111717 1684 1667 1395 1299 644 493 483 389 58 38 ------
NM_018916chr5111717 1684 1667 1395 1299 644 493 483 389 58 38 ------
NM_018917chr5111717 1684 1667 1395 1299 644 493 483 389 58 38 ------
NM_018918chr5111717 1684 1667 1395 1299 644 493 483 389 58 38 ------
NM_018919chr5111717 1684 1667 1395 1299 644 493 483 389 58 38 ------
NM_018920chr5111717 1684 1667 1395 1299 644 493 483 389 58 38 ------
NM_018921chr5111717 1684 1667 1395 1299 644 493 483 389 58 38 ------
NM_018922chr5111717 1684 1667 1395 1299 644 493 483 389 58 38 ------
NM_018923chr5111717 1684 1667 1395 1299 644 493 483 389 58 38 ------
NM_018924chr5111717 1684 1667 1395 1299 644 493 483 389 58 38 ------
NM_018925chr5111717 1684 1667 1395 1299 644 493 483 389 58 38 ------
NM_018926chr5111717 1684 1667 1395 1299 644 493 483 389 58 38 ------
NM_018927chr5111717 1684 1667 1395 1299 644 493 483 389 58 38 ------
NM_018928chr5111717 1684 1667 1395 1299 644 493 483 389 58 38 ------
NM_018929chr5111717 1684 1667 1395 1299 644 493 483 389 58 38 ------
NM_018948chr111113 --1118 --
NM_018951chr7----1883 --
NM_018963chr2111466 2397 271 ----
NM_018970chr711166 12996 1637 --
NM_018976chr122475 278 ------
NM_018977chrX2432 372 --1717 --
NM_018979chr1292439 2105 1843 1818 1744 546 481 443 251 ------
NM_018994chr12454 113 ------
NM_018999chr1064927 4736 4293 1122 771 698 21002 246 11848 14420
NM_019000chr521374 1304 ------
NM_019001chr374327 4315 4255 3756 1719 1328 1072 23835 39 11639 --
NM_019004chr762307 2127 1544 616 472 381 11803 ----
NM_019008chr2283729 3277 2963 2808 2598 1186 390 214 33806 2845 1510 32776 185 49 --
NM_019036chr631238 828 258 ------
NM_019042chr71324 1987 ----
NM_019050chr421624 534 ------
NM_019063chr251982 1711 796 461 24 11754 12067 --
NM_019064chr17--2612 211 1802 --
NM_019072chr553745 3282 1522 1430 1360 13566 11598 --
NM_019080chr1331519 969 599 --1570 --
NM_019084chr1011667 --12145 1115
NM_019087chr55644 282 257 221 130 1139 --11465
NM_019091chr21796 1879 ----
NM_019096chr64963 845 418 145 --3979 857 806 --
NM_019098chr851736 1573 714 295 280 --1205 --
NM_019102chr7170 ------
NM_019102chr7170 ------
NM_019106chr22133199 2990 2868 2588 2397 1304 1249 1234 789 783 754 748 290 1685 1386 1428
NM_019114chr962233 2227 2052 1656 1644 1011 12263 1953 --
NM_019116chr16