TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-5197-5p
miRNA Sequence: CAAUGGCACAAACUCAUUCUUGA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000027chr4--1908 ----
NM_000038chr541924 1413 729 51 ------
NM_000044chrX1128 ------
NM_000052chrX22152 36 --13011 --
NM_000061chrX1381 ------
NM_000084chrX116946 6832 6112 5718 5581 1792 1661 1639 1628 786 252 --24738 2718 --
NM_000088chr171931 --11064 --
NM_000090chr21250 --1633 --
NM_000092chr253906 2937 2789 1694 82 1809 24535 4180 --
NM_000104chr222303 373 11968 12158 --
NM_000109chrX12336 --42490 1932 1728 338 --
NM_000110chr111026 ------
NM_000125chr6103971 3856 3717 3300 3056 3037 3023 2930 246 139 ------
NM_000127chr81286 ------
NM_000138chr156965 877 852 297 281 228 11863 1610 12607
NM_000163chr522100 575 12302 12272 --
NM_000165chr6--11211 --11126
NM_000167chrX31249 273 185 ------
NM_000176chr553902 3585 3063 2737 1293 1509 ----
NM_000189chr2168 --1590 12337
NM_000201chr192530 87 ------
NM_000214chr2041573 1295 87 68 ----11339
NM_000217chr1235146 3815 1571 ------
NM_000245chr731360 696 239 11854 32088 1873 484 --
NM_000248chr322197 1973 --12371 --
NM_000255chr61155 ------
NM_000259chr1595335 4807 4742 4422 4400 4387 2510 2302 850 36379 5734 129 15905 26356 863
NM_000264chr943337 2612 2347 858 --12585 --
NM_000267chr1731260 354 135 --12130 --
NM_000276chrX42227 1970 1628 312 ------
NM_000288chr6----2345 104 --
NM_000297chr421794 1476 11762 ----
NM_000304chr17------1838
NM_000310chr14527 471 373 173 11225 ----
NM_000314chr1093151 2934 2707 2473 2363 1175 784 573 213 ----11245
NM_000321chr1321755 186 11194 1229 --
NM_000332chr675505 5294 4566 2817 1669 796 462 --24866 4496 1133
NM_000337chr596392 6195 5396 5374 5341 2269 2208 693 73 --21610 268 1424
NM_000340chr31136 11199 ----
NM_000345chr42681 350 ------
NM_000346chr1721567 1468 ------
NM_000361chr2051989 1868 819 704 474 11961 --11838
NM_000362chr2242572 2510 244 149 ------
NM_000368chr944737 4107 1935 1148 11046 ----
NM_000369chr1431772 1219 515 2649 532 21291 289 1393
NM_000371chr181101 ------
NM_000396chr1----190 --
NM_000408chr212876 23107 2229 23075 194 12675
NM_000411chr2152256 2231 1192 486 423 ------
NM_000428chr1452481 1982 814 269 173 ------
NM_000430chr1762815 1242 853 737 558 358 --1319 --
NM_000439chr5187 --11714 --
NM_000449chr151155 1110 937 245 89 ------
NM_000451chrX2854 321 --1418 --
NM_000461chr344425 3452 3294 873 --23404 49 --
NM_000474chr7----150 --
NM_000480chr1121516 348 --11639 --
NM_000489chrX1336 --22617 711 --
NM_000503chr821665 1531 --11356 --
NM_000508chr42844 251 --3964 354 115 --
NM_000533chrX31423 417 200 ------
NM_000555chrX67725 7219 6749 5076 2451 89 12923 37881 6113 2586 16718
NM_000574chr131150 1058 987 --11245 --
NM_000598chr721194 1063 --1504 --
NM_000610chr1162436 2398 2268 1182 545 281 ------
NM_000615chr1132647 2524 2241 --11928 12376
NM_000618chr1256576 6383 1306 1219 374 --34922 4604 910 --
NM_000618chr1256576 6383 1306 1219 374 --34922 4604 910 --
NM_000633chr1844787 3799 1444 201 ----15218
NM_000641chr1921564 441 1101 11167 --
NM_000668chr41393 --21268 277 --
NM_000671chr41293 --1135 --
NM_000673chr42625 32 ------
NM_000679chr51511 ------
NM_000701chr1--1322 ----
NM_000719chr1246029 5680 5463 1316 25401 1842 ----
NM_000720chr31140 ------
NM_000721chr142275 1974 1697 212 --22425 891 --
NM_000725chr1211018 --1816 --
NM_000794chr51823 ----171
NM_000800chr521483 1460 1651 --11664
NM_000806chr551798 1361 1269 601 333 11297 1612 --
NM_000807chr43653 210 60 1661 ----
NM_000813chr595163 5085 5039 4245 1006 706 491 432 340 12010 43898 2259 1743 1556 --
NM_000814chr1564060 3671 3285 1087 1066 799 13750 ----
NM_000824chr41346 --1119 --
NM_000826chr422252 23 --12002 --
NM_000827chr532241 1639 791 ----11648
NM_000829chr1131959 1771 680 ----11672
NM_000831chr196080 5086 4915 4373 3902 2166 1912 967 672 --1368 --
NM_000833chr1631527 1082 163 --11351 --
NM_000838chr622619 1804 --11824 11085
NM_000842chr111150 ------
NM_000868chrX22235 1949 --12293 --
NM_000872chr10132 --1170 --
NM_000875chr1596247 6145 6125 5999 5151 4340 2699 1843 1438 1468 11277 --
NM_000877chr232924 2429 1128 ------
NM_000891chr1733573 2650 2542 1517 13193 12883
NM_000899chr1243929 3265 1469 1224 --11199 13067
NM_000902chr321087 545 --1946 --
NM_000924chr1221366 49 ------
NM_000933chr203528 512 270 ------
NM_000945chr241770 1485 802 519 ------
NM_000950chrX43659 2455 2412 543 --11437 --
NM_001001132chr21----1397 1446
NM_001001323chr1212941 ----12298
NM_001001331chr331019 869 833 --1955 --
NM_001001389chr1162436 2398 2268 1182 545 281 ------
NM_001001390chr1162436 2398 2268 1182 545 281 ------
NM_001001391chr1162436 2398 2268 1182 545 281 ------
NM_001001392chr1162482 2444 2314 1228 591 327 ------
NM_001001394chr2----1496 --
NM_001001395chr1242586 2459 1931 440 --2722 244 --
NM_001001396chr174350 4233 4016 4001 3813 1432 1087 13123 33802 653 551 --
NM_001001419chr564422 3900 3342 3233 733 646 --1716 12048
NM_001001420chr564422 3900 3342 3233 733 646 --1716 12048
NM_001001433chr2022575 962 --1353 --
NM_001001481chr842861 2735 2495 2162 --1399 --
NM_001001484chr1032270 1978 643 1162 12011 --
NM_001001556chr15----11591 1117
NM_001001557chr822204 531 ------
NM_001001664chr233238 2829 411 12630 22874 276 --
NM_001001668chr1944202 3277 3029 1479 1300 ----
NM_001001669chr512300 ----12220
NM_001001740chr1183 ------
NM_001001740chr1183 ------
NM_001001924chr821602 444 --11824 --
NM_001001925chr821602 444 --11824 --
NM_001001931chr821602 444 --11824 --
NM_001001933chr11523 --146 --
NM_001001937chr18----143 --
NM_001001971chr10165 --1566 11406
NM_001001974chr102361 35 --21573 1557 --
NM_001001995chrX31745 413 214 11675 --11405
NM_001002243chr21788 ------
NM_001002257chr21111 --31245 1175 856 22890 2307
NM_001002258chr22122 94 ----11749
NM_001002294chr1----162 --
NM_001002811chr121620 1173 1573 1455 --
NM_001002812chr121620 1173 1573 1455 --
NM_001002812chr121620 1173 1573 1455 --
NM_001002838chrX31698 383 93 ------
NM_001002843chr15157 1816 ----
NM_001002860chr1434079 3970 3391 --33790 3429 580 --
NM_001002919chr21529 ------
NM_001003652chr18118713 7730 7721 7654 6188 5784 5469 5252 1311 643 54 17233 15380 --
NM_001003674chr1876699 5866 4589 4403 1727 1330 1304 26832 771 16639 --
NM_001003675chr1876699 5866 4589 4403 1727 1330 1304 26832 771 16639 --
NM_001003688chr4----1896 11222
NM_001003694chr31517 ------
NM_001003698chr62573 169 --11280 --
NM_001003699chr62573 169 --11280 --
NM_001003712chr1283813 3709 3060 2875 2863 2531 1449 378 --12812 13408
NM_001003794chr333010 2316 776 ------
NM_001003810chr42307 221 1597 ----
NM_001004304chr1243120 2928 2007 725 --1867 --
NM_001004317chr653474 3145 1657 671 178 ----13136
NM_001004346chr42434 88 11120 139 --
NM_001004419chr1234285 1656 1397 --24464 3274 --
NM_001005209chr21648 ------
NM_001005266chr15----1479 --
NM_001005267chr15----1479 --
NM_001005268chr15----1479 --
NM_001005269chr15----1479 --
NM_001005404chr1744485 4189 114 43 11459 ----
NM_001005463chr101330 --11729 --
NM_001005473chr544270 4261 2448 2017 --11487 --
NM_001005502chr1254871 3178 1525 963 760 --1643 11822
NM_001005526chr2----1102 --
NM_001005739chr2----1184 --
NM_001005743chr141385 ----1927
NM_001005744chr141385 ----1927
NM_001005745chr141385 ----1927
NM_001005910chr3156 ------
NM_001005911chr3156 ------
NM_001006118chrY----1213 --
NM_001006120chrY----1213 --
NM_001006600chr53730 723 484 ------
NM_001006605chr11859 --1190 --
NM_001006605chr11859 --1190 --
NM_001006610chr162733 673 ------
NM_001006612chrX------1107
NM_001006613chrX------1107
NM_001006614chrX------1107
NM_001006617chr931364 988 189 11434 1574 --
NM_001006619chr931364 988 189 11434 1574 --
NM_001006620chr931364 988 189 11434 1574 --
NM_001006621chr931364 988 189 11434 1574 --
NM_001006636chr21129 ------
NM_001006938chrX1652 ------
NM_001006943chr1----1231 --
NM_001007027chr11----1231 --
NM_001007067chr82410 286 ------
NM_001007068chr82410 286 ------
NM_001007069chr82410 286 ------
NM_001007070chr82410 286 ------
NM_001007094chr1024098 1710 --33430 1622 812 --
NM_001007097chr934344 1069 59 ----11938
NM_001007102chr631558 560 493 ------
NM_001007157chr71118 ------
NM_001007237chr132472 1906 195 ----1224
NM_001007246chr2121267 682 --1519 --
NM_001007257chr111270 --11472 --
NM_001007267chr23786 282 127 ------
NM_001007277chr113799 371 134 --21036 437 --
NM_001007466chr655200 4233 3658 918 261 --1438 --
NM_001007526chrY----1213 --
NM_001007559chr181551 --22053 1369 --
NM_001007565chr3140 ------
NM_001008220chr531366 1353 827 --13805 --
NM_001008222chrX1880 ------
NM_001008225chr7----1482 --
NM_001008239chr1883538 3493 3066 2875 2523 1371 911 78 --11087 --
NM_001008392chr333068 2630 844 --1668 --
NM_001008401chr1931477 1068 587 ------
NM_001008408chr765474 4744 4672 4413 1227 1051 --26239 988 --
NM_001008495chr82585 41 ----11659
NM_001008541chr1021810 315 1483 12167 --
NM_001008541chr1021810 315 1483 12167 --
NM_001008660chr1121062 215 --11435 --
NM_001008723chr101408 ------
NM_001008738chr522419 1789 12476 12245 --
NM_001008740chr1186 ------
NM_001008783chr62879 600 ----1284
NM_001008860chr15----1791 --
NM_001008892chr15----1791 --
NM_001008894chr15----1791 --
NM_001009185chr51550 ------
NM_001009552chr83559 481 155 ------
NM_001009566chr141308 1094 92 50 ------
NM_001009570chr21123 ------
NM_001009571chr711625 ----1504
NM_001009814chr13180 ------
NM_001009899chr395786 5494 4803 4686 4475 4282 2369 1254 300 ----15658
NM_001009909chr1173683 3446 3281 2978 1129 438 272 --31442 503 38 --
NM_001009955chr1------183
NM_001009955chr1------183
NM_001009993chr264189 3113 3089 2811 1309 795 1162 ----
NM_001010888chrX34563 3632 847 1954 ----
NM_001010891chr5136929 6600 6396 6229 4832 4647 4191 2403 2275 2202 1759 1419 134 --14288 --
NM_001010927chr61499 ------
NM_001010942chr1211254 1496 ----
NM_001011537chr342251 1916 1683 364 --21925 450 --
NM_001011546chr204625 567 113 55 ------
NM_001011551chrX------154
NM_001011645chrX1128 ------
NM_001011666chr765697 5599 5502 4542 4199 1732 ------
NM_001011713chr141628 ------
NM_001012267chr91675 --21294 79 --
NM_001012393chr1124715 592 ----14887
NM_001012420chr1532693 2661 350 1250 ----
NM_001012423chr1542693 2661 2235 350 1250 1422 --
NM_001012755chrX45086 3530 895 695 --2885 279 11926
NM_001012761chr552199 1949 1675 384 66 --22264 706 --
NM_001012980chrX125 ------
NM_001012989chrX1181 ------
NM_001013031chr1032718 773 357 --1476 --
NM_001013398chr721194 1063 --1504 --
NM_001013406chr71503 --11268 --
NM_001013415chr42473 323 11077 ----
NM_001013620chr1298396 8030 6552 6181 3386 3267 2452 1545 764 --33285 2202 400 12587
NM_001013699chr122524 112 ------
NM_001014797chr1078152 7109 7053 5950 2937 1432 1140 --12588 --
NM_001014812chr15----1380 --
NM_001014831chr19----1654 --
NM_001014832chr19----1654 --
NM_001014834chr19----1654 --
NM_001014835chr19----1654 --
NM_001015877chrX1979 --12806 12402
NM_001015881chrX----11016 --
NM_001017368chr1732020 610 136 ------
NM_001017371chr2----1508 --
NM_001017420chr8----11360 1903
NM_001017440chr7118168 6368 6297 6288 5738 5719 5546 5259 5224 2961 53 27772 555 2843 635 28020 761
NM_001017523chr1211251 ----11903
NM_001017923chr1431257 1227 328 ----11523
NM_001018008chr151576 ------
NM_001018009chr311118 ------
NM_001018025chrX3810 572 266 ------
NM_001018037chr921354 404 --11398 --
NM_001018067chr143720 1946 1433 949 --1110 11199
NM_001018068chr143720 1946 1433 949 --1110 11199
NM_001018069chr143720 1946 1433 949 --1110 11199
NM_001018072chr1211251 ----11903
NM_001018074chr553902 3585 3063 2737 1293 1509 ----
NM_001018075chr553902 3585 3063 2737 1293 1509 ----
NM_001018076chr553902 3585 3063 2737 1293 1509 ----
NM_001018077chr553902 3585 3063 2737 1293 1509 ----
NM_001018089chr1563767 3520 3489 2733 2558 1092 --21562 744 --
NM_001018108chr15----1696 --
NM_001020825chr541377 1060 538 212 ------
NM_001023567chr1542080 2043 849 421 1250 ----
