TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-5197-3p
miRNA Sequence: AAGAAGAGACUGAGUCAUCGAAU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr5----1857 --
NM_000021chr1461047 987 898 692 409 35 1924 ----
NM_000024chr52435 215 ------
NM_000038chr521323 1283 ----1781
NM_000044chrX2169 56 ------
NM_000045chr62412 63 ------
NM_000051chr1182821 2560 2332 2164 1031 815 685 205 33508 3417 693 --1794
NM_000052chrX123411 3318 3285 3203 2528 2329 857 623 610 159 98 74 33251 2233 1375 33205 2827 907 13414
NM_000055chr31365 ------
NM_000061chrX1306 --2153 36 --
NM_000081chr131872 1639 702 1329 ----
NM_000084chrX96288 5823 5445 1918 1425 817 451 175 126 35451 2345 499 66127 6022 5853 5367 688 395 1635
NM_000088chr1711008 11053 ----
NM_000089chr75704 660 104 63 52 ------
NM_000090chr22929 274 --2622 165 --
NM_000092chr284097 3113 2980 1777 1736 1408 1384 880 23497 1339 1705 --
NM_000093chr982252 2124 2007 1741 1707 1532 892 827 2900 386 22111 964 --
NM_000096chr31954 ------
NM_000097chr331186 992 109 1768 1966 --
NM_000104chr252917 1083 547 539 169 12711 42919 1085 761 86 --
NM_000108chr731709 317 27 11609 11283 --
NM_000109chrX62293 2043 2019 1739 1719 562 12306 12159 --
NM_000110chr141049 396 213 87 2115 59 2767 215 --
NM_000112chr5105294 5189 5069 5005 4245 4207 1789 966 760 721 35483 1948 505 35479 1475 762 13660
NM_000115chr1362312 1989 1683 890 465 31 11637 ----
NM_000125chr6144271 4064 3807 3779 3638 3524 3016 2648 2604 1603 278 234 181 174 13732 24218 1220 --
NM_000133chrX61006 538 506 353 124 82 21322 531 11261 --
NM_000138chr1522140 1846 --22331 904 --
NM_000139chr1152671 2641 2586 2495 211 12195 --12422
NM_000141chr1031224 1127 1095 --1502 --
NM_000142chr411126 11185 11501 --
NM_000158chr33456 89 49 ------
NM_000161chr1451852 1495 1328 391 192 ------
NM_000163chr562396 2351 2108 2084 894 136 ------
NM_000165chr661354 1148 1092 647 434 297 --11548 --
NM_000167chrX51210 679 576 468 439 11778 --1474
NM_000168chr7122829 2787 2562 2539 2351 2338 2320 2297 2170 969 696 324 32765 2343 333 23039 247 12708
NM_000170chr9----2482 431 --
NM_000173chr172388 120 1411 ----
NM_000175chr19----2236 46 --
NM_000176chr573768 3488 2646 1324 567 346 200 1383 ----
NM_000189chr261589 1513 833 543 43 31 ------
NM_000192chr1271508 1342 1179 454 443 325 309 ------
NM_000196chr161545 ------
NM_000210chr252303 1669 843 709 399 --1848 --
NM_000212chr1782384 2010 1747 1681 918 841 333 289 11700 ----
NM_000214chr2031666 1156 608 --11543 --
NM_000217chr12184964 4805 4739 4656 4321 4300 4184 3986 3659 3452 3403 2121 2074 1762 1560 766 714 658 2957 252 23349 768 --
NM_000218chr113966 684 192 ------
NM_000222chr441978 1888 1463 70 --3567 75 44 --
NM_000223chr171123 ------
NM_000227chr182306 87 1292 ----
NM_000232chr463102 2932 2671 2643 2102 154 1686 12057 22267 295
NM_000238chr71152 --1302 --
NM_000240chrX61935 1767 1492 838 672 423 11483 ----
NM_000248chr372478 2138 953 710 588 454 82 --12054 1688
NM_000253chr42770 755 ------
NM_000259chr1595764 5275 5037 4377 2473 1633 1009 652 184 --34923 1937 1016 --
NM_000264chr973287 3011 2671 1340 1263 745 61 --33092 1061 747 12225
NM_000266chrX3936 398 223 ------
NM_000267chr1783212 2139 1153 765 391 204 157 46 41114 783 488 208 2895 190 --
NM_000268chr2253681 3470 1268 1082 1066 13738 23481 2320 --
NM_000271chr183678 566 232 ------
NM_000276chrX72261 2232 2143 1813 795 614 235 11726 ----
NM_000278chr1072261 1859 1698 1563 838 740 558 ------
NM_000280chr1121013 791 ------
NM_000281chr102284 27 ------
NM_000284chrX71990 1896 1845 1756 1619 555 517 --11498 --
NM_000293chr162642 329 ------
NM_000297chr481950 1914 1825 1298 819 290 186 131 31365 779 462 --1510
NM_000304chr1721081 887 ------
NM_000313chr321089 31 ------
NM_000314chr1053105 2579 1133 1054 895 --1128 --
NM_000319chr1221178 1033 ------
NM_000321chr1341613 722 353 259 21769 1108 2505 119 --
NM_000329chr12914 809 --1916 --
NM_000330chrX52276 1521 1506 280 248 ------
NM_000332chr6216407 6398 6369 6163 5800 5517 5023 4693 2474 2244 2136 1771 1710 1497 1393 1241 1199 984 961 606 100 47075 6987 4972 1892 66216 6103 5025 4891 2107 429 --
NM_000333chr341045 897 726 335 ------
NM_000335chr321698 1409 11448 31768 843 408 --
NM_000337chr5146623 6030 5254 5101 4922 4658 4085 2646 1708 1680 1149 1091 540 409 ----1415
NM_000338chr1531111 1090 172 1822 1177 --
NM_000340chr371554 1452 1369 963 493 468 396 21498 293 ----
NM_000346chr17101972 1812 1588 1481 1422 1380 1302 1294 305 128 --21981 574 --
NM_000353chr1641264 1191 270 143 21233 1204 ----
NM_000354chrX1246 ------
NM_000362chr2273335 1213 398 369 199 102 67 22999 886 22900 278 11105
NM_000368chr974483 4099 4066 3082 1523 599 285 --23586 712 --
NM_000369chr1471931 1562 1410 1395 1359 1336 617 --21342 716 --
NM_000378chr1131148 329 111 2375 278 ----
NM_000384chr2130 ------
NM_000396chr1239 30 1445 ----
NM_000399chr1021204 168 1393 ----
NM_000405chr541779 1501 359 50 11690 1368 --
NM_000408chr262817 2339 1001 769 749 223 --42748 2121 807 294 --
NM_000411chr2181307 1301 1266 1216 332 162 117 81 ------
NM_000425chrX2587 462 --1464 --
NM_000428chr1432620 2476 1853 --1885 --
NM_000430chr1793756 3528 3125 3074 2529 510 469 420 349 --132 --
NM_000435chr196866 345 264 249 91 74 --1103 --
NM_000439chr572296 2074 2057 2049 2010 438 42 1751 1127 11765
NM_000441chr751441 927 696 584 72 22332 100 --12127
NM_000447chr11157 --199 --
NM_000448chr1173069 2975 2920 2662 2494 759 457 2985 523 12108 12160
NM_000449chr1111375 1355 1044 1021 955 534 473 457 302 176 94 1988 ----
NM_000451chrX92144 2002 1923 1854 1768 1674 708 440 423 ------
NM_000461chr3104339 4270 3716 3620 3233 3097 1673 1372 988 514 23147 2810 2854 72 --
NM_000462chr1551717 1645 1301 587 304 11329 ----
NM_000474chr73676 514 133 ------
NM_000478chr11696 1303 1701 --
NM_000480chr1181661 1493 1354 1255 1181 616 554 343 --1356 --
NM_000484chr213955 784 203 11056 1883 --
NM_000489chrX112739 2649 2476 2427 1264 1093 792 691 497 206 171 33340 1115 50 11095 --
NM_000492chr721117 471 ------
NM_000493chr651112 818 238 228 112 ------
NM_000495chrX41043 926 876 778 1207 --11007
NM_000503chr891857 1757 1713 1631 1557 1502 1318 1243 417 --11633 --
NM_000522chr74949 216 160 154 ------
NM_000523chr22139 133 --21203 826 --
NM_000525chr1111206 --11080 11503
NM_000530chr121090 273 11072 ----
NM_000533chrX91608 1582 1499 1379 748 443 332 165 83 11228 1110 1194
NM_000544chr6_cox_hap193283 2934 2388 1361 1234 1222 1111 1015 1003 11032 33137 916 27 --
NM_000555chrX207832 7650 7622 6976 6960 5814 5579 5513 5286 5264 3046 2773 2355 2040 1432 1397 1359 1022 990 509 12987 86517 5692 5522 2894 1947 1281 926 444 --
NM_000560chr13702 505 465 1256 ----
NM_000573chr182304 1872 719 520 486 475 346 181 22062 570 --11754
NM_000575chr241016 731 234 142 11042 21018 896 --
NM_000578chr221515 544 ------
NM_000582chr42398 358 1420 ----
NM_000587chr561362 1194 1036 980 100 93 --1187 --
NM_000594chr61639 --186 --
NM_000595chr6----2625 623 --
NM_000596chr7--1182 ----
NM_000598chr72237 198 --21402 1076 --
NM_000599chr2134603 4532 4217 3892 3068 2992 1410 1051 1021 1015 1000 829 236 23937 1696 34320 3450 2837 --
NM_000601chr71158 146 ----
NM_000609chr1043072 2748 2368 1239 --22248 533 --
NM_000610chr1182928 2536 2518 1980 1850 715 686 112 1130 1137 32642 972 789
NM_000611chr11107037 6886 6414 6313 5493 2749 2261 2160 1395 1098 15671 27108 1285 11054
NM_000612chr1132362 704 511 --1518 --
NM_000615chr1182578 2193 1958 1083 891 686 666 145 22549 677 32160 902 900 12791
NM_000617chr1272328 2148 1631 1617 1556 462 21 21868 1506 ----
NM_000618chr12156224 5651 4980 4528 4473 2635 2616 2328 2172 1906 1828 1718 1567 1182 745 26113 230 35289 4475 809 21831 1741
NM_000618chr12156224 5651 4980 4528 4473 2635 2616 2328 2172 1906 1828 1718 1567 1182 745 26113 230 35289 4475 809 21831 1741
NM_000620chr1241906 1699 503 326 11627 --1213
NM_000633chr1874885 4869 3858 1924 1896 1666 582 --15053 --
NM_000651chr182304 1872 719 520 486 475 346 181 22062 570 --11754
NM_000675chr221819 ------
NM_000678chr201800 --2227 225 --
NM_000679chr5----1155 --
NM_000680chr8----176 --
NM_000683chr4--1511 ----
NM_000685chr3199 --1169 1146
NM_000685chr3199 --1169 1146
NM_000686chrX4304 179 117 106 --1108 --
NM_000689chr93169 90 30 --195 --
NM_000693chr1571642 1573 1141 1131 534 460 106 11739 ----
NM_000701chr1166 ------
NM_000719chr12115246 5000 4548 4445 2630 2162 1799 1381 1372 885 751 --65931 4616 4562 2523 727 704 11767
NM_000721chr142680 1871 908 226 22644 2624 42101 1992 1888 32 22705 321
NM_000723chr173447 403 317 ------
NM_000724chr1041699 1528 245 180 1532 ----
NM_000726chr231351 587 249 ------
NM_000729chr31215 ------
NM_000735chr63192 99 40 ------
NM_000788chr441057 925 525 176 --2323 178 --
NM_000801chr204991 295 189 98 1745 11129 --
NM_000806chr521784 566 --11845 --
NM_000807chr41284 ------
NM_000808chrX31027 793 716 ------
NM_000809chr4279038 8559 8105 7827 7801 7742 7464 7411 6999 6872 6747 6433 6209 5932 5693 5609 3603 3394 3223 3111 2643 2297 2174 1527 666 441 53 59288 8115 7423 6573 2250 68496 7059 3659 3657 3228 1640 12752
NM_000811chr5259 43 --1216 1552
NM_000813chr5115546 5329 4310 4127 2078 1838 1723 1367 1257 1053 468 11538 33729 1772 1664 --
NM_000814chr1543009 695 597 318 12698 12694 13844
NM_000816chr51590 1635 ----
NM_000817chr22184 40 --1984 11033
NM_000818chr102474 216 ------
NM_000824chr41276 1824 ----
NM_000826chr462589 2443 2054 1794 1025 208 2848 342 1262 12029
NM_000827chr5122586 2563 2451 2400 2030 1885 1709 977 824 465 381 180 11028 42353 1792 1024 208 --
NM_000828chrX42039 877 461 222 1522 12041 --
NM_000829chr1142046 1929 1740 733 1634 ----
NM_000831chr195651 4033 1025 972 962 763 553 373 205 ------
NM_000833chr1621009 379 11559 1144 --
NM_000834chr1281296 1099 801 417 402 348 214 196 --11138 --
NM_000838chr642680 2359 1908 630 32796 1928 1760 1334 --
NM_000840chr71454 ------
NM_000842chr118679 512 502 491 484 275 201 189 1205 ----
NM_000844chr351070 1059 377 286 76 --1806 --
NM_000857chr43102 82 49 2488 137 ----
NM_000859chr571600 1591 1270 582 563 223 146 11724 11534 --
NM_000860chr461527 1489 1138 1077 496 324 1139 ----
NM_000861chr362610 1929 1899 1734 1028 585 1898 1575 --
NM_000864chr1111119 1096 958 793 239 232 155 141 81 62 31 ------
NM_000865chr6--1192 ----
NM_000868chrX92522 2512 946 710 303 287 71 57 21 ------
NM_000870chr551206 629 237 149 96 11373 31520 556 519 --
NM_000875chr15136757 6748 6545 5741 4999 4882 4613 2828 1832 1723 1395 1147 1128 37042 2453 1509 25870 1402 --
NM_000876chr631394 920 447 --21257 582 --
NM_000891chr17103614 3423 3254 2657 1068 1059 655 593 583 324 23131 2702 33519 3517 1278 --
NM_000895chr121156 --137 --
NM_000899chr1283505 3000 2685 1684 811 607 463 384 11392 23094 1642 --
NM_000900chr12----128 --
NM_000901chr472297 2025 1031 761 696 564 444 11796 21922 1700 --
NM_000902chr363080 2343 2249 1275 1075 655 1675 11297 --
NM_000903chr1621092 98 --2598 293 --
NM_000912chr893431 2795 1360 1049 921 778 675 276 32 13346 21319 215 --
NM_000917chr104996 912 764 21 1173 ----
NM_000919chr52543 532 --1242 --
NM_000921chr122132 56 ------
NM_000922chr11--1435 ----
NM_000927chr73575 467 421 ------
NM_000933chr2021739 1648 1482 ----
NM_000934chr172219 64 --1680 --
NM_000935chr351045 986 953 484 341 11232 ----
NM_000938chr4----1136 --
NM_000941chr72371 274 ------
NM_000944chr452314 1771 1654 761 696 32380 1604 724 1220 --
NM_000945chr272027 1941 1703 528 282 109 40 1292 ----
NM_000949chr53589 148 42 2954 923 ----
NM_000950chrX83400 2417 2368 1376 1217 717 506 140 1471 12431 --
NM_000958chr52478 149 1269 ----
NM_000959chr193795 3218 3206 2921 2888 1187 973 765 707 ----23990 3226
NM_000962chr962742 2299 957 599 180 94 --32336 2025 777 --
NM_000963chr172275 2216 1863 1707 435 256 101 ------
NM_000964chr17----149 --
NM_000965chr33850 259 194 ------
NM_000972chr9121 ------
NM_000983chr151582 1364 1305 175 168 21618 1574 2525 341 --
NM_000984chr17148 ------
NM_000990chr1173759 2508 1358 1045 868 439 67 2935 872 1832 --
NM_001001132chr2141498 1002 969 539 11158 1930 --
NM_001001323chr1293065 3052 2787 2654 2449 2104 1259 349 243 --12870 12793
NM_001001331chr362478 1929 1750 1735 642 408 --3438 436 192 --
NM_001001342chr1071505 1017 506 397 353 322 30 1560 11042 --
NM_001001344chrX62414 2355 2181 2116 358 280 22007 344 ----
NM_001001389chr1182928 2536 2518 1980 1850 715 686 112 1130 1137 32642 972 789
NM_001001390chr1182928 2536 2518 1980 1850 715 686 112 1130 1137 32642 972 789
NM_001001391chr1182928 2536 2518 1980 1850 715 686 112 1130 1137 32642 972 789
NM_001001392chr1192974 2582 2564 2026 1896 1888 761 732 158 1176 1183 32688 1018 835
NM_001001395chr1242073 936 783 53 42307 2166 1130 47 ----
NM_001001396chr1124089 4053 3980 3824 3539 2909 1555 1327 853 812 366 290 24097 2849 ----
NM_001001419chr5164994 4506 4473 4302 4168 4085 3555 2039 2032 1931 1893 1790 1209 1003 655 623 54774 3666 843 582 118 34119 1648 1624 --
NM_001001420chr5164994 4506 4473 4302 4168 4085 3555 2039 2032 1931 1893 1790 1209 1003 655 623 54774 3666 843 582 118 34119 1648 1624 --
NM_001001433chr2073081 2945 2473 1977 1069 566 408 1726 ----
NM_001001436chr162686 557 ------
NM_001001481chr8103418 3218 3149 2836 2824 2739 1372 1064 1052 992 12706 12699 --
NM_001001484chr1052418 1953 1642 961 295 1595 12420 --
NM_001001522chr111429 --1431 --
NM_001001523chr13521 120 79 1998 ----
NM_001001549chr7102883 2781 2568 2516 2389 2140 1963 1935 1911 1789 11747 22575 2573 12395
NM_001001550chr7102883 2781 2568 2516 2389 2140 1963 1935 1911 1789 11747 22575 2573 12395
NM_001001555chr7102883 2781 2568 2516 2389 2140 1963 1935 1911 1789 11747 22575 2573 12395
NM_001001557chr882224 2038 1678 1448 780 708 274 262 ------
NM_001001560chr221157 --1531 --
NM_001001567chr21--1193 ----
NM_001001568chr21--1193 ----
NM_001001571chr21--1193 ----
NM_001001572chr21--1193 ----
NM_001001573chr21--1193 ----
NM_001001574chr21--1193 ----
NM_001001575chr21--1193 ----
NM_001001576chr21--1193 ----
NM_001001577chr21--1193 ----
NM_001001579chr21--1193 ----
NM_001001580chr21--1193 ----
NM_001001581chr21--1193 ----
NM_001001582chr21--1193 ----
NM_001001584chr21--1193 ----
NM_001001585chr21--1193 ----
NM_001001664chr2124028 3786 3507 2775 2673 1577 1311 1220 1058 936 432 171 ------
NM_001001668chr1933317 3180 3130 ------
NM_001001740chr11278 ------
NM_001001740chr11278 ------
NM_001001787chr1--1178 ----
NM_001001790chr92355 101 ------
NM_001001852chr222313 179 ------
NM_001001890chr21124269 4253 3606 2998 2941 2866 2827 2821 2797 2760 1074 859 13299 33468 653 631 --
NM_001001933chr12486 179 ------
NM_001001936chr1061123 994 786 767 274 167 ------
NM_001001938chr993337 3326 1613 1540 1279 1238 624 474 313 33270 1138 87 13342 --
NM_001001974chr1062298 1812 1635 751 290 130 12161 22209 1817 --
NM_001001995chrX41260 1218 547 176 11786 21515 1447 11659
NM_001002009chr7--1205 1169 --
NM_001002010chr7--1205 1169 --
NM_001002026chr381698 683 628 544 429 335 248 83 11550 ----
NM_001002032chr173196 40 30 1107 ----
NM_001002233chr831999 740 341 1183 --21941 630
NM_001002243chr24910 367 242 33 --1582 --
NM_001002252chr12128 --1227 --
NM_001002255chr62130 120 ------
NM_001002257chr2142870 2350 2276 2265 1436 1290 1278 1217 1097 876 792 762 473 298 1923 23221 619 --
NM_001002275chr15573 520 447 239 124 1458 1222 --
NM_001002295chr1021078 905 ------
NM_001002814chr863794 3644 2664 906 740 341 23651 183 --1630
NM_001002838chrX51447 1390 1207 241 76 11798 31900 1357 403 --
NM_001002843chr1521089 389 --1970 --
NM_001002860chr14104417 4249 3952 3318 3291 3058 1539 447 315 274 44648 4452 1835 1316 34600 1707 522 11710
NM_001002909chr1782132 2111 2015 1587 905 747 342 193 --41642 1631 1589 228 --
NM_001002919chr21126 ------
NM_001003406chr2233029 2852 701 --13052 --
NM_001003652chr18268245 7989 7878 7449 6842 6674 6640 6309 5987 5910 5577 5569 5368 3121 2921 2868 2808 2664 2634 2454 1550 1500 1093 648 548 475 55941 5640 2941 2848 1660 97991 7305 7163 6418 6314 3242 1784 737 49 --
NM_001003665chr141228 820 101 89 --33552 167 91 --
NM_001003674chr18137034 6867 6841 6794 5912 4965 4704 2310 1755 1631 994 648 446 15636 35136 4967 4698 16928
NM_001003675chr18137034 6867 6841 6794 5912 4965 4704 2310 1755 1631 994 648 446 15636 35136 4967 4698 16928
NM_001003676chr112267 259 --1758 --
NM_001003679chr162221 1740 1579 882 550 490 12071 ----
NM_001003681chr2241567 1485 338 253 --11763 --
NM_001003688chr461191 1133 831 817 801 437 ------
NM_001003698chr62548 329 --21744 1682 --
NM_001003699chr62548 329 --21744 1682 --
NM_001003712chr12133906 3644 3480 3023 2895 2703 2504 1594 1208 807 538 409 144 34026 2936 154 11124 --
NM_001003786chr172509 118 --1554 --
NM_001003787chr172509 118 --1554 --
NM_001003788chr172509 118 --1554 --
NM_001003790chr84763 707 288 244 2617 184 ----
NM_001003791chr84763 707 288 244 2617 184 ----
NM_001003792chr351235 959 767 488 332 --21237 443 --
NM_001003793chr351235 959 767 488 332 --21237 443 --
NM_001003800chr983498 3134 2683 2524 1326 1220 1046 572 1297 11162 --
NM_001003895chrY--156 ----
NM_001003937chr271576 1490 1432 1124 1104 692 500 11534 ----
NM_001003940chr1553819 3263 2396 1029 287 --1861 --
NM_001003942chr1553819 3263 2396 1029 287 --1861 --
NM_001003943chr1563823 3267 2400 1033 291 22 --1865 --
NM_001004019chr31373 --1375 --
NM_001004023chr11158 ------
NM_001004065chr9123981 3823 3813 3795 3477 3030 2953 2508 1426 788 634 485 ------
NM_001004127chr13--171 ----
NM_001004196chr331093 973 955 ------
NM_001004303chr12687 574 ------
NM_001004303chr12687 574 ------
NM_001004304chr1263197 2902 2307 2166 1014 680 --1813 13273
NM_001004313chr1742101 2051 1493 524 ------
NM_001004317chr663891 3701 3309 1348 862 436 33802 928 455 1591 --
NM_001004342chr1146105 6014 5789 2437 1871 830 820 809 763 717 698 679 342 151 25954 505 55351 4333 2148 1032 726 14511
NM_001004360chr241858 1769 1410 280 --21746 751 --
NM_001004419chr12104615 4583 4332 4252 4234 3423 1428 1373 1329 638 ------
NM_001004720chr24950 300 245 118 ------
NM_001004722chr241119 469 414 287 ------
NM_001005158chr32399 125 ------
NM_001005159chr32399 125 ------
NM_001005209chr2--1707 ----
NM_001005217chr4273 62 ------
NM_001005271chr1731091 1047 154 --11126 --
NM_001005273chr1731091 1047 154 --11126 --
NM_001005335chr19148 ------
NM_001005366chr121754 --1620 --
NM_001005368chr10127 ------
NM_001005375chrY31883 1395 255 1703 --11193
NM_001005386chr242362 684 605 42 3973 688 253 ----
NM_001005404chr17154545 4431 4356 3756 3655 3602 3502 3427 3188 3010 1686 1143 1080 186 59 ------
NM_001005417chr12213 197 ------
NM_001005463chr1042082 861 408 193 --21686 227 --
NM_001005473chr5135804 5424 5215 4856 4735 4224 2581 2347 2283 2109 838 173 151 34653 4082 2335 56500 5036 5002 2289 388 15789
NM_001005474chr331494 1244 1134 ------
NM_001005476chr22135 29 1708 ----
NM_001005505chr321223 47 --11697 --
NM_001005527chr33923 398 320 --2389 55 --
NM_001005732chr211125 1633 ----
NM_001005733chr212226 125 1590 ----
NM_001005739chr21736 ------
NM_001005743chr1421175 253 1975 1100 --
NM_001005744chr1421175 253 1975 1100 --
NM_001005745chr1421175 253 1975 1100 --
NM_001005746chr231351 587 249 ------
NM_001005747chr231351 587 249 ------
NM_001005751chr101147 ------
NM_001005753chr272108 2062 1859 1703 933 788 712 22318 549 21843 122 12070
NM_001005781chr22424 383 --1227 --
NM_001005782chr25873 832 110 62 22 --1676 --
NM_001005845chr861886 1430 459 448 404 33 1757 11691 --
NM_001005849chr171117 ------
NM_001005910chr3--1650 ----
NM_001005911chr3--1650 ----
NM_001005920chr162994 120 --1728 --
NM_001006115chr372635 2579 1746 828 490 405 112 --12039 --
NM_001006600chr552389 1823 822 663 428 22063 569 ----
NM_001006605chr131176 1044 949 ------
NM_001006605chr131176 1044 949 ------
NM_001006610chr164759 245 90 21 21011 769 ----
NM_001006612chrX1379 2403 187 ----
NM_001006613chrX1379 2403 187 ----
NM_001006614chrX1379 2403 187 ----
NM_001006617chr941263 1084 474 414 ----11307
NM_001006619chr941263 1084 474 414 ----11307
NM_001006620chr941263 1084 474 414 ----11307
NM_001006621chr941263 1084 474 414 ----11307
NM_001006623chr2112470 2407 1719 1036 671 515 485 474 363 329 302 --2541 487 2508 133
NM_001006634chr162640 69 ------
NM_001006636chr22922 401 ------
NM_001006657chr283215 2738 2676 2648 787 498 307 232 2869 581 32403 2249 249 --
NM_001006665chr13764 753 510 --1188 --
NM_001006684chrX3419 404 58 ------
NM_001006939chr102745 611 --1747 --
NM_001007024chr17174379 3949 3686 3459 3436 3286 3267 2957 2723 1506 1477 844 464 428 351 292 205 33838 2980 193 23113 388 --
NM_001007025chr17174379 3949 3686 3459 3436 3286 3267 2957 2723 1506 1477 844 464 428 351 292 205 33838 2980 193 23113 388 --
NM_001007027chr11----138 --
NM_001007067chr841056 1001 983 152 1793 ----
NM_001007068chr841056 1001 983 152 1793 ----
NM_001007069chr841056 1001 983 152 1793 ----
NM_001007070chr841056 1001 983 152 1793 ----
NM_001007072chr152233 90 ------
NM_001007075chr41842 ------
NM_001007097chr9124999 4988 4021 3870 3722 3552 3500 3185 1906 1891 1166 124 1489 54418 3836 3831 326 269 1977
NM_001007098chr14850 820 230 116 1739 1318 --
NM_001007099chr12903 796 1811 ----
NM_001007100chr12903 796 1811 ----
NM_001007102chr691605 1320 1271 1181 655 378 359 255 214 --21429 598 --
NM_001007156chr1531518 747 87 31975 1868 307 1677 --
NM_001007226chr1731263 1117 1027 11427 ----
NM_001007227chr1731263 1117 1027 11427 ----
NM_001007228chr1731263 1117 1027 11427 ----
NM_001007229chr1731263 1117 1027 11427 ----
NM_001007230chr1731263 1117 1027 11427 ----
NM_001007237chr182719 2682 2565 2380 2090 1910 586 460 --21936 350 --
NM_001007245chr7--247 28 ----
NM_001007246chr21101888 1707 1393 1378 1298 1201 627 524 460 333 21682 404 11929 --
NM_001007257chr121257 528 1470 1609 --
NM_001007267chr24826 770 132 96 1176 1158 --
NM_001007277chr115887 776 770 425 362 1376 1179 --
NM_001007278chr13115184 4413 4192 4082 3747 3507 1898 1297 875 334 26 25160 819 1927 --
NM_001007464chr61119 ------
NM_001007466chr6195165 5124 5030 4783 4573 4558 4510 4437 4029 3971 3920 1963 1874 1589 1474 1325 995 673 301 22003 444 21181 307 --
NM_001007546chr221451 1240 ------
NM_001007553chr151199 441 432 362 82 1830 11011 --
NM_001007559chr1821929 357 ----1838
NM_001007794chr12688 35 ------
NM_001008220chr53122 59 45 --2546 61 --
NM_001008222chrX81397 1337 1183 1057 886 298 152 114 ------
NM_001008225chr72604 172 --2676 584 1679
NM_001008239chr18123797 2957 2912 2678 1005 804 685 558 367 210 146 55 43185 2665 1230 545 32565 2354 1412 --
NM_001008272chr32293 97 ------
NM_001008273chr32293 97 ------
NM_001008388chr44814 396 104 91 --2819 367 --
NM_001008391chr113201 159 111 2592 123 ----
NM_001008392chr352736 2666 1344 797 384 4516 474 466 440 1234 1189
NM_001008401chr1911448 21459 1335 ----
NM_001008408chr7116202 5278 5170 5083 4039 1068 1022 928 467 439 53 25072 5056 35172 4737 4735 --
NM_001008495chr8112180 2124 2076 1841 1818 1733 1700 1537 1485 210 164 12015 32185 1740 821 --
NM_001008530chr144363 188 146 24 --1190 --
NM_001008539chr865326 1979 1304 1108 1060 561 23876 3426 --1956
NM_001008541chr1061772 945 822 322 275 97 --1329 1332
NM_001008541chr1061772 945 822 322 275 97 --1329 1332
NM_001008564chr1342128 204 170 145 21748 64 --1858
NM_001008660chr1161602 1528 1048 984 442 240 --51416 489 444 397 111 --
NM_001008701chr1952979 2863 2820 2798 2156 --12900 --
NM_001008707chr1431894 697 307 ----1297
NM_001008723chr101487 ------
NM_001008726chr1431710 1614 409 ------
NM_001008738chr542626 696 173 85 32841 2598 1041 11035 --
NM_001008740chr1123 ------
NM_001008783chr61723 1902 ----
NM_001008784chr32220 23 ------
NM_001008800chr12175 52 ------
NM_001008801chr1952138 2128 1684 1455 1439 12015 ----
NM_001008860chr154759 694 533 113 --1152 --
NM_001008883chr12175 52 ------
NM_001008892chr154759 694 533 113 --1152 --
NM_001008894chr154759 694 533 113 --1152 --
NM_001008895chr1341377 1286 1167 183 1212 11224 --
NM_001008925chr4143428 3231 3146 3124 2861 2850 2731 1146 1098 928 862 806 799 217 33050 744 643 ----
NM_001008938chr111356 1459 1388 --
NM_001009185chr55615 565 258 158 127 ------
NM_001009552chr82605 463 ------
NM_001009554chr4134183 3985 3950 3848 3650 3171 2986 1779 1502 1382 452 431 366 24285 3873 ----
NM_001009554chr4134183 3985 3950 3848 3650 3171 2986 1779 1502 1382 452 431 366 24285 3873 ----
NM_001009565chr24441 397 389 222 ------
NM_001009567chr102450 84 1160 --1456
NM_001009571chr791709 1596 1494 1487 1448 1127 653 351 325 --21566 238 --
NM_001009881chr12646 553 ------
NM_001009882chr12646 553 ------
NM_001009899chr3186391 5544 5085 5017 4980 4433 4391 2509 2503 2471 2380 1978 1875 1122 908 874 628 131 14047 62414 2412 1881 1869 1864 1736 25829 2347
NM_001009909chr1173844 3465 3320 2845 1135 730 54 23697 960 ----
NM_001009955chr11446 ------
NM_001009955chr11446 ------
NM_001009958chr73395 235 221 ------
NM_001009959chr261726 897 867 598 394 381 1223 1125 21732 500
NM_001009993chr283219 3056 1807 1664 1601 498 465 98 --23931 1316 --
NM_001010846chr1103750 3210 2875 1797 1368 1153 930 698 570 244 --14004 --
NM_001010853chr662992 2984 2525 817 243 109 22153 53 11072 22534 63
NM_001010861chr152642 2204 711 199 192 --22688 2686 12618
NM_001010862chrX73103 2999 2683 2601 532 187 92 --1319 12475
NM_001010867chr186682 6273 2453 1963 1745 1594 1529 199 --12231 --
NM_001010876chr6161 ------
NM_001010888chrX134404 3887 3612 3491 3427 3167 3016 2955 1579 1495 1298 1263 386 43891 3816 3711 826 33704 3479 391 1171
NM_001010891chr5156933 6559 6261 6250 5634 5092 4800 4317 4247 2227 2129 2051 1434 575 391 46286 1080 919 701 26508 5784 12345
NM_001010895chr972001 1531 628 415 105 85 46 41596 1550 582 546 --11888
NM_001010898chr163711 1000 850 601 146 70 --33536 3337 2675 --
NM_001010908chr104637 617 606 572 --3651 649 642 --
NM_001010917chr1062173 2017 1461 425 320 228 ----21743 585
NM_001010924chr1021210 799 --21199 856 --
NM_001010927chr62566 364 ------
NM_001010932chr71158 146 ----
NM_001010934chr741178 1168 1057 752 --11183 11206
NM_001010971chr13676 358 306 2693 328 ----
NM_001010984chr192467 2395 2059 988 959 909 542 508 227 12297 ----
NM_001010986chrX42497 1660 934 636 12477 --1260
NM_001010989chr161560 ----1466
NM_001010990chr161560 ----1466
NM_001011513chr4154025 4017 3781 3007 2959 2930 2776 2589 1632 1613 1598 1117 1109 931 920 34067 3487 2975 21528 922 --
NM_001011515chr4142 1117 --1127
NM_001011516chr4142 1117 --1127
NM_001011537chr342136 2015 1694 544 --22217 459 --
NM_001011546chr20--1119 ----
NM_001011551chrX2178 99 ----1108
NM_001011553chr73874 629 233 ------
NM_001011645chrX2169 56 ------
NM_001011663chr104847 818 389 316 ------
NM_001011666chr7216527 5863 5093 5042 4955 4720 4350 2576 1962 1573 1339 1283 1150 813 627 607 565 507 421 242 109 32245 157 61 74732 4647 4645 1632 1332 278 232 --
NM_001011708chr251952 1191 948 252 213 --12849 12808
NM_001011713chr1471577 1529 1223 1198 633 414 213 --21160 641 --
NM_001011720chr821423 27 --1584 --
NM_001011885chr152393 126 31529 1418 1396 ----
NM_001012264chr144772 733 699 212 1182 1685 --
NM_001012267chr921343 83 ------
NM_001012329chr132346 2216 456 ------
NM_001012333chr111253 --1320 --
NM_001012334chr111253 --1320 --
NM_001012337chr3189 ------
NM_001012393chr11215030 5015 4589 4192 4107 4082 4056 3657 3527 3364 2066 2042 1969 1756 1142 597 529 460 125 104 93 25024 1246 1531 25147 1608
NM_001012398chr162957 268 11054 1743 --
NM_001012415chr92215 85 ------
NM_001012418chr694294 4219 3914 3774 3724 3698 3383 3332 668 --13408 23672 3338
NM_001012420chr15122819 2349 2314 2295 2218 2041 1884 1174 983 581 455 222 --1799 --
NM_001012423chr15122819 2349 2314 2295 2218 2041 1884 1174 983 581 455 222 --1799 --
NM_001012426chr643105 3096 469 420 12075 ----
NM_001012427chr643105 3096 469 420 12075 ----
NM_001012507chr6142 ------
NM_001012514chr241093 453 434 244 11142 31109 42 40 --
NM_001012516chr241093 453 434 244 11142 31109 42 40 --
NM_001012732chr431095 350 300 146 11007 --
NM_001012751chr1051933 1737 1291 1217 776 11653 11296 --
NM_001012754chr1331893 1800 1520 195 ----
NM_001012968chrX72233 2198 1821 1755 947 826 346 21890 656 2488 460 --
NM_001012977chrX81428 1370 1171 1160 894 470 324 174 11327 2483 284 --
NM_001012979chrX157 1168 ----
NM_001012989chrX154 ------
NM_001013031chr1083179 1103 1064 861 814 665 239 115 --1256 --
NM_001013398chr72237 198 --21402 1076 --
NM_001013399chr631010 359 152 ------
NM_001013406chr731622 1539 1391 --11624 --
NM_001013415chr451585 1419 635 478 308 21034 376 11105 --
NM_001013437chr18182 199 ----
NM_001013438chr31929 1186 ----
NM_001013439chr31775 132 ----
NM_001013615chr131000 224 207 ----138
NM_001013620chr12208427 8013 7975 7600 7442 6808 6291 2817 2791 1899 1876 1782 1732 1589 1536 1189 1175 1030 646 352 77189 6920 5795 3365 2995 2279 95 --27365 3125
NM_001013635chr1221053 865 21098 346 11043 --
NM_001013690chr1261937 1738 1539 812 776 404 ------
NM_001013703chr151482 1415 ----
NM_001013843chr153922 364 217 --2143 114 --
NM_001014431chr143989 972 783 ------
NM_001014432chr143989 972 783 ------
NM_001014434chr13638 96 34 1100 141 --
NM_001014435chr16141 --1429 --
NM_001014442chr131121 ------
NM_001014443chr1193 ------
NM_001014764chr171164 ------
NM_001014797chr10138045 7231 5519 5476 2797 2340 2205 1666 1577 1144 498 415 277 35743 2555 1393 57320 2177 514 503 197 1831
NM_001014809chr44701 683 132 59 --1141 --
NM_001014811chr11--1111 ----
NM_001014812chr152385 181 1352 ----
NM_001014831chr192518 262 --1629 1632
NM_001014832chr192518 262 --1629 1632
NM_001014834chr192518 262 --1629 1632
NM_001014835chr192518 262 --1629 1632
NM_001014839chr1----1135 --
NM_001014841chr1----1135 --
NM_001014972chr2--1211 ----
NM_001015048chr1483066 3039 2933 2364 2294 2186 543 188 11047 1933 11247
NM_001015049chr1483066 3039 2933 2364 2294 2186 543 188 11047 1933 11247
NM_001015053chr1731227 1121 268 156 ----
NM_001015877chrX132628 2458 2447 2246 2049 1980 1968 1136 663 544 521 484 61 22412 75 11022 --
NM_001015880chr1071460 1265 1187 494 457 377 37 2263 110 21651 424 151
NM_001015881chrX--21290 815 1455 --
NM_001015885chr201348 ------
NM_001015887chr351463 1402 1158 620 318 --21518 1465 1515
NM_001017365chr1150 ------
NM_001017366chr1150 ------
NM_001017367chr1150 ------
NM_001017369chr44958 878 384 98 2353 163 1303 --
NM_001017371chr261406 1154 1085 1022 412 83 ------
NM_001017395chr343075 2694 1353 143 32296 889 89 --12714
NM_001017405chr41829 1961 1267 --
NM_001017415chr14814 618 295 91 ------
NM_001017416chr14814 618 295 91 ------
NM_001017420chr831364 332 301 41380 1104 941 356 ----
NM_001017424chr151411 468 360 276 57 21606 566 --11832
NM_001017425chr151411 468 360 276 57 21606 566 --11832
NM_001017434chr13518 153 127 1121 ----
NM_001017440chr7278279 8186 7986 7644 7610 7557 7393 7384 7079 6515 6250 5781 5062 2510 2469 2342 2237 1679 1641 1487 1436 1348 1277 1169 847 828 68 27429 233 46745 6014 5474 2331 1622
NM_001017923chr141347 11692 21451 1064 11701
NM_001017926chr851238 1202 1152 267 36 21517 271 21819 1762 11741
NM_001017962chr104996 912 764 21 1173 ----
NM_001017967chr161117 2928 59 ----
NM_001017969chr92184 155 ------
NM_001017975chr12337 108 ----1202
NM_001017977chr1167 ------
NM_001017979chr41293 ------
NM_001017999chr152155 2071 1702 318 300 --32073 2053 1951 1717
NM_001017999chr152155 2071 1702 318 300 --32073 2053 1951 1717
NM_001018000chr152155 2071 1702 318 300 --32073 2053 1951 1717
NM_001018000chr152155 2071 1702 318 300 --32073 2053 1951 1717
NM_001018001chr152155 2071 1702 318 300 --32073 2053 1951 1717
NM_001018004chr153740 670 529 --1614 --
NM_001018006chr153740 670 529 --1614 --
NM_001018007chr153740 670 529 --1614 --
NM_001018009chr351151 1131 1077 352 157 --2984 359 --
NM_001018020chr153740 670 529 --1614 --
NM_001018037chr971464 1299 1077 507 488 315 210 1230 ----
NM_001018053chr1111800 1630 1565 1263 1256 605 587 548 520 386 373 21344 669 31329 1249 346 11435
NM_001018054chr121024 1011 1207 11232 --
NM_001018056chr9----187 --
NM_001018064chr992142 840 311 260 245 218 210 195 167 169 ----
NM_001018065chr9166008 5907 5445 5435 5166 5035 4996 4895 4775 4571 3721 1732 1421 842 733 572 11585 15083 --
NM_001018066chr9166008 5907 5445 5435 5166 5035 4996 4895 4775 4571 3721 1732 1421 842 733 572 11585 15083 --
NM_001018067chr174624 3500 1837 1253 864 570 263 34535 1362 1349 24889 1247 --
NM_001018068chr174624 3500 1837 1253 864 570 263 34535 1362 1349 24889 1247 --
NM_001018069chr174624 3500 1837 1253 864 570 263 34535 1362 1349 24889 1247 --
NM_001018074chr573768 3488 2646 1324 567 346 200 1383 ----
NM_001018075chr573768 3488 2646 1324 567 346 200 1383 ----
NM_001018076chr573768 3488 2646 1324 567 346 200 1383 ----
NM_001018077chr573768 3488 2646 1324 567 346 200 1383 ----
NM_001018088chr151134 ------
NM_001018090chr15122486 2238 2225 2151 2010 1984 1925 752 551 423 327 283 32596 2526 2229 32038 584 542 --
NM_001018091chr15122596 2348 2335 2261 2120 2094 2035 862 661 533 437 393 32706 2636 2339 32148 694 652 --
NM_001018100chr152689 255 ------
NM_001018102chr15122486 2238 2225 2151 2010 1984 1925 752 551 423 327 283 32596 2526 2229 32038 584 542 --
NM_001018108chr1582140 1818 1583 1562 1420 595 492 359 1789 3690 584 494 --
NM_001018111chr7103984 3846 3832 3066 2898 2652 2519 912 710 154 33589 3348 1190 11403 --
NM_001018159chr162122 106 ------
NM_001018160chr162122 106 ------
NM_001020658chr121144 439 ------
NM_001020658chr121144 439 ------
NM_001020818chr1991906 1544 1537 183 135 107 62 47 40 11913 81615 1519 484 482 465 454 274 266 --
NM_001020819chr1991906 1544 1537 183 135 107 62 47 40 11913 81615 1519 484 482 465 454 274 266 --
NM_001020820chr1991906 1544 1537 183 135 107 62 47 40 11913 81615 1519 484 482 465 454 274 266 --
NM_001020821chr1991906 1544 1537 183 135 107 62 47 40 11913 81615 1519 484 482 465 454 274 266 --
NM_001020825chr531243 963 121 ------
NM_001023567chr1572211 1905 991 584 457 311 222 11738 1802 --
NM_001023587chr361128 867 847 821 809 199 ------
NM_001024071chr142874 350 ------
NM_001024094chr573768 3488 2646 1324 567 346 200 1383 ----
NM_001024218chr142812 321 1157 ----
NM_001024226chr11993 ------
NM_001024227chr11993 ------
NM_001024228chr11993 ------
NM_001024372chr882270 1999 1967 1463 923 454 366 142 11784 ----
NM_001024380chr861692 1617 826 114 82 49 --1630 --
NM_001024381chr861692 1617 826 114 82 49 --1630 --
NM_001024455chrX82446 2196 2176 1683 968 947 362 41 ------
NM_001024463chr152259 153 --1202 --
NM_001024601chr1138 ------
NM_001024647chr1287398 6173 6072 3049 1854 1826 1349 295 56039 4696 980 464 150 16253 1301
NM_001024649chr5122958 2919 2479 2458 2302 2230 2204 2032 1018 930 857 33 42789 1925 1120 1027 22460 2022 --
NM_001024660chr331711 1351 196 31430 668 511 11303 --
NM_001024666chrX3650 483 57 --1451 1251
NM_001024668chr121700 --1702 --
NM_001024680chr261466 1455 1228 1165 708 179 --11524 --
NM_001024688chr8101993 1874 1855 1807 1796 834 789 524 208 158 1796 ----
NM_001024808chr1231963 810 414 ------
NM_001024809chr17----149 --
NM_001024847chr342250 1559 896 699 22459 2346 32406 1829 615 1956
NM_001024934chr64612 198 123 100 ------
NM_001024935chr64612 198 123 100 ------
NM_001024936chr64612 198 123 100 ------
NM_001024937chr175489 482 199 182 78 --1288 1593
NM_001024948chr193523 3235 3146 2486 2436 1262 756 516 270 23257 430 23433 1264 --
NM_001024956chr11175656 5564 5431 4956 4319 3915 3793 3718 1930 1827 1743 1567 1561 1453 981 458 59 25033 2217 23780 968 15163
NM_001024959chr31305 --2865 824 --
NM_001024960chr31305 --2865 824 --
NM_001025068chr311335 --196 21748 1695
NM_001025069chr311335 --196 21748 1695
NM_001025076chr10135922 5293 5022 4693 4244 4041 3829 3821 2216 1715 1387 392 345 36176 5068 1059 14385 15474
NM_001025077chr10147280 6651 6380 6051 5602 5399 5187 5179 4987 2745 1750 1703 1386 1324 37534 6426 2417 25743 4953 16832
NM_001025079chr3133438 3009 2919 2818 2711 2558 2525 1510 1309 948 939 864 784 --63504 2693 2654 2578 950 777 11598
NM_001025081chr1821327 340 --11144 --
NM_001025090chr1821327 340 --11144 --
NM_001025092chr1821327 340 --11144 --
NM_001025101chr1821327 340 --11144 --
NM_001025105chr561408 1389 1243 1090 1055 1018 1246 11025 --
NM_001025107chr172402 2050 501 458 250 112 99 --42436 2153 855 252 --
NM_001025107chr172402 2050 501 458 250 112 99 --42436 2153 855 252 --
NM_001025108chr2144010 3228 2888 1347 1278 1268 1220 979 947 877 836 628 214 140 13051 1949 --
NM_001025201chr24743 675 631 525 ------
NM_001025233chr1262722 2380 1847 623 585 313 41898 1731 327 281 22045 785 12232
NM_001025252chr853154 2617 1214 469 384 21050 358 --12045
NM_001025253chr853154 2617 1214 469 384 21050 358 --12045
NM_001025266chr3134638 4376 4308 3495 3409 3356 1326 920 903 487 357 201 183 24949 94 34836 4564 4313 --
NM_001025356chr12112889 2191 1969 1927 1908 826 426 394 320 314 237 32999 2957 927 22030 2025 1829
NM_001025366chr641348 571 432 275 ------
NM_001025366chr641348 571 432 275 ------
NM_001025367chr641348 571 432 275 ------
NM_001025367chr641348 571 432 275 ------
NM_001025368chr641348 571 432 275 ------
NM_001025368chr641348 571 432 275 ------
NM_001025369chr641364 587 448 291 ------
NM_001025369chr641364 587 448 291 ------
NM_001025370chr641348 571 432 275 ------
NM_001025370chr641348 571 432 275 ------
NM_001025389chr1181661 1493 1354 1255 1181 616 554 343 --1356 --
NM_001025390chr1181661 1493 1354 1255 1181 616 554 343 --1356 --
NM_001025579chr172861 287 21192 467 1292 --
NM_001025580chrX63092 377 358 331 312 46 --14030 187
NM_001025595chr461596 1385 1108 1099 1086 356 ----11325
NM_001025596chr113206 118 38 1332 ----
NM_001025603chr1111375 1355 1044 1021 955 534 473 457 302 176 94 1988 ----
NM_001025777chr23517 378 68 1256 21399 1032 --
NM_001025780chr941560 550 222 54 ------
NM_001029839chr331507 1478 238 1591 ----
NM_001029840chr331507 1478 238 1591 ----
NM_001029858chr663157 2695 2117 1185 856 509 1871 --1411
NM_001029859chr1162413 2295 2275 1826 311 195 --11867 --
NM_001029863chr652492 2173 2009 979 615 1889 22085 1129 1487
NM_001029875chr562614 2459 1168 1090 717 698 32381 2136 108 ----
NM_001029882chr13621 594 565 --2599 585 --
NM_001029882chr13621 594 565 --2599 585 --
NM_001029884chr672648 2287 1842 1670 813 621 214 2558 135 ----
NM_001029955chr441186 1126 613 211 22353 807 --1303
NM_001029976chr8155 ------
NM_001029998chr42458 432 1438 11305 --
NM_001030001chr141326 ------
NM_001030006chr1742229 696 616 591 1290 32489 948 301 --
NM_001030007chr1683998 3805 3715 3627 3156 2719 759 231 23222 535 33757 586 238 11309
NM_001030055chr14144725 4612 4127 4048 3936 3837 3766 3360 1615 1114 1076 906 374 123 64661 4367 3799 1859 629 322 24727 1116 11618
NM_001030059chr10180 ------
NM_001030272chr111419 ------
NM_001030273chr111419 ------
NM_001030287chr111141 ------
NM_001031623chr611216 173 11116 --
NM_001031677chr51344 ------
NM_001031679chr12123534 3478 3424 3300 2849 2724 2270 522 288 266 235 129 12853 22808 268 --
NM_001031685chr11667 1281 ----
NM_001031690chr7132911 2889 2827 2666 2567 2391 2099 1222 1127 833 448 433 356 --22461 981 1995
NM_001031694chr13701 620 222 154 ----
NM_001031694chr13701 620 222 154 ----
NM_001031695chr22184880 4743 4633 4622 4557 4212 3920 3904 1600 1052 824 788 629 619 606 488 240 214 41482 1422 864 481 44929 4715 4463 4461 11516
NM_001031700chr452310 1710 823 426 225 1579 31922 1828 1779 11625
NM_001031702chr3186 ------
NM_001031710chr72883 726 2997 150 ----
NM_001031711chr551227 730 643 310 184 11689 2739 169 --
NM_001031716chr231129 374 324 ------
NM_001031722chr6--1144 ----
NM_001031723chr4246 37 1388 ----
NM_001031732chr493640 3152 2500 2437 1256 1077 795 786 602 22286 1058 1507 --
NM_001031738chr22435 54 ------
NM_001031743chr62214 158 ------
NM_001031746chr1071441 368 327 314 307 279 124 ------
NM_001031804chr16134070 3346 2785 2764 2737 1292 1146 647 632 594 476 436 385 --12856 --
NM_001031812chr5102262 2178 1878 1691 1579 1430 409 309 179 162 --1414 --
NM_001032221chr91585 --21444 162 --
NM_001032279chr112383 372 ------
NM_001032280chr641682 1635 1200 606 1393 ----
NM_001032282chr831304 487 352 2475 367 --11095
NM_001032283chr121226 1666 ----
NM_001032284chr121226 1666 ----
NM_001032288chr2011502 183 ----
NM_001032289chrX3379 277 118 --1193 --
NM_001032293chr172225 191 --2544 45 --
NM_001032296chr1352703 2015 1044 927 46 12200 11998 --
NM_001032363chr1101671 1594 1559 1487 901 856 494 254 177 92 ------
NM_001032363chr1101671 1594 1559 1487 901 856 494 254 177 92 ------
NM_001032380chr1061489 1478 1228 445 291 60 11482 ----
NM_001032394chr682590 2563 2458 1941 534 525 307 290 12709 32476 2463 2445 --
NM_001032395chr682457 2430 2325 1808 401 392 174 157 12576 32343 2330 2312 --
NM_001032999chr20155238 4798 4745 4453 4358 3576 1661 1341 1331 1255 1092 957 799 710 291 --1528 --
NM_001033025chr161254 1218 596 529 411 202 ------
NM_001033044chr151394 1354 190 59 41 11303 2424 349 1449
NM_001033045chr2104178 4077 3988 3960 3938 3893 3694 1553 1140 863 13571 44153 3895 1555 120 23941 1561
NM_001033047chr482519 2348 2059 1689 476 259 148 64 12605 274 47 --
NM_001033056chr151394 1354 190 59 41 11303 2424 349 1449
NM_001033057chr371919 1882 1839 1588 455 363 327 ------
NM_001033059chr62648 546 --2821 206 1804
NM_001033081chr121730 196 11925 ----
NM_001033082chr121730 196 11925 ----
NM_001033085chr2139 ------
NM_001033087chr20113226 3057 2963 2842 2730 2691 2261 1323 674 549 266 12005 23174 268 --
NM_001033112chr52722 301 ------
NM_001033117chr3134551 4241 4067 4039 3884 3654 3493 3257 3233 1869 1590 1080 495 --64924 4789 3656 3259 1483 580 --
NM_001033503chr51479 --1366 --
NM_001033506chr11--1390 ----
NM_001033507chr121487 728 ------
NM_001033518chr772884 2746 2314 1094 783 596 238 1772 21952 243 --
NM_001033519chr772884 2746 2314 1094 783 596 238 1772 21952 243 --
NM_001033520chr772884 2746 2314 1094 783 596 238 1772 21952 243 --
NM_001033521chr204791 274 150 125 ------
NM_001033522chr204791 274 150 125 ------
NM_001033557chr261190 1157 1138 316 65 40 --131 --
NM_001033561chr174804 719 587 172 190 1177 --
NM_001033564chr61122 11782 ----
NM_001033566chr171960 ----1356
NM_001033568chr171960 ----1356
NM_001033578chr842083 1513 393 144 1148 12128 --
NM_001033602chr1372670 2513 2366 2267 1876 1073 597 1453 ----
NM_001033659chr1721501 1439 21680 1413 --11541
NM_001033723chr882572 2179 1806 1790 764 551 472 81 1579 22574 2478 1554
NM_001033756chr641282 505 366 209 ------
NM_001033756chr641282 505 366 209 ------
NM_001033910chr131731 637 161 12045 22236 1759 1282
NM_001033925chr1041902 1753 538 216 21666 165 11875 --
NM_001034025chr123884 840 62 155 ----
NM_001034841chr1695525 5462 5278 4820 4711 4364 1812 1422 1164 11547 54369 3740 1644 1354 1352 15528
NM_001034845chr451410 1197 1101 449 263 11141 ----
NM_001034850chr531387 1304 332 ------
NM_001034852chr142569 373 --1571 --
NM_001034853chrX4961 917 811 745 1903 ----
NM_001034954chr10103192 3176 2659 2298 1103 874 854 774 717 66 --22497 859 --
NM_001034955chr10103192 3176 2659 2298 1103 874 854 774 717 66 --22497 859 --
NM_001034956chr10103192 3176 2659 2298 1103 874 854 774 717 66 --22497 859 --
NM_001034957chr10103192 3176 2659 2298 1103 874 854 774 717 66 --22497 859 --
NM_001034996chr3133 ------
NM_001035chr15527 366 311 289 120 ----11279
NM_001035003chr42912 188 1390 ----
NM_001035004chr42912 188 1390 ----
NM_001035005chr181648 ------
NM_001035235chr52552 459 ------
NM_001035260chr10----1460 --
NM_001035267chr121281 ------
NM_001035511chr182124 2108 1751 719 622 555 345 218 11849 11872 --
NM_001035512chr182231 2215 1858 826 729 662 452 325 11956 11979 --
NM_001035513chr182231 2215 1858 826 729 662 452 325 11956 11979 --
NM_001035521chr22793 156 ------
NM_001037131chr22221 106 --1440 --
NM_001037132chr742262 2036 515 106 --12146 11738
NM_001037133chr742262 2036 515 106 --12146 11738
NM_001037164chr741783 509 219 39 --1199 --
NM_001037165chr797392 6729 6226 6053 5661 2453 1901 1660 577 38883 6599 1842 28108 2058 --
NM_001037172chr331364 1086 447 1984 1310 --
NM_001037281chr16--1119 ----