NM_001024094chr553902 3585 3063 2737 1293 1509 ----
NM_001024372chr81482 12300 11486 1560
NM_001024380chr852049 1537 731 599 315 ------
NM_001024381chr852049 1537 731 599 315 ------
NM_001024455chrX41921 1850 1062 70 --42192 2172 930 62 --
NM_001024463chr1531146 326 183 1346 --1388
NM_001024649chr542240 1909 921 497 ----12719
NM_001024736chr1511445 --11348 --
NM_001024847chr322396 202 ------
NM_001024855chr331889 1487 1397 1246 ----
NM_001024934chr6180 ------
NM_001024935chr6180 ------
NM_001024936chr6180 ------
NM_001024948chr12396 24 12311 13090 --
NM_001024956chr1165599 5482 5295 1953 1395 1087 --34345 3712 1442 --
NM_001025076chr10106026 5627 4515 2461 2128 1811 1485 1243 562 125 23988 1933 1995 --
NM_001025077chr1087384 6985 5873 2843 2601 1920 1483 179 15346 12353 --
NM_001025079chr3104004 3991 3780 3713 3640 3368 3339 3316 3022 1616 --23766 619 --
NM_001025107chr1135 ------
NM_001025107chr1135 ------
NM_001025201chr21241 ------
NM_001025233chr121258 ------
NM_001025252chr862992 2800 2596 821 294 80 --13236 --
NM_001025253chr862992 2800 2596 821 294 80 --13236 --
NM_001025266chr344628 1520 1237 242 13315 64792 3815 3508 1387 482 391 --
NM_001025366chr61265 --11641 --
NM_001025366chr61265 --11641 --
NM_001025367chr61265 --11641 --
NM_001025367chr61265 --11641 --
NM_001025368chr61265 --11641 --
NM_001025368chr61265 --11641 --
NM_001025369chr61281 --11657 --
NM_001025369chr61281 --11657 --
NM_001025370chr61265 --11641 --
NM_001025370chr61265 --11641 --
NM_001025389chr1121516 348 --11639 --
NM_001025390chr1121516 348 --11639 --
NM_001025580chrX63390 1351 1206 1185 567 122 --13757 --
NM_001025595chr421336 262 --1631 --
NM_001025603chr151155 1110 937 245 89 ------
NM_001025616chr42540 370 ------
NM_001025780chr931216 1110 612 ------
NM_001029858chr642524 2447 1111 691 ----13113
NM_001029863chr672266 2228 2016 1287 1240 598 592 --13112 --
NM_001029875chr542302 1958 1833 179 ------
NM_001030055chr1424256 3161 --13016 --
NM_001031679chr121511 --33124 2751 117 --
NM_001031684chr211292 ------
NM_001031690chr721983 584 --12083 --
NM_001031695chr2255003 4618 3798 2029 57 1994 11460 --
NM_001031700chr43604 311 240 --1377 --
NM_001031722chr61133 ------
NM_001031723chr41321 ------
NM_001031732chr473259 3167 2673 2295 585 422 357 12834 1645 --
NM_001031748chr121201 ----1572
NM_001031804chr1633031 1724 1439 --34105 3352 1339 1862
NM_001031812chr531776 1670 123 11858 ----
NM_001032280chr61577 ------
NM_001032282chr82904 466 ------
NM_001032288chr201202 ------
NM_001032289chrX2866 849 --1145 --
NM_001032380chr1051645 1381 1300 662 626 ------
NM_001032394chr62324 40 --12821 1220
NM_001032395chr61191 --12688 187
NM_001032999chr201885 11116 25251 197 --
NM_001033047chr421634 759 --32354 663 524 --
NM_001033057chr341866 787 434 416 --12104 --
NM_001033059chr611994 --1605 --
NM_001033081chr121336 317 11713 ----
NM_001033082chr121336 317 11713 ----
NM_001033087chr2033238 2301 2103 --22453 1285 --
NM_001033507chr121536 1368 11302 ----
NM_001033557chr221288 1041 --1938 --
NM_001033578chr81398 1243 1286 --
NM_001033602chr133868 718 616 1861 ----
NM_001033756chr61199 --11575 --
NM_001033756chr61199 --11575 --
NM_001034837chr52683 499 --1593 --
NM_001034838chr52683 499 --1593 --
NM_001034850chr51661 ----11491
NM_001035chr151256 1089 980 437 267 ------
NM_001035003chr431394 1341 956 ------
NM_001035004chr431394 1341 956 ------
NM_001035260chr1021569 1142 ------
NM_001035511chr112043 1368 11521 --
NM_001035512chr112150 1475 21628 67 --
NM_001035513chr112150 1475 21628 67 --
NM_001037132chr721567 755 ------
NM_001037133chr721567 755 ------
NM_001037164chr711717 1757 --1110
NM_001037172chr321345 513 --1951 11219
NM_001037290chr111818 ------
NM_001037332chr542493 711 513 74 ------
NM_001037333chr542493 711 513 74 ------
NM_001037535chrX41445 1314 1300 1001 11123 --1531
NM_001037536chrX41445 1314 1300 1001 11123 --1531
NM_001037540chrX41445 1314 1300 1001 11123 --1531
NM_001037631chr241036 770 117 108 ------
NM_001037637chr5----153 --
NM_001037738chr5186 ------
NM_001037872chr23735 655 41 ------
NM_001037954chr1143364 2967 1359 745 11222 --1330
NM_001039091chrX----2892 249 --
NM_001039459chr72857 429 ------
NM_001039479chr142260 238 --11901 --
NM_001039538chr21804 ----13029
NM_001039569chr223277 644 ----1400
NM_001039574chr111015 --1268 --
NM_001039580chr485084 4535 3785 3645 3587 1699 1668 837 21483 779 13953 --
NM_001039585chr14932 859 486 160 11156 1218 --
NM_001039590chrX43463 2637 935 507 ------
NM_001039591chrX43463 2637 935 507 ------
NM_001039618chr1134176 2033 1898 24496 499 12341 --
NM_001039709chr201885 11116 25251 197 --
NM_001039802chr11903 ------
NM_001039840chrX55444 4753 2066 1455 597 --26028 37 1260
NM_001039916chr122295 226 ------
NM_001039917chr122295 226 ------
NM_001039918chr122295 226 ------
NM_001039919chr122295 226 ------
NM_001039920chr122295 226 ------
NM_001039937chr1352629 1134 966 804 107 --24114 265 --
NM_001040001chr6----21989 196 --
NM_001040057chr731478 1261 508 ------
NM_001040110chr711715 ------
NM_001040142chr232113 665 384 --22263 872 --
NM_001040143chr232113 665 384 --22263 872 --
NM_001040151chr1134490 4164 470 13334 ----
NM_001040152chr784769 4366 3721 3712 3513 3272 1959 1159 --1316 --
NM_001040167chr721174 443 ------
NM_001040181chr321021 201 --2814 31 --
NM_001040182chr321021 201 --2814 31 --
NM_001040183chr321021 201 --2814 31 --
NM_001040199chr321021 201 --2814 31 --
NM_001040200chr321021 201 --2814 31 --
NM_001040214chr642146 810 490 334 --12242 1641
NM_001040272chr911824 ------
NM_001040284chr1673978 1952 1740 1569 1294 636 264 --15164 --
NM_001040402chr412618 11178 21264 140 --
NM_001040409chr22750 734 1231 1343 --
NM_001040429chr132661 641 1730 13365 --
NM_001040440chr51119 ----1163
NM_001040441chr145479 1871 1127 154 11341 13703 1527
NM_001040446chr562269 2131 2122 570 384 254 ------
NM_001040450chr1542805 2398 2333 289 1327 ----
NM_001040453chr1542805 2398 2333 289 1327 ----
NM_001040455chr1131321 505 54 --1850 --
NM_001040624chr852215 614 488 421 107 --12471 --
NM_001040625chr852215 614 488 421 107 --12471 --
NM_001040626chr852215 614 488 421 107 --12471 --
NM_001040627chr852215 614 488 421 107 --12471 --
NM_001040628chr852215 614 488 421 107 --12471 --
NM_001040629chr852215 614 488 421 107 --12471 --
NM_001040630chr852215 614 488 421 107 --12471 --
NM_001040633chr72930 797 ----1245
NM_001040665chr774911 4612 3539 885 760 174 26 --11675 23532 49
NM_001040708chr82932 189 ------
NM_001040709chr152583 1790 1627 488 21 ------
NM_001040712chr943339 2401 1389 1022 --12684 22821 2764
NM_001040876chr441589 713 64 29 --1730 --
NM_001042361chr102307 125 11109 --11588
NM_001042364chr102307 125 11109 --11588
NM_001042365chr102307 125 11109 --11588
NM_001042387chr102307 125 11109 --11588
NM_001042393chr102307 125 11109 --11588
NM_001042396chr102307 125 11109 --11588
NM_001042397chr102307 125 11109 --11588
NM_001042404chr111404 ------
NM_001042413chr933617 1315 1171 11342 33276 2752 1489 --
NM_001042422chr17----2181 61 --
NM_001042423chr17----2181 61 --
NM_001042425chr61577 ------
NM_001042453chrX31705 1276 358 21360 138 ----
NM_001042481chr142651 87 11978 ----
NM_001042492chr1731260 354 135 --12130 --
NM_001042493chr651659 1499 1364 570 244 21300 176 11250 --
NM_001042494chr1523230 1366 2793 187 1684 --
NM_001042495chr1523230 1366 2793 187 1684 --
NM_001042496chr1523230 1366 2793 187 1684 --
NM_001042497chr1523230 1366 2793 187 1684 --
NM_001042506chrX11212 --1260 11450
NM_001042537chrX21665 1634 --21556 117 12379
NM_001042543chr431155 1095 65 --21520 1336 1372
NM_001042550chr931871 484 402 2821 466 ----
NM_001042555chr1234409 4323 4309 --44637 3207 1770 666 1828
NM_001042599chr286460 6127 6016 2132 1767 922 844 401 15723 36405 6300 4882 --
NM_001042601chr321079 715 --2866 466 12787
NM_001042604chr331865 1321 1086 13903 34489 3655 1478 --
NM_001042669chr42540 370 ------
NM_001042749chrX135 --11269 --
NM_001042750chrX135 --11269 --
NM_001042751chrX135 --11269 --
NM_001044722chr531776 1670 123 11858 ----
NM_001044723chr531776 1670 123 11858 ----
NM_001046chr542673 2367 2263 779 2984 688 1920 --
NM_001071775chr1331617 641 246 ----11195
NM_001083620chr422250 23 --12000 --
NM_001083621chr164410 3957 3805 1341 792 450 --34151 1623 1143 --
NM_001099678chr375784 4689 4605 1684 1140 1045 466 --24975 4125 34528 1291 655
NM_001106chr3128842 7545 6334 3540 3400 3108 2870 2497 2228 2163 1653 1248 --58568 7824 7586 7015 117 --
NM_001111chr1135 ------
NM_001113490chrX73680 3383 3021 3011 2356 1273 826 ------
NM_001116chr1621196 122 --12594 --
NM_001123chr101667 --196 --
NM_001126chr1--1721 2435 340 --
NM_001135chr151101 ------
NM_001146chr841779 1478 407 167 ------
NM_001148chr411595 ------
NM_001149chr1031245 1029 338 --2945 313 --
NM_001153chr2--1173 --176
NM_001173chr1424256 3161 --13016 --
NM_001186chr2122787 2723 --1287 --
NM_001198chr63931 864 472 ------
NM_001200chr201155 ------
NM_001204chr287518 7283 6878 2636 2287 1854 1258 887 1363 22969 764 15650
NM_001206chr922740 637 ------
NM_001207chr5----153 --
NM_001215chr1----1382 --
NM_001219chr721665 548 ----1574
NM_001235chr112645 255 --165 --
NM_001238chr191493 ------
NM_001241chr222392 440 --12465 11890
NM_001241chr222392 440 --12465 11890
NM_001253chr61231 ------
NM_001256chr1752383 2131 2052 1185 101 --11863 --
NM_001259chr745301 1388 839 98 --1290 --
NM_001270chr511061 ------
NM_001274chr11146 ------
NM_001278chr104796 767 261 46 ------
NM_001280chr191119 ------
NM_001284chr51390 ------
NM_001286chr122726 995 --12834 --
NM_001305chr71802 ------
NM_001310chr1242259 2087 1884 546 ----12546
NM_001315chr622259 887 --22218 807 --
NM_001326chr11----1117 --
NM_001331chr1142789 779 699 519 --12159 --
NM_001332chr521068 154 ------
NM_001343chr51661 ------
NM_001351chr331582 1320 1132 ------
NM_001364chr1154756 3727 3445 2916 1114 --1667 --
NM_001378chr2----1192 --
NM_001386chr842157 1764 979 645 --1958 --
NM_001396chr2132308 1022 330 ------
NM_001400chr121177 1047 ------
NM_001401chr921642 1326 ------
NM_001404chr11--159 ----
NM_001407chr3----11072 --
NM_001412chrX63258 2790 1064 508 486 386 --1599 12619
NM_001416chr171443 --1104 --
NM_001418chr11145 ------
NM_001418chr11145 ------
NM_001419chr1933916 3381 1805 --14219 12951
NM_001423chr1251614 1442 713 518 49 ----11768
NM_001426chr21207 --1488 --
NM_001432chr443703 3673 2653 1325 ------
NM_001438chr141367 1349 1082 822 --13244 --
NM_001444chr81145 ------
NM_001449chrX1951 11278 --11271
NM_001453chr611675 ------
NM_001458chr71692 ------
NM_001460chr173484 3272 965 891 832 380 47 1957 ----
NM_001478chr121678 ------
NM_001527chr634676 3000 1288 --24355 4050 --
NM_001530chr14--1974 ----
NM_001541chr111149 ------
NM_001542chr132472 1906 195 ----1224
NM_001543chr5104797 4761 4358 3437 3418 2945 1892 1218 664 382 --14650 --
NM_001565chr42255 204 ------
NM_001570chr321359 393 --11433 --
NM_001584chr1111093 --2244 50 --
NM_001587chrX42227 1970 1628 312 ------
NM_001616chr253508 2671 1176 1135 736 --33412 819 376 --
NM_001621chr71797 --1121 --
NM_001621chr71797 --1121 --
NM_001627chr331814 447 327 1972 ----
NM_001634chr611994 --1605 --
NM_001635chr7----11076 --
NM_001650chr1821379 121 21452 1403 23938 2966 --
NM_001655chr1121976 1561 ------
NM_001659chr122580 215 ------
NM_001660chr3----1168 --
NM_001663chr1422253 2126 --1516 12316
NM_001677chr13365 89 31 ------
NM_001681chr121557 ------
NM_001682chr1212655 ----12012
NM_001683chr331019 869 833 --1955 --
NM_001684chr174067 3950 3733 3718 3530 1149 804 12840 33519 370 268 --
NM_001689chr22122 94 ----11749
NM_001701chr911042 ------
NM_001704chr6--1377 --1422
NM_001714chr122571 224 --1410 --
NM_001718chr61331 ------
NM_001720chr12861 668 ----11379
NM_001722chr8--1583 1237 --
NM_001730chr1331538 481 185 --1541 --
NM_001730chr1331538 481 185 --1541 --
NM_001743chr2----1167 --
NM_001746chr542240 1909 921 497 ----12719
NM_001753chr731630 388 175 --1499 --