NM_001037317chr152642 2204 711 199 192 --22688 2686 12618
NM_001037331chr184721 304 206 198 ------
NM_001037334chr1882402 1949 1876 898 792 785 560 314 ------
NM_001037339chr131460 512 370 --11624 --
NM_001037340chr131460 512 370 --11624 --
NM_001037341chr131460 512 370 --11624 --
NM_001037341chr131460 512 370 --11624 --
NM_001037494chr121240 1212 ----
NM_001037495chr121240 1212 ----
NM_001037535chrX31472 442 76 --11364 --
NM_001037536chrX31472 442 76 --11364 --
NM_001037540chrX31472 442 76 --11364 --
NM_001037553chr2154908 4772 3967 1413 102 34357 2054 1496 35160 5109 384 --
NM_001037582chr421705 669 ------
NM_001037631chr22434 157 ------
NM_001037738chr51197 1111 ----
NM_001037872chr23638 530 139 1113 ----
NM_001037954chr11133338 3114 2520 2153 1376 1352 1184 849 751 730 717 538 156 21028 999 43123 2992 649 458 --
NM_001038493chr231424 1040 72 --2546 544 --
NM_001038640chr152652 642 286 44 --1947
NM_001038702chr592762 1905 1881 1811 1757 1736 870 274 219 31831 856 258 ----
NM_001038707chr182207 1970 1927 1711 781 614 592 519 --1115 --
NM_001038707chr182207 1970 1927 1711 781 614 592 519 --1115 --
NM_001039029chr1231864 782 361 11900 ----
NM_001039199chr20114664 4517 4203 3343 3201 3148 1090 939 363 43 34 24984 4972 33812 3157 45 --
NM_001039350chr7278 34 1612 1549 --
NM_001039465chr142479 202 --1101 --
NM_001039479chr144807 687 406 228 42233 2202 2117 2038 32090 1826 471 --
NM_001039538chr293614 3573 3213 2559 2281 1296 1232 1222 1061 23217 146 ----
NM_001039547chr3216585 6474 6449 5981 5946 5872 5009 3133 2612 2438 2359 2011 2000 1941 1777 1641 1515 1498 977 867 293 1226 --17271
NM_001039569chr2123286 2733 2381 2354 2290 2279 2266 2249 2229 2222 2097 979 4707 672 428 412 82889 2383 2374 2369 2364 2362 2251 988 --
NM_001039574chr13663 283 84 ----1939
NM_001039577chr174503 3171 2873 1645 1571 1339 1332 11693 1385 --
NM_001039580chr474503 4419 3085 2045 1154 666 290 14742 11312 --
NM_001039585chr194052 3475 3463 3178 3145 1444 1230 1022 964 22576 98 --24247 3483
NM_001039590chrX103547 3204 3189 2812 2559 1165 1116 336 291 65 43276 3237 2725 1019 ----
NM_001039591chrX103547 3204 3189 2812 2559 1165 1116 336 291 65 43276 3237 2725 1019 ----
NM_001039618chr11135839 5768 4852 4751 4695 3924 2242 2222 1342 701 389 305 217 22191 2060 35153 540 482 --
NM_001039649chr131203 ------
NM_001039690chr1672381 2221 1894 1725 1709 290 213 1851 12383 --
NM_001039693chr274052 3989 3895 1643 1334 365 185 --1986 24093 3452
NM_001039709chr20155238 4798 4745 4453 4358 3576 1661 1341 1331 1255 1092 957 799 710 291 --1528 --
NM_001039711chr13840 825 209 ------
NM_001039712chr13840 825 209 ------
NM_001039762chr1062250 1677 796 774 644 66 12013 ----
NM_001039772chr113448 373 63 ------
NM_001039802chr111396 --21234 434 --
NM_001039840chrX135921 5343 4760 3926 3865 2309 2061 1665 1525 1285 571 169 125 45589 5546 2017 364 34016 956 135 --
NM_001039888chr12550 538 --2727 560 --
NM_001039916chr1241067 1056 160 53 --2170 86 --
NM_001039917chr1241067 1056 160 53 --2170 86 --
NM_001039918chr1241067 1056 160 53 --2170 86 --
NM_001039919chr1241067 1056 160 53 --2170 86 --
NM_001039920chr1241067 1056 160 53 --2170 86 --
NM_001039937chr13123978 3929 3140 3053 2858 2708 2675 2542 857 303 87 38 12889 23189 166 12606
NM_001039960chr1291431 1253 1143 1124 397 320 264 256 248 --11258 11264
NM_001040001chr652049 1874 333 270 43 --32064 1717 652 1484
NM_001040002chr1751439 1174 1064 203 81 21417 170 ----
NM_001040033chr13702 505 465 1256 ----
NM_001040057chr73514 201 101 ------
NM_001040058chr42398 358 1420 ----
NM_001040060chr42398 358 1420 ----
NM_001040092chr82439 156 ------
NM_001040100chr34785 307 179 169 1491 1114 --
NM_001040101chr441341 439 347 224 11175 ----
NM_001040108chr1482539 2416 2018 1010 852 778 666 475 --1461 --
NM_001040110chr731620 1410 186 130 11622 --
NM_001040113chr16129 ------
NM_001040135chr7--1701 ----
NM_001040142chr221923 1900 11535 1423 --
NM_001040143chr221923 1900 11535 1423 --
NM_001040144chr1672381 2221 1894 1725 1709 290 213 1851 12383 --
NM_001040146chr1672381 2221 1894 1725 1709 290 213 1851 12383 --
NM_001040147chr183705 242 113 1641 ----
NM_001040152chr745080 1348 696 341 --21627 1605 --
NM_001040153chr132885 693 ------
NM_001040158chr52418 401 ------
NM_001040159chr441488 1120 349 76 11126 ----
NM_001040167chr741210 1102 899 381 --1901 --
NM_001040172chr551206 629 237 149 96 11373 31520 556 519 --
NM_001040173chr551206 629 237 149 96 11373 31520 556 519 --
NM_001040214chr641537 837 418 209 12248 ----
NM_001040260chr451177 743 424 388 96 11099 41051 448 431 426 --
NM_001040261chr451177 743 424 388 96 11099 41051 448 431 426 --
NM_001040272chr961763 1663 931 458 176 81 21747 551 ----
NM_001040273chr1052084 1538 1324 361 228 ------
NM_001040280chr681456 1136 591 412 403 233 159 22 --1382 --
NM_001040284chr16135846 5323 5175 5135 4124 2334 1187 1108 964 944 690 602 27 54396 1985 1636 1589 879 24175 1314 --
NM_001040402chr472796 2543 2446 2343 1243 1139 1044 1805 42575 785 721 719 --
NM_001040409chr251014 1007 941 880 709 1690 1914 2712 319
NM_001040427chr16------144
NM_001040429chr1353265 1443 1206 175 33 13125 143 --
NM_001040439chr16------1102
NM_001040440chr51607 1453 ----
NM_001040441chr195373 4239 3867 3332 2127 1268 1160 685 66 23532 300 22055 1595 --
NM_001040446chr5102692 2637 2176 1822 919 604 520 358 347 258 32301 956 876 2661 659 --
NM_001040450chr1572613 2305 2284 1887 644 335 183 32472 1837 881 ----
NM_001040453chr1572613 2305 2284 1887 644 335 183 32472 1837 881 ----
NM_001040455chr1141300 1238 485 254 11341 21302 410 --
NM_001040458chr53607 476 270 21841 1693 1679 --
NM_001040610chr15125 ------
NM_001040619chr131591 1028 414 ------
NM_001040624chr862337 2321 2037 535 157 55 ------
NM_001040625chr862337 2321 2037 535 157 55 ------
NM_001040626chr862337 2321 2037 535 157 55 ------
NM_001040627chr862337 2321 2037 535 157 55 ------
NM_001040628chr862337 2321 2037 535 157 55 ------
NM_001040629chr862337 2321 2037 535 157 55 ------
NM_001040630chr862337 2321 2037 535 157 55 ------
NM_001040633chr72839 126 ------
NM_001040665chr7105033 4855 4727 4273 4164 3990 1729 1451 387 149 44934 3514 1886 197 41926 1841 1459 1202 --
NM_001040666chr72735 557 1636 ----
NM_001040697chr111513 ------
NM_001040708chr831032 376 165 21088 943 ----
NM_001040709chr172533 2128 2103 1883 548 76 44 1736 ----
NM_001040712chr983520 3236 3174 2364 1036 987 809 618 22413 2351 32929 2711 61 --
NM_001040876chr421442 593 --2210 190 --
NM_001042353chr202472 410 ------
NM_001042355chr16114669 4258 4218 4065 1891 1857 1337 709 549 398 367 25186 608 --21607 335
NM_001042357chr1051535 1491 1300 426 133 ------
NM_001042358chr1051535 1491 1300 426 133 ------
NM_001042360chr1051535 1491 1300 426 133 ------
NM_001042363chr1051535 1491 1300 426 133 ------
NM_001042383chr3122789 2749 1377 1360 1307 1131 1096 941 241 196 167 76 ----21315 1030
NM_001042388chr181762 2991 911 ----
NM_001042389chr1051535 1491 1300 426 133 ------
NM_001042390chr1051535 1491 1300 426 133 ------
NM_001042392chr1051535 1491 1300 426 133 ------
NM_001042395chr1051535 1491 1300 426 133 ------
NM_001042399chr122391 347 ----1491
NM_001042403chr123333 85 22 2347 289 --1240
NM_001042404chr151550 693 405 300 124 ----11759
NM_001042412chr16114669 4258 4218 4065 1891 1857 1337 709 549 398 367 25186 608 --21607 335
NM_001042413chr9102700 1465 1443 1319 1238 1135 1089 569 239 197 23651 3627 21114 527 --
NM_001042424chr493291 2743 2692 2252 763 648 573 513 368 --1829 --
NM_001042425chr641682 1635 1200 606 1393 ----
NM_001042430chr14--144 2549 547 --
NM_001042453chrX21435 1323 21135 504 11371 2662 535
NM_001042454chr16--1355 ----
NM_001042465chr101873 2248 50 1210 --
NM_001042466chr101873 2248 50 1210 --
NM_001042473chr1052168 1903 1687 1660 345 1402 32170 1905 1672 --
NM_001042475chr61111 ------
NM_001042481chr1432177 115 94 1980 2661 451 --
NM_001042486chr2041182 460 319 76 --1465 --
NM_001042492chr1783212 2139 1153 765 391 204 157 46 41114 783 488 208 2895 190 --
NM_001042494chr15103592 2506 2390 1274 1258 1182 1074 898 583 34 43874 2991 1333 1026 --13168
NM_001042495chr15103592 2506 2390 1274 1258 1182 1074 898 583 34 43874 2991 1333 1026 --13168
NM_001042496chr15103592 2506 2390 1274 1258 1182 1074 898 583 34 43874 2991 1333 1026 --13168
NM_001042497chr15103592 2506 2390 1274 1258 1182 1074 898 583 34 43874 2991 1333 1026 --13168
NM_001042498chrX3414 255 122 --2330 124 --
NM_001042506chrX51181 894 470 324 174 11462 2483 284 --
NM_001042510chr812112 --11347 283 41
NM_001042511chr812112 --11347 283 41
NM_001042517chr131659 1163 ----
NM_001042533chr353239 3068 2614 2573 749 ------
NM_001042537chrX92325 1922 1715 968 831 674 580 484 301 32474 2363 2222 2676 495 --
NM_001042539chr164985 974 943 319 --2368 252 --
NM_001042543chr41433 21525 190 21322 1117 --
NM_001042548chr21796 ------
NM_001042550chr941831 806 240 122 2394 255 11641 --
NM_001042555chr12144758 4342 3578 3375 1837 1565 1210 1127 1069 899 856 809 778 117 33951 3869 643 11842 --
NM_001042573chr1762052 1854 720 556 376 49 ------
NM_001042599chr2317687 7586 7360 7279 7031 6815 6441 6163 6149 6045 5975 5510 5380 5142 5017 2914 2804 2669 2470 1910 1587 1561 1524 1426 1112 893 743 348 318 216 64 66607 6580 5120 2377 2083 494 57712 2640 2117 1745 355 --
NM_001042601chr3133145 3034 2999 2895 2176 2075 1174 837 354 342 315 89 34 --23150 2077 --
NM_001042603chr12155326 5039 4844 4778 4122 3555 1947 1917 1787 1569 1544 1305 882 205 148 34297 1825 1155 23285 1498 11810
NM_001042604chr3154415 4393 4317 4135 3463 3330 3042 3034 1870 1719 1643 1515 1077 151 31 23661 791 23932 470 --
NM_001042632chr2042546 1923 1901 251 --12237 --
NM_001042633chr2042546 1923 1901 251 --12237 --
NM_001042646chr361755 598 556 310 218 71 1815 21240 533 --
NM_001042678chr1--1141 ----
NM_001042679chr1--1141 ----
NM_001042681chr1112281 2107 2100 2041 1870 1859 1036 875 798 566 298 2468 105 12247 --
NM_001042682chr1112281 2107 2100 2041 1870 1859 1036 875 798 566 298 2468 105 12247 --
NM_001042682chr1112281 2107 2100 2041 1870 1859 1036 875 798 566 298 2468 105 12247 --
NM_001042683chr671437 1368 1298 1188 734 581 171 31720 1631 1399 21156 302 --
NM_001042749chrX61917 1846 1716 635 218 99 21984 40 ----
NM_001042750chrX61917 1846 1716 635 218 99 21984 40 ----
NM_001042751chrX61917 1846 1716 635 218 99 21984 40 ----
NM_001042762chr751072 1028 895 831 43 1338 ----
NM_001042784chr4185 ------
NM_001043318chr14114137 3531 3473 3181 2773 1622 1263 1138 791 667 574 --24002 3624 22945 615
NM_001043351chr13397 175 151 --1860 --
NM_001044305chr641531 1453 1281 96 1462 1640 --
NM_001044385chr283790 3356 2681 916 845 793 449 264 --32694 1165 451 --
NM_001044387chr1973850 3484 3424 3412 2616 2581 199 1442 ----
NM_001044388chr1973850 3484 3424 3412 2616 2581 199 1442 ----
NM_001044722chr5102262 2178 1878 1691 1579 1430 409 309 179 162 --1414 --
NM_001044723chr5102262 2178 1878 1691 1579 1430 409 309 179 162 --1414 --
NM_001046chr562821 2464 891 463 429 218 12104 1108 22968 374
NM_001048183chr153581 3376 623 617 120 11034 ----
NM_001074chr4193 ------
NM_001077628chr13655 268 207 1637 ----
NM_001078chr12707 699 ------
NM_001079874chr141525 437 317 268 ------
NM_001083620chr462587 2441 2052 1792 1024 207 2847 341 1261 12027
NM_001083621chr164350 1766 1171 784 744 656 --13276 --
NM_001087chr21130 --1157 --
NM_001092chr173833 488 154 1824 11575 --
NM_001094chr173818 698 661 ------
NM_001095chr1251710 1553 1270 1205 184 ------
NM_001096chr172337 46 --1841 --
NM_001099678chr396276 5496 5071 4277 4200 4180 2464 2352 2042 55566 4334 2211 2114 1759 35574 2482 1489 1492
NM_001100108chr1148328 7870 6775 6441 5990 5754 3069 2491 1668 1417 1019 986 815 805 48226 3184 2911 2757 45178 1540 1203 1021 11809
NM_001104548chr13161 128 65 ----1131
NM_001106chr3299779 9222 9127 8359 8163 7670 7573 7475 7270 7227 7163 6165 3641 3448 3381 3242 2959 2676 2644 2548 2338 1988 1765 1718 1307 953 895 855 343 67260 5967 2063 1602 1472 1239 58440 6742 3185 2802 2446 17273
NM_001111chr172402 2050 501 458 250 112 99 --42436 2153 855 252 --
NM_001113490chrX93657 2877 2655 2585 2477 2387 2261 646 569 22910 913 23057 1175 --
NM_001116chr1642598 2142 1995 180 --23049 996 --
NM_001117chr1862311 2188 2071 1846 675 161 --2821 819 --
NM_001121chr1031712 1318 1302 ------
NM_001122631chr112554 172 ------
NM_001122679chr5----1857 --
NM_001125chr391877 1831 1791 1659 1345 307 171 65 33 11745 2190 53 --
NM_001126chr14793 756 326 137 11001 1795 --
NM_001128chr1683998 3805 3715 3627 3156 2719 759 231 23222 535 33757 586 238 11309
NM_001135chr152653 261 --185 --
NM_001140chr175243 237 196 131 97 ------
NM_001144chr1641162 1050 1041 197 1931 1242 --
NM_001146chr842319 1917 1826 1574 22244 1900 ----
NM_001147chr82389 93 ------
NM_001148chr441693 1500 503 331 ------
NM_001149chr1031440 465 423 ------
NM_001153chr21326 165 ----
NM_001157chr101254 ----1205
NM_001167chrX136749 6463 4889 4661 4560 2531 2457 2235 1862 1458 826 772 339 42493 2326 980 517 ----
NM_001173chr14144725 4612 4127 4048 3936 3837 3766 3360 1615 1114 1076 906 374 123 64661 4367 3799 1859 629 322 24727 1116 11618
NM_001174chrX22085 56 ------
NM_001177chr1242221 1568 1558 219 --22223 221 --
NM_001178chr111419 ------
NM_001179chr41185 ------
NM_001186chr21102678 2523 2376 2353 2048 648 559 439 279 36 43120 2441 1093 411 11139 --
NM_001191chr2041431 1107 378 345 1162 11126 --
NM_001192chr16272 42 --1212 --
NM_001197chr22293 81 ------
NM_001198chr632171 2039 1892 11600 22249 2247 --
NM_001200chr2041042 972 866 795 1997 11081 --
NM_001201chr4113939 2996 2805 2725 1271 1056 1011 927 863 467 62 13596 53538 3525 3388 852 242 --
NM_001204chr2207415 7395 7346 7292 6932 6839 6714 5344 5223 5195 2453 2255 2155 2030 1805 1746 1185 576 555 487 107638 5568 5425 5245 2065 1572 1554 1134 910 771 77578 7072 5368 1997 1304 596 489 14729
NM_001206chr982787 2372 2057 1931 1031 486 304 126 1805 ----
NM_001219chr771393 818 743 630 347 340 272 --1901 11846
NM_001222chr10----11808 --
NM_001227chr1051294 1265 416 236 156 ------
NM_001232chr141108 798 176 115 21118 1097 1128 --
NM_001233chr75875 840 830 787 157 12412 --2833 174
NM_001235chr113692 603 588 ------
NM_001238chr191117 --155 --
NM_001239chr51126 ----1117
NM_001241chr262405 1816 1618 1550 480 239 ------
NM_001241chr262405 1816 1618 1550 480 239 ------
NM_001253chr6--1221 ----
NM_001254chr172931 314 ------
NM_001256chr17102946 2889 2807 2602 2191 1959 1042 442 263 253 11818 62948 2727 2331 1174 745 255 2976 205
NM_001257chr165440 289 261 213 139 11233 ----
NM_001259chr7195138 5120 4750 4726 4695 4633 2542 1970 1711 1618 1605 1597 1503 996 920 804 617 577 125 54763 2078 2036 468 301 44963 4894 1505 619 15351
NM_001261chr951068 467 439 213 40 1277 ----
NM_001262chr13260 232 119 ------
NM_001265chr131223 1943 1331 --
NM_001268chr13171 11038 3830 778 257 --
NM_001269chr13277 172 151 2998 949 2158 127 --
NM_001270chr52982 232 1104 2810 34 --
NM_001271chr1543094 2457 736 348 ------
NM_001273chr122450 375 --1380 --
NM_001274chr11162 ------
NM_001278chr102935 87 1454 --11058
NM_001280chr191689 --1190 --
NM_001282chr1742229 696 616 591 1290 32489 948 301 --
NM_001283chr73683 462 195 1527 ----
NM_001284chr52455 228 ----1234
NM_001286chr142902 2752 2311 1829 --22194 197 --
NM_001288chr6137 ------
NM_001290chr48919 855 428 280 158 150 144 102 3907 825 164 ----
NM_001293chr113101 93 62 1562 ----
NM_001299chr191486 1493 ----
NM_001300chr101143 ------
NM_001304chr17113586 3535 3201 3075 2489 2339 1460 493 352 242 99 33177 1163 884 21144 465 --
NM_001305chr72761 41 1829 ----
NM_001310chr1252957 2478 2056 2020 1060 12652 1905 --
NM_001313chr44701 683 132 59 --1141 --
NM_001315chr662141 1449 1424 907 781 54 --1266 --
NM_001319chr192435 31 ------
NM_001324chr204791 274 150 125 ------
NM_001326chr111368 ------
NM_001329chr1011635 --1439 --
NM_001331chr11162768 2451 2331 2288 2185 2164 1958 1746 1729 1031 945 499 286 225 170 81 1475 102072 2070 2065 1965 1894 1880 1872 1767 1070 671 --
NM_001332chr551534 1159 637 409 79 ------
NM_001338chr212869 229 1256 ----
NM_001343chr531686 1208 168 11529 41699 1100 641 598 1151
NM_001349chr2194 ------
NM_001351chr341862 1369 526 160 21485 607 ----
NM_001356chrX1757 11575 ----
NM_001357chr11230 ------
NM_001358chr43403 126 79 ------
NM_001364chr11163810 3777 3705 3655 3365 3338 3178 3110 3101 1824 1786 1612 1041 918 447 347 --54366 3868 3301 3250 3156 --
NM_001365chr173782 578 497 ------
NM_001385chr83342 323 150 ------
NM_001386chr8102065 1915 891 776 755 472 431 401 354 72 --41711 1590 739 406 1745
NM_001387chr5103004 2784 2443 2272 812 790 741 712 673 188 12719 1924 --
NM_001389chr215575 553 539 477 177 ------
NM_001391chr1851017 484 282 110 36 1203 21030 454 11033
NM_001394chr82572 273 ------
NM_001395chrX1213 --1195 --
NM_001396chr2162655 2318 2002 1131 1119 407 1962 1232 --
NM_001400chr141242 1165 353 35 31063 495 239 11011 --
NM_001401chr941303 1091 1066 535 1617 ----
NM_001406chr1751475 1126 435 415 384 11659 1389 --
NM_001408chr141494 1328 1097 304 --21470 1070 --
NM_001412chrX113401 3376 3220 2952 2870 2528 1410 1344 538 286 31 1209 33331 721 33 --
NM_001416chr171112 --1175 --
NM_001417chr1241959 1728 1668 1661 11870 123 --
NM_001418chr111549 ------
NM_001418chr111549 ------
NM_001419chr19134317 4052 4029 4006 3940 3509 3164 2989 1247 1135 1090 488 432 43874 3749 1759 956 21240 62 --
NM_001420chr1943170 2409 2227 294 12778 ----
NM_001421chrX21371 1342 11770 31678 1640 1635 --
NM_001422chr1151167 1044 237 208 87 144 195 --
NM_001423chr1261990 1921 1493 1294 634 528 21911 1582 31551 1296 756 --
NM_001426chr2----2590 545 --
NM_001427chr7102133 1948 1769 1754 1604 1465 824 775 741 247 --11467 --
NM_001429chr224903 887 234 41 ------
NM_001430chr25641 557 495 360 161 --11571 --
NM_001431chr67981 931 807 459 448 289 252 ------
NM_001438chr1143249 3000 1075 1034 799 518 474 343 317 247 238 232 214 205 23100 392 4372 370 345 255 --
NM_001439chr161254 1218 596 529 411 202 ------
NM_001440chr862752 1924 957 894 688 640 11992 1909 --
NM_001448chrX61544 1293 1155 549 310 157 ----163
NM_001449chrX41078 1021 521 128 --3444 264 130 --
NM_001451chr163519 453 78 ------
NM_001452chr6--1589 ----
NM_001453chr691473 1458 664 610 466 383 336 327 193 --2657 655 --
NM_001458chr7----1603 --
NM_001461chr14618 593 213 118 1411 1389 1254
NM_001463chr23704 303 261 1230 2173 153 --
NM_001482chr154723 714 671 324 --1157 1379
NM_001483chr721064 213 1723 2138 136 --
NM_001491chr632733 1805 1739 1404 12484 1814
NM_001493chrX3246 227 171 ------
NM_001494chr102674 652 2304 240 ----
NM_001495chr84932 904 298 154 ------
NM_001497chr9102425 2084 2061 1889 982 829 542 423 371 354 --32470 2170 544 --
NM_001498chr661108 890 543 427 410 112 1374 ----
NM_001511chr41258 1146 ----
NM_001518chr72844 49 2425 123 ----
NM_001521chr22793 156 ------
NM_001527chr6164861 4802 4791 4523 4059 3763 3572 1339 1310 1150 1095 350 309 198 149 65 31735 774 176 23205 200 --
NM_001530chr1431163 1108 210 21071 74 1167 --
NM_001533chr19148 ------
NM_001540chr7295 87 ------
NM_001542chr182719 2682 2565 2380 2090 1910 586 460 --21936 350 --
NM_001543chr5104237 4008 3637 3557 3287 3259 1807 960 704 468 34581 3701 3535 33023 296 294 --
NM_001546chr631112 482 234 --2484 226 --
NM_001550chr7--247 28 ----
NM_001552chr1731093 1037 222 --11095 --
NM_001553chr4--184 ----
NM_001557chr231336 83 46 ------
NM_001560chrX42670 2283 1046 48 --12299 1501
NM_001564chr4--139 ----
NM_001584chr1161012 494 460 444 228 106 2288 56 ----
NM_001587chrX72261 2232 2143 1813 795 614 235 11726 ----
NM_001604chr1121013 791 ------
NM_001608chr21247 1803 1752 --
NM_001609chr10114110 3670 3595 3396 3239 3018 2882 2784 1110 483 164 --23685 169 --
NM_001614chr17--1646 ----
NM_001614chr17--1646 ----
NM_001616chr2113418 2622 2532 2381 2282 1047 984 831 398 286 84 21014 997 12964 13142
NM_001617chr231231 1221 422 --2482 477 --
NM_001621chr782968 2847 2829 2535 1172 929 718 607 32282 563 314 21874 1869 --
NM_001621chr782968 2847 2829 2535 1172 929 718 607 32282 563 314 21874 1869 --
NM_001629chr132287 239 --188 --
NM_001634chr62648 546 --2821 206 1804
NM_001635chr72971 875 --1880 --
NM_001642chr1141148 1141 406 264 1174 ----
NM_001649chrX52499 2096 965 891 420 ----12113
NM_001650chr18134101 3849 3016 2998 2976 2914 2872 2695 2550 1621 1521 1323 612 1479 13548 --
NM_001654chrX3420 159 150 ------
NM_001655chr1192083 1946 1606 1552 1537 773 726 232 111 ------
NM_001656chr541791 1658 1343 431 2419 244 ----
NM_001658chr11993 ------
NM_001659chr1262140 2099 2092 719 691 318 --42463 2207 1022 744 --
NM_001660chr32802 662 ----1224
NM_001662chr73294 254 102 ------
NM_001663chr1462459 895 830 186 162 78 1525 3871 167 98 --
NM_001664chr341061 1014 773 744 --3989 920 918 --
NM_001665chr112150 134 ------
NM_001668chr141821 1787 656 591 --22284 478 --
NM_001674chr111141 ------
NM_001677chr11936 2816 398 ----
NM_001678chr1791728 1706 1650 1469 1408 641 634 557 137 11372 ----
NM_001679chr31557 --1279 --
NM_001681chr121538 ------
NM_001682chr1282779 2766 2501 2368 2163 1818 973 63 11044 12584 12507
NM_001683chr362478 1929 1750 1735 642 408 --3438 436 192 --
NM_001684chr1113806 3770 3697 3541 3256 2626 1272 1044 570 529 83 23814 2566 ----
NM_001690chr361698 1663 359 293 211 34 32377 1938 1583 2931 594 --
NM_001693chr871190 1180 1027 975 440 247 52 11070 ----
NM_001695chr8124085 3710 3581 3330 3306 1707 1122 869 721 280 196 160 43869 3299 1421 1244 --11256
NM_001701chr951507 1495 1269 557 42 1260 1243 --
NM_001702chr81551 --2566 561 --
NM_001704chr62529 450 ------
NM_001706chr34936 370 229 102 1393 ----
NM_001707chr71223 --1799 --
NM_001709chr1142609 2223 884 339 ----12474
NM_001714chr122576 85 ------
NM_001716chr1131489 1404 31 --1181 --
NM_001717chr152447 205 21512 1258 ----
NM_001718chr631244 1012 274 11002 ----
NM_001719chr20140 ------
NM_001730chr1331510 626 604 ------
NM_001730chr1331510 626 604 ------
NM_001731chr122916 773 2818 692 ----
NM_001735chr9173 ------
NM_001740chr16----1497 --