NM_001755chr1621537 200 11712 22043 374 --
NM_001759chr1285026 4875 4562 4173 1565 1512 749 418 14751 25317 1773 --
NM_001777chr3104004 3991 3780 3713 3640 3368 3339 3316 3022 1616 --23766 619 --
NM_001791chr11903 ------
NM_001797chr16----1640 --
NM_001798chr1231005 313 78 ----11105
NM_001806chr1931051 950 124 ------
NM_001822chr21241 ------
NM_001830chrX63876 3445 2994 904 645 454 --21552 45 --
NM_001833chr9170 ------
NM_001845chr1331095 1001 552 ------
NM_001854chr121455 1199 ------
NM_001858chr654846 4422 1993 1906 230 ------
NM_001859chr973978 3803 3289 3149 2726 2577 751 ------
NM_001874chr1254871 3178 1525 963 760 --1643 11822
NM_001884chr51130 136 ----
NM_001901chr61155 --1340 --
NM_001904chr31112 ------
NM_001920chr122689 641 --2190 53 1495
NM_001924chr11508 ------
NM_001938chr131611 732 159 --1112 1137
NM_001939chrX33001 942 296 12903 ----
NM_001942chr1841949 1820 1510 32 ------
NM_001949chr632252 554 67 --1830 12501
NM_001966chr31312 ------
NM_001967chr32572 179 ----1401
NM_001973chr11373 --1124 --
NM_001980chr1231927 397 22 --32236 2041 72 --
NM_001993chr1133 ------
NM_001995chr421452 355 11017 21342 1254 --
NM_001999chr541194 1010 490 361 ----11225
NM_002006chr435648 4514 629 --45691 1821 1457 394 11374
NM_002009chr151378 ------
NM_002015chr1333245 2637 2383 13355 1243 12202
NM_002024chrX1423 --2515 429 --
NM_002025chrX88158 8108 2994 2633 2369 604 206 154 28809 2125 ----
NM_002028chr1431290 1259 528 ------
NM_002035chr1813928 13861 ----
NM_002040chr2123085 2658 --12408 --
NM_002044chr15----11591 1117
NM_002046chr121169 ------
NM_002056chr2--1254 --1899
NM_002063chrX1895 ------
NM_002076chr1243215 3205 2035 995 --11021 --
NM_002078chr32664 37 --1132 --
NM_002080chr161398 --2307 54 --
NM_002092chr484451 4387 4133 4026 3375 3069 1760 1427 21840 1093 23911 3875 --
NM_002107chr1------1506
NM_002126chr1743546 2751 630 275 22990 2920 43833 2939 1199 225 --
NM_002128chr1332464 1714 943 ------
NM_002137chr71175 1400 ----
NM_002138chr42307 221 1597 ----
NM_002139chrX1558 --1515 --
NM_002146chr1721219 1204 ------
NM_002148chr2--1169 ----
NM_002156chr2----1183 --
NM_002158chr243495 2468 982 888 --43419 3374 1165 638 --
NM_002160chr9----1413 1383
NM_002166chr21696 ------
NM_002182chr332499 1991 819 ------
NM_002184chr51155 ------
NM_002190chr61418 ----11006
NM_002196chr2011075 ------
NM_002196chr2011075 ------
NM_002199chr41677 ------
NM_002202chr51413 --2934 242 --
NM_002203chr544158 3139 2568 1163 13754 12813 --
NM_002210chr232565 2480 850 --13167 13225
NM_002211chr1021018 87 --11134 --
NM_002214chr744529 1359 905 739 ------
NM_002223chr1243476 1471 1412 925 ----1821
NM_002227chr131081 840 69 --11227 --
NM_002228chr11924 ------
NM_002232chr11932 --31221 1133 975 --
NM_002233chr111422 ------
NM_002247chr103824 811 747 1894 1157 --
NM_002252chr2----1307 --
NM_002253chr421288 1179 --11433 --
NM_002264chr364888 4767 3873 3776 3156 582 11655 ----
NM_002267chr1322466 1539 ----1699
NM_002268chr331814 1660 449 ------
NM_002270chr574988 4942 4120 3998 2027 1362 174 13566 ----
NM_002271chr1322225 117 --1605 11855
NM_002293chr122221 545 12512 12612 --
NM_002294chrX1194 1328 1377 --
NM_002296chr111385 --31514 310 49 --
NM_002310chr556601 4543 4409 4216 1172 24381 2318 1990 14450
NM_002336chr1294842 4206 3634 3571 3376 1567 766 645 215 187 ----
NM_002349chr231654 469 173 ------
NM_002356chr6------11155
NM_002373chr1531327 943 555 ------
NM_002374chr21804 ----13029
NM_002381chr22754 305 ----1109
NM_002383chr161845 ------
NM_002397chr5102087 2031 1881 1762 1726 1609 456 307 98 55 ------
NM_002398chr2------1552
NM_002399chr1511104 --1451 --
NM_002430chr222581 549 ------
NM_002439chr52952 871 --1916 --
NM_002444chrX31591 710 559 ------
NM_002480chr1241441 1218 1162 588 --1104 --
NM_002493chr92219 114 ------
NM_002499chr1542197 1783 1516 577 --1859 --
NM_002500chr231162 1029 966 ----1146
NM_002515chr1411297 22025 782 1271 --
NM_002543chr1241097 1019 458 62 --1108 --
NM_002545chr1124715 592 ----14887
NM_002547chrX93928 3899 3869 3515 1445 539 448 369 91 --24225 3194 --
NM_002572chr111364 ------
NM_002576chr1131162 477 205 --11103 --
NM_002577chr332828 2649 268 ------
NM_002578chrX------1433
NM_002581chr945447 4668 675 276 13878 ----
NM_002583chr122610 561 --1463 --
NM_002590chr132574 126 --1223 --
NM_002594chr2032373 2250 482 --2566 254 --
NM_002613chr1685103 4804 4383 3682 1959 1287 709 268 ------
NM_002618chr21110 ------
NM_002623chr201238 ------
NM_002628chr331210 965 115 --1993 1809
NM_002639chr182907 137 --11338 --
NM_002641chrX--21600 608 21694 1675 --
NM_002645chr111215 1233 1460 --
NM_002655chr853822 3395 924 756 591 24017 270 14984 24586 3716
NM_002656chr63289 272 244 1941 ----
NM_002657chr2022632 846 ----13830
NM_002687chr142259 28 11042 ----
NM_002706chr21571 --1221 --
NM_002709chr232705 1124 88 12198 ----
NM_002711chr7138 --1313 --
NM_002713chr121133 440 --11084 --
NM_002715chr551102 257 166 141 30 ------
NM_002716chr1133675 1465 218 --1618 --
NM_002731chr152266 2224 2216 206 137 ------
NM_002737chr1796533 6377 5427 4993 4392 2336 2001 832 656 ------
NM_002738chr162330 54 --21146 37 --
NM_002740chr322754 2532 --31814 372 40 --
NM_002742chr141641 ----188
NM_002745chr2254437 3082 1486 675 127 --1647 --
NM_002748chr152363 78 --2194 104 --
NM_002750chr101183 ------
NM_002752chr51528 ------
NM_002755chr154581 303 229 49 --1155 --
NM_002765chrX----2892 249 --
NM_002786chr111112 ------
NM_002806chr14------197
NM_002816chr171236 143 ----
NM_002827chr2051762 1175 658 559 230 11797 ----
NM_002829chr92899 381 ------
NM_002833chr154331 267 231 77 --1507 --
NM_002834chr1253809 2755 1349 729 672 ------
NM_002835chr7------1765
NM_002837chr1234403 3981 92 --14003 1499
NM_002838chr11916 ----1816
NM_002839chr943339 2401 1389 1022 --12684 22821 2764
NM_002844chr611248 ------
NM_002849chr123855 754 336 ------
NM_002874chr942418 2299 1814 1790 --22336 616 --
NM_002886chr333731 1584 454 21697 286 21467 1115 --
NM_002890chr51282 ------
NM_002892chr1441199 223 214 38 --1489 --
NM_002912chr61824 1641 132 --
NM_002922chr12528 231 --1446 --
NM_002923chr12563 72 ------
NM_002940chr441589 713 64 29 --1730 --
NM_002941chr3----21360 1325 --
NM_002942chr32392 302 ------
NM_002955chr62573 169 --11280 --
NM_002956chr12----1444 2345 265
NM_002959chr133925 3618 1369 13288 ----
NM_002970chrX1278 ------
NM_002971chr311116 ------
NM_002973chr121208 ------
NM_002977chr283402 3134 2857 2807 2503 626 600 310 ----1847
NM_002993chr421062 674 --21090 709 --
NM_002994chr431490 702 260 --3736 266 239 --
NM_002998chr832212 463 107 ------
NM_003001chr112150 1475 21628 67 --
NM_003010chr17------21991 1648
NM_003020chr15----1358 --
NM_003028chr931481 1136 682 ------
NM_003030chr311650 --1458 --
NM_003031chr162733 673 ------
NM_003036chr11302 ------
NM_003043chr321019 354 --11624 --
NM_003069chrX128 --1184 --
NM_003070chr92659 80 ------
NM_003074chr32383 318 ------
NM_003088chr7----11105 --
NM_003099chr1576598 6344 5020 2578 2251 2134 353 --12106 --
NM_003101chr1----1495 --
NM_003111chr2----1508 --
NM_003112chr743117 2924 2312 1085 ------
NM_003115chr11142 --1361 --
NM_003118chr511436 --22060 243 --
NM_003128chr242450 1972 1083 600 --32763 2464 886 11090
NM_003137chr642243 1652 1517 185 --11563 11600
NM_003139chr11------1906
NM_003150chr1721905 142 ------
NM_003155chr832775 330 265 12137 --22659 2568
NM_003156chr1121236 1196 --1941 --
NM_003157chr3181 ------
NM_003161chr1723528 807 12683 --1112
NM_003178chr331651 1498 702 --42130 1944 1916 98 --
NM_003185chr20----11313 --
NM_003188chr61333 ------
NM_003199chr1865499 5313 3942 3757 1809 583 14505 14575 --
NM_003220chr61577 ------
NM_003221chr623668 875 ------
NM_003223chr16--1781 1110 --
NM_003234chr322002 1747 11594 21736 630 --
NM_003242chr322396 202 ------
NM_003244chr182159 36 ------
NM_003246chr151537 --41804 1769 750 326 --
NM_003247chr6142 1387 --1276
NM_003253chr2121604 448 --21802 165 --
NM_003262chr364983 4856 4376 4007 1485 404 1198 ----
NM_003270chrX1238 --2452 403 --
NM_003272chr11742 --1202 --
NM_003274chr2152924 2297 474 349 134 --12116 --
NM_003286chr2011042 ------
NM_003295chr133174 60 37 ------
NM_003298chr365371 5293 5180 4509 2326 110 11978 --15954
NM_003299chr121235 ------
NM_003304chr321515 119 11195 ----
NM_003329chr93101 37 30 ------
NM_003336chrX------179
NM_003337chr521214 673 11630 11575 --
NM_003338chr1031606 1360 1268 11572 21493 733 --
NM_003339chr5--1579 11235 --
NM_003340chr441360 1290 1042 967 --11436 --
NM_003341chr31447 ----1211
NM_003342chr1753307 2912 2556 2266 748 1772 11330 1935
NM_003348chr1221255 181 ------
NM_003349chr201202 ------
NM_003350chr8----2755 226 --
NM_003359chr41202 ----175
NM_003360chr4------159
NM_003369chr1152259 2104 792 696 282 --11099 --
NM_003376chr61265 --11641 --
NM_003376chr61265 --11641 --
NM_003385chr2161 --1180 --
NM_003387chr262887 2878 1891 1038 205 50 --12254 --
NM_003390chr1121007 167 ------
NM_003392chr343965 2639 586 368 13487 1962 --
NM_003403chr141568 ------
NM_003405chr221679 ------
NM_003406chr8159 --21847 1713 --
NM_003409chr182953 145 ------
NM_003410chrX32525 1952 493 --12086 --
NM_003413chrX21537 620 --11749 --
NM_003421chr1024098 1710 --33430 1622 812 --
NM_003423chr1922599 1019 1217 11956 --
NM_003439chr742986 2838 1223 25 ------
NM_003453chr131290 ----1169
NM_003463chr663102 2938 2827 2606 2558 2148 1777 22599 239 --
NM_003473chr103684 360 262 --1425 --
NM_003478chr1143127 3014 2594 899 1790 22246 659 --
NM_003483chr122973 90 --1814 --
NM_003489chr2143378 2567 2124 185 --13343 --
NM_003505chr731742 1614 1270 --11296 --
NM_003557chr151398 1126 1116 580 39 --11431 --
NM_003558chr91578 --1456 --
NM_003574chr1844640 4198 2281 1634 --34688 2114 1655 --
NM_003580chr81564 1169 1178 --
NM_003583chr1233578 2835 2494 12566 ----
NM_003590chr233243 3136 1143 13785 23871 3552 13272
NM_003603chr452058 1948 792 533 89 --11913 --
NM_003613chr15150 1549 --1283
NM_003615chr333232 1204 89 ------
NM_003618chr211121 ------
NM_003620chr17----1811 --
NM_003622chr1252341 2240 1718 906 858 ------
NM_003629chr122543 2349 --13044 23221 1355
NM_003633chr552524 2449 1801 672 592 ------
NM_003635chr101381 --1437 --
NM_003648chr212562 ------
NM_003651chr121457 ------
NM_003663chr322409 324 --12765 --
NM_003664chr51525 ------
NM_003672chr111762 11703 ----
NM_003676chr13619 292 226 1676 1253 --
NM_003677chr122404 358 ------
NM_003690chr23573 554 255 ------
NM_003714chr532091 758 633 22624 797 22342 609 --
NM_003716chr32945 889 --1132 --
NM_003725chr121304 ------
NM_003741chr3--1366 ----
NM_003743chr251858 1596 451 298 102 --12147 --
NM_003744chr141385 ----1927
NM_003758chr152260 24 ------
NM_003758chr152260 24 ------
NM_003759chr453970 1376 1310 1171 716 11500 2622 186 12652
NM_003763chr2022575 962 --1353 --
NM_003787chr1811475 --21345 529 --
NM_003796chr192516 488 ------
NM_003800chr642145 1633 978 461 ------
NM_003806chr12----1257 --
NM_003812chr21239 ------
NM_003816chr81581 ----1342
NM_003819chr11127 ------
NM_003825chr1521252 244 ----11090
NM_003850chr133609 113 42 ------
NM_003861chr1441937 435 414 188 ------
NM_003870chr1532125 1549 439 1393 3846 466 375 11648
NM_003872chr272673 2562 2354 2339 793 219 92 --2663 595 --
NM_003877chr121725 --1815 --
NM_003884chr321410 266 11353 11172 --
NM_003885chr1742510 2103 2095 879 --12411 --
NM_003887chr232318 459 203 --32159 2054 1859 --
NM_003895chr2122207 93 11977 ----
NM_003902chr11708 ------
NM_003913chr663247 3240 2990 1625 1303 796 --21565 953 24148 3602
NM_003930chr722386 1825 --21727 229 12533
NM_003931chr6180 ------
NM_003932chr22--11703 --1183
NM_003934chr911089 ------
NM_003938chr1931137 1093 154 ------
NM_003946chr16------1556
NM_003947chr3----11228 --
NM_003968chr32588 439 --176 --
NM_003980chr6173 11403 ----
NM_003983chr1653978 1751 1512 1107 240 13469 ----
NM_003994chr1243929 3265 1469 1224 --11199 13067
NM_003998chr4----3663 601 452 --
NM_004006chrX12336 --42490 1932 1728 338 --
NM_004007chrX12336 --42490 1932 1728 338 --
NM_004009chrX12336 --42490 1932 1728 338 --
NM_004010chrX12336 --42490 1932 1728 338 --
NM_004011chrX12336 --42490 1932 1728 338 --
NM_004012chrX12336 --42490 1932 1728 338 --
NM_004013chrX12336 --42490 1932 1728 338 --
NM_004014chrX12336 --42490 1932 1728 338 --
NM_004015chrX12336 --42490 1932 1728 338 --
NM_004016chrX12250 --42404 1846 1642 252 --
NM_004017chrX12336 --42490 1932 1728 338 --
NM_004018chrX12250 --42404 1846 1642 252 --
NM_004020chrX12336 --42490 1932 1728 338 --
NM_004021chrX12250 --42404 1846 1642 252 --
NM_004022chrX12250 --42404 1846 1642 252 --
NM_004023chrX12250 --42404 1846 1642 252 --
NM_004028chr1821379 121 21452 1403 23938 2966 --
NM_004040chr21901 ------
NM_004046chr18----143 --
NM_004060chr5----1338 1399
NM_004080chr741440 1036 531 431 1159 ----
NM_004089chrX----11016 --
NM_004093chr1353164 3046 2325 2022 1133 --12979 --
NM_004109chr1142176 1800 870 640 --1155 12115
NM_004114chrX----1934 1147
NM_004124chr1423461 1032 13095 33238 2182 698 22922 2682
NM_004132chr1021126 961 ------
NM_004133chr832693 2448 1648 ------
NM_004134chr52527 478 1547 1227 --
NM_004136chr1542599 2315 528 441 --32545 1007 980 22620 198
NM_004156chr83559 481 155 ------
NM_004157chr32866 830 --2119 101 --
NM_004170chr9----31672 1356 374 --
NM_004207chr17----2181 61 --
NM_004229chrX----1385 --
NM_004232chr1873677 2816 2747 401 310 98 79 --21298 1250 --
NM_004241chr103676 569 317 ------
NM_004242chr6161 ------
NM_004253chr91846 --1742 --
NM_004272chr511292 ----1507
NM_004277chr611452 --31410 481 311 --
NM_004279chr7----3940 730 302 --
NM_004280chr63335 310 96 ------
NM_004296chr1443047 1396 886 499 --11311 --
NM_004297chr91118 ------
NM_004311chr1022811 973 --12592 --
NM_004319chr152232 744 571 329 227 23210 1009 --1267
NM_004331chr8------22698 311
NM_004337chr822000 1986 1355 --140
NM_004338chr1876699 5866 4589 4403 1727 1330 1304 26832 771 16639 --
NM_004341chr21230 ------
NM_004342chr711877 --22189 775 --
NM_004356chr111503 ------
NM_004364chr19----1353 --
NM_004370chr631730 1618 729 --1337 --
NM_004378chr15161 1227 ----
NM_004379chr2----21306 1218 --
NM_004384chr531776 1670 123 11858 ----
NM_004388chr13418 288 83 ------
NM_004397chr1123528 468 --43545 1701 1666 1452 --
NM_004414chr21----11302 --
NM_004415chr62629 24 --1669 --
NM_004418chr21462 ------
NM_004430chr832613 2310 1112 ------
NM_004432chr911861 --22023 1608 --
NM_004433chr11486 ------
NM_004438chr253331 2277 836 694 196 --33238 2215 1322 --
NM_004443chr31549 ------
NM_004447chr121842 --1405 1990
NM_004458chrX1581 ------
NM_004459chr1741993 1532 1397 570 ------
NM_004469chrX----132 --
NM_004483chr16----1487 --
NM_004496chr1431066 1052 874 --1886 --
NM_004501chr153581 2613 2582 1444 383 --13630 --
NM_004503chr12--1572 ----
NM_004504chr22400 311 --1634 --
NM_004520chr52624 75 --1542 --
NM_004529chr921177 510 ----11402
NM_004535chr20----11166 --
NM_004537chr1231376 1143 295 --11490 11015
NM_004560chr91345 --1825 --
NM_004566chr10----12354 --
NM_004571chr2142275 816 606 549 --1318 1687
NM_004575chr4--1645 --11646
NM_004583chr171167 ------
NM_004586chrX75423 5257 4467 3915 3593 1828 439 --24907 1935 12131
NM_004593chr31841 ------
NM_004598chr532839 1038 243 --12337 --
NM_004607chr5178 ------
NM_004612chr974398 3152 1754 1688 1573 1513 1082 --1799 --
NM_004615chrX----1766 --
NM_004622chr232128 1854 564 --1730 11798
NM_004634chr31517 ------
NM_004643chr141850 ------
NM_004655chr1751287 927 913 283 251 --11058 --
NM_004660chrY41441 865 799 663 --11456 --
NM_004661chr531209 1020 983 ------
NM_004663chr1531466 1444 198 ------
NM_004685chr1341199 1083 464 169 --12655 12202
NM_004686chr82315 186 --1103 1282
NM_004705chr113271 213 123 ------
NM_004726chrX105765 5393 5375 5316 4986 4540 3533 2026 473 83 --1577 --
NM_004730chr51190 --31819 1751 824 --
NM_004738chr201933 --21628 294 --
NM_004741chr101383 ------
NM_004742chr331578 1171 661 --11692 --
NM_004745chr846628 6459 5168 2758 14651 26572 6487 --
NM_004748chr152961 921 21407 690 ----
NM_004768chr131136 369 202 --147 1435
NM_004772chr521577 160 --1563 --
NM_004774chr1733063 584 512 --11091 --
NM_004775chr1812258 --11784 --
NM_004779chr511096 --1353 --
NM_004781chr131262 262 68 --1325 21438 300
NM_004781chr131262 262 68 --1325 21438 300
NM_004788chr1142575 2509 1803 1107 --32448 796 346 --
NM_004791chr131265 2651 46 ----
NM_004808chr1083277 3230 3075 2557 2278 1246 1239 1153 13406 2364 71 --
NM_004815chr134639 3604 1523 --14874 --
NM_004822chr1713010 --13689 --
NM_004824chr61146 1220 ----
NM_004840chrX31917 683 376 ------
NM_004841chr11899 --1304 --
NM_004842chr671721 1624 1531 634 497 444 324 --1342 --
NM_004844chr311118 ------
NM_004845chrX23483 996 ----1861
NM_004849chr61204 --21533 618 --
NM_004856chr151217 --1440 --
NM_004857chr1444384 1882 628 322 14671 14092 --
NM_004859chr1763099 2528 2417 2197 2170 1930 --12375 --
NM_004863chr1474975 3972 3898 3814 3259 1887 328 --15102 --
NM_004865chr61310 ------
NM_004879chr112677 249 --2914 315 --
NM_004887chr511085 ------
NM_004890chr17------171
NM_004896chr1031484 1057 628 ------
NM_004902chr20----1107 --
NM_004904chr765697 5599 5502 4542 4199 1732 ------
NM_004905chr14756 654 118 92 --1892 --
NM_004906chr6----133 --
NM_004912chr71503 --11268 --
NM_004927chr1111057 11454 ----
NM_004929chr8------11518
NM_004932chr541733 1329 537 54 --21712 511 --
NM_004949chr1822149 2019 --1299 1679
NM_004956chr774566 4407 4020 3950 1254 808 162 --1449 --
NM_004969chr101508 ----1135
NM_004976chr1145103 4791 3346 1362 --13982 --
NM_004978chr111678 ------
NM_004985chr1274498 3916 3090 1815 1080 660 505 ----1565
NM_004992chrX36577 2181 406 27924 3397 16367 --
NM_004992chrX36577 2181 406 27924 3397 16367 --
NM_004999chr644069 3547 1536 39 12834 23140 1468 --
NM_005010chr721567 755 ------
NM_005011chr711715 ------
NM_005016chr121267 ------
NM_005020chr7----2451 413 1434
NM_005025chr3----1198 --
NM_005032chrX31021 101 60 ------
NM_005045chr71379 --2943 786 --
NM_005054chr211664 ------
NM_005056chr1221913 974 --25395 4644 --
NM_005057chr151821 693 346 70 38 --1359 --
NM_005058chrY----1213 --
NM_005066chr11750 ------
NM_005068chr611377 ------
NM_005079chr862992 2800 2596 821 294 80 --13236 --
NM_005080chr22--1682 ----
NM_005093chr201885 11116 25251 197 --
NM_005095chr122044 583 --11678 --
NM_005103chr11152 ------
NM_005105chr132131 1869 1793 11439 11648 --
NM_005109chr31147 --12334 --
NM_005112chr4----2844 70 --
NM_005116chr20104561 4202 3602 3424 2993 1744 1579 1349 854 300 --1412 --
NM_005121chr1763745 2749 1163 1105 943 95 13582 43181 3161 2673 170 --
NM_005130chr4139 ------
NM_005135chr1523230 1366 2793 187 1684 --
NM_005153chr16------1640
NM_005156chr965395 4515 3632 3596 1672 513 --13738 24530 1617
NM_005160chr2276531 5443 4342 1722 1224 1045 870 --46133 5959 2193 1782 16048
NM_005167chr11142 ------
NM_005180chr1031244 1224 516 11508 --165
NM_005181chr83709 545 319 ------
NM_005188chr1196703 6239 6110 5430 3072 2385 1853 672 654 1856 22710 1093 18085
NM_005197chr1445653 4703 4094 2021 --15628 11055
NM_005201chr31114 ----2846 451
NM_005202chr132151 1924 1466 ------
NM_005204chr102631 177 --198 --
NM_005207chr2253719 2396 1089 1047 409 --13047 --
NM_005208chr171132 ------
NM_005214chr24999 733 80 71 ------
NM_005219chr511776 ------
NM_005233chr321909 290 ------
NM_005235chr286460 6127 6016 2132 1767 922 844 401 15723 36405 6300 4882 --
NM_005238chr111835 ------
NM_005245chr43537 177 154 --1204 --
NM_005254chr1511110 ------
NM_005256chr112833 120 ------
NM_005259chr221363 1064 --11257 --
NM_005296chrX158 --1432 --
NM_005324chr1751791 1319 668 525 115 1284 --1597
NM_005334chrX----11759 --
NM_005339chr433755 1015 371 14135 --14041
NM_005342chrX22004 601 --11787 11856
NM_005359chr1855226 4792 2606 1172 468 --16135 --
NM_005370chr191898 --1217 --
NM_005376chr111104 ------
NM_005378chr21319 ------
NM_005384chr9----2101 42 --
NM_005387chr112646 43 --1217 --
NM_005388chr931287 1274 55 ------
NM_005402chr731846 1767 1616 --165 --
NM_005409chr411068 ------
NM_005410chr51160 ------
NM_005415chr21145 ------
NM_005418chr111606 ------
NM_005433chr1822018 1083 --12700 12186
NM_005440chr1732956 2808 414 1782 22403 2273 --
NM_005455chr1----2405 318 --
NM_005458chr921878 771 ------
NM_005460chr5----1517 --
NM_005461chr2011387 ------
NM_005465chr1130 ------
NM_005475chr1233291 3274 1112 --1662 --
NM_005494chr71155 --1608 --
NM_005499chr191450 ------
NM_005502chr952851 2785 612 541 435 ----13012
NM_005509chr541631 682 258 172 --1497 11557
NM_005522chr71488 ------
NM_005530chr1511103 --1276 1965
NM_005539chr1011084 ------
NM_005542chr721242 317 --1634 --
NM_005544chr23727 677 328 ------
NM_005546chr521694 555 --21951 356 --
NM_005563chr12843 229 --171 --
NM_005569chr2241599 1451 1427 131 ------
NM_005578chr333659 907 453 --23925 1403 23382 114
NM_005587chr151890 ------
NM_005595chr11937 ------
NM_005596chr945069 4844 4456 570 --11985 --
NM_005598chr11193 --11268 --
NM_005600chr11226 ------
NM_005605chr81280 ------
NM_005610chr12852 295 ----1133
NM_005614chr711047 ------
NM_005625chr82410 286 ------
NM_005629chrX----11367 --
NM_005637chr181551 --22053 1369 --
NM_005655chr82904 466 ------
NM_005657chr15135 ------
NM_005662chr81373 ------
NM_005664chr152376 242 --152 --
NM_005665chr143232 2998 1852 207 --34871 4739 3870 13152
NM_005668chr533970 1084 1059 ----11216
NM_005688chr311240 --145 1452
NM_005711chr51696 ------
NM_005715chr662743 2156 1831 495 252 137 ------
NM_005721chr2----1712 --
NM_005725chr142346 1594 403 360 ------
NM_005731chr2--1410 ----
NM_005734chr112735 319 --1264 --
NM_005737chr212418 1822 ----
NM_005738chr711717 1757 --1110
NM_005746chr722617 241 12373 ----
NM_005748chr1253222 3121 2652 826 221 --2737 731 --
NM_005749chr171594 ------
NM_005759chr284777 4054 3352 3084 1873 1780 961 192 ----14709
NM_005776chr141692 ------
NM_005778chr3----1376 --
NM_005779chr533192 3133 2771 --121 --
NM_005780chr132907 812 --1995 --
NM_005786chr181350 --11012 --
NM_005789chr1732039 1987 760 ------
NM_005792chr162484 408 ------
NM_005795chr262316 2058 1975 1081 509 110 --12579 --
NM_005802chr92842 705 ------
NM_005808chr333068 2630 844 --1668 --
NM_005822chr621863 1797 ------
NM_005833chr91168 ------
NM_005840chrX95765 5653 3020 2666 2244 1580 1383 740 244 --15443 15352
NM_005843chr231505 1221 470 --21688 1553 --
NM_005857chr111095 --1143 --
NM_005859chr511135 1380 --21159 957
NM_005868chr722412 1890 ------
NM_005870chr1311214 --21413 152 186
NM_005871chr101117 --1170 --
NM_005877chr2232338 985 492 --21779 33 1360
NM_005884chr19----1654 --
NM_005898chr1122019 1025 ------
NM_005900chr4----1896 11222
NM_005901chr18118713 7730 7721 7654 6188 5784 5469 5252 1311 643 54 17233 15380 --
NM_005903chr564422 3900 3342 3233 733 646 --1716 12048
NM_005906chr611496 --21482 499 --
NM_005909chr532749 136 126 ------
NM_005910chr1763963 3697 3370 2628 1175 962 --23356 2856 --
NM_005924chr72456 303 ------
NM_005927chr521055 195 ------
NM_005933chr1163033 2358 2310 888 582 360 ------
NM_005940chr222686 672 ----1755
NM_005941chr864162 3107 1152 878 774 645 14207 42879 1602 1403 237 --
NM_005955chr185008 4548 4229 1767 1638 1330 273 68 --1552 --
NM_005962chr1021810 315 1483 12167 --
NM_005962chr1021810 315 1483 12167 --
NM_005964chr172993 386 --1516 --
NM_005966chr232157 769 249 ------
NM_005986chr1332070 1934 1842 --1827 --
NM_006007chr964406 4322 3729 1598 1454 83 13303 34388 3175 1439 --
NM_006011chr1524016 1021 --22769 479 --
NM_006016chr621772 98 22100 1425 31875 634 431 --
NM_006036chr221015 498 22367 661 --12576
NM_006037chr234471 4445 3927 --14400 --
NM_006038chr2022019 833 --1614 --
NM_006039chr171726 ----11077
NM_006040chr161416 --11388 1328
NM_006047chr2052823 1412 1277 727 666 ------
NM_006064chrX1164 ----1149
NM_006070chr3140 ------
NM_006076chr723137 610 --11123 --
NM_006080chr762461 2025 731 361 328 320 --1314 --