NM_001742chr721864 1208 11841 ----
NM_001743chr21147 1492 157 --
NM_001745chr531088 291 232 1109 1463 153
NM_001746chr5122958 2919 2479 2458 2302 2230 2204 2032 1018 930 857 33 42789 1925 1120 1027 22460 2022 --
NM_001752chr11--1417 ----
NM_001753chr751509 1325 685 617 556 --41444 591 464 167 --
NM_001754chr21124269 4253 3606 2998 2941 2866 2827 2821 2797 2760 1074 859 13299 33468 653 631 --
NM_001755chr1662208 2103 2037 806 686 417 3924 433 280 1345 12211
NM_001759chr12195261 4981 4769 4290 4115 3979 3759 3521 3342 1965 1920 1885 1852 1411 1342 1086 886 842 709 34192 3471 142 94986 3581 3421 3397 3275 1048 1043 844 52 --
NM_001769chr12--1169 ----
NM_001773chr161514 1181 1166 1097 999 586 --31388 1289 1082 --
NM_001777chr3133438 3009 2919 2818 2711 2558 2525 1510 1309 948 939 864 784 --63504 2693 2654 2578 950 777 11598
NM_001781chr122645 137 1680 ----
NM_001783chr191383 --1152 --
NM_001785chr11233 ----1308
NM_001788chr73874 629 233 ------
NM_001791chr111396 --21234 434 --
NM_001792chr182919 278 ------
NM_001797chr161558 --1187 --
NM_001798chr121728 ------
NM_001799chr51188 ------
NM_001800chr191185 --178 --
NM_001806chr19102892 2715 2527 2485 1155 1129 981 437 314 128 1441 ----
NM_001810chr203602 218 203 ------
NM_001812chr42323 125 ------
NM_001819chr201206 --1208 --
NM_001822chr24743 675 631 525 ------
NM_001829chr42857 66 1916 ----
NM_001830chrX83260 3159 1558 1392 1369 1348 1267 1099 13359 11269 11248
NM_001833chr9294 61 ------
NM_001839chr15702 660 584 165 157 1285 ----
NM_001844chr121157 --1146 --
NM_001854chr121014 258 11470 ----
NM_001855chr94900 885 815 40 ------
NM_001858chr685030 3152 2057 1849 1779 1415 405 287 23909 1943 ----
NM_001873chr43649 472 65 ------
NM_001875chr271067 771 348 339 205 173 147 ------
NM_001880chr21242 ------
NM_001881chr10--1346 ----
NM_001882chr5--2442 184 ----
NM_001892chr561408 1389 1243 1090 1055 1018 1246 11025 --
NM_001893chr171282 1355 ----
NM_001894chr2221053 51 ------
NM_001895chr207999 849 776 361 274 207 176 --1424 --
NM_001896chr16142 ------
NM_001901chr6--21084 112 ----
NM_001903chr52916 667 ------
NM_001904chr31311 ------
NM_001913chr72700 632 ------
NM_001916chr81182 ------
NM_001918chr1139244 9038 9000 8890 5966 5951 5671 5611 3129 2227 1437 1053 974 29027 7071 46532 5829 3459 772 --
NM_001920chr122625 206 1648 1309 --
NM_001921chr431095 350 300 146 11007 --
NM_001923chr113611 197 82 1486 1482 --
NM_001931chr1121224 87 21199 804 ----
NM_001933chr1481012 934 521 376 315 282 162 55 --1164 --
NM_001935chr21874 1330 1360 --
NM_001936chr7278 34 1612 1549 --
NM_001938chr151923 1885 1814 746 180 31380 487 30 --11719
NM_001939chrX103587 3467 3078 2869 1480 1223 1196 613 355 203 22677 673 --13522
NM_001942chr1871964 1601 1346 710 632 332 241 21880 1454 21966 197 --
NM_001945chr521137 305 ------
NM_001946chr124953 785 758 187 ------
NM_001949chr673004 2795 2395 2152 2087 521 94 --1530 --
NM_001951chr81127 ------
NM_001954chr62521 215 1731 ----
NM_001955chr6--1425 1220 --
NM_001957chr442245 2083 834 99 31420 1407 415 186 --
NM_001962chr51127 ------
NM_001963chr43662 559 59 1780 161 1169
NM_001964chr52432 246 ------
NM_001965chr2----178 --
NM_001967chr31194 ------
NM_001968chr42966 76 ------
NM_001969chr14143922 3634 3412 3312 3223 2914 2835 1404 1101 1090 1079 665 307 230 --13314 --
NM_001973chr12157 144 --1269 --
NM_001975chr124790 243 235 225 ------
NM_001977chr42374 164 --1620 --
NM_001980chr1242167 1980 1732 538 ------
NM_001981chr1132203 2191 1939 1782 1732 1683 1496 1470 614 185 174 154 39 32159 1571 463 ----
NM_001982chr124268 199 106 68 ------
NM_001987chr12114108 3921 3866 3534 3491 2955 1710 1500 1332 628 356 11546 54273 4023 1378 606 505 11480
NM_001990chr13134 126 38 ------
NM_001995chr44578 498 314 139 --149 --
NM_001998chr31373 --1375 --
NM_001999chr531248 550 466 --11522 --
NM_002006chr4195831 5792 5483 5447 5238 4874 4284 4157 3904 3716 3552 1582 1228 1006 803 662 524 318 253 35419 4189 1400 35495 1124 1104 --
NM_002009chr1582511 2292 2150 868 288 80 68 62 --11069 --
NM_002010chr131385 ------
NM_002014chr123516 468 206 1114 1615 --
NM_002015chr1393329 3305 2970 2592 1177 813 670 483 105 1382 22972 419 23308 673
NM_002017chr112987 311 ------
NM_002023chr141608 1298 287 130 --3524 478 209 1353
NM_002024chrX41431 806 467 348 21502 263 12025 --
NM_002025chrX278869 7876 7452 7446 7426 7377 6992 6882 6786 6583 6267 6250 6232 6168 6085 5875 2677 2211 2091 1976 1130 1113 1097 1047 255 128 101 35664 1121 218 58883 8043 6889 6884 1978 13392
NM_002026chr261020 1012 874 757 191 92 1827 1993 1996
NM_002028chr1441339 911 866 25 --1913 --
NM_002030chr194350 85 77 31 21215 1188 11159 --
NM_002031chr63644 611 255 1568 ----
NM_002033chr11103696 3173 3033 1622 1470 904 813 415 264 103 24100 831 ----
NM_002035chr18123799 3689 3093 3061 2699 1070 920 810 647 517 329 130 23725 225 --13096
NM_002040chr21153055 3015 2745 2362 2222 2143 2089 1273 1265 1255 1062 1045 1026 666 164 33154 2366 93 11267 --
NM_002041chr15--122 ----
NM_002045chr31144 --169 --
NM_002051chr1021078 905 ------
NM_002054chr21409 2297 138 ----
NM_002061chr141638 1579 627 528 2740 221 ----
NM_002062chr63586 507 209 --11106 1426
NM_002065chr151394 1354 190 59 41 11303 2424 349 1449
NM_002067chr192275 247 ------
NM_002069chr731611 1368 1223 ------
NM_002071chr182684 668 ------
NM_002072chr98949 943 934 819 804 759 368 233 1676 1326 1335
NM_002074chr191617 1529 1357 1237 1100 598 347 253 140 11107 ----
NM_002076chr12113265 2231 1183 1115 1053 1027 1015 875 273 222 44 ----12183
NM_002077chr952150 843 783 762 45 --11636 --
NM_002080chr163725 699 237 --1248 --
NM_002081chr221753 1386 ------
NM_002086chr17102291 2043 1883 1831 1789 1554 437 280 263 246 --32062 2009 285 --
NM_002092chr4114805 4522 4065 3959 3440 3411 3357 1821 1796 1623 1266 24071 3882 13929 --
NM_002094chr16182 ------
NM_002107chr11480 --159 1430
NM_002111chr453511 2860 2428 606 169 --2548 546 --
NM_002114chr62496 86 ------
NM_002126chr1783815 3589 3200 2951 2622 1658 1448 377 53560 3088 1173 815 252 --11021
NM_002128chr1382539 2084 1008 521 498 479 135 28 ------
NM_002130chr541620 1208 266 173 1554 ----
NM_002131chr621097 1006 --11344 --
NM_002135chr121401 --1511 --
NM_002137chr792045 2022 1874 1851 1811 959 770 731 379 1717 ----
NM_002139chrX1206 ------
NM_002140chr92782 92 2794 56 1454 --
NM_002141chr71536 --355 50 45 --
NM_002143chr11750 ------
NM_002145chr171151 1159 1300 --
NM_002146chr1731388 1093 575 ------
NM_002148chr22540 113 ------
NM_002149chr22794 641 1503 ----
NM_002151chr192261 87 ------
NM_002154chr54552 518 448 202 ------
NM_002158chr293382 2952 2791 1334 1188 571 364 309 28 12901 23621 3619 --
NM_002166chr23509 495 259 270 26 ----
NM_002182chr362716 2682 954 861 409 309 42266 909 598 573 12588 1849
NM_002193chr241720 1432 562 59 1156 11392 --
NM_002196chr2031060 334 257 1908 11042 11045
NM_002196chr2031060 334 257 1908 11042 11045
NM_002198chr52845 192 ------
NM_002199chr43853 168 75 --1888 1856
NM_002201chr151111 ------
NM_002202chr541026 926 813 770 1371 ----
NM_002207chr32683 85 --1124 --
NM_002210chr252486 994 467 420 73 --32499 2497 747 11304
NM_002211chr102913 713 1861 1255 1853
NM_002214chr7164647 4335 4198 3755 3640 3559 3523 3482 3463 2027 1570 1041 982 670 650 519 35644 4885 4623 34836 3970 3532 14816
NM_002221chr192868 2719 2522 2507 2155 2142 1159 861 77 --12160 12189
NM_002222chr331082 1035 916 --11084 --
NM_002226chr14--1144 ----
NM_002227chr151306 1173 1133 383 192 ------
NM_002228chr131196 490 284 --1774 --
NM_002229chr191457 ------
NM_002230chr174984 168 41 30 ------
NM_002232chr131394 1263 212 ------
NM_002234chr125706 674 601 527 161 --1603 --
NM_002235chr1251600 1436 1366 1249 1056 ------
NM_002240chr212552 67 --129 --
NM_002241chr182940 2265 2168 2086 984 967 737 47 --3937 121 38 12362
NM_002245chr12641 630 ------
NM_002247chr1052327 2105 1996 832 441 22331 927 ----
NM_002252chr21170 ------
NM_002253chr42994 204 1155 1229 --
NM_002254chr252059 2048 1739 581 406 --2272 161 1377
NM_002264chr3194797 4463 4217 3768 3422 3120 1838 1704 1159 1100 1074 1017 774 766 586 563 484 473 316 21958 521 14576 21595 233
NM_002265chr174839 338 304 56 --1331 --
NM_002266chr17178 --1250 --
NM_002267chr1362061 2022 1857 1788 744 110 ------
NM_002268chr351778 1585 1399 748 535 11245 ----
NM_002270chr5115008 4208 4037 4002 1985 1813 1681 1663 1608 1575 1112 13469 11597 --
NM_002271chr1362263 2153 885 533 297 121 1245 ----
NM_002274chr17----1253 --
NM_002285chr2144010 3228 2888 1347 1278 1268 1220 979 947 877 836 628 214 140 13051 1949 --
NM_002293chr182393 1775 1091 1049 982 782 496 216 1670 12409 22175 985
NM_002294chrX2168 53 1117 ----
NM_002296chr161592 702 448 337 119 85 31500 1172 159 21563 371 --
NM_002310chr5216623 6446 5815 5662 5639 5442 5416 4436 4040 2401 2221 1829 1558 1449 1393 1062 717 689 358 336 230 35954 5028 4296 ----
NM_002314chr71904 ------
NM_002317chr51272 ----1376
NM_002333chr1931211 1122 437 ------
NM_002336chr12144331 4303 3700 3365 2034 1773 1279 1216 1157 972 880 718 545 186 34810 851 822 21543 936 11310
NM_002345chr122559 41 ----1521
NM_002349chr231064 1039 267 21676 1490 ----
NM_002350chr821155 1029 ----11032
NM_002351chrX--133 1467 --
NM_002355chr1281347 1309 1284 1056 192 183 145 27 1947 ----
NM_002356chr6102641 2378 1978 1953 1004 673 500 253 173 123 22671 2518 138 1274
NM_002359chr17114299 3824 3494 2965 2824 1091 1081 957 435 122 105 1819 22950 88 13078
NM_002360chr752659 2351 2331 1919 979 --12254 --
NM_002373chr1521270 375 ------
NM_002374chr293614 3573 3213 2559 2281 1296 1232 1222 1061 23217 146 ----
NM_002376chr141596 3559 165 102 ----
NM_002382chr1451172 940 280 109 101 1524 ----
NM_002383chr165808 797 766 348 142 --3366 191 75 --
NM_002385chr1821327 340 --11144 --
NM_002387chr5154785 3910 3846 3300 3229 3130 1989 1315 1248 1103 920 843 801 420 208 1400 31265 375 304 24788 3167
NM_002391chr111253 --1320 --
NM_002395chr651530 603 519 386 243 176 ----
NM_002397chr552161 2065 1737 259 34 ----12071
NM_002398chr22440 377 11386 ----
NM_002399chr1521312 1018 --21318 970 --
NM_002402chr71306 11211 ----
NM_002408chr145753 589 318 294 148 2675 31 ----
NM_002409chr2233157 2190 1218 ------
NM_002430chr22142561 2532 2525 2440 2357 1746 1725 1686 822 464 432 422 349 135 --41000 832 727 441 --
NM_002431chr141303 ------
NM_002438chr102450 84 1160 --1456
NM_002442chr1241746 1640 1327 210 11531 11724 --
NM_002448chr43648 497 133 ----1206
NM_002449chr54924 413 223 194 1363 ----
NM_002451chr983752 3367 3261 3238 2938 844 492 364 1875 32837 1279 274 --
NM_002455chr1--133 ----
NM_002465chr121226 ------
NM_002467chr8--1421 ----
NM_002469chr121416 ------
NM_002470chr17----191 --
NM_002473chr222986 366 1351 ----
NM_002480chr123511 471 166 1529 1574 --
NM_002482chr13669 132 76 ------
NM_002485chr8101993 1874 1855 1807 1796 834 789 524 208 158 1796 ----
NM_002486chr972288 2271 2196 1616 1600 377 268 --22273 1621 --
NM_002487chr15--1318 ----
NM_002492chr3136 ------
NM_002493chr92277 72 ------
NM_002499chr1582233 2214 1828 1545 985 901 870 690 --12415 --
NM_002500chr2--2924 204 --1215
NM_002501chr1983999 3803 1608 1598 1313 1278 1175 616 --23927 1247 --
NM_002505chr671582 1338 1310 1269 540 202 69 ----11454
NM_002508chr151552 1255 509 302 141 11757 11576 --
NM_002514chr8--21095 158 --11128
NM_002515chr1451668 708 660 193 91 --11263 --
NM_002516chr19152 --130 --
NM_002518chr241205 1194 1167 979 ------
NM_002519chr1121388 1221 11269 ----
NM_002522chr1743921 3132 393 87 23161 553 2362 77 --
NM_002524chr13411 262 248 ------
NM_002526chr63585 518 292 ------
NM_002537chr151424 11026 ----
NM_002539chr21215 ------
NM_002544chr17--1235 ----
NM_002545chr11215030 5015 4589 4192 4107 4082 4056 3657 3527 3364 2066 2042 1969 1756 1142 597 529 460 125 104 93 25024 1246 1531 25147 1608
NM_002546chr81603 1581 ----
NM_002547chrX104172 3793 3782 3375 3083 1378 1171 805 338 65 --23564 1134 21659 941
NM_002553chr72497 389 ------
NM_002556chr1141988 1770 1453 1337 --51360 1351 1349 867 295 --
NM_002569chr1511480 --21349 1283 11355
NM_002572chr113338 292 78 --1340 --
NM_002574chr11251 --159 --
NM_002575chr18--2207 96 1113 --
NM_002576chr112925 869 1909 2416 87 --
NM_002577chr383938 3893 3599 3122 2947 966 894 778 43369 3229 1435 40 93940 2952 1535 1520 1515 1510 425 78 28 --
NM_002578chrX1329 1472 ----
NM_002581chr9165581 5452 5397 5361 5319 5220 5061 3907 3728 3487 2150 1564 1555 846 666 427 35496 1414 1315 34707 1473 429 --
NM_002585chr1----2145 140 --
NM_002586chr651640 1317 1101 302 230 ------
NM_002588chr5111796 1767 1717 1684 1490 1392 1299 1238 669 644 387 ------
NM_002590chr131214 ------
NM_002592chr203127 79 38 --181 --
NM_002594chr2091710 1619 1589 905 885 797 761 175 116 --11591 --
NM_002595chr1281944 1813 1525 1275 215 136 121 81 --11754 --
NM_002597chr13361 334 292 ------
NM_002600chr131460 512 370 --11624 --
NM_002601chr2----1177 --
NM_002605chr1521232 228 1926 --1472
NM_002606chr21--1193 ----
NM_002610chr2123136 3122 2893 2827 2787 2311 2183 1230 1131 932 641 252 32632 421 359 21176 815 22878 644
NM_002613chr16115253 4686 4392 4122 3874 3550 3334 2115 2103 462 430 25276 4183 11634 --
NM_002616chr17146 ------
NM_002618chr21476 ------
NM_002623chr203800 100 71 1267 ----
NM_002628chr35862 783 496 347 94 1108 2445 440 --
NM_002631chr1192 ------
NM_002635chr121176 ------
NM_002636chr61222 --1388 --
NM_002639chr1841299 1271 1007 188 184 2351 37 --
NM_002641chrX61963 1771 633 394 328 142 ------
NM_002645chr1162797 2687 2630 2428 2305 984 22184 335 ----
NM_002646chr162043 1963 1361 785 496 182 32196 834 542 21711 772 --
NM_002648chr63968 436 427 --1237 1498
NM_002649chr771060 558 542 531 409 225 142 --21445 126 --
NM_002651chr13865 744 317 ------
NM_002653chr51177 ------
NM_002655chr8154469 4405 4299 4078 3849 3808 3387 1671 1517 1488 1148 835 827 761 443 23996 1544 ----
NM_002656chr631113 1079 841 ------
NM_002657chr20133230 3093 2461 1544 1528 1441 1299 1162 948 923 780 317 286 13741 33693 2463 1443 --
NM_002658chr102927 258 ------
NM_002669chr4135 --128 --
NM_002670chr331615 1486 298 21442 1183 1469 11515
NM_002674chr12125 ------
NM_002687chr144434 284 264 120 --11312 --
NM_002690chr81103 ------
NM_002693chr15----1308 --
NM_002697chr11235 ------
NM_002698chr1962235 1968 1867 1116 886 201 --52586 2348 2248 1138 77 --
NM_002699chr131463 1381 1345 --2496 75 --
NM_002701chr62224 97 ------
NM_002703chr461782 1668 1426 737 219 147 ------
NM_002705chr163266 256 21 ------
NM_002706chr21473 ------
NM_002707chr23307 72 37 ------
NM_002709chr283518 3206 2971 2845 1295 1283 927 907 1155 11026 --
NM_002710chr124866 354 312 181 ------
NM_002711chr72295 104 --1732 --
NM_002713chr141016 882 250 229 ------
NM_002714chr63157 96 55 11009 ----
NM_002715chr541124 913 836 470 ------
NM_002717chr8----1471 --
NM_002718chr3--2754 506 11724 --
NM_002719chr14102325 2277 2243 2076 2017 2006 1992 580 506 42 2568 339 11921 --
NM_002720chr162244 229 ------
NM_002721chr9256 32 1188 142 --
NM_002725chr153861 1778 1110 153 79 --54416 3803 3252 3250 3240 --
NM_002726chr64483 449 198 158 ------
NM_002730chr1941190 244 233 29 ------
NM_002731chr192973 2729 2654 1948 905 299 281 275 240 22139 825 ----
NM_002734chr172653 241 --127 --
NM_002736chr721973 93 1487 ----
NM_002737chr17176228 6207 6123 6048 5829 5366 5216 4396 4316 2330 2187 1993 1973 1782 1663 1627 696 56353 6304 6092 4411 2342 26230 1388 11391
NM_002738chr1631151 383 108 11155 1317 --
NM_002740chr3112438 2423 2182 2146 1845 1774 968 884 525 274 125 12387 ----
NM_002742chr142666 94 ------
NM_002745chr22144589 4456 4121 3805 3100 3025 1552 1529 1243 1039 603 386 180 55 21655 681 23522 605 1340
NM_002748chr15254 33 1157 ----
NM_002752chr51545 ------
NM_002753chr42297 164 ------
NM_002755chr151692 ------
NM_002756chr172693 664 ------
NM_002763chr14559 510 197 163 ------
NM_002767chr171470 1514 1221 --
NM_002778chr101873 2248 50 1210 --
NM_002796chr11101 --178 --
NM_002806chr141232 ------
NM_002808chr3----1114 --
NM_002811chr16179 ------
NM_002814chrX2634 106 1233 ----
NM_002815chr172101 81 ------
NM_002822chr1231856 1555 129 3619 542 411 ----
NM_002823chr22571 236 ------
NM_002824chr12181 --2397 129 --
NM_002825chr72608 465 ------
NM_002827chr2021370 449 --11193 --
NM_002828chr181984 2693 624 ----
NM_002829chr92271 29 ------
NM_002833chr1541492 1201 1143 336 ------
NM_002834chr12114114 3419 3409 3300 3012 1626 1018 1005 903 736 658 23648 1211 ----
NM_002835chr7----1302 --
NM_002837chr1263992 3397 1740 1460 1386 198 32984 1113 373 14170 --
NM_002839chr983520 3236 3174 2364 1036 987 809 618 22413 2351 32929 2711 61 --
NM_002840chr141376 456 369 294 11588 11261 --
NM_002841chr3--1505 ----
NM_002843chr11103266 2421 1314 915 757 743 734 683 492 320 1507 43134 892 771 527 --
NM_002844chr641364 552 365 300 2876 516 ----
NM_002845chr181625 --1124 --
NM_002846chr2145 ------
NM_002847chr741489 1090 460 262 185 ----
NM_002848chr1251084 1067 819 402 195 189 ----
NM_002850chr1931146 1007 774 1447 ----
NM_002851chr73636 259 48 1572 ----
NM_002855chr1142450 1059 704 386 --33456 3201 3112 --
NM_002858chr121358 354 ------
NM_002859chr1251817 1792 1466 1302 332 1655 21246 397 --
NM_002866chr192507 28 --1512 --
NM_002867chr1----2301 299 --
NM_002868chr1292406 2328 2299 1935 1907 1680 728 307 265 12073 42256 411 409 309 --
NM_002869chr11152167 2147 2091 1954 1767 1760 1376 820 744 595 279 265 96 59 27 --1391 --
NM_002874chr942350 882 283 260 --32056 591 300 --
NM_002880chr32806 164 --164 1167
NM_002886chr3105192 4667 3299 1860 1575 1438 547 423 416 224 2460 410 23637 585 15036
NM_002890chr51103 1802 ----
NM_002892chr1451662 1608 1315 237 123 --41664 1655 1436 157 --
NM_002893chrX1281 ------
NM_002895chr201966 --1848 1620
NM_002897chr2170 --3620 542 540 1593
NM_002902chr15--1151 ----
NM_002906chr1171609 426 270 253 190 154 28 22190 832 2925 239 --
NM_002907chr123415 335 316 123 ----
NM_002911chr1941680 1459 550 341 2575 333 ----
NM_002912chr61788 ------
NM_002918chr192901 302 11114 1748 --
NM_002924chr12233 160 ------
NM_002926chr411172 ------
NM_002931chr61313 ----1214
NM_002938chr471942 1662 1504 1337 1288 646 497 11567 1132 --
NM_002940chr421442 593 --2210 190 --
NM_002941chr331172 600 317 ------
NM_002942chr34919 290 206 176 --1318 --
NM_002943chr152189 124 ------
NM_002945chr17--2769 569 1647 --
NM_002953chr13764 753 510 --1188 --
NM_002955chr62548 329 --21744 1682 --
NM_002956chr1261090 925 895 507 351 226 11180 ----
NM_002957chr953733 1469 821 738 65 12561 11432 --
NM_002959chr1114414 3794 3330 2857 1760 1128 893 793 608 328 261 14235 32851 570 500 --
NM_002968chr163926 239 144 1352 ----
NM_002970chrX2347 330 ------
NM_002971chr341158 1085 764 73 ----1767
NM_002977chr273274 2449 2283 2247 1225 717 315 22613 2169 2911 67 --
NM_002979chr12903 796 1811 ----
NM_002994chr441577 683 141 57 11853 ----
NM_002996chr1641947 1763 633 524 --1526 --
NM_002998chr862253 1796 893 700 298 44 11724 ----
NM_003001chr182231 2215 1858 826 729 662 452 325 11956 11979 --
NM_003010chr1762228 1816 1787 1496 699 502 --2701 232 --
NM_003011chr9274 44 --2136 134 --
NM_003013chr41634 ------
NM_003015chr101218 1724 ----
NM_003016chr1792025 1966 1854 1685 1516 784 767 757 71 --22041 1576 --
NM_003017chr621043 890 ------
NM_003026chr931241 1077 373 ------
NM_003027chr153390 174 131 --1392 --
NM_003028chr942709 2680 1192 357 --12632 --
NM_003030chr341618 1602 711 112 11860 11349 11775
NM_003031chr165759 629 245 90 21 21011 769 ----
NM_003034chr12228038 7865 7693 7580 7570 7012 6343 6317 5966 5615 5587 5500 5309 5283 5144 3211 2916 2438 1791 1674 631 482 26897 52 42578 2089 1036 638 1945
NM_003036chr161194 1000 935 928 849 496 1177 ----
NM_003043chr364226 2775 1376 419 382 304 11458 24231 4105 --
NM_003046chr865326 1979 1304 1108 1060 561 23876 3426 --1956
NM_003047chr121462 43 ------
NM_003051chr161947 1912 1563 1544 1512 804 --21709 664 --
NM_003060chr531200 943 811 --3874 813 472 --
NM_003068chr85988 311 279 83 41 --1313 --
NM_003069chrX3581 255 188 ----1584
NM_003070chr91699 ------
NM_003071chr341833 1692 1395 259 3365 154 101 11379 --
NM_003074chr362103 1913 1520 801 399 103 31546 1535 758 22286 537 --
NM_003075chr12--1338 ----
NM_003076chr1261678 1639 1403 1179 1035 186 --21691 170 --
NM_003077chr171579 --1581 --
NM_003079chr17198 --2200 198 1276
NM_003081chr203265 189 170 --162 --
NM_003082chr142196 38 1556 ----
NM_003088chr74877 711 390 290 11087 ----
NM_003093chr61215 ------
NM_003095chr121377 1331 1281 --
NM_003099chr15145926 5688 5395 5240 5004 2464 2210 1896 1427 1308 766 496 333 187 22140 1830 1711 21980 760
NM_003100chr52358 324 ------
NM_003101chr121645 607 ------
NM_003104chr1531232 1073 281 --2990 93 --
NM_003106chr32887 252 ------
NM_003107chr642096 1730 1053 896 1426 1670 1899
NM_003108chr2207028 6603 6466 6232 5643 5531 5146 5051 4782 4671 2124 1766 1758 1052 1036 943 784 548 367 23 36205 5008 676 77270 5426 5004 4787 4652 2582 1874 15088
NM_003110chr1721096 752 ----1775
NM_003111chr261406 1154 1085 1022 412 83 ------
NM_003112chr772853 1987 1297 533 513 408 355 --22783 2635 21019 516
NM_003113chr22806 25 ------
NM_003114chr83775 195 25 2648 559 ----
NM_003128chr252631 2406 1740 1131 39 --1586 --
NM_003129chr81281 ------
NM_003131chr692288 2266 1958 1567 790 504 207 72 63 11483 11878 --
NM_003133chr14838 333 137 50 ------
NM_003136chr144143 120 101 72 --2155 128 --
NM_003137chr662230 1395 548 94 79 72 31858 748 380 ----
NM_003139chr113801 676 51 ------
NM_003140chrY1101 --1106 --
NM_003142chr21228 ------
NM_003144chr662190 2136 2105 839 340 324 1179 ----
NM_003145chr1--1470 1104 --
NM_003146chr11121 ------
NM_003149chr361656 1433 1101 1040 582 536 ------
NM_003150chr1732347 1937 511 ------
NM_003152chr17125 --1204 --
NM_003153chr1211022 --11024 139
NM_003155chr892527 2421 2300 2260 2232 2074 853 617 552 1116 22324 2265 1248
NM_003156chr1111354 ------
NM_003161chr17133553 3505 3446 3349 2876 2667 2362 2192 1197 1081 634 511 249 --12308 --
NM_003162chr23994 911 824 1166 ----
NM_003164chr113544 441 431 ------