NM_006085chr12176 165 ------
NM_006095chr454160 3751 3252 2963 1324 23596 2985 54446 3169 3085 1650 894 1309
NM_006106chr111569 11141 1306 22435 246
NM_006107chr17----1497 --
NM_006135chr11207 1373 ----
NM_006139chr262115 2015 2001 701 615 224 --12769 12780
NM_006141chr1642548 2120 1105 91 ------
NM_006153chr33548 519 44 ------
NM_006154chr1541961 513 408 36 ------
NM_006158chr851832 1587 1559 606 161 --11394 --
NM_006186chr221141 328 --1184 --
NM_006187chr1283176 2287 1302 792 690 614 578 482 ------
NM_006195chr91259 ------
NM_006197chr81133 ----11947
NM_006203chr545315 3695 188 98 ------
NM_006206chr431997 614 548 ------
NM_006211chr8185 ------
NM_006237chr1321963 1452 ------
NM_006241chr331904 928 782 11609 22386 919 --
NM_006246chr141293 --1441 --
NM_006247chr191458 1496 ----
NM_006252chr197117 7105 7047 6085 2824 2258 2112 1763 762 --1137 --
NM_006256chr11339 --12278 22176 417
NM_006258chr1031607 641 424 ------
NM_006265chr811523 11443 11340 --
NM_006267chr21690 162 ----
NM_006282chr2034487 637 171 --14576 --
NM_006283chr844832 4775 883 724 24237 1324 11762 --
NM_006298chr652797 2180 667 604 278 ----23030 1120
NM_006306chrX95207 5004 4960 4790 4490 2185 1745 884 693 11070 --11819
NM_006309chr31156 ----1109
NM_006310chr17----11297 --
NM_006313chr1241734 685 434 351 ------
NM_006321chr342215 1873 1554 60 1283 ----
NM_006322chr131390 ----1912
NM_006325chr12----1304 --
NM_006352chr111904 ------
NM_006357chr21164 --1370 --
NM_006359chrX21665 1634 --21556 117 12379
NM_006362chr11174 ------
NM_006364chr1411129 ------
NM_006366chr621242 129 ------
NM_006371chr374901 4617 2036 1584 1573 407 150 ------
NM_006372chr6----1438 --
NM_006377chr92964 288 11202 21256 971 --
NM_006379chr722239 192 --11955 --
NM_006380chr1753995 1680 1158 1026 930 14232 13137 --
NM_006391chr111311 ------
NM_006393chr1054148 1352 1294 775 266 24570 94 21495 734 --
NM_006403chr621828 1809 ----11565
NM_006416chr61612 --1624 --
NM_006420chr2043402 2320 1046 287 --2276 53 --
NM_006429chr21123 ------
NM_006451chr5----1791 --
NM_006464chr284649 4186 4110 4077 2998 1577 1487 1125 --11771 --
NM_006466chr202955 130 ------
NM_006467chr542183 1897 916 218 --21706 1487 --
NM_006476chr113748 502 76 ------
NM_006478chr22----1185 --
NM_006482chr1233578 2835 2494 12566 ----
NM_006489chr1411297 22025 782 1271 --
NM_006494chr192631 203 ------
NM_006520chrX11689 21550 30 11072 --
NM_006534chr201621 --33431 585 147 --
NM_006544chr14115810 5508 4631 4237 4192 4082 2234 1717 1616 1387 601 11179 31635 1051 379 --
NM_006546chr1746133 5857 4553 1485 --34428 2434 2376 --
NM_006557chr921555 1480 --11441 --
NM_006561chr10106026 5627 4515 2461 2128 1811 1485 1243 562 125 23988 1933 1995 --
NM_006572chr1733437 3381 870 --11004 --
NM_006575chr1431130 436 302 --11156 --
NM_006577chr23902 298 244 ------
NM_006595chr1151981 1735 1275 551 86 --21675 1369 --
NM_006599chr1687762 7586 6120 5025 3089 2368 2221 1882 --27991 1999 1345
NM_006603chrX135 --11269 --
NM_006609chr222527 336 ------
NM_006612chr172477 450 ------
NM_006614chr333054 2240 1021 --13011 --
NM_006618chr121375 221 --1120 --
NM_006625chr111050 --1847 1403
NM_006625chr111050 --1847 1403
NM_006625chr111050 --1847 1403
NM_006626chr932076 1838 1018 ------
NM_006628chr1534087 918 95 14405 44292 715 613 139 --
NM_006629chr1831871 996 415 ------
NM_006636chr22750 734 1231 1343 --
NM_006644chr132592 49 --1687 --
NM_006646chr1342942 1929 1054 755 ------
NM_006650chr531366 1353 827 --13805 --
NM_006654chr1234409 4323 4309 --44637 3207 1770 666 1828
NM_006658chr73815 146 97 1744 ----
NM_006667chrX21117 114 ------
NM_006681chr4137 ------
NM_006682chr722765 1995 --22001 874 --
NM_006691chr111973 --1146 11151
NM_006699chr112409 --1721 --
NM_006713chr5195 ------
NM_006714chr6----1281 --
NM_006718chr63289 272 244 1941 ----
NM_006721chr101667 --196 --
NM_006722chr322197 1973 --12371 --
NM_006726chr4----1139 --
NM_006729chrX85249 5198 4842 4144 2227 1966 788 511 --15577 --
NM_006734chr611543 ----1120
NM_006735chr72367 332 ------
NM_006746chrX41445 1314 1300 1001 11123 --1531
NM_006750chr1687088 6270 5076 4885 2425 1640 959 832 --36101 5975 919 --
NM_006751chr2----189 --
NM_006754chr71340 --1930 --
NM_006756chr811025 ------
NM_006763chr132047 104 45 --11667 --
NM_006766chr822721 1899 --32207 1925 401 --
NM_006775chr642762 2699 1178 620 12049 12225 --
NM_006777chrX52878 2579 2427 2009 635 --11907 --
NM_006788chr1821657 1557 11329 12162 --
NM_006802chr13448 431 100 ------
NM_006805chr541340 1308 1180 239 ------
NM_006806chr21127 ------
NM_006808chr9123 ------
NM_006814chr2042041 1993 692 327 12683 1540 --
NM_006815chr12------172
NM_006820chr123950 3283 ----1472
NM_006823chr81235 ----1195
NM_006824chr12194 87 ------
NM_006827chr1453307 3298 3285 2311 2193 --2846 605 --
NM_006838chr122322 241 ------
NM_006846chr51110 ------
NM_006852chr17----3895 781 518 --
NM_006854chr711834 --11307 11292
NM_006856chr1251116 1016 1005 714 65 ------
NM_006870chr204625 567 113 55 ------
NM_006873chr243262 929 661 350 --1616 --
NM_006874chr41452 ------
NM_006877chr6------1350
NM_006884chr311650 --1458 --
NM_006885chr1654174 3589 2976 2930 438 11219 12630 --
NM_006888chr1443386 2880 2666 433 ------
NM_006892chr2011170 --11211 --
NM_006892chr2011170 --11211 --
NM_006894chr1----162 --
NM_006898chr21732 ------
NM_006912chr142464 2242 2134 824 1259 ----
NM_006915chrX52318 2272 704 630 214 --1930 --
NM_006918chr1165599 5482 5295 1953 1395 1087 --34345 3712 1442 --
NM_006922chr242355 860 421 355 21975 1771 11946 --
NM_006924chr1721603 198 14175 2895 503 --
NM_006939chr142742 21 --11045 --
NM_006940chr1251827 1541 1513 1354 642 ----11769
NM_006948chr2152108 815 795 575 525 ------
NM_006951chr10----1282 --
NM_006981chr931913 787 303 12544 --11820
NM_006997chr10----1185 --
NM_007005chr921266 56 1181 21118 162 11443
NM_007006chr1622298 1216 --13554 11059
NM_007007chr1254776 4534 4024 1565 1191 1283 11797 --
NM_007008chr23627 211 178 ------
NM_007011chr1556380 2688 1498 869 181 --25979 384 --
NM_007017chr51828 ------
NM_007030chr544030 3711 333 252 ------
NM_007038chr2155992 4124 3860 2265 494 15131 25439 2010 --
NM_007039chr1422278 1468 ------
NM_007042chr321856 547 ----1535
NM_007043chr1222123 713 21739 1588 1260 --
NM_007050chr2057257 5579 2924 1196 183 --26749 2873 --
NM_007067chr1731366 1347 1241 --170 --
NM_007073chr634012 3723 3224 --44239 4154 3110 1042 --
NM_007084chr13----1523 --
NM_007096chr9170 ------
NM_007106chr132908 142 ------
NM_007111chr132691 118 --1257 --
NM_007114chr322744 2564 1515 --12583
NM_007124chr611690 --1647 21845 1490
NM_007125chrY21309 376 ------
NM_007146chr171491 ------
NM_007159chr351510 1436 520 491 136 ------
NM_007166chr1121062 215 --11435 --
NM_007174chr1222035 494 ------
NM_007175chr813456 --12687 1308
NM_007187chr131262 ------
NM_007192chr143996 432 136 --1110 --
NM_007195chr1853087 1449 848 576 220 --12284 --
NM_007197chr121666 ------
NM_007207chr12851 296 --1183 --
NM_007212chr141567 1393 595 140 --11991 --
NM_007217chr31140 ----1267
NM_007246chr4------1949
NM_007249chr1368283 6420 6032 3667 3585 611 13080 37355 604 273 --
NM_007269chr1173 1496 1165 --
NM_007276chr72922 791 1313 ----
NM_007283chr333010 2316 776 ------
NM_007287chr321087 545 --1946 --
NM_007288chr321087 545 --1946 --
NM_007289chr321087 545 --1946 --
NM_007347chr1521176 714 --13192 --
NM_007358chr131313 759 176 11665 ----
NM_007373chr1031423 1275 151 ----147
NM_007375chr11606 --12281 --
NM_012069chrX22452 1009 ------
NM_012081chr543546 2350 1069 992 11108 ----
NM_012082chr81270 --1184 --
NM_012089chr131482 1100 323 ------
NM_012090chr11387 --1836 --
NM_012092chr21493 ----11590
NM_012093chr131247 1075 1010 --1821 --
NM_012096chr333019 1009 824 12615 ----
NM_012104chr1143159 3058 2993 862 --1474 --
NM_012104chr1143159 3058 2993 862 --1474 --
NM_012117chr12----123 --
NM_012120chr632706 1935 1151 ------
NM_012137chr132571 2228 1022 --1578 --
NM_012141chr1352629 1134 966 804 107 --24114 265 --
NM_012154chr84568 335 210 115 --1681 --
NM_012156chr2013125 --1703 --
NM_012161chr441159 1061 1007 286 --1292 --
NM_012164chr966700 2770 2355 1110 667 424 --25838 5777 11375
NM_012183chr1----1530 --
NM_012188chr51869 ------
NM_012193chr1144833 4556 3873 604 --25425 4294 --
NM_012199chr133349 1468 913 ------
NM_012207chr101896 --11126 --
NM_012214chr266313 5932 5747 5088 2057 1163 15022 51000 697 610 591 130 --
NM_012215chr1021873 369 --11879 --
NM_012223chr221241 903 --11203 --
NM_012238chr1021563 1468 --11776 --
NM_012243chr1------1830
NM_012244chr1411215 ------
NM_012249chr243566 1404 1274 802 ------
NM_012250chr112859 169 ------
NM_012252chr765089 4554 3843 2092 451 53 22107 2057 15246 --
NM_012255chr20----153 --
NM_012257chr71802 ----1722
NM_012259chr621159 125 ------
NM_012262chr154595 3621 3384 3256 1741 14775 25262 5232 --
NM_012281chr732347 1793 895 ------
NM_012287chr332897 888 230 --14462 --
NM_012288chr675593 5203 4717 4010 1895 899 884 --35080 2275 1724 --
NM_012290chr211512 21108 661 2577 165 --
NM_012297chr422240 2163 --11759 --
NM_012300chr532357 2258 1584 1499 1961 --
NM_012301chr72759 344 --1662 11804
NM_012316chr164007 2082 2032 1629 1533 1045 --33429 1937 1230 --
NM_012319chr182953 39 ------
NM_012322chr7----1327 1305
NM_012325chr2011517 --21540 620 --
NM_012328chr71462 1127 11198 --
NM_012330chr1041266 1243 624 523 ------
NM_012333chr13371 331 90 ------
NM_012334chr564462 3438 1775 948 837 75 ------
NM_012338chr73225 170 106 ------
NM_012347chr632430 2393 667 --1922 --
NM_012381chr6--1255 ----
NM_012382chr594554 3635 3475 3197 2899 1827 1808 804 740 --21167 501 --
NM_012383chr91426 --148 --
NM_012405chr143696 3641 2398 1232 --1996 1110
NM_012412chr72706 37 ------
NM_012416chr931179 1000 336 --2813 281 --
NM_012419chr61569 ------
NM_012431chr723330 3257 --1563 --
NM_012434chr631651 675 453 ------
NM_012454chr61499 ------
NM_012460chr141119 ------
NM_012464chr432702 2173 948 12075 21102 892 --
NM_012471chrX31862 698 621 --2475 391 --
NM_012479chr762601 2526 2435 1866 959 882 12737 ----
NM_012482chr12563 529 --168 --
NM_013227chr151101 ------
NM_013230chrY1555 ------
NM_013231chr1444036 3412 1637 176 --11033 12823
NM_013233chr251370 1344 908 280 33 --1924 --
NM_013254chr121652 ----1636
NM_013257chr81398 1243 1286 --
NM_013262chr61108 --1501 --
NM_013269chr1234212 1583 1324 --24391 3201 --
NM_013272chr15146 ------
NM_013281chr2031252 405 132 ------
NM_013293chr7----1202 --
NM_013316chr71783 1168 ----
NM_013322chr741645 1536 1274 101 ------
NM_013323chr1731182 360 285 1152 11001 --
NM_013351chr171679 ------
NM_013352chr6128 ----1367
NM_013354chr82896 402 ------
NM_013357chr83809 648 575 ------
NM_013374chr321005 877 --2490 425 11124
NM_013381chr1222015 1642 ------
NM_013396chr2131538 352 89 ----11337
NM_013411chr131955 1767 761 ------
NM_013437chr8----31311 1278 315 --
NM_013438chr921764 1249 ----11549
NM_013449chr1232957 2614 2244 12837 165 --
NM_013943chr143299 2450 591 285 --2871 803 --
NM_013995chrX----12375 --
NM_014007chr92435 397 ----193
NM_014016chr321729 219 11413 1401 --
NM_014021chr121369 73 --11082 13076
NM_014034chr6--136 ----
NM_014035chr511427 ------
NM_014043chr331575 528 149 --1498 1347
NM_014048chr1675159 3756 1925 1831 1324 1269 1035 ------
NM_014056chr352357 2255 2116 675 205 ------
NM_014106chr1571098 1040 950 879 718 345 219 --32636 2516 2298 --
NM_014109chr84426 174 59 51 ------
NM_014110chr121133 440 --11084 --
NM_014112chr845004 3969 1747 398 13842 12189 --
NM_014117chr1631687 585 137 --22077 1733 --
NM_014141chr754952 4843 3371 1856 1115 --34802 4315 1581 --
NM_014142chr10123 ----197
NM_014154chr3----1319 1182
NM_014155chr1156532 6230 5651 1349 1119 17104 47185 1055 817 101 11865
NM_014160chr32986 562 11350 1215 --
NM_014181chr222720 2595 1180 ----
NM_014183chr20----127 --
NM_014223chr12257 47 ------
NM_014231chr1252190 2087 2052 1943 35 21400 206 ----
NM_014253chrX51693 1617 667 577 388 ------
NM_014267chr113572 311 149 --1890 --
NM_014268chr181558 --21169 916 1114
NM_014278chr4----1112 --
NM_014280chr13856 697 39 ------
NM_014283chr111389 ----11529
NM_014294chr821314 171 --21265 118 11424
NM_014299chr1912203 ------
NM_014309chr2254993 4608 3788 2019 47 1984 11450 --
NM_014313chr121135 320 --186 --
NM_014317chr10--1294 1209 --
NM_014331chr467617 7591 6440 1513 1002 295 --47705 2521 2510 726 --
NM_014345chr61849 --1355 1287
NM_014372chr141863 1569 1525 617 ------
NM_014376chr542493 711 513 74 ------
NM_014382chr361588 1472 1238 1202 525 465 --11441 --
NM_014395chr41191 ----21975 396
NM_014411chr721798 1779 --11943 --
NM_014415chr311683 ----1684
NM_014421chr432083 1866 1451 ----1257
NM_014423chr554734 4680 1590 1088 70 --34563 4093 1910 15588
NM_014445chr352165 1781 904 677 163 --1140 --
NM_014447chr421335 262 --1631 --
NM_014454chr61118 --3411 221 140 --
NM_014455chr11314 ------
NM_014456chr1021342 266 --11671 11749
NM_014488chr111645 ------
NM_014494chr1631721 1486 105 ------
NM_014547chr151287 ------
NM_014547chr151287 ------
NM_014548chr1531061 573 43 ------
NM_014572chr1321693 1678 --1699 --
NM_014573chr1741767 1537 1168 379 ------
NM_014575chr32382 107 ----1508
NM_014584chr1421426 1180 --1657 --
NM_014585chr221235 1163 ------
NM_014586chr2174420 4295 4207 3945 1741 1320 426 ------
NM_014592chr52683 499 --1593 --
NM_014600chr221536 1020 ----11654
NM_014602chr3--1327 1363 1352
NM_014607chr211761 ------
NM_014608chr151432 ------
NM_014612chr931523 1036 949 --1590 1400
NM_014613chr521235 727 --22299 698 --
NM_014614chr211293 --31078 374 174 --
NM_014615chr1652762 1197 1106 385 117 --2861 199 --
NM_014616chr332896 2328 1127 1305 11357 --
NM_014621chr2--1269 ----
NM_014630chr1522977 2967 --22837 809 --
NM_014636chr9----33050 2758 735 --
NM_014647chr1652000 771 376 112 92 ------
NM_014659chr1531146 326 183 1346 --1388
NM_014661chr1083778 3543 3512 3378 3344 2997 2944 414 --12986 --
NM_014666chr51402 ------
NM_014670chr241247 1146 1012 54 11114 31411 1387 1133 --
NM_014671chr741548 1230 573 232 --21364 130 --
NM_014673chr8----189 --
NM_014682chr872038 1888 1675 1520 902 366 98 --1425 --
NM_014690chr721983 584 --12083 --
NM_014701chr1523126 2156 152 ----
NM_014702chr642487 977 200 21 13031 ----
NM_014705chr721991 1614 --1798 --
NM_014707chr7----12032 --
NM_014715chr112923 284 --1200 --
NM_014717chr191809 ------
NM_014721chr677381 5577 5409 5157 4925 4890 2746 12978 64969 1801 1618 1559 1341 1088 27427 6350
NM_014733chr531983 1819 1620 1882 ----
NM_014735chrX31596 1339 226 --11887 --
NM_014739chr634185 2974 769 1606 13393 --
NM_014743chr422525 216 ------
NM_014749chr14151 1190 ----
NM_014751chr811558 ------
NM_014752chr1121623 781 11968 1654 --
NM_014754chr82901 289 1134 ----
NM_014755chr222673 628 --13950 --
NM_014757chr552276 1925 1615 1587 344 ------
NM_014758chr113624 488 312 --12426 --
NM_014774chr153263 3163 2816 2729 2264 1961 ----
NM_014776chr1242403 1266 654 410 ------
NM_014779chr33754 202 171 --1458 --
NM_014781chr81826 --11094 --
NM_014783chr1511422 --21236 335 125
NM_014786chr1111207 ------
NM_014790chr52495 362 1127 ----
NM_014795chr21491 ------
NM_014800chr72857 429 ------
NM_014802chr1221096 456 ----163
NM_014810chr133536 2767 1169 --13360 --
NM_014812chr111404 ------
NM_014819chr542515 466 119 103 11839 ----
NM_014820chr321628 75 --21975 1962 --
NM_014824chr11----3650 207 195 --
NM_014827chr121253 244 --1211 --
NM_014828chr1432483 1564 318 ------
NM_014836chr1051645 1381 1300 662 626 ------
NM_014839chr142518 2484 2021 144 ------
NM_014840chr1252613 1303 1285 626 615 12578 ----
NM_014841chr621088 332 ----1274
NM_014869chr321230 580 ------
NM_014870chr164410 3957 3805 1341 792 450 --34151 1623 1143 --
NM_014871chr12------1143
NM_014892chr6143 ------
NM_014897chr1743020 2931 748 192 ------
NM_014901chr551797 1788 1694 1447 466 --11833 --
NM_014903chr1231870 1711 1670 --22119 1946 12471
NM_014904chr1042938 719 648 287 --12966 12751
NM_014905chr211297 --2815 110 12022
NM_014906chr1723083 575 23006 2866 11245 --
NM_014912chr1013306 --1307 1699
NM_014913chr1821386 245 ------
NM_014918chr1521504 441 --21489 1188 11405
NM_014920chr643255 3116 2652 559 13497 13268 1745
NM_014923chr133460 416 45 --31942 1923 132 --
NM_014924chr1442011 905 835 769 --1478 --
NM_014939chr18--1384 31061 966 135 --
NM_014944chr141308 1094 92 50 ------
NM_014946chr21729 --11209 --
NM_014947chr132607 1267 456 --23008 822 13096
NM_014948chr2012064 --1619 --
NM_014964chr1722319 1486 --21964 758 --
NM_014969chr131062 870 216 ----11187
NM_014974chr1061762 1283 1236 474 433 105 ------
NM_014978chr101741 --21267 261 --
NM_014982chr1463892 3665 2174 1813 390 380 23958 1971 14639 12016
NM_014988chr411983 1786 --1660
NM_014990chr142391 257 --1886 --
NM_014991chr432712 1198 1140 --1634 22894 2061
NM_014996chr31354 ------
NM_015000chr121965 ----11068
NM_015002chr1231681 512 39 ------
NM_015004chr31124 ------
NM_015005chr1441750 464 406 116 --1355 --
NM_015009chr31152 ------
NM_015015chr19----11799 --
NM_015020chr1663746 3712 3451 3196 3080 207 --12378 33210 597 256
NM_015024chr811229 ------
NM_015025chr252684 2614 2076 1683 234 --12061 --
NM_015026chr1244802 4158 3160 1870 23469 1555 24749 3893 --
NM_015027chr1631629 1615 626 ------
NM_015032chr1322862 1880 --32900 2037 473 1588
NM_015035chr2056374 6046 5992 4298 1761 --26587 93 25101 373
NM_015039chr143509 2753 1118 466 --14228 --
NM_015040chr243341 3022 2642 572 ------
NM_015045chr102703 380 ------
NM_015057chr132260 171 1252 ----
NM_015064chr124528 293 119 26 --13009 --
NM_015068chr753621 3218 2573 2564 811 --21581 1555 --
NM_015069chr162476 64 --193 1144
NM_015071chr5146384 5004 4651 4463 4069 2424 2381 1304 1055 694 596 586 262 74 --35982 5240 1492 --
NM_015074chr174422 4345 3498 1311 1044 979 579 ------
NM_015076chr624301 4012 --199 --
NM_015082chr542614 2592 1711 353 12549 ----
NM_015091chr142530 120 ------
NM_015092chr1664191 3410 3065 1883 979 852 --24341 1336 --
NM_015093chr62178 61 --1468 --
NM_015097chr321464 664 --12301 1548
NM_015100chr12442 227 --11741 --
NM_015101chr132564 671 62 --12853 --
NM_015110chr93579 490 245 --12465 --
NM_015115chr412618 11178 21264 140 --
NM_015116chr1331648 573 101 ------
NM_015130chr421301 370 ------
NM_015137chr822256 204 1853 21813 520 --
NM_015138chr1522198 668 --12864 --
NM_015143chr421188 44 1964 --11195
NM_015144chr1653802 2977 2753 2560 300 --33405 3239 1049 --
NM_015150chr3----1775 1207
NM_015153chr64673 566 119 93 1602 ----
NM_015155chr1053023 2972 2601 2263 540 1691 13317 --
NM_015156chr1454043 3932 2593 1397 413 1113 23225 2660 --
NM_015163chr1431749 1480 191 --21991 1327 11391
NM_015172chr1----31393 1372 533 --
NM_015176chr111383 ------
NM_015184chr31226 ------
NM_015185chrX11965 ----1408
NM_015192chr2042759 2286 2260 183 --1902 12734
NM_015200chr42965 598 --1987 --
NM_015208chr1813734 --1147 --
NM_015213chr112701 581 ------
NM_015215chr12327 192 --12870 --
NM_015225chr912685 --22428 117 --
NM_015233chr133868 718 616 1861 ----
NM_015245chr611899 ------
NM_015251chr1622154 303 ------
NM_015252chr2----1902 --
NM_015256chr51550 ------
NM_015263chr151233 ----1967
NM_015265chr212434 21664 289 --1863
NM_015271chr474118 3903 3610 3480 2813 1738 1601 13774 33026 1528 1328 --
NM_015272chr1622145 1622 ----11835
NM_015277chr1821882 1413 --21699 255 --
NM_015278chr633445 3090 387 --12255 --
NM_015282chr23955 861 585 ----11905
NM_015285chr1852304 2233 413 179 114 ------
NM_015288chr523848 1128 --43509 1425 721 72 --
NM_015291chr193093 2971 2629 2235 943 896 789 439 399 ------
NM_015296chr13----1163 --
NM_015310chr897990 7827 5921 2553 2520 2442 2285 2074 699 ------
NM_015317chr212315 --22580 1878 --
NM_015323chr6123 ------
NM_015328chr773010 2834 1144 1034 434 310 112 12280 2882 785 --
NM_015335chr122844 623 --22616 1697 --
NM_015336chr1221849 106 --32134 1842 190 --
NM_015338chr2041293 703 536 409 ------
NM_015347chr1242555 2100 1109 982 12866 ----
NM_015349chr61376 --12387 --
NM_015355chr1761813 1454 1431 1402 672 273 --11693 1207
NM_015358chr212941 392 --11085 --
NM_015365chrX63390 1351 1206 1185 567 122 --13757 --
NM_015393chr453751 3488 2349 1334 912 --23795 2451 --
NM_015397chr921711 1678 ------
NM_015423chr113701 671 306 --11278 21756 617
NM_015429chr331043 186 82 ------
NM_015436chr443016 1241 798 758 ------
NM_015439chr6----1488 --
NM_015443chr1721110 522 --11218 --
NM_015446chr11530 --21379 523 --
NM_015455chr532675 1397 243 12833 32684 1457 1175 --
NM_015458chr864580 3662 1785 516 239 52 --33445 294 278 --
NM_015460chr372143 1951 1566 1498 1457 675 618 ------
NM_015464chr71409 ------
NM_015483chr7--1839 146 --
NM_015497chr151361 --1715 --
NM_015509chr12----21169 1040 11026
NM_015520chr342564 1132 1114 34 --12802 --
NM_015527chr161293 ------
NM_015541chr331218 261 26 --21117 998 --
NM_015542chr1011117 ------
NM_015554chr15--11112 12663 --
NM_015559chr1821101 930 ------
NM_015564chr522496 347 --22249 810 --
NM_015570chr721852 1467 --1519 --
NM_015571chr632283 1910 800 --2886 21 --
NM_015576chr362936 2875 2370 2106 1030 485 21186 45 1228 1347
NM_015577chr52220 35 --2394 79 --
NM_015601chr104986 945 834 382 ----1901
NM_015602chr141796 1475 1378 1152 --11487 --
NM_015605chr102307 125 11109 --11588
NM_015609chr161990 1824 1000 75 35 27 ------
NM_015626chr172801 265 ------
NM_015630chr22359 45 ------
NM_015640chr143720 1946 1433 949 --1110 11199
NM_015646chr1211254 1496 ----
NM_015678chr1331654 1322 196 ------
NM_015691chrX32156 889 561 1102 22919 2529 11172
NM_015693chr4----1246 --
NM_015702chr2----1258 --
NM_015713chr833356 2886 2487 1848 22782 37 --
NM_015726chr11380 11453 11562 --
NM_015840chr1135 ------
NM_015841chr1135 ------
NM_015852chr733341 3179 1025 --13326 --
NM_015866chr111270 --11472 --
NM_015878chr852007 1895 1662 1359 135 ------
NM_015879chr18137392 7041 6911 6762 6554 5328 3214 3003 2850 1341 1276 880 725 --38237 6229 110 --
NM_015885chr111670 --1310 --
NM_015891chr641434 794 211 48 --11795 --
NM_015902chr8197 ------
NM_015905chr7------1572
NM_015906chr134124 3212 1909 --1319 1531
NM_015912chr832306 2024 884 --22114 237 --
NM_015920chr152523 221 ------
NM_015967chr12810 247 ------
NM_015980chr5----11519 --
NM_015981chr52965 109 --23133 1044 --
NM_015984chr11468 ------
NM_015994chr145655 556 498 488 84 ------
NM_015995chr1555228 4065 2077 1895 1764 --15100 --
NM_015999chr12678 669 ------
NM_016018chr832037 1826 109 ------
NM_016019chr71677 1900 ----
NM_016021chr622055 674 --22716 475 --
NM_016032chrX1880 ------
NM_016045chr201492 1728 ----
NM_016070chr17163 ------
NM_016071chr7190 ------
NM_016072chr124873 630 269 54 --22272 467 --
NM_016073chr15----2889 109 --
NM_016075chr1352637 2503 2212 436 227 12021 1622 --
NM_016076chr111039 22391 1265 13126 --
NM_016078chr172858 776 ------
NM_016081chr441690 1476 1409 246 ------
NM_016083chr633500 1130 312 33811 3314 874 13201 1471
NM_016090chr11136 ------
NM_016118chr74770 439 211 44 --11170 --
NM_016125chr17----140 --
NM_016131chr241743 1565 391 27 ------
NM_016132chr1563278 1371 685 254 209 62 --1526 11232
NM_016133chr22354 309 ------
NM_016141chr33580 550 314 --1223 --
NM_016162chr123909 893 120 ------
NM_016195chr103712 283 46 ------
NM_016203chr72930 797 ----1245
NM_016205chr421464 540 11104 ----
NM_016206chr378998 8263 7669 6739 5723 1530 441 17767 39006 6157 2968 16353
NM_016213chr15156 ------
NM_016217chr632990 2292 28 --1821 --
NM_016224chr641567 1560 787 600 --1502 --
NM_016227chr111389 ----11529
NM_016252chr24916 763 379 271 ------
NM_016258chr11284 ------
NM_016260chr287671 6902 3046 2980 1991 1619 1514 1239 --55647 4709 2204 1893 157 16207
NM_016261chr171786 ------
NM_016269chr421123 412 --21212 1139 --
NM_016271chr1832289 117 42 --11647 --
NM_016275chr332343 1884 670 --12368 --
NM_016277chr641486 1477 255 67 --11644 --
NM_016282chr921209 618 11710 1372 --
NM_016289chr222273 53 --1221 --
NM_016297chr243419 912 193 180 --13385 1103