NM_003170chr171120 ------
NM_003176chr11230 ------
NM_003176chr11230 ------
NM_003178chr361906 856 595 489 296 210 --12239 --
NM_003183chr23725 596 244 1319 ----
NM_003185chr202138 95 11214 ----
NM_003186chr111429 --1431 --
NM_003188chr62857 831 --1162 --
NM_003189chr163343 3265 3043 2148 556 254 33000 2979 1311 1172 --
NM_003194chr64554 548 418 40 1438 ----
NM_003199chr1885001 4085 3707 3690 3482 931 713 344 25176 2129 34643 3937 3661 --
NM_003201chr104761 749 716 125 ------
NM_003203chr272089 2083 689 376 341 275 255 31811 783 367 21699 85 --
NM_003204chr1751364 1331 1286 597 119 ------
NM_003206chr61314 ------
NM_003211chr122532 271 --11259 --
NM_003216chr2293337 3212 3170 2045 1029 844 768 655 413 23092 3007 12154 --
NM_003217chr1231907 1783 248 --1528 11910
NM_003220chr641682 1635 1200 606 1393 ----
NM_003221chr684124 3940 3424 3380 3095 1028 547 506 13213 1988 --
NM_003223chr164731 724 715 683 --2650 134 1123
NM_003224chr202856 131 1116 ----
NM_003234chr392431 2307 2117 2050 1483 733 674 530 274 11562 --22323 2150
NM_003242chr342250 1559 896 699 22459 2346 32406 1829 615 1956
NM_003244chr182464 341 ------
NM_003246chr1561898 1759 1462 1330 1311 113 21976 1717 1115 --
NM_003247chr641765 1523 289 133 32035 1866 1292 ----
NM_003253chr21101619 1611 1574 1511 1346 1284 647 473 415 223 11861 1549 --
NM_003255chr172711 463 12196 12367 --
NM_003257chr1531386 897 566 ------
NM_003259chr19--1130 ----
NM_003262chr395059 4215 4174 3908 3774 3701 1536 1407 1273 31386 489 51 24261 3612 --
NM_003269chr641178 997 356 22 --11258 --
NM_003270chrX1364 ------
NM_003274chr21102583 2123 2082 2048 1885 1190 853 801 336 70 --22407 203 1504
NM_003275chr92377 196 --11119 --
NM_003285chr13515 348 34 1339 ----
NM_003286chr202972 836 11121 ----
NM_003288chr2071536 1155 1130 601 496 388 379 ------
NM_003290chr19----160 --
NM_003291chr131204 ------
NM_003292chr152292 1742 505 462 163 ------
NM_003298chr3126067 6011 5895 4438 4236 3923 3851 2452 1573 1522 1207 498 25701 239 25607 5094 12033
NM_003299chr12163 ------
NM_003300chr142445 326 ------
NM_003304chr331411 501 260 --11249 --
NM_003311chr11------1258
NM_003314chr5------1153
NM_003317chr144870 785 300 176 --1104 --
NM_003318chr61202 ------
NM_003319chr23932 156 43 ------
NM_003320chr1174375 4127 3543 3328 3061 3011 315 --12753 --
NM_003324chr1231397 396 226 ------
NM_003326chr152502 2077 749 634 75 22580 215 22347 296 --
NM_003337chr531237 688 25 --11441 --
NM_003338chr1031961 1952 1454 ------
NM_003339chr511507 --1278 1618
NM_003340chr451194 868 177 109 75 ------
NM_003342chr1792477 2313 1289 1099 1016 857 850 540 391 22172 1000 22877 515 --
NM_003344chr791710 1683 1603 1507 1339 1098 703 538 21 1357 ----
NM_003345chr162207 195 ------
NM_003347chr2251649 358 268 218 146 --2480 270 --
NM_003348chr1251597 1564 1375 1112 60 ------
NM_003349chr2011502 183 ----
NM_003350chr83921 824 207 11014 ----
NM_003352chr25873 832 110 62 22 --1676 --
NM_003359chr441138 1124 1026 949 ------
NM_003367chr191483 ------
NM_003368chr14814 618 295 91 ------
NM_003369chr1162570 2504 2069 581 528 208 ----1666
NM_003370chr19----1214 1597
NM_003371chr942163 816 456 34 --12165 --
NM_003373chr1061941 1759 526 388 366 142 --31950 1807 168 --
NM_003374chr52519 253 174 ----
NM_003376chr641348 571 432 275 ------
NM_003376chr641348 571 432 275 ------
NM_003383chr9----187 --
NM_003387chr262416 1879 946 370 179 83 12028 ----
NM_003390chr1141060 886 440 203 --1813 --
NM_003392chr3103931 3386 3150 3087 1703 1417 1024 866 350 260 33924 2779 1214 53933 3609 3607 2693 1712 14354
NM_003394chr123669 508 56 --2660 222 --
NM_003400chr25759 616 153 124 27 ------
NM_003403chr141330 ------
NM_003404chr2021868 1389 12002 21853 1851 --
NM_003405chr224672 576 548 60 ------
NM_003406chr831910 1739 1237 21873 1309 ----
NM_003407chr192574 125 ------
NM_003409chr1831250 921 158 31454 1310 1040 ----
NM_003410chrX103077 2623 2080 1240 1196 1028 826 650 622 607 11106 --1330
NM_003411chrY61645 1151 1121 672 665 613 --1139 1315
NM_003412chr372839 2299 1034 919 357 343 207 --32841 2674 1064 --
NM_003413chrX41990 452 378 244 21715 693 1180 --
NM_003418chr3366 53 30 ------
NM_003423chr1922353 1873 11855 11005 --
NM_003430chr1931435 1201 319 1232 --1586
NM_003432chr51193 ------
NM_003439chr782854 2649 2154 1407 1364 1309 596 282 1803 ----
NM_003440chr123864 764 246 ----1198
NM_003442chr112574 47 ----1257
NM_003453chr133569 305 218 --1680 --
NM_003454chr1621363 1196 11356 ----
NM_003455chr1161699 1459 1444 1238 137 94 ------
NM_003457chr172225 191 --2544 45 --
NM_003458chr373780 2907 1621 1301 921 857 190 --1951 12521
NM_003463chr622172 834 13036 22649 2565 --
NM_003468chr2104321 3503 3038 2994 2931 2726 1392 676 261 172 --41401 1118 678 241 --
NM_003469chr2165 ----1446
NM_003470chr1651372 1329 1162 663 500 11214 11895 --
NM_003471chr372335 1643 1565 1486 441 205 82 1573 12340 --
NM_003473chr1031096 861 180 ------
NM_003474chr1072384 2018 1944 1545 1466 776 459 ------
NM_003478chr11103352 3079 3037 2258 2155 639 468 418 337 201 22861 2544 22372 342 --
NM_003482chr1252757 2487 2126 198 50 --2775 535 11781
NM_003483chr1272955 2193 1050 968 882 288 46 12798 31180 1067 543 22706 702
NM_003487chr17----188 --
NM_003488chr174950 738 187 28 1650 1321 --
NM_003489chr2173366 2841 2129 612 421 367 31 33431 2556 275 1846 --
NM_003498chr1672728 2531 2248 1029 1022 1005 967 12763 ----
NM_003503chr11203 1384 1820 1475
NM_003505chr751300 397 382 331 120 --11571 --
NM_003506chr881329 1275 1206 1174 1157 1112 391 91 1536 --1271
NM_003507chr261868 1805 1584 1562 1328 756 11883 1506 --
NM_003509chr6----153 --
NM_003511chr6----139 --
NM_003512chr6----152 --
NM_003517chr1----135 --
NM_003518chr6139 ------
NM_003520chr6----156 --
NM_003521chr6----153 --
NM_003522chr6------138
NM_003524chr6----132 --
NM_003525chr6------145
NM_003527chr6----135 --
NM_003529chr6158 --140 --
NM_003531chr6----136 --
NM_003532chr6----139 --
NM_003536chr6----140 --
NM_003538chr6149 ------
NM_003542chr6167 ------
NM_003545chr6154 ------
NM_003547chr6159 ------
NM_003549chr32388 48 --128 --
NM_003557chr171071 539 523 317 182 150 89 193 ----
NM_003559chr1783434 3285 3112 3087 2499 1481 993 244 12525 22753 2414 --
NM_003563chr1731263 1117 1027 11427 ----
NM_003565chr1221472 1407 1218 ----
NM_003566chr1293239 2125 883 755 744 733 643 501 456 ----1167
NM_003567chr12443 32 ------
NM_003568chr12306 235 ------
NM_003569chr63591 544 485 3535 194 176 --1573
NM_003573chr19--1268 ----
NM_003574chr18175658 5573 4517 3714 3501 3495 2051 1902 1843 1491 1238 1124 1012 961 509 40 29 11560 21702 1354 15321
NM_003576chr1352703 2015 1044 927 46 12200 11998 --
NM_003581chr24950 300 245 118 ------
NM_003582chr11158 ------
NM_003583chr12102873 2865 1336 1258 1202 1068 1021 849 400 121 1682 2792 782 1811
NM_003586chr16----1616 --
NM_003587chr6139 ------
NM_003589chr1341377 1286 1167 183 1212 11224 --
NM_003591chr103308 277 118 ------
NM_003597chr282182 1854 1795 615 548 445 190 46 1487 32297 2053 159 1326
NM_003603chr482117 2068 1904 1491 1467 658 471 449 --11538 --
NM_003607chr1124279 4082 4032 3848 3182 2973 2653 1614 1573 1190 913 69 ----11567
NM_003610chr201348 ------
NM_003613chr151126 --125 --
NM_003615chr3193849 3695 3475 3465 3345 3054 3020 3002 2978 2889 2654 2565 1318 978 832 771 530 245 183 23853 1331 32567 1290 292 23468 790
NM_003618chr231016 1005 245 --11191 --
NM_003621chr111144 --1506 --
NM_003622chr1242092 1750 215 55 41995 501 219 45 ----
NM_003624chr1911180 ------
NM_003626chr1151292 1223 1021 1004 231 11282 ----
NM_003628chr22135 29 1708 ----
NM_003629chr153455 2372 851 436 360 33024 2127 43 32954 2374 1326 --
NM_003631chr1091003 815 788 639 412 324 264 225 139 1229 ----
NM_003633chr562611 2302 2172 2048 608 327 --22384 942 1611
NM_003642chr2139 ------
NM_003644chr17136270 5018 4186 4034 2179 2149 2119 1996 1614 1475 1099 1055 352 16237 11697 14235
NM_003646chr111605 ------
NM_003660chr191673 --1263 --
NM_003663chr392620 2523 2500 2176 922 846 448 432 271 22438 777 ----
NM_003670chr361474 1353 1168 1124 380 298 ------
NM_003671chr983130 2996 2804 2337 2296 2270 739 392 13295 12927 --
NM_003672chr151517 783 588 50 31 ----11520
NM_003679chr1103088 2986 2944 2402 2270 2118 1324 1188 1120 411 23013 2719 1322 11327
NM_003680chr14251 121 54 27 ------
NM_003685chr196929 644 364 207 41 23 ------
NM_003688chrX2200 59 ------
NM_003692chr92317 55 --1382 --
NM_003701chr133711 703 393 ------
NM_003702chr82666 91 ------
NM_003704chr41675 ------
NM_003711chr5183 140 ----
NM_003713chr11632 --1700 --
NM_003716chr33715 702 87 ------
NM_003718chr71434 ----150
NM_003722chr362664 2486 1797 767 657 21 22547 697 22719 659 --
NM_003725chr123448 440 106 ------
NM_003735chr5111796 1767 1717 1684 1490 1392 1299 1238 669 644 387 ------
NM_003736chr5111796 1767 1717 1684 1490 1392 1299 1238 669 644 387 ------
NM_003740chr621787 40 ------
NM_003743chr262214 2167 788 749 106 71 ------
NM_003744chr1421175 253 1975 1100 --
NM_003746chr121240 1212 ----
NM_003749chr1352217 834 336 186 100 1328 21690 806 --
NM_003750chr107967 832 825 814 725 701 205 ------
NM_003758chr1521275 116 ------
NM_003758chr1521275 116 ------
NM_003759chr494090 4006 3596 3561 3520 3510 3071 1267 813 13329 23962 3144 --
NM_003760chr13789 263 250 --1265 --
NM_003762chr12167 104 21236 192 ----
NM_003763chr2073081 2945 2473 1977 1069 566 408 1726 ----
NM_003766chr171497 ------
NM_003768chr121721 732 --21827 199 --
NM_003769chr12123 ------
NM_003772chr115380 346 168 70 50 1295 2382 336 --
NM_003774chr12102834 2439 2415 2173 1311 1266 1186 771 737 452 22623 504 43292 2420 2178 251 13129
NM_003778chr31139 ------
NM_003779chr12419 309 1486 1446 --
NM_003780chr12213 197 ------
NM_003783chr12377 279 ------
NM_003784chr183705 242 113 1641 ----
NM_003787chr1871699 1485 1454 1267 1188 624 599 31633 1489 104 ----
NM_003794chr34870 717 429 23 ----1873
NM_003795chr61217 ------
NM_003798chr92134 79 ------
NM_003799chr18174466 4450 4106 3880 3632 3351 2872 2812 2799 1575 1303 1085 960 753 722 651 312 ------
NM_003800chr692400 2281 2235 2037 2000 1826 1582 1530 793 11749 --11547
NM_003812chr21264 ------
NM_003816chr841500 1044 73 62 1371 11305 --
NM_003818chr2031015 312 111 ------
NM_003822chr143092 1268 915 493 ------
NM_003825chr1581390 620 613 288 205 162 153 68 ----1100
NM_003829chr92188 140 2774 491 1193 --
NM_003831chr1841758 608 504 124 ----1703
NM_003838chr131604 1554 320 1291 --11437
NM_003842chr841591 929 168 49 22270 1965 11593 --
NM_003850chr134234 217 210 81 1517 ----
NM_003858chr142614 27 149 ----
NM_003861chr1452570 2219 2028 1952 600 --22899 2107 12523
NM_003872chr2102979 2226 2220 932 688 538 468 436 391 271 1891 2868 641 --
NM_003873chr1062270 948 826 592 518 330 12394 1126 --
NM_003877chr122926 316 --1692 --
NM_003883chr53393 167 38 ------
NM_003884chr351737 1639 713 497 158 41716 1319 387 246 --11690
NM_003885chr1762500 2306 1933 1908 781 591 11030 32311 615 394 --
NM_003887chr221630 336 1751 12303 --
NM_003888chr1571459 1325 1313 1235 1100 524 421 31716 1484 643 11256 --
NM_003895chr2162048 1578 746 303 291 217 21531 698 1772 --
NM_003899chr1352612 2475 1748 1672 597 --22150 2081 --
NM_003901chr1092684 2449 2163 1939 1044 853 660 590 156 22670 1887 3961 518 477 1273
NM_003902chr14848 633 555 533 ------
NM_003905chr162122 106 ------
NM_003913chr674167 3524 3231 1577 1569 1279 1114 23360 154 11131 13212
NM_003919chr7168 --295 70 --
NM_003922chr151178 ------
NM_003924chr441539 1465 1402 1209 --21407 662 --
NM_003927chr1841022 772 445 227 ------
NM_003930chr762424 2317 2285 1921 1711 25 22139 709 ----
NM_003931chr64612 198 123 100 ------
NM_003932chr2271851 1780 1401 487 470 323 297 --21938 769 --
NM_003934chr981261 1176 1164 1095 917 405 352 239 2907 149 ----
NM_003936chr23783 412 244 ------
NM_003939chr10114018 3275 3143 3100 1521 988 896 689 653 637 246 1240 52972 2677 1493 990 888 --
NM_003941chr772494 2102 2031 1865 414 380 365 11715 1730 --
NM_003945chr52499 484 --195 --
NM_003947chr341338 1195 414 204 11001 ----
NM_003948chr4112620 2398 2236 2197 1736 1053 1011 743 424 132 55 22511 704 1843 --
NM_003953chr162890 2611 2564 2264 574 267 ------
NM_003954chr1731474 1164 277 --11219 --
NM_003955chr1721391 390 11458 ----
NM_003957chr111762 --11097 --
NM_003958chr693658 3649 3188 2506 1327 1267 1074 865 836 1850 52706 874 872 427 285 --
NM_003968chr31108 1254 2279 131 --
NM_003971chr17----284 41 --
NM_003972chr10--2419 372 ----
NM_003973chr3133 ------
NM_003980chr661062 1042 578 416 272 216 1102 --1173
NM_003983chr16134483 4225 4044 3837 3710 3289 1615 1358 1299 551 471 452 400 --34148 1148 1117 --
NM_003987chr1072261 1859 1698 1563 838 740 558 ------
NM_003988chr1072338 1936 1775 1640 915 817 635 ------
NM_003989chr1072197 1795 1634 1499 774 676 494 ------
NM_003990chr1072197 1795 1634 1499 774 676 494 ------
NM_003993chr1--132 ----
NM_003994chr1283505 3000 2685 1684 811 607 463 384 11392 23094 1642 --
NM_003998chr41143 1481 1588 --
NM_004001chr15573 520 447 239 124 1458 1222 --
NM_004006chrX62293 2043 2019 1739 1719 562 12306 12159 --
NM_004007chrX62293 2043 2019 1739 1719 562 12306 12159 --
NM_004009chrX62293 2043 2019 1739 1719 562 12306 12159 --
NM_004010chrX62293 2043 2019 1739 1719 562 12306 12159 --
NM_004011chrX62293 2043 2019 1739 1719 562 12306 12159 --
NM_004012chrX62293 2043 2019 1739 1719 562 12306 12159 --
NM_004013chrX62293 2043 2019 1739 1719 562 12306 12159 --
NM_004014chrX62293 2043 2019 1739 1719 562 12306 12159 --
NM_004015chrX62293 2043 2019 1739 1719 562 12306 12159 --
NM_004016chrX62207 1957 1933 1653 1633 476 12220 12073 --
NM_004017chrX62293 2043 2019 1739 1719 562 12306 12159 --
NM_004018chrX62207 1957 1933 1653 1633 476 12220 12073 --
NM_004019chrX3360 187 110 ----198
NM_004020chrX62293 2043 2019 1739 1719 562 12306 12159 --
NM_004021chrX62207 1957 1933 1653 1633 476 12220 12073 --
NM_004022chrX62207 1957 1933 1653 1633 476 12220 12073 --
NM_004023chrX62207 1957 1933 1653 1633 476 12220 12073 --
NM_004024chr121500 323 ------
NM_004027chr2172 ------
NM_004028chr18134101 3849 3016 2998 2976 2914 2872 2695 2550 1621 1521 1323 612 1479 13548 --
NM_004040chr211164 --1261 --
NM_004041chr114244 101 87 68 ------
NM_004050chr1422170 2025 --12287 12315
NM_004056chr81392 ------
NM_004059chr93435 164 55 --1124 --
NM_004067chr741584 1413 1252 220 ------
NM_004071chr21268 ------
NM_004075chr124435 404 84 58 ------
NM_004077chr1231184 1095 177 1877 1958 --
NM_004078chr12964 43 ------
NM_004080chr73602 548 286 --21320 567 --
NM_004081chrY31883 1395 255 1703 --11193
NM_004085chrX2805 103 --1279 --
NM_004086chr14--1631 ----
NM_004087chr382060 1756 1554 612 342 137 57 44 --2462 27 --
NM_004089chrX--21290 815 1455 --
NM_004093chr1323135 951 --12860 --
NM_004094chr1432219 2050 434 1485 ----
NM_004096chr1071977 1896 1640 1531 1503 668 185 1704 21642 778 --
NM_004099chr971646 1571 1482 1374 845 451 438 21398 795 31972 1898 84 --
NM_004100chr662570 2538 2259 562 555 378 --22386 612 --
NM_004103chr86802 764 740 715 709 697 1830 3804 750 748 --
NM_004112chr1731636 380 286 --1554 --
NM_004113chr352016 1745 775 763 21 11947 --11967
NM_004114chrX61261 1183 879 455 368 256 2472 65 2502 500 --
NM_004116chr21453 ------
NM_004124chr1463553 2722 2171 538 519 131 33174 2323 901 2628 231 --
NM_004130chr31574 ------
NM_004134chr5192 ----1601
NM_004136chr1563011 2910 2882 2361 488 166 1912 ----
NM_004145chr191710 1380 ----
NM_004156chr82605 463 ------
NM_004157chr31747 ------
NM_004161chr271392 1316 1248 1032 509 458 348 --121 --
NM_004162chr32385 33 --1935 --
NM_004163chr181114 ------
NM_004169chr172153 133 ------
NM_004170chr91599 1138 ----
NM_004171chr11239511 9283 9216 8246 8206 7923 7148 7083 7011 6581 6318 5899 3172 2831 2604 2345 2316 1935 1837 1824 1179 567 216 67097 6714 6703 6550 6003 1112 59094 7393 2467 327 297 21711 1042
NM_004175chr225475 175 108 93 35 ------
NM_004180chr22461 135 ------
NM_004181chr42111 37 --1344 --
NM_004187chrX31338 1286 61 --1428 --
NM_004193chr102400 88 ----1408
NM_004200chr1153233 2799 2291 1197 347 --1241 --
NM_004202chrY--167 ----
NM_004209chr161949 ------
NM_004210chr1061866 845 575 109 90 36 ------
NM_004215chr82410 213 ------
NM_004225chr841385 994 600 62 ----11377
NM_004226chr21111 ------
NM_004229chrX92170 2115 1732 1629 1529 693 668 321 177 --42124 1903 1734 874 11714
NM_004232chr18143723 3523 3381 3321 2921 2901 1512 1177 1063 931 653 629 408 90 73477 2773 2458 1067 676 599 583 1759 --
NM_004233chr681456 1136 591 412 403 233 159 22 --1382 --
NM_004235chr9160 2738 218 ----
NM_004236chr15----1429 --
NM_004238chr2161 ----164
NM_004241chr101119 ------
NM_004242chr6--1323 ----
NM_004252chr171152 1136 ----
NM_004261chr131021 772 377 1105 ----
NM_004263chr251623 1483 1350 429 109 ------
NM_004267chr31558 1485 ----
NM_004272chr581398 778 677 586 449 293 137 51 11282 ----
NM_004273chr1054724 4615 4396 1403 735 --11560 --
NM_004274chr14103188 3119 2985 2888 2726 2534 2223 347 218 175 12044 1317 11028
NM_004277chr651173 579 170 151 93 21484 247 2475 182 --
NM_004279chr741884 1459 798 537 ------
NM_004281chr101406 1177 1173 --
NM_004283chr192601 315 --1373 --
NM_004285chr1115375 4635 4496 2541 1695 1588 1493 1339 779 695 599 16418 35377 1963 1556 --
NM_004288chr21888 3769 385 299 ----
NM_004290chr571248 1124 1067 1032 523 297 105 ------
NM_004291chr5----1130 --
NM_004293chr983792 3145 3017 3000 2356 1437 1342 1112 11095 12808 --
NM_004295chr1721175 1068 --11090 --
NM_004296chr1463985 3972 3428 3222 1506 634 1784 21508 239 --
NM_004299chrX122 197 ----
NM_004301chr3185 ------
NM_004302chr1242904 2863 2571 2460 --1724 1192
NM_004305chr2296 67 --1358 --
NM_004308chr1171688 1463 611 418 261 187 54 ------
NM_004311chr1043040 2319 2254 611 21981 284 ----
NM_004313chr172123 97 1451 ----
NM_004316chr1211105 ------
NM_004319chr172764 2537 2521 2488 2213 555 163 12481 ----
NM_004323chr952171 2086 1964 193 85 --22254 237 --
NM_004326chr171028 994 972 843 758 406 368 --1370 --
NM_004329chr1021444 108 ------
NM_004330chr153776 306 200 2927 439 ----
NM_004331chr882614 2124 2026 1734 1688 902 727 265 1626 --1730
NM_004337chr861979 1912 1865 1632 259 85 31503 721 672 1261 --
NM_004338chr18137034 6867 6841 6794 5912 4965 4704 2310 1755 1631 994 648 446 15636 35136 4967 4698 16928
NM_004341chr2--1236 124 --
NM_004342chr752304 2221 2090 1618 1454 31983 1733 114 --1255
NM_004344chrX2421 93 ----1427
NM_004349chr841194 1127 915 227 --21304 229 --
NM_004354chr43826 299 236 ------
NM_004356chr111172 ------
NM_004360chr1641950 1641 329 234 --11723 --
NM_004370chr661879 1725 1458 1443 762 567 --31445 646 167 11834
NM_004371chr141297 189 137 99 ----1146
NM_004374chr8124 ------
NM_004379chr25653 595 324 247 99 2105 87 ----
NM_004380chr1692411 2218 2211 727 289 237 200 77 23 2737 494 1729 --
NM_004382chr1731055 724 329 --1731 --
NM_004384chr5102262 2178 1878 1691 1579 1430 409 309 179 162 --1414 --
NM_004385chr53683 528 498 1252 2719 664 --
NM_004386chr1982125 2102 1895 1614 1470 803 752 375 1870 21913 158 12105
NM_004389chr24730 51 38 31 1569 140 1593
NM_004391chr331512 1418 188 11334 --21688 1635
NM_004392chr13102657 2647 1871 1831 1705 1669 693 554 515 168 42577 2485 1818 326 1351 --
NM_004393chr332363 1461 255 1402 11578 --
NM_004395chr52700 529 --2184 179 --
NM_004396chr17146 ------
NM_004397chr11172994 2755 2748 2727 1544 1352 1011 936 762 674 598 570 547 529 262 137 77 3557 494 96 ----
NM_004403chr71171 ------
NM_004407chr42847 718 1878 ----
NM_004414chr214583 488 301 83 21231 54 1303 --
NM_004415chr65611 593 537 276 178 --2595 282 --
NM_004416chr121661 --11035 --
NM_004417chr52593 25 1598 ----
NM_004419chr104972 732 712 295 11019 1698 --
NM_004423chr372524 2244 1085 1075 778 769 75 --1771 --
NM_004426chr124591 537 498 194 2685 427 11579 --
NM_004428chr1----1801 --
NM_004429chrX31463 1449 1398 1546 11033 --
NM_004430chr872585 1852 1043 997 986 620 28 --1799 --
NM_004432chr992389 1712 743 634 596 412 386 369 308 1193 1310 --
NM_004433chr121587 1289 2681 525 11297 --
NM_004434chr1431894 697 307 ----1297
NM_004438chr253199 2546 1128 925 544 23254 3169 22530 239 --
NM_004439chr4123 ------
NM_004440chr631226 737 438 11664 ----
NM_004441chr341197 497 406 384 --2413 408 --
NM_004442chr141556 1150 587 27 ------
NM_004443chr32303 189 ------
NM_004444chr72570 547 1584 ----
NM_004446chr1265 24 --1172 --
NM_004447chr123731 228 95 --1454 --
NM_004449chr211931 ------
NM_004450chr142324 251 ------
NM_004454chr352313 2173 1966 1811 663 ----21610 510
NM_004457chr231267 606 255 --41636 1631 1593 188 --
NM_004458chrX62303 2101 1797 1688 843 469 ------
NM_004459chr1762035 1259 799 547 457 344 --1549 --
NM_004464chr494250 3083 3032 1533 1140 659 460 429 310 1560 1895 --
NM_004468chr11541 ----162
NM_004472chr51440 --154 --
NM_004475chr1781127 958 837 786 269 253 186 24 ------
NM_004480chr142703 181 1261 ----
NM_004481chr182675 2454 2098 2015 1816 979 962 255 1584 1981 --
NM_004482chr24912 777 755 127 1765 1672 --
NM_004484chrX1337 184 ----
NM_004485chr1143860 3814 2932 2826 2777 2766 2760 2683 1307 1051 862 535 182 150 --64377 3212 2892 2805 1068 31 --
NM_004491chr1933898 3041 444 --11370 --
NM_004496chr1441194 1155 315 304 ------
NM_004497chr191589 ------
NM_004498chr15--1335 ----
NM_004500chr1461903 1675 1586 776 336 252 31719 1262 572 ----
NM_004501chr194086 3894 3586 3301 1248 994 560 151 65 1331 1156 --
NM_004502chr171375 ------
NM_004504chr292825 2714 2483 2193 2016 1202 1063 1056 296 2927 540 21923 1905 1516
NM_004506chr63499 283 256 --1143 --
NM_004514chr1732640 2431 808 1956 ----
NM_004516chr1951213 1029 978 508 119 ------
NM_004519chr82195 160 ----1248
NM_004520chr52756 745 1277 1158 --
NM_004523chr1051355 1229 1163 570 451 1547 1613 --
NM_004525chr221091 149 --11093 --
NM_004527chr1751439 1174 1064 203 81 21417 170 ----
NM_004528chr1--174 ----
NM_004529chr941413 1034 490 164 1967 1233 --
NM_004535chr2031472 477 252 11368 ----
NM_004537chr1251447 1353 1297 1210 393 2441 367 ----
NM_004538chrX3735 692 219 ------
NM_004539chr185739 207 119 109 51 ------