NM_016300chr31188 ------
NM_016302chr31702 --2609 283 1247
NM_016303chrX------1107
NM_016308chr12242 58 --11934 11467
NM_016315chr211672 11800 2701 56 --
NM_016316chr23735 655 41 ------
NM_016322chr932445 2170 1261 ----12059
NM_016338chr5----21049 62 1457
NM_016351chr71404 --1177 --
NM_016377chr671721 1624 1531 634 497 444 324 --1342 --
NM_016396chr1543037 2430 1166 600 --12750 177
NM_016401chr11141 ------
NM_016422chr112849 629 --2128 29 --
NM_016423chr142410 390 ------
NM_016424chr172289 215 --42002 1348 754 330 --
NM_016436chr2042388 1678 200 161 22637 1897 ----
NM_016470chr201393 ------
NM_016485chr61384 --11428 --
NM_016488chr1231913 1697 464 --21291 1210 --
NM_016507chr1732931 1945 506 --12011 --
NM_016513chr643255 3116 2652 559 13497 13268 1745
NM_016516chr2----1184 --
NM_016530chr1594069 4015 3711 3598 3567 3068 1442 1289 560 1529 1739 11627
NM_016531chr473677 3197 2807 2682 2609 724 525 --21524 1153 --
NM_016542chrX31705 1276 358 21360 138 ----
NM_016544chr253928 2988 1542 1207 725 12705 1124 --
NM_016548chr9--1660 1638 --
NM_016578chr111537 ------
NM_016587chr72922 791 1313 ----
NM_016603chr532271 2086 805 ------
NM_016604chr521231 497 ------
NM_016605chr512161 --12272 --
NM_016607chrX21667 1134 --31681 304 247 --
NM_016628chr101657 ------
NM_016631chr213790 248 215 ------
NM_016652chr2031745 1682 300 ------
NM_016654chr1511110 ------
NM_016656chrX1164 ----1149
NM_016733chr2241599 1451 1427 131 ------
NM_016830chr123552 449 414 ------
NM_016834chr1763963 3697 3370 2628 1175 962 --23356 2856 --
NM_016835chr1763963 3697 3370 2628 1175 962 --23356 2856 --
NM_016841chr1763963 3697 3370 2628 1175 962 --23356 2856 --
NM_016929chr654161 3722 3452 679 152 --11359 --
NM_017415chr554363 4174 2830 764 749 --23784 3726 --
NM_017423chr421996 672 --1666 --
NM_017447chr2114199 1105 43469 449 432 276 --
NM_017488chr211395 ------
NM_017491chr4----2844 70 --
NM_017544chrX----1925 --
NM_017548chr341493 1374 285 64 ------
NM_017553chr151512 --21239 1190 --
NM_017563chr385932 4398 3893 1952 1688 1621 1466 521 --25642 378 --
NM_017569chr131240 ------
NM_017580chr1042155 1872 1479 882 ------
NM_017582chr131497 336 151 ------
NM_017596chr124684 4124 --12829 --
NM_017599chr12--1413 --1791
NM_017610chr1531969 1831 127 ------
NM_017612chr122547 27 ------
NM_017628chr414116 13970 24148 1069 --
NM_017629chr13737 384 182 ------
NM_017633chr632577 348 34 --23097 1386 1263
NM_017634chr811234 --1681 --
NM_017635chr1111063 ------
NM_017637chr9107799 7693 7089 6652 5725 3704 2283 886 549 62 16382 16983 --
NM_017643chr1742788 2683 2540 152 1533 1845 1386
NM_017645chr942792 2520 396 255 ------
NM_017650chr775259 4031 3999 1877 646 601 436 --34764 2055 2039 11751
NM_017651chr61416 ----11088
NM_017657chr21788 ------
NM_017658chr1473372 3172 3048 1664 1634 1524 728 --14574 --
NM_017661chr15157 1816 ----
NM_017666chrX21403 262 12039 ----
NM_017680chr9--1748 ----
NM_017691chr152396 296 ------
NM_017693chr1321540 45 ------
NM_017709chr143523 1041 940 276 --24337 576 --
NM_017719chr312120 ------
NM_017724chr31156 ----1109
NM_017730chr31232 ------
NM_017734chr11430 1153 ----
NM_017737chr12607 402 --11799 --
NM_017738chr94917 799 398 185 ------
NM_017739chr11561 ------
NM_017745chrX2655 60 --1478 --
NM_017746chr9------188
NM_017747chr51356 ------
NM_017754chr674372 4032 3828 3255 1134 708 314 14236 14211 --
NM_017769chr1432768 2354 974 22958 2859 22259 44 --
NM_017770chr622959 781 ----1153
NM_017779chr132777 720 599 ----21769 93
NM_017780chr81891 1174 ----
NM_017798chr204956 784 389 316 --2475 397 --
NM_017799chr1421298 1262 --1179 --
NM_017812chr71560 1209 ----
NM_017813chr895304 5194 5026 4958 4231 1046 715 434 238 --1724 23962 1317
NM_017831chr1834767 2951 242 ------
NM_017848chrX63927 3743 3049 2992 1763 1151 ------
NM_017849chr222075 2053 1255 12188 --
NM_017870chr111167 ------
NM_017902chr103287 125 39 --13518 --
NM_017910chr21344 1101 ----
NM_017913chr9162 --132 --
NM_017933chr231591 1083 351 ------
NM_017938chrX32159 311 22 --11721 --
NM_017946chr7----1426 --
NM_017954chr711625 ----1504
NM_017955chr1431212 1059 433 --21033 769 --
NM_018000chr21307 --1388 --
NM_018015chrX11015 ------
NM_018027chr1042991 2279 373 141 ------
NM_018028chr1911037 ------
NM_018030chr183384 289 204 ------
NM_018045chr131061 531 162 ------
NM_018046chr531839 1582 596 --1264 --
NM_018047chr51850 ----1198
NM_018070chr1------183
NM_018078chr41886 --1860 11017
NM_018079chr21506 ------
NM_018092chr16----21528 238 --
NM_018098chr331136 856 270 --2244 134 --
NM_018105chr811158 ------
NM_018120chr8----11356 --
NM_018121chr10----22250 164 13199
NM_018126chr411453 ------
NM_018133chr311839 1404 21489 439 --
NM_018142chr84195 176 93 73 ------
NM_018155chr321302 814 --31205 977 253 --
NM_018157chr1242595 2584 2138 896 ------
NM_018159chrX51235 690 584 547 441 --11087 11120
NM_018184chr321490 190 11879 ----
NM_018195chr1152130 1849 744 387 117 --1829 --
NM_018202chr1----1123 --
NM_018214chr611084 --1902 --
NM_018221chr22321 64 ------
NM_018227chr442908 2001 1183 781 --1243 --
NM_018241chr41711 --21001 399 1919
NM_018243chr433885 977 65 --23808 3581 --
NM_018245chr101166 ------
NM_018246chr832230 1966 533 --32809 1836 1788 --
NM_018247chr632498 2138 1260 --23142 94 --
NM_018254chr131567 855 723 12166 ----
NM_018257chr2011763 --1985 --
NM_018266chr331114 1067 776 ------
NM_018293chr342919 2203 555 444 --182 --
NM_018299chr842861 2735 2495 2162 --1399 --
NM_018302chr441696 729 244 37 22464 614 1210 21923 795
NM_018313chr362007 1750 300 164 134 58 11958 ----
NM_018315chr42473 323 11077 ----
NM_018318chr122753 258 ----1884
NM_018323chr421632 198 --21332 484 --
NM_018325chr921469 256 --1674 --
NM_018328chr21382 ------
NM_018330chr1011649 ------
NM_018339chr931720 1657 664 ------
NM_018340chr1654983 4699 3621 1086 671 --14905 --
NM_018342chr421232 519 ----11717
NM_018348chr16--11299 21263 291 --
NM_018351chr12104015 3523 1849 1835 1805 1796 1770 1442 1325 1274 --24400 3884 1841
NM_018361chr821233 783 --13969 --
NM_018362chr1133947 2957 266 11219 1129 --
NM_018364chr154061 3372 881 679 359 --11026 --
NM_018368chr61201 ------
NM_018371chr81541 ------
NM_018374chr7----15187 23898 1075
NM_018383chr2------11758
NM_018388chrX2986 980 --11138 --
NM_018400chr1134490 4164 470 13334 ----
NM_018401chr411525 ------
NM_018403chr341249 1114 898 704 --33292 1104 837 --
NM_018416chr121732 22366 2200 12614 --
NM_018424chr941897 1550 424 174 --11174 --
NM_018425chr1012425 11020 12233 --
NM_018429chr522331 1075 --22861 2244 --
NM_018439chr181373 12498 --12082
NM_018440chr8108340 6993 6630 6487 5934 5680 2686 2243 1463 1135 --35794 2426 374 35648 2003 1708
NM_018445chr151191 ------
NM_018452chr6_random33261 2631 781 23499 2741 1742 --
NM_018469chr17----1165 --
NM_018471chr21230 ------
NM_018482chr821890 1631 --22520 2406 1887
NM_018488chr171760 ------
NM_018489chr11335 --21949 1513 --
NM_018490chr1151846 1688 1312 537 156 1664 ----
NM_018557chr241679 1529 1384 403 ------
NM_018559chr13------1226
NM_018566chr154418 4344 3894 3618 1308 --25069 4660 15076
NM_018569chr421339 232 ----11395
NM_018584chr121220 303 ------
NM_018590chr1021703 1388 ------
NM_018602chr1521645 313 21196 1135 ----
NM_018638chr1285308 4005 3672 2051 1601 971 496 192 15053 25125 3595 14558
NM_018640chr1242586 2459 1931 440 --2722 244 --
NM_018652chr151418 1317 138 --
NM_018662chr154233 3602 3267 3124 435 --2360 256 --
NM_018684chrX160 --11400 --
NM_018685chr73817 41 21 --21091 182 --
NM_018695chr53730 723 484 ------
NM_018704chr132022 406 293 --11786 --
NM_018712chr112978 188 --11569 --
NM_018718chr731828 1676 76 ------
NM_018834chr51737 ------
NM_018898chr5--1668 12364 --
NM_018899chr5--1668 12364 --
NM_018900chr5--1668 12364 --
NM_018901chr5--1668 12364 --
NM_018902chr5--1668 12364 --
NM_018903chr5--1668 12364 --
NM_018904chr5--1668 12364 --
NM_018905chr5--1668 12364 --
NM_018906chr5--1668 12364 --
NM_018907chr5--1668 12364 --
NM_018908chr5--1668 12364 --
NM_018909chr5--1668 12364 --
NM_018910chr5--1668 12364 --
NM_018911chr5--1668 12364 --
NM_018945chr673683 3080 1347 578 376 305 182 12719 23593 621 --
NM_018953chr121842 ------
NM_018970chr712389 --22555 620 --
NM_018976chr1222122 738 --2549 313 --
NM_018977chrX1898 --1943 --
NM_018979chr1231700 1059 660 22534 564 --1933
NM_018983chr41112 ------
NM_018999chr1024315 1608 14798 23810 911 14687
NM_019000chr51661 ----11491
NM_019001chr331865 1321 1086 13903 34489 3655 1478 --
NM_019004chr732197 1767 752 ------
NM_019006chr152108 76 ------
NM_019044chr254086 3559 3411 3019 572 --128 --
NM_019060chr11301 ------
NM_019063chr242262 2118 2035 1895 --31466 1442 566 --
NM_019071chr71211 ----1635
NM_019072chr573705 3607 3555 3516 3416 1147 344 23808 2801 --1513
NM_019084chr1032592 1989 524 --22094 311 --
NM_019087chr531596 573 120 --11495 --
NM_019091chr22404 38 --11024 --
NM_019094chr1252733 637 513 333 109 --22538 561 13350
NM_019102chr7------1158
NM_019102chr7------1158
NM_019114chr91404 ------
NM_019556chrX21409 463 11318 ----
NM_019590chr101197 ------
NM_019593chr2053171 2356 2349 478 22 12608 42737 2074 561 162 --
NM_019594chr9----11548 --
NM_019600chr151565 ------
NM_019610chr121695 567 1409 1523 --
NM_019842chr61295 ------
NM_019859chr10163 --1201 --
NM_019860chr101111 --1249 --
NM_019891chr1----21177 944 --
NM_019895chr321021 201 --2814 31 --
NM_020119chr741415 1266 702 32 --21223 875 --
NM_020123chr1031370 1110 615 --21354 473 --
NM_020130chr81929 ------
NM_020135chr6----1302 --
NM_020141chr12310 139 --21753 784 --
NM_020147chr15131 --2844 73 --
NM_020148chr1812885 ------
NM_020154chr15------1253
NM_020159chr411069 11723 1502 --
NM_020177chr552823 2762 2382 1128 834 22059 689 12398 12086
NM_020180chr182938 504 --21210 492 --
NM_020198chr1711138 ------
NM_020199chr52368 76 1843 ----
NM_020205chr11684 --1479 --
NM_020210chr15----1986 --
NM_020225chr41312 ------
NM_020226chr41625 ------
NM_020245chr655106 4139 3564 824 167 --1344 --
NM_020336chr2062476 1542 1492 1078 587 508 ------
NM_020338chr1023319 2875 --1694 --
NM_020341chr2031429 500 491 1233 ----
NM_020342chr211611 12270 12598 --
NM_020346chr11----21709 1273 --
NM_020347chr3186 --11924 --
NM_020357chr31551 ------
NM_020362chr11311 ------
NM_020366chr14177 ------
NM_020382chr1211610 ------
NM_020403chr132421 285 1548 1400 --
NM_020425chr651659 1499 1364 570 244 21300 176 11250 --
NM_020429chr752926 2207 949 778 409 ------
NM_020431chr1432734 2418 1695 ------
NM_020432chr752109 1493 911 352 323 ------
NM_020443chr174742 2686 2525 2460 1170 1026 1003 --57005 6368 5098 2195 1867 --
NM_020455chr62324 40 --12821 1220
NM_020456chr1322356 2097 --22042 553 --
NM_020463chr221358 936 ------
NM_020465chr1641859 1755 1239 309 ------
NM_020473chrX--21600 608 21694 1675 --
NM_020474chr181376 21268 135 11560 --
NM_020532chr23627 211 178 ------
NM_020546chr522821 2189 --22672 617 --
NM_020640chr312091 ------
NM_020651chr221763 100 ------
NM_020654chr32660 121 --1515 --
NM_020655chr1611449 ------
NM_020673chr2097791 7672 7447 7272 2766 1227 908 644 536 15732 --11748
NM_020692chr142155 30 ------
NM_020699chr134399 3514 345 --13622 --
NM_020708chr2022109 462 ----12327
NM_020718chr1656053 4690 2503 2425 635 --65690 5137 4573 1991 653 197 16035
NM_020727chr2153891 3868 3793 1182 67 ----11507
NM_020734chr1243243 2926 2280 406 --1474 12687
NM_020739chr152961 921 21407 690 ----
NM_020742chrX32535 2186 2134 ------
NM_020747chr54855 342 117 25 --1706 --
NM_020748chr1732147 1376 325 ------
NM_020749chr821602 444 --11824 --
NM_020752chr102657 623 ----12396
NM_020755chr611440 1243 1145 --
NM_020762chr12--1698 1213 --
NM_020766chrX4882 865 609 444 24622 3945 34191 3562 582 --
NM_020768chr542358 1178 318 39 --11239 --
NM_020771chr631507 1131 326 --1421 --
NM_020772chr1788497 8479 7528 6243 5689 2503 1285 359 --48518 6037 3240 785 27219 7009
NM_020774chr1821872 1656 --45273 5208 5070 4643 12118