NM_004554chr1441769 1574 372 114 ------
NM_004566chr1072302 2251 1663 1017 967 856 94 --1549 --
NM_004571chr2173400 3237 2638 2252 2237 2111 1311 1323 ----
NM_004574chr17----140 --
NM_004575chr451463 1348 576 521 266 11127 471 62 50 48 --
NM_004576chr51286 ------
NM_004578chr14917 873 655 224 191 ----
NM_004583chr175748 725 489 249 242 ------
NM_004586chrX55373 4330 3812 1992 1202 15117 34020 3387 159 --
NM_004588chr11104025 3399 3243 3098 3092 2922 2841 2793 2690 181 --11630 --
NM_004592chr12------1244
NM_004593chr3--2774 303 ----
NM_004598chr593278 3242 3104 3091 3020 2561 2444 1048 993 11077 3938 868 98 12772
NM_004599chr22198 1455 ----
NM_004600chr151505 1173 1041 1008 367 ------
NM_004602chr2041298 599 563 331 ----1504
NM_004612chr994049 3815 3611 3244 1521 1467 1089 763 33 34460 1175 1025 14549 --
NM_004619chr131731 637 161 12045 22236 1759 1282
NM_004620chr111147 ------
NM_004622chr261921 1724 1564 524 348 117 21716 373 21579 288 --
NM_004626chr114554 526 475 456 ------
NM_004627chr213710 511 48 1178 ----
NM_004630chr1151209 1105 891 250 241 ------
NM_004631chr121024 1011 1207 11232 --
NM_004635chr32940 870 195 ----
NM_004637chr381328 1204 993 986 856 428 346 82 --11159 --
NM_004639chr6187 ------
NM_004642chr122478 34 ------
NM_004643chr141549 ------
NM_004645chr171275 --1749 --
NM_004651chrX1337 ------
NM_004654chrY1560 ------
NM_004660chrY42207 1953 655 232 ----1725
NM_004661chr531261 1217 258 --199 --
NM_004663chr1561454 1384 1164 604 261 137 21458 1089 1411 --
NM_004664chr12--1267 ----
NM_004666chr621368 117 1260 2413 21 --
NM_004670chr1071460 1265 1187 494 457 377 37 2263 110 21651 424 151
NM_004671chr183130 79 49 ------
NM_004680chrY--156 ----
NM_004685chr1352771 2022 1976 1106 556 1811 --12461
NM_004686chr841778 1607 677 565 2413 380 1612 --
NM_004687chr1751588 1557 841 271 52 ------
NM_004689chr141451 ------
NM_004694chr173707 295 237 ------
NM_004697chr95944 867 787 266 97 ------
NM_004701chr152161 46 1123 1108 --
NM_004703chr1752344 1829 955 724 361 --1795 --
NM_004705chr113732 723 188 ------
NM_004709chrX41438 565 450 256 --51569 1567 1548 1311 224 --
NM_004710chr172778 93 ------
NM_004711chr2242987 2741 2508 656 13419 ----
NM_004713chr143750 551 260 ------
NM_004714chr19--1226 ----
NM_004715chr183693 605 97 ------
NM_004716chr114902 890 877 856 --4861 810 783 34 --
NM_004717chr711389 21338 1177 1432 --
NM_004723chr151028 856 691 684 237 ------
NM_004725chr1071329 1202 1188 1137 1117 497 397 --11471 --
NM_004726chrX95523 5153 4297 3839 3712 1736 1674 1399 55 74815 4333 4006 1660 623 347 295 45680 5303 5167 142 24854 4702
NM_004730chr522005 1792 ------
NM_004733chr31547 --1237 --
NM_004734chr1393116 3051 3015 2716 2374 2306 1056 1044 654 12960 1599 --
NM_004736chr191930 1856 1841 1416 749 621 452 174 128 1204 5787 782 559 181 176 --
NM_004737chr2241347 1207 243 123 1904 ----
NM_004738chr2032556 909 744 21005 188 ----
NM_004739chr115658 593 534 456 412 ------
NM_004742chr341865 1652 1543 34 --11249 --
NM_004744chr44933 449 315 188 43765 3757 1046 992 13586 --
NM_004745chr8106919 6668 6515 6493 5888 2018 1556 1113 945 859 35453 1968 1925 25755 4293 15018
NM_004747chr1031578 1349 1020 21504 1423 164 2333 67
NM_004755chr1411087 2844 70 1209 1874
NM_004757chr41275 1623 --1113
NM_004758chr174968 956 316 161 1972 ----
NM_004760chr741610 624 535 522 22218 1979 ----
NM_004762chr1721855 773 --152 --
NM_004764chr122618 204 --129 --
NM_004768chr121069 858 ------
NM_004772chr561358 1351 1113 1045 331 78 --21273 470 --
NM_004774chr17113048 3018 2688 2682 2498 2445 2397 2151 1120 335 214 --22491 2145 --
NM_004775chr1852178 2114 2021 1561 800 --2652 104 --
NM_004779chr551341 1081 912 358 93 1365 1501 --
NM_004781chr13630 459 42 11123 21277 1169 --
NM_004781chr13630 459 42 11123 21277 1169 --
NM_004783chr162526 482 ------
NM_004784chr43124 98 50 ------
NM_004787chr41149 ------
NM_004788chr11112055 1862 966 909 651 353 293 284 275 96 71 --61926 1907 1894 497 102 90 12266
NM_004789chr91359 --1370 --
NM_004791chr132210 37 1121 ----
NM_004794chrX147 ------
NM_004795chr1341509 774 370 338 --1212 --
NM_004796chr1452449 2383 1841 1694 439 --12395 --
NM_004797chr3123603 3576 3244 3216 3200 3139 3006 2753 2456 2421 1341 461 13714 43292 3267 3194 2262 --
NM_004798chr2083618 3536 3107 818 801 626 305 128 1204 22574 2409 22446 349
NM_004799chr12428 24 ------
NM_004800chr13146 ------
NM_004801chr221158 1055 --21160 1057 --
NM_004805chr22912 319 ------
NM_004808chr1022196 1068 22493 317 11042 --
NM_004811chr116476 400 371 214 76 24 --1227 --
NM_004816chr91509 --1239 --
NM_004818chr12179 2653 585 ----
NM_004820chr8170 ------
NM_004821chr56827 619 590 539 510 320 --2609 607 1746
NM_004822chr1743903 3701 3086 2468 ------
NM_004824chr651382 987 485 392 301 ------
NM_004831chr195759 722 695 437 167 --2770 182 --
NM_004834chr262986 2250 701 502 196 187 12847 33102 3100 1326 11353
NM_004835chr3199 --1169 1146
NM_004835chr3199 --1169 1146
NM_004836chr22725 99 ------
NM_004840chrX3796 456 284 22407 849 22371 136 --
NM_004841chr161150 978 805 797 741 190 11046 --1747
NM_004842chr62669 135 11616 --1572
NM_004844chr351151 1131 1077 352 157 --2984 359 --
NM_004845chrX143715 3069 2964 2952 2938 2915 2904 2867 2853 2833 2661 1562 1440 875 12819 32890 2877 2803 --
NM_004850chr261460 334 253 243 150 46 11447 --1337
NM_004857chr1484696 4082 3308 3233 3108 1585 1472 1126 22917 53 21477 1023 23745 3396
NM_004859chr1762404 854 697 260 249 128 ------
NM_004863chr14124616 3545 3486 3322 3267 1438 1245 1217 714 671 649 626 55190 5123 4099 3605 1264 25135 1121 25138 1140
NM_004865chr61414 1362 --1110
NM_004866chr584583 4015 3362 3175 1658 1018 540 46 54981 4890 4653 1652 711 34585 914 548 --
NM_004867chrX2458 232 ------
NM_004869chr1841596 563 339 156 ----198
NM_004871chr17174379 3949 3686 3459 3436 3286 3267 2957 2723 1506 1477 844 464 428 351 292 205 33838 2980 193 23113 388 --
NM_004873chr1483066 3039 2933 2364 2294 2186 543 188 11047 1933 11247
NM_004874chr8----175 --
NM_004879chr115765 654 648 303 240 1254 157 --
NM_004884chr152417 291 --21270 1268 --
NM_004887chr52972 947 ------
NM_004888chr97880 830 683 296 259 244 200 --1882 --
NM_004891chr21170 ------
NM_004893chr52418 401 ------
NM_004895chr1--1503 1591 --
NM_004896chr102621 611 --1375 --
NM_004897chr104829 812 263 120 --1926 --
NM_004898chr492842 2727 2623 2609 2272 1128 730 626 481 11161 12675 12138
NM_004902chr202536 38 169 1728 --
NM_004904chr7216527 5863 5093 5042 4955 4720 4350 2576 1962 1573 1339 1283 1150 813 627 607 565 507 421 242 109 32245 157 61 74732 4647 4645 1632 1332 278 232 --
NM_004906chr63559 150 135 --1155 --
NM_004912chr731622 1539 1391 --11624 --
NM_004922chr1011006 --1222 --
NM_004923chr112670 529 --1178 --
NM_004924chr1931035 344 167 ------
NM_004926chr1481782 1497 1347 1312 677 557 413 213 11261 169 --
NM_004929chr831368 470 144 187 ----
NM_004930chr12589 69 --1606 --
NM_004932chr521750 519 21692 157 ----
NM_004936chr971119 1087 842 295 285 181 39 11187 22156 2038 --
NM_004937chr1731658 893 504 --41971 707 242 240 --
NM_004938chr951237 1102 1040 339 97 1228 1430 1463
NM_004939chr21155 ------
NM_004941chr173460 141 120 ------
NM_004947chr372387 1690 1603 686 551 425 277 ------
NM_004952chr12777 674 --1770 --
NM_004953chr31312 ------
NM_004956chr7154440 4250 3909 3684 3040 2854 2788 1137 1121 974 889 880 135 47 38 1767 21433 1123 13127
NM_004958chr1134 ------
NM_004964chr15558 484 203 176 48 176 ----
NM_004968chr72644 455 ------
NM_004969chr102556 230 1514 ----
NM_004972chr931198 895 169 3826 800 458 ----
NM_004973chr671726 1257 1224 1159 1065 492 117 --11606 --
NM_004975chr2021001 243 --181 --
NM_004976chr1154190 3564 3558 3538 1352 1636 25198 1401 --
NM_004977chr192565 438 ------
NM_004978chr151326 593 511 384 47 ----11602
NM_004979chrX31053 1037 33 --1809 --
NM_004985chr12134325 3701 3685 2962 2796 1585 1376 892 869 708 668 300 21 53689 2888 1544 603 480 31799 1211 894 14424
NM_004992chrX307658 7240 7018 6637 6533 6375 6311 6267 6255 6169 5695 5670 5427 5317 5167 3333 3078 3058 3002 2618 2566 1987 1828 1814 1559 1507 1308 933 189 124 --57162 2369 2051 1219 61 1252
NM_004992chrX307658 7240 7018 6637 6533 6375 6311 6267 6255 6169 5695 5670 5427 5317 5167 3333 3078 3058 3002 2618 2566 1987 1828 1814 1559 1507 1308 933 189 124 --57162 2369 2051 1219 61 1252
NM_004993chr14101246 1018 990 604 551 538 362 307 297 246 21061 234 21381 568 --
NM_004995chr142481 374 ------
NM_004998chr154951 848 725 211 --1942 --
NM_005006chr21794 2788 361 ----
NM_005010chr742262 2036 515 106 --12146 11738
NM_005011chr731620 1410 186 130 11622 --
NM_005016chr122362 258 ------
NM_005020chr74554 86 77 64 ------
NM_005023chr561539 1380 1257 1160 301 289 21386 617 186 --
NM_005026chr13766 512 329 21898 1751 ----
NM_005027chr1941107 1057 154 148 11143 21120 198 --
NM_005028chr1022353 1679 11864 2831 829 --
NM_005032chrX3319 186 114 ------
NM_005040chr114482 335 91 28 272 33 ----
NM_005044chrX84594 4086 3997 3782 2922 2845 1414 93 13024 31353 516 122 --
NM_005045chr74864 846 744 26 2676 60 ----
NM_005055chr113184 170 46 ------
NM_005056chr12155570 5283 5088 5022 4366 3799 2191 2161 2031 1813 1788 1549 1126 449 392 34541 2069 1399 23529 1742 22054 32
NM_005057chr141796 1691 1215 589 ------
NM_005060chr13521 120 79 1998 ----
NM_005063chr10133242 2949 2679 2512 2453 1530 990 958 813 443 382 240 199 1135 33739 3128 818 22952 220
NM_005065chr14115342 5255 4871 4807 3760 1975 1193 1125 946 895 252 35276 4268 1402 23891 257 --
NM_005066chr12218 95 2696 62 ----
NM_005067chr31973 ------
NM_005068chr621409 442 ------
NM_005076chr173800 3607 3585 3502 3142 1257 198 --23609 2919 --
NM_005078chr1551470 1461 1169 414 326 --1334 --
NM_005079chr853154 2617 1214 469 384 21050 358 --12045
NM_005080chr224865 828 739 350 ------
NM_005087chr31775 132 ----
NM_005088chrX1913 ------
NM_005093chr20155238 4798 4745 4453 4358 3576 1661 1341 1331 1255 1092 957 799 710 291 --1528 --
NM_005095chr152183 1499 1454 1373 649 11921 ----
NM_005096chrX61017 1011 447 258 204 167 ------
NM_005097chr102350 294 137 179 --
NM_005102chr21796 ------
NM_005105chr15806 554 273 267 30 1159 ----
NM_005109chr3102563 2259 2112 2044 1785 620 481 419 161 140 --11702 --
NM_005110chr52637 280 --2701 523 --
NM_005112chr421032 172 --31034 863 781 --
NM_005113chr142508 470 140 1513 --
NM_005116chr2031469 1001 964 24475 4438 34069 734 143 --
NM_005117chr113945 365 24 ------
NM_005119chr161009 1000 991 908 448 254 1839 1400 --
NM_005121chr1783424 3369 2616 2384 1364 892 195 81 --33690 2891 438 21410 496
NM_005124chr63323 217 142 --1871 --
NM_005126chr372207 2040 1949 1908 848 671 167 11953 1673 --
NM_005128chr212611 510 --2658 656 --
NM_005133chr112383 372 ------
NM_005134chr181762 2991 911 ----
NM_005135chr15103592 2506 2390 1274 1258 1182 1074 898 583 34 43874 2991 1333 1026 --13168
NM_005140chrX2754 345 1334 2872 290 --
NM_005141chr42170 71 1295 128 --
NM_005151chr1882402 1949 1876 898 792 785 560 314 ------
NM_005153chr163102 87 76 --1749 --
NM_005154chr152567 502 132 ----
NM_005155chr6------1668
NM_005156chr9194962 4076 3955 3785 3579 3453 2136 1964 1699 1624 1596 1416 1376 1306 1145 600 584 195 94 45245 4585 3913 961 55351 4099 3646 1530 1444 --
NM_005157chr961623 1565 1329 407 368 356 11804 11817 11820
NM_005159chr1592134 1896 1659 1589 1562 780 596 588 571 ------
NM_005160chr22136793 6199 5865 5781 5506 4941 4377 4242 2010 1148 504 450 209 46517 5476 1572 398 36610 5743 4640 --
NM_005163chr143989 972 783 ------
NM_005168chr221759 142 1474 ----
NM_005178chr191405 --1163 --
NM_005180chr102239 116 ------
NM_005181chr85735 689 652 335 23 ------
NM_005182chr16141 --1429 --
NM_005184chr1981378 1156 1145 231 212 180 170 69 --31410 1287 49 --
NM_005188chr11388357 7613 7124 7084 6017 5929 5907 5661 5586 5577 5488 5454 5437 3281 3137 3127 3078 2969 2617 2587 2333 2307 2258 2240 2232 2202 2164 1917 1825 1750 1667 1426 1385 1379 1359 1323 1139 478 47860 7834 1557 585 57615 5976 3144 2785 1325 --
NM_005190chr631010 359 152 ------
NM_005194chr202545 479 ------
NM_005197chr14226155 6095 5920 5911 5080 4990 4945 4800 4473 4376 4011 2176 1585 1486 1454 1446 984 904 258 131 124 97 15162 31474 169 133 24729 4340
NM_005201chr3135 ------
NM_005202chr172265 1785 1646 927 885 703 60 --11799 --
NM_005203chr101162 ------
NM_005207chr2263664 1234 1222 495 222 75 13484 23619 420 --
NM_005210chr2123 ------
NM_005214chr22397 120 ------
NM_005219chr531664 488 337 --1399 11283
NM_005221chr71240 --127 --
NM_005222chr78960 758 388 257 233 216 185 176 --1235 --
NM_005227chr13549 474 409 1458 ----
NM_005229chrX3878 852 208 11254 ----
NM_005230chr121121 --1578 --
NM_005233chr392509 2298 2183 2164 2018 827 645 255 163 2670 435 --1514
NM_005235chr2317687 7586 7360 7279 7031 6815 6441 6163 6149 6045 5975 5510 5380 5142 5017 2914 2804 2669 2470 1910 1587 1561 1524 1426 1112 893 743 348 318 216 64 66607 6580 5120 2377 2083 494 57712 2640 2117 1745 355 --
NM_005238chr1142959 2656 2173 605 11168 --13042
NM_005239chr2151762 1390 769 399 357 ------
NM_005241chr351316 1264 1086 454 53 --2946 392 --
NM_005244chr20--1631 1253 --
NM_005245chr42491 218 ------
NM_005249chr14--1709 ----
NM_005252chr144713 539 494 197 1699 2303 301 --
NM_005254chr1551368 1227 1186 1083 301 ----11347
NM_005256chr111795 ------
NM_005257chr1861193 1180 1156 392 382 351 ------
NM_005261chr84995 417 326 235 2989 271 ----
NM_005264chr102814 667 ------
NM_005268chr1------1229
NM_005271chr104425 364 296 34 --1865 --
NM_005277chr441761 1643 637 202 11330 21606 1285 1205
NM_005296chrX1782 --1217 --
NM_005302chr71299 1306 ----
NM_005308chr101416 ------
NM_005311chr7102883 2781 2568 2516 2389 2140 1963 1935 1911 1789 11747 22575 2573 12395
NM_005313chr1561121 982 937 394 146 37 1273 ----
NM_005316chr113919 789 422 --1956 --
NM_005318chr225416 142 71 61 47 --2942 852 --
NM_005321chr6----153 --
NM_005324chr1731373 834 631 ----11702
NM_005326chr16------144
NM_005327chr42659 81 1232 ----
NM_005328chr81589 1788 1568 --
NM_005329chr1621975 936 12131 12265 --
NM_005334chrX51417 543 446 141 29 --2587 451 1572
NM_005336chr262149 1887 1796 1726 403 112 --22024 843 11890
NM_005339chr493941 3426 2963 1593 1325 922 774 754 224 23363 91 33538 1721 40 12623
NM_005342chrX52850 2824 1881 705 327 1960 1862 12518
NM_005347chr931699 682 156 1312 ----
NM_005349chr45636 606 566 485 105 ------
NM_005354chr193655 478 250 ------
NM_005358chr1381844 1671 1513 751 672 581 133 90 11212 ----
NM_005359chr18206197 5345 5234 5077 4993 4382 4362 4303 2464 2086 1950 1893 1353 1149 825 770 743 250 187 107 35437 5008 1735 15909 25963 2391
NM_005369chrX9695 672 647 593 477 279 195 153 34 --1155 --
NM_005370chr1931211 1153 179 --21138 523 --
NM_005373chr141624 1404 496 245 21683 377 --11394
NM_005374chr1762422 2415 2399 1873 1534 903 --22094 1785 --
NM_005375chr63903 163 81 --1389 --
NM_005378chr23827 757 328 ------
NM_005380chr131300 880 259 --21174 238 --
NM_005381chr22314 26 ------
NM_005385chr352418 2148 694 340 240 11837 22500 2420 --
NM_005386chr201732 ------
NM_005387chr111157 ------
NM_005388chr961665 1612 1442 400 88 80 11306 ----
NM_005389chr65724 672 511 208 22 ------
NM_005392chr941353 492 202 113 11216 21737 204 --
NM_005397chr7103984 3846 3832 3066 2898 2652 2519 912 710 154 33589 3348 1190 11403 --
NM_005398chr1031155 1031 264 ----11412
NM_005399chr1134345 4294 4001 3558 2796 2765 1446 1080 1067 1012 895 576 472 13480 64245 4003 3781 2770 1326 897 12686
NM_005400chr2132751 2671 2641 2458 2259 2249 2140 1002 958 883 658 609 416 1328 22870 1965 --
NM_005402chr741522 1418 1375 1154 1389 11156 --
NM_005406chr1821539 135 ------
NM_005407chr1461288 1155 290 198 95 28 --1136 --
NM_005409chr421102 1075 ----1113
NM_005410chr53529 245 238 ----1619
NM_005412chr122492 171 --1173 --
NM_005426chr11667 1281 ----
NM_005429chr4--133 ----
NM_005430chr122994 404 --4848 836 811 382 --
NM_005433chr1862750 2503 2117 530 314 90 32261 488 64 1692 --
NM_005436chr10103535 3471 3447 3244 3116 2788 1635 1434 537 361 --31186 1184 706 --
NM_005437chr1061456 1104 1032 435 284 115 ------
NM_005443chr42471 204 1441 ----
NM_005455chr131433 1197 233 ----1659
NM_005458chr931703 1668 214 22288 2162 11531 --
NM_005460chr53511 148 98 --174 --
NM_005461chr2041594 1572 1532 695 ------
NM_005465chr122045 338 1347 11554 --
NM_005467chr112164 134 --1100 --
NM_005471chr51497 11324 --11255
NM_005474chr1731227 1121 268 156 ----
NM_005475chr1222992 2874 --1342 --
NM_005479chr102601 417 --1618 --
NM_005487chr2241567 1485 338 253 --11763 --
NM_005493chr61609 1165 ----
NM_005494chr71662 1501 ----
NM_005497chr1765820 3926 2291 1644 981 29 41938 1275 1262 610 --11430
NM_005501chr17147 ------
NM_005502chr963054 2951 2799 2208 1155 1100 --12343 --
NM_005503chr152785 260 --11020 --
NM_005504chr12186278 5604 5392 4752 4493 4420 4372 2521 2439 2282 2053 1951 1808 1405 804 545 451 151 44553 4293 1903 1836 45189 1710 1478 1476 --
NM_005507chr111449 ------
NM_005509chr551708 730 323 296 282 --21218 429 --
NM_005520chr51177 ------
NM_005521chr101807 ------
NM_005522chr751392 945 346 227 103 2557 355 11256 --
NM_005524chr32279 49 ------
NM_005530chr1531218 385 315 --1131 1455
NM_005536chr87977 966 485 455 386 105 36 ------
NM_005539chr1031107 906 348 ------
NM_005542chr741927 1572 142 81 ------
NM_005544chr221050 973 ----158
NM_005546chr592235 2186 2023 1852 1788 1751 1731 1592 473 1823 32240 858 801 --
NM_005552chr14----1533 --
NM_005558chr121030 406 --1787 --
NM_005561chr1321000 855 ------
NM_005562chr121218 421 21710 682 ----
NM_005563chr13342 247 234 --1197 1250
NM_005566chr111432 ------
NM_005572chr1177 ------
NM_005573chr52600 289 ----1749
NM_005575chr54705 559 165 117 2715 258 1167 --
NM_005576chr15--1299 1196 --
NM_005578chr3185110 4820 4798 4792 4776 4760 4333 3371 1935 1794 1621 1448 951 806 484 458 309 103 44969 1664 855 713 54812 4671 3433 994 330 --
NM_005584chr132572 109 ------
NM_005585chr153310 297 289 ------
NM_005587chr152965 761 ------
NM_005593chr125506 434 195 108 29 1528 2508 436 --
NM_005595chr1--1869 ----
NM_005596chr9145744 5525 5518 5499 5180 5080 4915 4748 4346 3946 2523 2333 1440 677 24953 1774 12513 --
NM_005599chr121445 1099 1433 ----
NM_005604chr672401 2370 2293 2251 1875 707 574 1104 ----
NM_005606chr144363 188 146 24 --1190 --
NM_005607chr82918 669 1250 135 --
NM_005610chr13284 213 42 2227 156 --1943
NM_005611chr163919 198 26 ------
NM_005613chr151858 1595 1451 1364 866 21786 1608 ----
NM_005625chr841056 1001 983 152 1793 ----
NM_005626chr12204 40 ------
NM_005627chr62393 211 --1363 --
NM_005634chrX1624 ------
NM_005637chr1821929 357 ----1838
NM_005638chrX41518 680 417 109 21406 1226 31479 1477 120 --
NM_005639chr1231928 1240 44 --21253 212 --
NM_005644chr13417 364 302 ------
NM_005647chrX73386 3349 1279 839 637 588 544 1535 13142 --
NM_005648chr8----134 --
NM_005650chr2211089 ------
NM_005652chr1661263 1253 1224 828 80 71 --11012 --
NM_005654chr5------1201
NM_005655chr831304 487 352 2475 367 --11095
NM_005657chr151158 ------
NM_005659chr222389 368 ------
NM_005660chrX----143 --
NM_005662chr82115 80 ------
NM_005665chr184790 4335 4220 4148 3661 3104 1781 350 44470 3418 1270 830 34928 3566 3564 --
NM_005668chr5104566 4162 3438 3202 1688 1609 1572 1168 534 35 13496 2546 37 --
NM_005669chr552202 1779 1755 955 348 ------
NM_005682chr1631346 1339 1322 ------
NM_005686chr131578 1467 1424 ------
NM_005688chr32515 482 --229 27 --
NM_005704chr13986 951 746 ------
NM_005707chr15273 39 ------
NM_005708chr132336 63 1112 165 --
NM_005711chr55881 438 313 174 28 --1248 --
NM_005713chr5135 ------
NM_005715chr6102764 2352 2246 1785 1753 1003 980 202 191 38 ------
NM_005717chr121246 943 11020 ----
NM_005718chr31305 --2865 824 --
NM_005719chr122193 70 ------
NM_005721chr261072 857 830 821 799 197 ------
NM_005722chr242362 684 605 42 3973 688 253 ----
NM_005724chr153200 178 138 ------
NM_005725chr131587 813 437 22469 1632 1876 --
NM_005730chr12103407 3281 2723 1179 1149 969 793 770 728 324 33368 3296 2711 11068 22585 646
NM_005731chr22354 89 --2283 270 --
NM_005737chr262262 2096 2054 765 713 382 12764 22900 2059 --
NM_005738chr741783 509 219 39 --1199 --
NM_005739chr15112408 2286 1880 1788 1739 1526 851 491 376 324 173 --2900 871 --
NM_005740chr223836 109 38 1827 1111 --
NM_005742chr22273 31 --3531 529 36 --
NM_005746chr762146 1955 1867 434 261 138 --12695 --
NM_005748chr1273478 3352 2546 2296 887 754 458 12591 ----
NM_005749chr171568 ------
NM_005751chr7167 --1348 --
NM_005752chr1621127 450 ------
NM_005754chr551140 924 902 466 171 21170 391 --11191
NM_005756chrX21491 1472 1465 11474 --
NM_005759chr2114549 3996 3889 3759 3558 3515 3076 3022 1392 447 389 33617 3576 3247 64485 3633 3628 3078 1864 449 --
NM_005761chr122127 37 ------
NM_005765chrX2743 670 2157 67 1575 --
NM_005766chr132349 58 1373 ----
NM_005767chr13166 ------
NM_005768chr122573 57 1671 ----
NM_005778chr32392 79 --1394 --
NM_005779chr573399 2779 2417 796 725 524 25 22505 800 23145 774 --
NM_005782chr171263 1109 ----
NM_005783chr23157 37 30 --1420 --
NM_005786chr1851266 954 248 184 127 ----1994
NM_005788chr115737 604 597 323 217 ------
NM_005789chr1772063 2043 1894 1799 1659 438 340 11615 1175 1198
NM_005795chr273015 3006 2743 888 759 578 460 22562 2123 2580 294 --
NM_005796chr162398 47 ------
NM_005797chr1151592 1548 1119 427 86 21306 386 2727 76 --
NM_005798chr13115184 4413 4192 4082 3747 3507 1898 1297 875 334 26 25160 819 1927 --
NM_005808chr352736 2666 1344 797 384 4516 474 466 440 1234 1189
NM_005811chr12195 ------
NM_005813chr272475 2192 990 589 545 314 259 32670 2225 1694 ----
NM_005819chr183455 3426 3299 3179 2532 1363 1083 596 22208 926 3372 370 128 --
NM_005822chr662282 2165 824 818 238 38 --11844 --
NM_005826chr13449 162 61 --1177 --
NM_005828chr17185059 3965 3777 3765 3742 3667 3414 1935 1722 1683 1646 1603 1369 979 576 565 441 232 14835 53749 3747 1765 443 247 --
NM_005832chr361421 934 424 254 60 50 21108 1052 1495 11035
NM_005834chrX1179 ------
NM_005839chr15802 701 375 369 357 ------
NM_005840chrX177452 7392 7205 6965 6577 6001 4803 4740 1593 1401 913 679 602 564 503 373 204 47076 4892 3009 399 56897 6272 484 118 31 22159 1949
NM_005842chr13248 41 1587 ----
NM_005843chr271937 1831 1323 1235 701 574 207 ------
NM_005850chr12164 44 ----147
NM_005851chr111395 ----1381
NM_005852chr1731091 1047 154 --11126 --
NM_005853chr16------130
NM_005857chr131275 956 569 1949 ----
NM_005859chr52522 446 11476 1186 --
NM_005862chr32938 271 1788 ----
NM_005863chr104281 212 136 67 11245 ----
NM_005871chr102433 424 168 1184 --
NM_005875chr3199 ------
NM_005876chr21701 ------
NM_005880chr1641230 654 570 33 ------
NM_005882chr41829 1961 1267 --
NM_005884chr192518 262 --1629 1632
NM_005885chr541082 383 178 63 ------
NM_005888chr121176 ------
NM_005895chr1283476 2755 2575 1593 1449 1085 430 191 186 ----
NM_005896chr28808 726 641 281 156 133 66 35 2759 227 --1136
NM_005898chr11102794 2755 2583 2352 2249 2073 1266 1030 1016 480 12293 ----
NM_005899chr173521 330 299 ------
NM_005900chr461191 1133 831 817 801 437 ------
NM_005901chr18268245 7989 7878 7449 6842 6674 6640 6309 5987 5910 5577 5569 5368 3121 2921 2868 2808 2664 2634 2454 1550 1500 1093 648 548 475 55941 5640 2941 2848 1660 97991 7305 7163 6418 6314 3242 1784 737 49 --
NM_005902chr15114625 4594 3884 3261 2918 1818 1101 1009 684 478 146 14510 21427 314 1986
NM_005903chr5164994 4506 4473 4302 4168 4085 3555 2039 2032 1931 1893 1790 1209 1003 655 623 54774 3666 843 582 118 34119 1648 1624 --
NM_005904chr185411 178 137 103 90 41474 1442 1137 1055 11042 --
NM_005907chr631561 1282 490 41251 662 540 137 164 --
NM_005909chr5114257 4033 4009 3595 3376 3336 1660 1464 1392 523 53 23730 608 33584 2802 2727 174
NM_005910chr17104009 3887 3634 3460 3028 3003 2983 1013 864 307 --13530 --
NM_005911chr231180 529 102 11090 ----
NM_005920chr1133859 3768 3705 3593 3407 3050 2902 2418 2372 1443 1004 845 228 --1270 --
NM_005922chr61484 ------
NM_005923chr62205 59 ------
NM_005924chr72980 835 ------
NM_005927chr54871 491 312 188 --1298 --
NM_005933chr1142069 1943 713 71 --32131 2010 725 12839
NM_005935chr4165282 5210 4921 4708 4192 4163 3851 3774 3674 2093 1766 1526 1457 1383 1083 471 --24238 3954 --
NM_005937chr1772783 2583 1644 1502 1484 505 462 24163 423 12576 --
NM_005938chrX31080 221 65 ----1902
NM_005940chr224771 720 659 581 ------
NM_005941chr8114137 4086 3874 2987 1677 1312 1231 418 326 213 29 --33966 3186 1317 13327
NM_005943chr651513 1394 1137 1117 58 --21412 1142 --
NM_005944chr331093 973 955 ------
NM_005952chr161105 1111 ----
NM_005953chr16--1104 ----
NM_005955chr1175103 5090 4976 4864 4608 4342 4102 3990 3982 3931 3626 2156 1851 902 888 432 137 25169 1165 13397 11535
NM_005962chr1061772 945 822 322 275 97 --1329 1332
NM_005962chr1061772 945 822 322 275 97 --1329 1332
NM_005964chr1711447 --11449 --
NM_005966chr242423 2366 1579 951 ------
NM_005967chr122690 555 ------
NM_005968chr19153 ------
NM_005977chr132406 320 ------
NM_005982chr142210 153 --1198 --
NM_005986chr1352258 1035 804 296 242 32064 735 719 32040 2038 503 --
NM_005994chr171899 ------
NM_005996chr1271545 1525 1323 1160 581 174 22 --1624 --
NM_005998chr12175 52 ------
NM_006007chr964466 3570 3316 873 454 88 ------
NM_006011chr1583925 3725 3700 3676 2962 1351 1314 109 13610 34044 3322 2827 --
NM_006015chr131112 1087 248 ------
NM_006016chr622146 889 32185 519 72 --11417
NM_006020chr1441212 483 446 263 1557 ----
NM_006022chr13----1145 --
NM_006029chr14----150 --
NM_006030chr321223 47 --11697 --
NM_006033chr1851604 829 717 594 103 11622 ----
NM_006036chr292548 2413 2290 2058 1830 819 706 425 340 12457 ----
NM_006037chr2164769 4733 4328 4198 3807 3559 3502 3404 3393 3122 1799 1731 1642 1616 1353 717 21446 505 44825 3000 2977 1872 --
NM_006038chr2051927 1829 1823 1612 275 21881 1652 21664 1533 --
NM_006040chr1641105 1066 531 265 ------
NM_006041chr172390 145 --1210 --
NM_006047chr2073321 2782 2573 2528 2515 1403 889 1474 32849 1213 1211 --
NM_006048chr131194 914 416 1302 ----
NM_006054chr1161465 1410 1311 1056 1009 138 --21467 527 --
NM_006060chr7104287 3775 3315 3194 2723 1253 956 899 892 413 14172 44432 4244 3243 996 --
NM_006063chr21167 1200 ----
NM_006064chrX2372 109 ------
NM_006067chr1661020 945 743 684 355 264 --1947 --
NM_006076chr773061 2881 2733 919 902 308 25 1656 ----
NM_006079chr63264 93 45 ------
NM_006080chr733022 607 288 22031 694 ----
NM_006088chr9145 ------
NM_006089chrX41818 1710 485 281 --1487 --
NM_006090chr12688 35 ------
NM_006091chr1581771 1550 1390 669 562 492 475 364 21379 23 21501 1499 --
NM_006094chr872347 2221 1755 1728 671 419 281 --1685 --
NM_006095chr484357 3908 3519 3415 3182 3008 1617 1605 52918 1703 1377 857 556 23935 197 11528
NM_006096chr861400 1376 1164 413 238 69 1660 21278 459 1503
NM_006099chr11824 --1191 --
NM_006100chr31245 ------
NM_006106chr11103425 3251 2402 1354 1242 552 412 239 191 152 ----33151 2925 923
NM_006107chr17--1525 ----
NM_006108chr1162078 2041 1566 846 768 216 11751 2482 459 --
NM_006113chr141525 437 317 268 ------
NM_006135chr171441 1041 563 226 196 172 21 31007 542 126 ----
NM_006136chr731340 378 335 2517 263 1464 --
NM_006139chr272570 2439 1903 1865 431 314 133 22223 590 ----
NM_006141chr1632173 1077 74 --1238 --
NM_006145chr193806 723 344 --1413 --
NM_006147chr1--1410 4191 97 95 30 --
NM_006148chr17132826 2595 2442 2292 2265 1950 765 504 220 158 139 128 76 ------
NM_006153chr32447 231 --1449 --
NM_006154chr1562851 2224 1920 823 632 362 ------
NM_006156chr14123 ------
NM_006158chr831671 567 174 ------
NM_006160chr173631 463 25 ------
NM_006166chr1262588 1806 1752 1661 1640 174 11724 ----
NM_006180chr992142 840 311 260 245 218 210 195 167 169 ----
NM_006183chr123530 434 137 ----2385 107
NM_006186chr241245 1159 819 478 11209 ----
NM_006190chr231093 999 838 --1843 --
NM_006191chr124692 634 288 82 ----1301
NM_006194chr14----1181 --
NM_006195chr941145 983 961 951 11023 11272 --
NM_006197chr862219 2039 1764 497 319 225 21969 502 ----
NM_006202chr1961574 1558 1534 1242 147 140 --31563 1527 471 --
NM_006203chr5115382 4234 3978 3813 3489 1960 1616 1095 943 929 906 64815 4612 4484 4259 675 490 ----
NM_006209chr82439 156 ------
NM_006212chr1164592 3882 3786 3434 1470 1426 1352 1239 987 944 865 486 444 329 206 189 21551 240 23507 946 14092
NM_006216chr23518 444 110 ------
NM_006218chr31287 ------
NM_006223chrX2535 66 ------
NM_006224chr172869 116 22387 2124 2912 910 --
NM_006228chr82399 120 ------
NM_006235chr11111975 1314 1305 395 383 376 307 250 225 208 158 --31944 1928 709 --
NM_006237chr1342131 1639 729 139 ----12137
NM_006238chr681819 411 285 263 233 219 196 71 --11972 1241
NM_006241chr371997 1946 1839 900 597 530 75 31957 972 855 31877 913 817 --
NM_006242chr2031594 126 94 32098 1605 165 ----
NM_006243chr15971 734 380 312 116 ------
NM_006245chr61341 --2748 175 --
NM_006246chr142501 76 ----1249
NM_006251chr5123194 2965 2687 2674 2532 2215 1282 966 500 483 418 25 11103 13037 12872
NM_006252chr1147495 6543 6227 5538 4803 2997 2961 2639 1481 1257 1058 960 914 802 86236 6091 6023 2233 2145 1633 745 534 37346 5922 1890 11061
NM_006253chr1241235 874 333 108 ------
NM_006254chr31350 ------
NM_006256chr11165 12589 22731 2423 --
NM_006258chr104434 193 182 46 1265 1595 --
NM_006259chr45888 728 693 297 76 1651 1226 --
NM_006265chr841312 970 335 132 ----11542
NM_006267chr231790 1695 1516 --2685 519 --
NM_006268chr1171168 1160 1037 979 866 462 83 ------
NM_006275chr2041744 1728 971 61 22385 2136 2920 84 --
NM_006282chr20124721 4662 4341 4226 3022 1535 1344 995 732 711 681 312 13666 64723 4343 1652 1000 459 457 24433 1006
NM_006283chr8114667 3627 3527 3240 3105 3084 1953 1096 942 360 350 34640 1644 402 1551 --
NM_006287chr262383 1724 807 537 233 76 42093 116 80 69 --1165
NM_006290chr671955 1927 1486 1382 723 666 141 11938 ----
NM_006292chr11147 --134 --
NM_006293chr152661 173 --1887 --
NM_006298chr6103197 2842 2331 1185 1070 968 632 362 305 147 ----12207
NM_006300chr1942340 1934 1808 452 --31905 1510 499 --
NM_006305chr151214 ------
NM_006306chrX85880 4578 4552 4361 1987 1781 1722 1662 12093 ----
NM_006307chrX132 --1316 1319
NM_006310chr1741178 1158 946 99 ------
NM_006311chr171115 --1325 --
NM_006313chr1231607 1373 497 --11050 --
NM_006315chr4103905 3191 2748 1648 1496 1478 1348 1307 852 443 11725 ----
NM_006317chr52784 603 ------
NM_006319chr162561 144 1708 2761 750 --
NM_006320chr441119 333 324 315 --1958 --
NM_006321chr372184 2116 2000 1646 661 271 160 --2217 168 --
NM_006323chr43710 486 176 1731 1638 --
NM_006325chr121317 1738 ----
NM_006327chr10------187
NM_006330chr861532 1363 1026 573 251 63 1175 2646 644 --
NM_006335chr121004 388 2394 144 ----
NM_006336chr941333 1237 1228 145 ------
NM_006346chr132473 52 1194 1457 --
NM_006348chr74804 382 238 148 1326 ----
NM_006350chr5133 1331 ----
NM_006352chr171945 1891 1882 552 436 407 320 --21929 330 --
NM_006353chr671451 1403 1207 1034 997 217 144 ------
NM_006359chrX92325 1922 1715 968 831 674 580 484 301 32474 2363 2222 2676 495 --
NM_006364chr1441314 482 449 346 ------
NM_006366chr641046 1009 847 461 11191 1868 --
NM_006367chr16822 781 386 216 196 70 1442 --173
NM_006369chr16438 416 357 132 117 101 --1122 --
NM_006371chr3105292 5215 5199 4639 753 644 532 510 102 62 ------
NM_006375chrX4771 615 392 133 1509 ----
NM_006378chr92184 152 11412 21033 462 --
NM_006379chr742026 1826 1772 160 12177 21774 262 11780
NM_006380chr1784257 4012 3663 2766 2692 404 262 31 21519 525 13311 12755
NM_006382chr171272 ------
NM_006386chr22122461 1856 1659 1637 789 503 381 284 188 151 105 78 11832 32084 1678 87 --
NM_006389chr1131401 1214 498 --31292 863 380 11404
NM_006390chr1271697 1589 1408 1190 706 679 153 --1666 --
NM_006391chr111232 --1326 --
NM_006393chr1084107 3658 2970 1483 1235 1161 867 55 23280 1260 ----
NM_006399chr14--1301 ----
NM_006401chr91506 ------
NM_006403chr651804 1549 1346 1262 179 --1540 --
NM_006405chr142230 41 --176 --
NM_006409chr71232 ------
NM_006415chr971259 1155 997 911 348 313 289 ------
NM_006416chr62672 648 1765 1650 --
NM_006420chr2092979 2831 2689 2587 2492 2261 2186 448 252 23415 296 12355 --
NM_006421chr82923 45 11166 1928 --
NM_006422chr12----129 --
NM_006427chr141160 ------
NM_006434chr10103192 3176 2659 2298 1103 874 854 774 717 66 --22497 859 --
NM_006439chr41213 ----1452
NM_006449chr262174 1993 1757 791 523 376 1109 32114 484 431 1434
NM_006451chr52911 343 --21041 324 1841
NM_006457chr4154025 4017 3781 3007 2959 2930 2776 2589 1632 1613 1598 1117 1109 931 920 34067 3487 2975 21528 922 --
NM_006459chr1031617 187 78 --11326 --
NM_006460chr1741793 1490 1363 640 1183 1212 --
NM_006461chr17----134 --
NM_006464chr2184630 4190 3624 3610 3242 3035 2985 1874 1781 1696 1636 1609 1222 1114 689 680 591 251 23655 1543 14480 31832 1225 491
NM_006465chr1572351 1939 1697 853 843 813 420 12303 --1870
NM_006467chr542220 2075 1877 344 ------
NM_006469chr131405 1291 331 2645 517 ----
NM_006471chr182289 61 ------
NM_006472chr15345 299 270 54 43 --11241 --
NM_006475chr131156 ------
NM_006482chr12102873 2865 1336 1258 1202 1068 1021 849 400 121 1682 2792 782 1811
NM_006483chr19--1226 ----
NM_006484chr19--1226 ----
NM_006489chr1451668 708 660 193 91 --11263 --
NM_006494chr194156 120 102 49 ----1340
NM_006496chr1111889 1773 1720 1621 1608 1583 1325 1239 506 492 134 --41223 697 695 324 --
NM_006497chr174794 759 744 280 1815 ----
NM_006503chr192112 91 ------
NM_006504chr1052885 2821 2356 2056 997 12708 ----
NM_006510chr63670 646 159 --2857 648 --
NM_006517chrX72157 1550 1481 623 592 579 38 --22021 1492 --
NM_006519chr6194 --284 82 --
NM_006520chrX4558 457 346 288 1510 ----
NM_006524chr71241 ------
NM_006526chr2062016 1400 819 715 509 284 --21891 463 --
NM_006527chr43703 588 242 ------
NM_006529chr41424 21516 181 31313 1108 670 --
NM_006534chr20103206 3200 2804 2670 2568 2200 2125 1170 691 322 22514 2479 22258 1207 12863
NM_006537chr152506 98 ------
NM_006538chr263596 2875 2809 2765 1355 590 34179 4040 3279 11000 --
NM_006540chr8125 11445 1188 --
NM_006544chr14155975 5300 4281 3944 3802 2141 2133 1727 1466 1457 1318 1031 565 510 452 54765 4527 1925 1272 968 22042 1361 --
NM_006546chr17156616 5827 5816 5648 5319 5214 4839 2642 2512 2438 2388 2183 2147 467 418 --16223 --
NM_006547chr731699 1627 316 --11850 --
NM_006548chr341519 1152 538 371 ----1564
NM_006549chr1262452 2339 2307 2054 781 722 22795 2142 ----
NM_006557chr961767 1660 1530 1445 416 280 ------
NM_006558chr82447 387 172 ----
NM_006559chr14975 254 134 117 ------
NM_006560chr113206 118 38 1332 ----
NM_006561chr10135922 5293 5022 4693 4244 4041 3829 3821 2216 1715 1387 392 345 36176 5068 1059 14385 15474
NM_006565chr1681102 884 842 521 436 358 83 69 ------
NM_006570chr91385 ------
NM_006571chr8150 --1238 --
NM_006572chr1792748 2184 1053 964 604 406 144 51 32 42943 2539 2224 1370 ----
NM_006574chr3----2111 109 --
NM_006575chr1451456 1442 1147 267 155 1582 ----
NM_006577chr211015 ----1325
NM_006578chr1581783 1637 1329 1262 698 571 546 231 11579 ----
NM_006584chr171120 ------
NM_006587chr461440 1169 1052 493 190 100 --21442 463 1344
NM_006595chr1151993 1417 648 437 75 1325 ----
NM_006599chr16278053 7814 7575 7409 7180 6926 6757 6433 6398 5380 5150 5138 3223 2963 2772 2190 2068 1857 1754 1732 1682 1592 869 813 507 388 378 67918 6472 6153 5953 2785 1608 75910 5140 2575 1740 1725 1584 878 --
NM_006601chr121453 --1320 --
NM_006602chr202301 274 ------
NM_006603chrX61917 1846 1716 635 218 99 21984 40 ----
NM_006609chr292884 2513 2447 2384 2352 2311 1987 511 193 32981 2293 966 2290 74 32519 2314 2020
NM_006614chr393546 2805 2676 2287 1346 848 705 360 161 ----13290
NM_006618chr171624 1455 990 500 306 156 64 --21389 521 11097
NM_006620chr683584 1160 1145 936 834 774 734 355 13149 21870 360 --
NM_006621chr161663 1492 415 406 183 78 11619 21603 789 --
NM_006622chr51546 --137 --
NM_006624chr1071990 1435 602 565 431 157 123 1679 21830 40 --
NM_006625chr11446 ------
NM_006625chr11446 ------
NM_006625chr11446 ------
NM_006626chr972603 2492 2098 1997 1889 837 514 11982 22136 1008 --
NM_006628chr1583990 3947 3441 1858 1806 1003 933 387 14143 33069 1860 1311 11252
NM_006629chr1852581 1852 1796 1768 646 11827 21048 1004 1649
NM_006636chr251014 1007 941 880 709 1690 1914 2712 319
NM_006640chr1721871 95 ------
NM_006646chr1352798 2728 2362 633 153 --22587 1882 12365
NM_006650chr53122 59 45 --2546 61 --
NM_006654chr12144758 4342 3578 3375 1837 1565 1210 1127 1069 899 856 809 778 117 33951 3869 643 11842 --
NM_006660chr15243 35 1290 ----
NM_006662chr162343 132 ------
NM_006667chrX31126 409 243 1247 11014 --
NM_006670chr61476 --1217 --
NM_006680chr11--1111 ----
NM_006681chr4169 ------
NM_006690chr2031970 1662 594 ------
NM_006696chr5121 ------
NM_006698chr2031216 1141 457 --1426 1449
NM_006699chr1102722 2619 2607 2580 2523 2505 2288 691 653 453 32514 1867 1669 --12084
NM_006700chr125624 146 86 78 38 1122 ----
NM_006703chr64356 180 101 77 ------
NM_006704chr132123 96 1454 ----
NM_006705chr9--1424 ----
NM_006706chr52619 295 --1174 --
NM_006710chr22949 319 1260 1321 --
NM_006711chr163700 330 214 --1744 166
NM_006713chr53541 533 56 2323 77 1543 --
NM_006716chr721266 23 1148 ----
NM_006717chr9123145 2875 2719 2419 2304 2274 2123 1160 840 673 585 527 22921 203 ----
NM_006718chr631113 1079 841 ------
NM_006722chr372478 2138 953 710 588 454 82 --12054 1688
NM_006724chr61484 ------
NM_006726chr41447 --21134 1111 2982 68
NM_006727chr51115 ------
NM_006729chrX185079 4812 4787 4442 4373 4266 3928 3832 3741 3537 3524 2120 2016 1889 1853 1256 1051 988 64565 4542 3612 2042 911 742 25338 1855 13802
NM_006731chr9155008 4625 4513 4295 3983 2152 2109 2014 1773 1647 1398 1274 1075 986 895 75845 4986 4279 3757 2028 587 245 32144 424 33 35125 4298 1085
NM_006732chr1931793 641 558 --32063 1795 1740 --
NM_006734chr621229 518 161 1250 1541
NM_006735chr73300 137 94 169 ----
NM_006738chr1584557 3207 3010 2901 1831 1734 1293 1199 --13443 --
NM_006745chr44958 878 384 98 2353 163 1303 --
NM_006746chrX31472 442 76 --11364 --
NM_006749chr821261 1037 --11168 --
NM_006750chr16227890 7855 7824 7723 7632 7371 7068 6442 5467 5413 3232 2958 2949 2771 2641 2440 1958 1802 817 360 304 84 15401 33161 2725 1963 1990
NM_006751chr24890 237 95 39 1894 --198
NM_006754chr731267 1136 815 ------
NM_006755chr111166 ------
NM_006756chr841132 1020 276 227 1315 ----
NM_006761chr172697 689 --1762 --
NM_006763chr151810 1714 859 676 513 1527 41939 1934 591 515 --
NM_006766chr8112522 2504 2404 2157 2119 2106 732 278 201 162 126 12265 1167 12160
NM_006769chr1--1713 ----
NM_006772chr6101782 1727 1638 1615 1288 1204 1119 227 199 28 --21698 1456 --
NM_006775chr682937 2837 2589 1999 1113 1063 404 29 32789 2375 291 ----
NM_006777chrX62898 2178 1843 1814 1183 394 12271 12441 --
NM_006778chr631923 1659 387 11955 1374 --
NM_006785chr1831917 836 187 ------
NM_006788chr1861755 358 302 257 126 111 1813 1116 --
NM_006790chr51378 ------
NM_006791chr155654 601 182 172 120 1619 ----
NM_006802chr12370 286 2932 62 ----
NM_006805chr5145 2554 436 ----
NM_006807chr172844 359 11284 1235 --
NM_006808chr9--1162 ----
NM_006810chr3124 ------
NM_006811chr202874 836 1298 ----
NM_006813chr62782 657 ------
NM_006814chr2032498 1955 225 11910 2484 408 --
NM_006815chr1261404 972 959 543 292 93 ------
NM_006818chr14868 792 667 645 --1647 --
NM_006819chr111336 ------
NM_006823chr831134 311 179 ------
NM_006825chr121247 --1385 --
NM_006826chr251248 840 449 420 130 ------
NM_006827chr14103393 2842 1222 965 904 514 471 435 337 192 2979 387 31301 342 134 --
NM_006838chr1241569 1344 677 36 1413 2612 555 --
NM_006841chr3155 --1497 1779
NM_006846chr5189 ------
NM_006851chr12112706 2506 2442 2409 2198 1161 935 887 844 461 389 12212 --1702
NM_006852chr17102863 2728 2633 2563 2358 1123 1110 844 422 126 11957 1424 --
NM_006854chr741555 1438 413 195 --21643 109 --
NM_006856chr1231041 1021 368 --11078 1317
NM_006861chr1222059 1500 ------
NM_006870chr20--1119 ----
NM_006873chr2133506 3369 3271 3241 2872 2505 1327 1281 1045 637 448 362 179 --23037 373 --
NM_006874chr441127 1100 968 954 --11214 --
NM_006877chr63312 305 54 --2274 128 --
NM_006884chr341618 1602 711 112 11860 11349 11775
NM_006885chr16173866 3439 3408 2845 2817 2757 1697 1508 1395 1360 1344 1331 1096 1069 495 346 197 24035 1403 52847 1450 1039 689 205 11456
NM_006887chr23265 240 206 ------
NM_006888chr1473355 3068 3030 2903 2803 1355 857 156 ----
NM_006906chr114947 859 749 167 ------
NM_006908chr741464 1251 607 573 11112 1966 --
NM_006910chr161415 ------
NM_006914chr931545 1092 347 11030 --2586 184
NM_006915chrX12222 --1715 --
NM_006918chr11175656 5564 5431 4956 4319 3915 3793 3718 1930 1827 1743 1567 1561 1453 981 458 59 25033 2217 23780 968 15163
NM_006920chr231783 799 415 --21960 1519 --
NM_006922chr252335 1892 1798 1018 865 31649 1596 582 ----
NM_006924chr1794451 3935 3857 3839 2709 1208 348 237 68 13814 44137 3763 3185 1383 --
NM_006925chr142479 202 --1101 --
NM_006930chr591915 1878 1867 1845 1595 1405 1365 1258 558 ----1658
NM_006931chr1231527 816 287 12134 1207 --
NM_006937chr171117 ------
NM_006939chr141424 1436 ----
NM_006940chr1261596 1386 757 669 545 500 --1475 --
NM_006943chr2052947 2812 2396 761 590 --23310 3301 --
NM_006947chr491422 1359 1253 599 567 503 431 288 100 --11682 --
NM_006948chr2142200 277 70 48 11798 ----
NM_006951chr102831 268 ------
NM_006958chr8155 ------
NM_006963chr1061191 1107 1060 203 122 73 11211 1828 --
NM_006965chr1841148 1101 316 40 21043 438 ----
NM_006973chr10127 ------
NM_006981chr982937 2632 2170 1113 517 348 147 141 1267 22163 156 --
NM_006982chr121242 2249 28 ----
NM_006988chr211272 --11036 --
NM_006990chr151881 1874 1563 242 29 --21565 798 --
NM_006996chr141644 1552 236 22 11441 11739 --
NM_006997chr101472 ------
NM_006999chr54699 241 223 143 32068 611 471 1701 --
NM_007002chr20187 --189 --
NM_007005chr911188 51226 1145 964 557 548 ----
NM_007006chr1653537 2871 2695 946 675 --33441 2271 107 --
NM_007007chr12104108 3771 3352 3075 2947 1929 1779 1545 1419 622 23916 3085 23668 3020 1690
NM_007008chr22369 241 ------
NM_007011chr15166595 6474 5297 4655 2677 2646 2414 1996 1924 1761 1396 982 946 355 205 162 56740 5860 5190 4358 1935 36114 5869 1437 16248
NM_007013chr84982 815 410 135 --1784 1169
NM_007017chr51811 ------
NM_007019chr20135 1128 ----
NM_007023chr231079 841 263 1352 ----
NM_007026chr171466 --179 --
NM_007027chr31422 ----1441
NM_007033chr152306 2278 197 109 70 11992 ----
NM_007034chr11108 1840 ----
NM_007039chr1452050 1930 1567 1559 509 3612 422 292 22097 1580 --
NM_007040chr1961079 959 276 265 225 190 ------
NM_007046chr21380 ------
NM_007050chr20168005 7906 7766 7592 6982 6071 5905 2950 2877 2008 1631 1615 1526 1517 911 220 --37381 2714 2344 15994
NM_007054chr573629 3463 3265 2643 1107 1001 229 43998 1013 976 935 23192 837 --
NM_007064chr331711 1351 196 31430 668 511 11303 --
NM_007067chr1721494 533 21170 346 21059 556 11559
NM_007074chr161108 ------
NM_007078chr1062149 1973 1136 616 148 83 12215 12066 --
NM_007084chr1321338 408 11473 ----
NM_007096chr9294 61 ------
NM_007100chr4122 ------
NM_007106chr1342837 2654 2140 147 21715 1071 32603 2053 149 12551
NM_007107chr3102308 1800 944 848 809 577 566 559 430 400 11938 11571 --
NM_007112chr11251 ------
NM_007114chr393003 2993 2412 2347 2321 2067 1071 1012 857 22828 84 ----
NM_007115chr22361 51 1103 ----
NM_007118chr5130 ------
NM_007122chr11615 --1620 --
NM_007124chr691946 1806 1443 1265 737 450 347 212 51 ----1462
NM_007125chrY31468 381 41 11062 --21471 1256
NM_007129chr133728 663 337 ------
NM_007136chr341084 271 46 32 ------
NM_007137chrX125538 5524 5255 4681 4564 4516 4094 3823 1701 906 776 716 34315 3973 1484 ----
NM_007139chr751119 1060 970 897 831 ----141
NM_007144chr17397 57 24 1184 --181
NM_007145chr1911152 --11239 --
NM_007146chr1742446 1163 1084 139 --1377 --
NM_007147chr1931070 250 69 --11075 --
NM_007150chrX42127 1772 1682 123 ------
NM_007157chrX152852 2440 2376 2332 2256 2149 1861 1170 1020 787 755 478 439 383 96 22492 2237 11027 12315
NM_007158chr151199 441 432 362 82 1830 11011 --
NM_007159chr351532 703 369 90 82 ------
NM_007166chr1161602 1528 1048 984 442 240 --51416 489 444 397 111 --
NM_007170chr12602 83 --1369 --
NM_007172chr2283065 2871 2700 2403 2141 329 284 76 23239 2252 22795 84 12157
NM_007173chr1172326 2064 1713 1635 1558 667 410 22265 135 ----
NM_007174chr1262322 404 393 254 237 183 ------
NM_007175chr863246 2449 1276 1194 734 702 ------
NM_007178chr121345 --1370 --
NM_007185chr161024 887 792 754 431 51 --11026 --
NM_007187chr1341037 968 929 699 --1751 --
NM_007191chr123721 203 155 1170 ----
NM_007192chr1451111 969 279 272 32 ------
NM_007195chr18103417 3269 3157 2884 2337 1169 1157 895 532 234 53531 3177 3115 1142 206 42992 2990 1162 922 175
NM_007197chr124944 863 77 71 --156 --
NM_007200chr1584557 3207 3010 2901 1831 1734 1293 1199 --13443 --
NM_007202chr172541 71 ------
NM_007203chr9123981 3823 3813 3795 3477 3030 2953 2508 1426 788 634 485 ------
NM_007207chr14826 283 85 78 ------
NM_007212chr17622 539 526 348 208 150 113 22045 446 22296 1623 --
NM_007214chr61965 --1360 --
NM_007216chr113381 344 173 1864 1346 --
NM_007218chr85712 365 325 189 170 ------
NM_007219chr202966 114 --1944 --
NM_007222chr851238 1202 1152 267 36 21517 271 21819 1762 11741
NM_007224chr122502 168 1654 ----
NM_007231chrX72213 2047 1930 1592 402 382 201 32123 593 344 1705 --
NM_007232chr201326 ------
NM_007235chr123369 137 91 ------
NM_007236chr155629 484 402 340 233 1768 12000 --
NM_007238chr2034911 337 315 --1898 --
NM_007245chr16--2799 792 ----
NM_007246chr451006 924 825 777 193 1383 ----
NM_007247chr174818 779 241 36 ------
NM_007249chr13228910 8603 8516 8081 7728 7622 7460 7136 6967 6332 6209 5744 3650 3476 3202 3114 2917 2421 1269 848 302 154 42808 1885 1416 1398 49275 6879 2423 1205 12558
NM_007250chrX4598 369 171 80 1380 ----
NM_007257chr8112974 2704 2647 1962 1085 652 526 386 203 181 60 12127 ----
NM_007259chr13478 383 362 --1209 --
NM_007260chr13761 732 120 ------
NM_007269chr12453 116 ------
NM_007270chr751554 1256 1076 569 502 --21556 1111 --
NM_007275chr32394 328 ------
NM_007276chr72975 264 ----1284
NM_007281chr41186 ------
NM_007285chr163461 197 87 ------
NM_007286chr532124 329 85 ------
NM_007287chr363080 2343 2249 1275 1075 655 1675 11297 --
NM_007288chr363080 2343 2249 1275 1075 655 1675 11297 --
NM_007289chr363080 2343 2249 1275 1075 655 1675 11297 --
NM_007294chr172181 91 1991 ----
NM_007295chr172181 91 1991 ----
NM_007296chr172181 91 1991 ----
NM_007297chr172181 91 1991 ----
NM_007298chr172181 91 1991 ----
NM_007299chr172181 91 1991 ----
NM_007300chr172181 91 1991 ----
NM_007302chr172181 91 1991 ----
NM_007303chr172181 91 1991 ----
NM_007304chr172181 91 1991 ----
NM_007305chr172181 91 1991 ----
NM_007313chr961623 1565 1329 407 368 356 11804 11817 11820
NM_007324chr12428 24 ------
NM_007325chrX42039 877 461 222 1522 12041 --
NM_007345chr1842080 1574 1450 896 --52082 530 493 491 204 --
NM_007346chr20----2329 301 --
NM_007347chr1552555 944 871 370 133 --11129 --
NM_007349chr71166 1413 ----
NM_007350chr12134461 4235 3887 3735 3615 1491 1339 1143 997 961 180 169 159 1265 13237 --
NM_007358chr181948 1871 1297 1243 727 687 497 41 2302 192 ----
NM_007361chr141559 1648 ----
NM_007362chr331572 1510 968 ----11068
NM_007363chrX31035 816 751 --1881 --
NM_007372chr173774 224 173 2727 284 ----
NM_007373chr10101798 1769 1592 1330 1152 509 435 366 223 197 ------
NM_007375chr142400 706 466 154 32198 1830 53 11131 --
NM_009585chr3199 --1169 1146
NM_009585chr3199 --1169 1146
NM_012064chr1221076 764 ----11143
NM_012069chrX62716 2552 2521 999 945 77 32646 2339 370 ----
NM_012081chr5133695 3283 3154 3126 3021 2746 2383 1364 895 454 430 181 138 22812 899 33441 3159 2751 --
NM_012082chr83794 666 645 ------
NM_012084chrX2414 34 1531 ----
NM_012090chr151214 1066 985 367 142 1343 1447 --
NM_012092chr231441 616 116 --1429 1457
NM_012093chr121256 1188 --11068 --
NM_012095chr10123510 3329 2136 1404 1313 1109 1069 1004 994 507 482 215 13370 ----
NM_012096chr382399 1475 1456 1273 1114 846 351 180 1968 43337 2401 2275 381 --
NM_012102chr1112281 2107 2100 2041 1870 1859 1036 875 798 566 298 2468 105 12247 --
NM_012104chr1172469 1441 1423 1159 1018 736 337 --3801 741 343 11085
NM_012104chr1172469 1441 1423 1159 1018 736 337 --3801 741 343 11085
NM_012105chr212343 156 --4751 696 641 337 --
NM_012110chr4----2234 232 --
NM_012111chr141153 ----1186
NM_012117chr12130 ------
NM_012120chr631939 997 939 12231 22474 888 --
NM_012124chr114714 181 160 82 ------
NM_012129chr772174 1840 1832 875 837 538 367 2552 374 2740 70 1486
NM_012137chr172614 2552 2142 2133 2092 1815 346 1989 32169 2053 925 32207 498 449
NM_012141chr13123978 3929 3140 3053 2858 2708 2675 2542 857 303 87 38 12889 23189 166 12606
NM_012153chr1182481 2461 1840 1786 1610 774 285 226 --21737 93 --
NM_012156chr2093171 3160 3145 2885 2839 2514 2486 707 460 13116 22897 2892 --
NM_012158chr132714 332 11491 11381 --
NM_012160chr62469 199 1528 ----
NM_012164chr9127207 7196 6673 6192 6000 5440 5199 4828 2858 1654 1211 399 47474 5524 1221 972 36695 5698 5221 26925 1196
NM_012175chr112219 213 ------
NM_012176chr52261 254 ------
NM_012180chr42539 137 1151 ----
NM_012188chr531090 1082 137 ------
NM_012192chr1141875 810 757 133 1279 ----
NM_012193chr11135090 4898 4692 4630 4417 3453 1872 1723 1488 727 670 523 26 --34697 1820 709 --
NM_012197chr931603 466 265 1354 41366 1286 1284 468 --
NM_012198chr27842 651 629 175 119 100 43 192 ----
NM_012199chr1134228 4038 3827 3688 3297 2939 2926 1873 1519 1501 1462 1148 652 23283 2966 53324 2962 2933 1150 1073 --
NM_012200chr11----131 --
NM_012207chr104827 423 165 76 ------
NM_012210chr921045 25 21068 146 ----
NM_012214chr2126188 5976 5895 5234 5065 4739 4073 2521 1989 1969 558 69 36004 988 947 55450 4929 2528 1874 884 1387
NM_012215chr1041673 1410 798 314 ------
NM_012218chr192827 465 ------
NM_012223chr231069 957 246 11336 ----
NM_012224chr421026 417 --1772 --
NM_012234chr383626 3531 1431 1378 1255 1173 437 92 --11439 --
NM_012236chr13701 620 222 154 ----
NM_012238chr1011788 21653 269 21632 430 --
NM_012242chr10--1260 ----
NM_012243chr13754 381 301 ------
NM_012247chr102902 422 1869 ----
NM_012248chr163672 496 254 ------
NM_012249chr263400 3221 2505 2329 2294 1243 23439 2559 11111 --
NM_012250chr113881 531 49 --1260 --
NM_012252chr7215364 4737 3923 3722 3610 3543 3530 3449 3390 3305 2119 1755 1521 1002 957 820 813 396 284 209 101 35285 4708 1860 44475 3557 866 864 14806
NM_012255chr20--1120 ----
NM_012257chr731017 943 227 ------
NM_012259chr661393 1064 950 943 424 173 11419 1167 --
NM_012262chr1125016 4514 4399 4052 3844 3735 3475 3341 3298 2000 1272 872 --34292 1679 388 --
NM_012266chr911077 1106 ----
NM_012281chr722060 1520 21890 1737 22155 285 --
NM_012286chrX2594 64 --2408 176 --
NM_012287chr3104140 4106 4015 3115 3073 1621 1581 746 432 311 54491 1682 1586 1074 1034 34131 4091 697 1203
NM_012288chr6125762 5639 4930 4922 3931 3818 1805 383 343 221 182 162 45530 4178 3772 3597 54727 4540 3970 3562 273 15117
NM_012290chr261548 1469 1385 630 459 84 11317 ----
NM_012295chr22------2415 269
NM_012296chr1173816 3425 3018 846 509 291 82 ------
NM_012297chr462098 1952 770 546 417 321 1757 12352 --
NM_012300chr561946 1658 664 550 404 150 41796 670 609 34 ----
NM_012301chr752245 1428 1378 806 48 1459 22247 893 --
NM_012302chr141085 1049 903 799 1503 ----
NM_012307chr183868 825 680 1875 --184
NM_012308chr1182168 2058 2000 1782 1764 1677 837 714 --22304 814 --
NM_012309chr11164860 4646 4251 4238 4147 4019 3739 3322 3131 1948 1615 1166 926 632 595 493 54309 4071 3840 1910 243 ----
NM_012316chr1255420 4272 4137 4072 4050 3732 3651 3540 3486 2231 2086 1915 1312 1104 1086 941 728 714 603 584 569 400 390 352 240 15449 33686 3669 1711 --
NM_012322chr7----1298 --
NM_012323chr2221618 1576 ------
NM_012325chr2051188 1146 162 105 35 11636 21548 128 --
NM_012327chr1841580 583 274 173 21555 181 ----
NM_012328chr761328 1262 948 251 71 41 ------
NM_012329chr1741056 470 166 119 1312 31195 674 610 --
NM_012330chr1091813 1758 1579 1499 1380 687 263 198 183 --11162 --
NM_012333chr12466 75 --177 31543 1481 102
NM_012334chr573890 3625 3566 3297 1486 903 559 34703 3159 574 ----
NM_012342chr103534 493 147 --2500 498 --
NM_012343chr541102 1082 1048 736 ------
NM_012347chr672976 2836 2406 2279 2019 926 367 22994 183 ----
NM_012382chr583391 3117 3044 1667 835 571 427 35 12877 54342 4262 3453 1410 837 1922
NM_012388chr1572893 2019 777 603 548 420 23 --1605 --
NM_012394chr1--127 ----
NM_012395chr7153414 3119 2590 2367 2288 2278 2127 1243 502 457 403 286 277 174 113 33204 3104 847 33055 2374 2369 --
NM_012398chr1972951 2174 1010 845 789 733 360 ------
NM_012399chr2231428 569 496 21900 792 1501 --
NM_012405chr193827 3557 3116 2989 2651 957 810 477 91 --23784 121 --
NM_012414chr11105 ------
NM_012417chr173641 230 69 ------
NM_012420chr1061568 509 370 300 189 182 11505 1717 --
NM_012426chr162345 138 --1153 --
NM_012428chr154797 696 77 63 --1698 --
NM_012430chr35751 729 666 521 229 1767 ----
NM_012432chr1--1355 ----
NM_012434chr62595 96 11667 ----
NM_012443chr101571 1133 ----
NM_012444chr203434 175 39 ------
NM_012446chr5----1152 --
NM_012448chr1782360 2158 1019 1010 946 678 646 30 22295 1654 2498 89 --
NM_012453chr741464 1295 135 114 11554 31346 220 175 11445
NM_012454chr62566 364 ------
NM_012463chr122204 148 ------
NM_012465chr10123266 3031 2983 2746 2173 2164 842 471 394 290 202 109 23165 847 ----
NM_012475chr1193 ------
NM_012479chr732141 645 150 --12146 --
NM_012482chr11127 133 ----
NM_012486chr11157 --199 --
NM_013227chr152653 261 --185 --
NM_013230chrY31528 1346 1326 31472 44 27 11690 --
NM_013231chr1483873 3815 3621 1429 1197 691 219 181 43998 3382 1752 1119 --1184
NM_013232chr52377 103 ----1293
NM_013233chr231279 1249 73 1377 --1459
NM_013236chr2231054 790 403 2126 60 2462 390 --
NM_013242chr161330 --145 --
NM_013243chr1541477 467 311 163 11047 21155 517 --
NM_013245chr163721 281 215 --1643 --
NM_013248chr202212 22 1239 --1231
NM_013249chr111206 ------
NM_013254chr12--1197 ----
NM_013255chr7258878 8725 7112 7061 6920 6849 6129 5840 5694 5498 3525 3089 2574 2086 1812 1206 1161 874 496 429 337 320 261 152 54 58688 7984 6329 2885 275 58602 8467 7332 7229 3527 17434
NM_013257chr842083 1513 393 144 1148 12128 --
NM_013259chr32293 97 ------
NM_013261chr4143377 3241 3209 2970 2819 2624 1516 1472 1456 1196 1176 1139 779 266 --22821 771 --
NM_013262chr661266 1163 1103 1089 474 429 11467 1987 --
NM_013263chr16166 ------
NM_013269chr12104542 4510 4259 4179 4161 3350 1355 1300 1256 565 ------
NM_013272chr152157 53 ------
NM_013275chr162639 607 --2322 195 --
NM_013277chr1241011 970 902 284 1731 ----
NM_013281chr201342 11521 11244 --
NM_013282chr1941097 990 875 365 31293 1123 1010 ----
NM_013283chr510889 858 817 801 745 673 368 304 198 22 1615 ----
NM_013293chr7191 --142 --
NM_013300chr12----1239 --
NM_013302chr16164739 4732 4710 4581 3331 2959 1854 1725 1476 1326 1303 1244 1030 978 696 618 11004 24741 1158 --
NM_013305chr182915 619 --2861 765 --
NM_013309chr1562178 1929 1768 899 601 449 11746 12634 --
NM_013313chr2242802 931 858 182 21366 225 12743 --
NM_013316chr761038 815 788 178 131 52 ------
NM_013322chr731406 1247 1092 ------
NM_013326chr18167 ------
NM_013330chr1--181 ----
NM_013341chr251952 1191 948 252 213 --12849 12808
NM_013348chr1911296 ------
NM_013352chr62898 310 1810 ----
NM_013354chr831486 483 323 ------
NM_013355chr91272 ----1210
NM_013357chr82866 834 --191 --
NM_013363chr31136 1430 ----
NM_013364chrX31995 1969 1420 ------
NM_013365chr221157 --1531 --
NM_013371chr11332 ------
NM_013372chr1542798 2362 1211 767 22873 2218 1496 --
NM_013374chr363050 2066 750 535 389 381 12672 13052 --
NM_013377chr122184 109 1204 ----
NM_013381chr121622 12443 1772 --
NM_013390chr921748 1559 1489 --11394
NM_013396chr2121048 300 1544 2302 39 --
NM_013400chr711064 1374 1846 --
NM_013423chrX21047 96 ------
NM_013427chrX21047 96 ------
NM_013433chr1941944 1927 1773 1633 ------
NM_013434chr221739 584 ------
NM_013434chr221739 584 ------
NM_013436chr21133 ------
NM_013437chr81554 ------
NM_013438chr951690 1292 708 176 166 --1181 --
NM_013441chr11125 1434 ----
NM_013443chr92839 79 --21111 896 --
NM_013444chrX31118 346 241 1107 ----
NM_013445chr21127 ------
NM_013446chr741442 1190 311 146 ------
NM_013449chr1272297 2130 696 654 587 554 266 --52256 773 642 637 271 --
NM_013450chr231224 467 110 1927 ----
NM_013937chr66917 724 414 295 105 56 1797 3919 903 115 --
NM_013943chr183200 2239 2083 1103 703 264 234 54 23259 2677 ----
NM_013952chr231905 650 625 --22335 731 --
NM_013953chr231905 650 625 --22335 731 --
NM_013958chr82473 334 ------
NM_013959chr82473 334 ------
NM_013961chr82473 334 ------
NM_013962chr82473 334 ------
NM_013992chr231905 650 625 --22335 731 --
NM_013993chr62521 215 1731 ----
NM_013994chr62521 215 1731 ----
NM_013995chrX52543 920 873 685 105 1716 1421 1584
NM_013999chr1751476 1211 1101 240 118 21454 207 ----
NM_014000chr1061941 1759 526 388 366 142 --31950 1807 168 --
NM_014003chr161318 ------
NM_014007chr931149 1127 835 ------
NM_014010chr93554 443 203 1213 1515 --
NM_014011chr232603 2121 504 3607 400 388 42555 953 573 568 --
NM_014015chr162648 25 --1717 --
NM_014016chr351737 680 435 182 96 11329 21739 456 --
NM_014021chr1103345 2979 2952 2531 2229 1203 1146 1112 646 453 23447 3305 ----
NM_014023chr1031846 624 130 12276 22573 65 --
NM_014028chr683079 2908 2479 1229 859 319 164 155 23014 2709 ----
NM_014030chr1711137 ------
NM_014033chr1232284 2242 240 21839 803 ----
NM_014034chr681143 1107 1040 968 457 404 255 195 ------
NM_014043chr341673 419 313 160 173 31675 537 255 --
NM_014048chr1685236 4880 3458 2027 1946 1631 1390 1116 34862 4025 1285 24926 4885 --
NM_014055chr125506 460 344 201 73 1380 1508 1356
NM_014059chr131254 ------
NM_014071chr202384 123 ------
NM_014089chr1342128 204 170 145 21748 64 --1858
NM_014106chr1572037 1076 1048 935 869 603 578 22077 1032 21196 352 --
NM_014110chr141016 882 250 229 ------
NM_014112chr8135009 4795 3810 3676 3627 3330 2074 1009 977 528 151 136 41 21552 1490 23322 1903 23630 849
NM_014117chr1652717 2510 2239 2081 1970 32539 1828 901 1984 --
NM_014141chr783606 3499 3493 3476 1642 1389 430 385 41895 1185 915 346 23448 908 13479
NM_014149chr72587 345 ------
NM_014153chr163624 527 464 ------
NM_014155chr11177554 7389 6522 6219 6144 5970 5897 5784 2975 2338 2227 1851 1249 1240 1001 549 141 46868 5362 2952 258 56308 4556 1200 988 802 15761
NM_014166chr1351154 943 807 424 162 --1825 --
NM_014170chr3--1333 1405 --
NM_014178chr144585 380 134 93 --127 --
NM_014181chr232800 824 280 12948 11094 --
NM_014183chr201308 ------
NM_014186chr1171815 694 600 580 541 205 197 --11963 --
NM_014191chr12--1215 ----
NM_014211chr521527 226 1456 ----
NM_014212chr122657 85 174 1718 --
NM_014216chr141110 ------
NM_014217chr151411 468 360 276 57 21606 566 --11832
NM_014223chr12296 211 --2636 634 --
NM_014231chr1262103 2096 2042 1483 546 250 1751 21928 739 --
NM_014232chr17101632 1512 1491 1416 671 635 512 408 355 291 --1652 --
NM_014232chr17101632 1512 1491 1416 671 635 512 408 355 291 --1652 --
NM_014233chr1762043 1889 1779 1517 1471 1359 ----12046
NM_014238chr1751490 1374 310 153 35 ------
NM_014240chr3124096 3251 3078 2905 2658 2652 2625 1243 803 507 485 413 14005 54098 3261 3256 2663 204 --
NM_014243chr442071 1918 1322 56 ----12074
NM_014250chr2241567 1485 338 253 --11763 --
NM_014253chrX42504 1994 1926 178 22133 78 ----
NM_014263chr1021367 1155 --1252 --
NM_014267chr114871 606 335 294 ------
NM_014268chr1881297 1272 1262 1145 562 302 166 50 11123 41291 336 277 275 --
NM_014270chr19279 69 ------
NM_014271chrX2700 588 1198 ----
NM_014278chr4--2446 61 ----
NM_014279chr921006 630 --1818 --
NM_014280chr14801 709 265 161 ------
NM_014282chr95922 886 492 107 58 ------
NM_014283chr141165 1065 415 322 1433 ----
NM_014284chr1----1135 --
NM_014288chr12223 213 ------
NM_014289chrX21150 120 --21076 129 --
NM_014290chr91180 ------
NM_014294chr841339 1208 105 77 1274 --11135
NM_014296chr331617 1263 51 ------
NM_014299chr195736 577 387 381 80 --1403 --
NM_014305chr13----299 97 --
NM_014309chr22184870 4733 4623 4612 4547 4202 3910 3894 1590 1042 814 778 619 609 596 478 230 204 41472 1412 854 471 44919 4705 4453 4451 11506
NM_014313chr121341 457 21163 91 21226 390 --
NM_014319chr1221770 1438 ------
NM_014329chr161302 ------
NM_014331chr4187245 7034 6741 6611 6457 6364 6196 5141 5109 2743 2426 2345 2284 1078 1061 1041 353 71 27518 6733 26090 5553 16244
NM_014332chrX2368 153 ------
NM_014333chr1192819 2473 2166 1877 1850 622 577 332 236 --3447 434 202 --
NM_014334chr91154 ------
NM_014335chr152434 62 ------
NM_014338chr225383 348 276 59 37 ------
NM_014342chr1151478 1382 1320 425 154 ------
NM_014344chr112697 134 ------
NM_014345chr62272 170 ------
NM_014352chr1161047 963 555 526 507 141 ----1578
NM_014353chr162716 227 ------
NM_014361chr111180 ------
NM_014363chr1331068 850 470 --1893 --
NM_014368chr91290 --1851 --
NM_014372chr182033 1963 1808 540 502 400 372 57 31896 1840 1505 21887 402 1699
NM_014374chr711064 1374 1846 --
NM_014381chr1482539 2416 2018 1010 852 778 666 475 --1461 --
NM_014382chr361287 1151 641 592 583 492 11364 1585 11122
NM_014388chr1136045 5426 4986 4702 4029 2246 1916 1663 1483 1047 560 338 148 65919 2231 1714 1052 350 297 --25717 5529
NM_014390chr72430 49 ------
NM_014392chr441341 439 347 224 11175 ----
NM_014393chr882214 400 301 259 233 202 172 50 1270 21772 218 --
NM_014394chr104970 902 452 169 1301 ----
NM_014396chr772274 1897 1785 470 192 162 133 --32276 687 39 --
NM_014397chr92443 61 --11435 --
NM_014399chr72168 60 ------
NM_014405chr1722366 705 --21896 50 --
NM_014409chr121127 967 11157 ----
NM_014411chr771561 1478 1349 1326 1303 1245 758 ------
NM_014415chr311180 11618 1393 --
NM_014417chr192955 903 ------
NM_014423chr5105656 5569 4646 4384 2116 1185 1152 453 113 32 45220 4672 1512 599 --13468
NM_014426chr201532 ------
NM_014429chr3169 158 2646 220 --
NM_014431chr1041412 1378 1144 569 --1358 --
NM_014432chr641277 1120 350 135 --1137 --
NM_014445chr332294 701 153 21961 175 21957 438 --
NM_014447chr461595 1384 1107 1098 1085 356 ----11324
NM_014452chr63380 296 64 --2214 195 --
NM_014454chr641098 737 682 145 ------
NM_014455chr11141 ------
NM_014456chr101173 1586 1225 --
NM_014458chr11879 21398 1050 ----
NM_014469chr115624 308 293 256 34 ------
NM_014488chr111199 ------
NM_014491chr771043 964 944 922 763 247 189 ------
NM_014494chr1661617 900 797 388 344 292 1909 32047 1894 1694 --
NM_014497chr2--1211 ----
NM_014500chrX1229 ------
NM_014505chr121543 1373 ----
NM_014515chr1231047 1027 214 --137 --
NM_014517chr351981 1658 1224 1203 317 ------
NM_014521chr241857 1689 550 501 --146 --
NM_014547chr152628 326 ------
NM_014547chr152628 326 ------
NM_014552chr211021 11432 ----
NM_014554chr1291711 1704 1696 1684 1668 1660 263 255 48 21732 1504 --11789
NM_014562chr22561 99 ------
NM_014569chr721481 178 ----1469
NM_014570chr224858 259 151 42 ------
NM_014572chr1371440 1307 1266 1126 292 206 141 31187 673 343 ----
NM_014574chr1441045 599 454 318 11353 21373 323 --
NM_014577chr225740 317 273 113 104 1152 ----
NM_014583chr31124 --1445 --
NM_014584chr1451613 1504 1411 1126 1037 ------
NM_014586chr21124550 4428 4355 4341 4300 4043 3747 3271 1682 1143 685 354 --14487 --
NM_014587chr1631368 266 215 11362 --1595
NM_014588chr203528 502 105 --1255 --
NM_014591chr10178 --11091 11324
NM_014603chr1721402 1124 1388 11690 --
NM_014606chr441420 1117 984 361 11525 ----
NM_014607chr23694 567 119 11550 1448 --
NM_014608chr151118 2407 159 ----
NM_014612chr941344 530 495 141 11565 ----
NM_014613chr562652 1996 943 885 732 296 --32654 2041 954 --
NM_014614chr241506 1259 1102 404 --132 --
NM_014616chr372749 1060 1034 873 829 469 240 32737 2321 2271 --1387
NM_014618chr92443 27 ------
NM_014620chr123531 124 116 --1118 --
NM_014630chr15113984 3337 2934 2926 2723 1402 1299 898 552 541 230 11200 22936 344 --
NM_014633chr113440 117 103 1633 1581 1123
NM_014634chr2272664 2592 1079 915 736 676 640 1889 32269 2267 2262 --
NM_014636chr9154136 4059 3901 3753 3040 2979 1700 1415 1362 1351 1336 1239 765 717 524 1678 22948 876 --
NM_014637chr841373 571 115 97 11076 ----
NM_014644chr131027 979 657 1663 1659 --
NM_014646chr1873016 2892 2496 2197 2019 617 485 --33037 2035 70 13083
NM_014647chr1652207 208 201 186 147 21456 850 2188 85 --
NM_014649chr19184 ------
NM_014659chr152259 153 --1202 --
NM_014660chr741130 1072 848 260 ----153
NM_014661chr1063653 3551 3117 1348 294 284 --1286 --
NM_014665chr873687 2777 2434 796 703 567 44 --12864 12893
NM_014666chr531122 381 360 195 ----
NM_014667chr382437 2353 2312 2124 1952 1749 894 747 ----11779
NM_014670chr231215 1202 240 3332 269 253 11217 --
NM_014671chr741540 1409 497 201 ----11187
NM_014672chr141163 ------
NM_014673chr82237 110 ------
NM_014674chr3164035 3986 3932 3780 3666 3504 3368 3327 3259 2508 1531 1334 1314 1011 825 329 23957 3047 13001 --
NM_014676chr121144 439 ------
NM_014677chr84915 347 312 106 --21051 1032 11042
NM_014678chr22180 --1172 --
NM_014680chr171129 ------
NM_014682chr852202 2160 1513 536 250 31856 344 243 1263 --
NM_014683chr1752012 1908 1892 806 216 ------
NM_014685chr161560 ----1466
NM_014686chr1952263 1916 1873 1850 966 32555 2285 2096 1968 --
NM_014689chr21182 ------
NM_014690chr7132911 2889 2827 2666 2567 2391 2099 1222 1127 833 448 433 356 --22461 981 1995
NM_014699chr162104 73 1341 ----
NM_014700chr1631588 998 413 11323 ----
NM_014701chr1573189 3135 3017 2751 2534 2453 840 --12218 --
NM_014702chr6123450 3334 3191 3115 3101 2458 2331 2223 1006 908 658 91 22180 999 22336 1353 --
NM_014703chr34989 917 854 221 1933 ----
NM_014705chr721916 679 11429 ----
NM_014707chr732287 1889 1877 21924 1437 1488 12177
NM_014709chr22638 475 ------
NM_014711chr16102124 1957 1937 1702 1588 1510 1500 1374 809 707 2826 785 ----
NM_014712chr161215 ------
NM_014713chr25546 427 171 113 81 1193 ----
NM_014719chr711081 ----1415
NM_014720chr107666 613 508 428 355 63 36 --1579 1531
NM_014721chr6207386 7272 6654 6611 6595 65