NM_020782chr1284645 4523 3686 3564 3558 1450 933 629 11634 24570 3039 --
NM_020783chr1831767 525 485 ------
NM_020791chr1731089 1073 176 ------
NM_020801chr5----21741 875 12201
NM_020805chr181679 --31598 1478 1373 --
NM_020809chr112527 245 --22310 2086 --
NM_020810chr1453275 1266 918 848 708 --13390 --
NM_020818chr14----1335 --
NM_020824chr102747 495 ------
NM_020839chr331465 1139 464 ------
NM_020841chr1283813 3709 3060 2875 2863 2531 1449 378 --12812 13408
NM_020844chr855639 2879 1742 1501 820 --15556 17051
NM_020854chr1831415 1402 384 1348 ----
NM_020856chr1911600 --11250 --
NM_020858chr1541594 1488 657 221 --1839 1355
NM_020860chr43410 251 132 ------
NM_020870chr421893 891 --11448 --
NM_020871chrX11920 12203 1827 --
NM_020872chr31596 --1369 --
NM_020922chrX31698 383 93 ------
NM_020924chr91369 --1435 --
NM_020925chr131429 249 134 ------
NM_020935chr244037 3070 1275 860 --34376 853 171 --
NM_020940chr1032454 2295 312 --22846 2735 --
NM_020948chr143575 3144 2357 1020 --33711 2731 1392 --
NM_020951chr1932073 1694 128 --22216 1986 --
NM_020959chr192246 45 ------
NM_020962chr1552158 1991 913 793 765 ------
NM_020964chr1843571 3472 3150 3042 --11914 --
NM_020967chr203493 351 119 ------
NM_020977chr411595 ------
NM_020981chr21128 --1236 --
NM_020987chr1031245 1029 338 --2945 313 --
NM_021007chr232113 665 384 --22263 872 --
NM_021025chr51532 ------
NM_021033chr1322964 2196 --13261 --
NM_021069chr452058 1948 792 533 89 --11913 --
NM_021072chr541049 982 773 746 ------
NM_021083chrX53524 3078 2823 1399 454 --13168 11216
NM_021090chr2244762 3125 3048 1712 13713 34695 4503 4381 --
NM_021097chr233056 861 89 --32557 1053 953 --
NM_021111chr921147 249 ----1479
NM_021116chr7128302 8279 7658 7643 7594 7373 6773 5679 3488 2881 2245 1606 --48759 7417 5498 875 --
NM_021120chrX63065 3050 2674 750 292 210 --12637 --
NM_021140chrX1392 --2725 40 --
NM_021141chr24705 218 83 36 ------
NM_021145chr74878 824 796 146 ------
NM_021153chr181709 --1174 --
NM_021155chr1972156 2145 1005 622 295 282 131 --12302 --
NM_021174chr82173 22 --1250 --
NM_021176chr2----21838 1581 --
NM_021183chrX1140 --22530 2139 --
NM_021190chr14859 225 197 47 --1331 --
NM_021192chr21441 ------
NM_021202chr2022301 122 --23069 537 --
NM_021205chr132888 713 28 ------
NM_021219chr21----1162 --
NM_021238chr121678 11820 1329 --
NM_021252chr10----2329 77 --
NM_021253chr621221 1129 --21279 1147 --
NM_021255chr1474091 3447 3094 2565 990 263 207 ------
NM_021614chr52210 39 ------
NM_021622chr102361 35 --21573 1557 --
NM_021627chr32943 392 ------
NM_021629chr364076 3483 900 578 373 317 --14181 12032
NM_021638chr484282 3898 3505 3057 1914 1422 307 270 13753 1651 23850 3629
NM_021643chr22747 678 1716 ----
NM_021644chr101896 --11126 --
NM_021648chr641865 734 568 455 --1180 --
NM_021722chr71363 --1136 --
NM_021723chr71404 --1177 --
NM_021785chrX1285 ------
NM_021803chr4159 ------
NM_021813chr645726 5234 3933 613 --44735 3572 1978 749 --
NM_021814chr611373 --11283 --
NM_021871chr4175 ------
NM_021911chr595163 5085 5039 4245 1006 706 491 432 340 12010 43898 2259 1743 1556 --
NM_021912chr1564060 3671 3285 1087 1066 799 13750 ----
NM_021914chr1451533 1501 950 570 230 1929 --1176
NM_021931chr20----11088 --
NM_021943chr62614 213 --1773 --
NM_021945chr633368 3226 248 1612 --1223
NM_021946chrX2585 205 --11361 --
NM_021947chr1741058 983 849 110 ------
NM_021951chr92838 302 ------
NM_021961chr1166160 5041 4971 1179 367 168 --27364 5271 --
NM_021964chr395806 5673 5167 4523 4425 1536 1001 535 389 --46191 5824 5635 249 24998 1962
NM_021988chr201202 ------
NM_021998chrX51279 451 432 370 28 ----1934
NM_022048chr1565309 5129 5062 1815 866 180 --62150 1990 952 322 298 68 22255 1270
NM_022049chr121472 201 --11800 1568
NM_022063chr1011651 ------
NM_022079chr104986 945 834 382 ----1901
NM_022087chr71446 ------
NM_022090chr52524 203 ------
NM_022130chr52241 215 --11019 --
NM_022138chr61141 --11547 --
NM_022143chr71259 --1388 --
NM_022144chrX----159 --
NM_022336chr212118 --42264 2148 2104 1942 --
NM_022337chr114669 560 530 238 ------
NM_022351chr822831 761 --22795 672 --
NM_022442chr201202 ------
NM_022451chr102845 326 --1183 --
NM_022457chr1183 ------
NM_022459chr1375949 5208 3852 987 884 209 102 25168 4285 15539 21538 363
NM_022465chr12----12593 --
NM_022469chr132498 1208 981 --23196 2967 1755
NM_022473chr1512829 23508 32 1267 --
NM_022474chr1452805 2481 2141 1751 1059 ------
NM_022475chr4------159
NM_022650chr51282 ------
NM_022658chr121929 --21272 90 --
NM_022726chr611740 --11303 --
NM_022728chr72631 30 ------
NM_022733chr121097 128 --2961 27 --
NM_022739chr171211 --1233 --
NM_022748chr742863 2464 402 58 --1832 --
NM_022753chr111787 --1955 12809
NM_022755chr942558 2534 2107 1041 ------
NM_022763chr373149 3110 2677 2618 2337 2178 765 ------
NM_022776chr331382 490 73 ------
NM_022780chr2----2361 245 --
NM_022782chr12----2140 125 --
NM_022787chr111050 --21881 917 --
NM_022822chr111149 ------
NM_022824chr521954 599 --31562 1422 170 --
NM_022826chr21414 --1749 --
NM_022831chr121811 1603 ------
NM_022841chr1532097 1817 652 ------
NM_022842chr353300 2923 2870 2641 1242 --22819 1060 --
NM_022843chr1321500 1190 --11453 --
NM_022845chr1621491 154 11666 21997 328 --
NM_022893chr232587 2543 388 13060 ----
NM_022894chr231527 236 87 ------
NM_022898chr1454673 3739 3395 1784 912 --34782 1583 922 --
NM_022901chr931931 659 70 --11824 --
NM_022910chr1641859 1755 1239 309 ------
NM_022912chr252620 2419 2179 1121 122 --12641 1339
NM_022918chr1131911 668 553 ------
NM_022977chrX1581 ------
NM_023000chr1441199 223 214 38 --1489 --
NM_023001chr1441199 223 214 38 --1489 --
NM_023010chrX1651 ------
NM_023037chr134977 944 64 47 --1805 --
NM_023039chr52361 339 ------
NM_023071chr122236 186 --1123 --
NM_023074chr1921112 54 --1890 1484
NM_023079chr1731752 1700 1412 ------
NM_023928chr1221045 860 ------
NM_023934chrX61987 1873 1451 1381 498 113 --11622 --
NM_024015chr1711060 ------
NM_024019chr41747 ------
NM_024052chr1742563 2121 1934 660 --11944 12924
NM_024087chrX2634 426 ------
NM_024090chr411326 1329 ----
NM_024091chr51202 ------
NM_024107chr172818 225 ------
NM_024117chr931364 988 189 11434 1574 --
NM_024122chrX----1253 --
NM_024295chr831953 1802 1610 11669 ----
NM_024306chr1631137 747 67 ------
NM_024429chr72930 797 ----1245
NM_024496chr141259 ------
NM_024501chr22721 270 ------
NM_024523chr71402 --194 1163
NM_024524chr343216 2199 1984 722 --11037 11081
NM_024539chrX31062 793 138 ------
NM_024545chr21236 --1557 --
NM_024548chr331439 1232 632 11303 ----
NM_024561chr1311405 ------
NM_024563chr521822 83 ------
NM_024567chr81743 ------
NM_024582chr41721 --1924 --
NM_024611chr1563767 3520 3489 2733 2558 1092 --21562 744 --
NM_024612chr173860 431 203 11154 1306 11163
NM_024613chr811475 11304 11225 --
NM_024617chr9----1816 --
NM_024618chr111376 ----1554
NM_024626chr121148 35 ------
NM_024631chr111243 --2635 567 --
NM_024646chr13981 902 878 ------
NM_024659chr21129 ------
NM_024665chr321558 79 --63514 3071 2871 1858 1794 1584 11183
NM_024670chr1021419 368 --1439 --
NM_024674chr152599 944 105 32 22 ------
NM_024692chr241486 1215 721 271 --11863 --
NM_024699chr81318 ------
NM_024705chr132281 191 ------
NM_024721chr832608 856 765 ------
NM_024740chr1133572 3421 867 --1730 --
NM_024744chr222581 752 ------
NM_024759chr81600 ------
NM_024769chr11164 --21110 859 --
NM_024770chr292654 1856 1517 1394 1252 1233 618 407 126 --2119 44 --
NM_024783chr111387 ------
NM_024812chr81376 12194 11380 1454
NM_024837chr151697 ----11876
NM_024887chr111486 --1552 --
NM_024893chr201933 --1944 --
NM_024915chr842824 2684 1077 992 ------
NM_024920chr431570 321 255 ----1593
NM_024930chr51886 --32681 551 448 1759
NM_024941chr531349 1239 404 ------
NM_024947chr367201 2553 2357 2067 1643 421 27725 6191 27915 6783 --
NM_024949chr443581 3124 1976 1321 14491 14633 13622
NM_024969chr2----1656 --
NM_024989chr276757 5855 5216 1784 1565 762 416 25323 2657 45251 5238 1446 665 --
NM_025054chr822664 390 185 12813 33815 3208 2942
NM_025073chr173201 1880 1402 1321 650 641 620 --44703 3571 1440 494 --
NM_025076chr21102 --1691 --
NM_025133chr211169 --131 --
NM_025134chr1642516 982 760 431 ------
NM_025138chr13----11457 1956
NM_025154chr7------11535
NM_025160chr144308 3735 1249 1164 --13929 --
NM_025164chr1132049 520 182 11435 ----
NM_025179chr143645 3025 1840 1004 13337 ----
NM_025181chr21187 ------
NM_025184chrX3878 208 148 ------
NM_025202chr221001 323 ------
NM_025208chr1132407 657 159 ------
NM_025221chr431394 1341 956 ------
NM_025222chr331024 777 21 --12492 --
NM_025230chr141515 ----21705 247
NM_025235chr1011728 --1223 1640
NM_025268chr14----1372 --
NM_030579chr1613039 --13524 --
NM_030621chr1473600 3059 3032 1408 1212 1182 829 11243 14145 --
NM_030625chr101326 --1460 --
NM_030627chr543971 3602 2677 211 --13476 --
NM_030634chr121657 144 ----1734
NM_030647chr755047 1758 972 390 22 24624 641 ----
NM_030648chr465578 1354 1206 553 418 340 --11573 --
NM_030650chr284247 3953 3557 3436 2902 1521 1086 137 ------
NM_030664chr1032270 1978 643 1162 12011 --
NM_030665chr1711414 ------
NM_030755chr14--12603 22657 2203 1123
NM_030758chr2211024 ------
NM_030762chr12----21926 1493 --
NM_030766chr122395 249 --1835 --
NM_030786chr11635 ------
NM_030791chr1451763 1207 694 482 192 ----1565
NM_030796chr732028 1740 543 ------
NM_030799chr522066 265 --1242 11648
NM_030806chr157202 3440 3403 1756 519 1563 22138 1695 --
NM_030809chr124921 895 441 314 ------
NM_030820chr621007 185 ------
NM_030821chr42768 758 ------
NM_030915chr211594 ------
NM_030916chr11311 ------
NM_030920chr131412 377 281 ------
NM_030922chr15----1791 --
NM_030939chr62448 378 ------
NM_030945chr532683 695 312 --22055 562 --
NM_030948chr6125 ------
NM_030958chr81149 ------
NM_030962chr1131520 563 148 ------
NM_030964chr511180 1918 13434 --
NM_030981chr1111147 ------
NM_031216chr18195 1830 1540 11441
NM_031243chr71175 1400 ----
NM_031262chr91456 ------
NM_031268chr1685103 4804 4383 3682 1959 1287 709 268 ------
NM_031271chr831488 1464 607 --1323 --
NM_031305chr42540 370 ------
NM_031369chr42307 221 1597 ----
NM_031370chr42307 221 1597 ----
NM_031372chr42660 190 31138 1118 1098 11473 --
NM_031411chr5--1668 12364 --
NM_031427chr14104963 3910 1763 1547 848 713 678 665 305 41 25188 3952 --12364
NM_031431chr1321428 565 --21307 491 --
NM_031435chr1213370 ------
NM_031442chrX----23020 1179 13003
NM_031445chr222121 793 --12254 --
NM_031461chr852211 2158 890 442 234 ----1449
NM_031468chr7118168 6368 6297 6288 5738 5719 5546 5259 5224 2961 53 27772 555 2843 635 28020 761
NM_031473chr121860 --1939 1431
NM_031475chr11531 ------
NM_031480chr62105 28 1232 ----
NM_031483chr2042508 2283 1266 1246 ------
NM_031844chr153581 2613 2582 1444 383 --13630 --
NM_031845chr21804 ----13029
NM_031847chr21804 ----13029
NM_031849chr5--1668 12364 --
NM_031857chr5--1668 12364 --
NM_031860chr5--1668 12364 --
NM_031892chrX1892 ------
NM_031938chr111818 ------
NM_031940chr852049 1537 731 599 315 ------
NM_031989chr121267 ------
NM_032021chr114468 375 330 122 11005 ----
NM_032027chr1----1288 --
NM_032041chr852215 614 488 421 107 --12471 --
NM_032102chr1122621 2255 2620 370 22395 184 --
NM_032121chrX42525 2494 2208 517 --22394 2186 --
NM_032124chr181930 --1247 --
NM_032132chr12212 144 --1413 --
NM_032145chr621502 445 ------
NM_032160chr181195 23953 1197 21461 1345 --
NM_032174chr111432 ----11452
NM_032182chr1011629 --21461 1386 11573
NM_032189chr1354788 4569 250 218 206 ------
NM_032192chr171225 ------
NM_032195chr21180 ------
NM_032208chr253607 3572 2497 2288 673 12582 12636 --
NM_032221chr2011989 ------
NM_032229chr132977 88 --1748 --
NM_032231chr15----1256 --
NM_032239chr42980 158 --2931 517 --
NM_032246chr151426 ------
NM_032256chr12--1242 ----
NM_032268chr1673015 2761 2343 2207 1254 842 215 --12404 --
NM_032288chr342251 1916 1683 364 --21925 450 --
NM_032291chr121291 428 --11196 11432
NM_032315chr1----1259 --
NM_032352chr143962 555 58 --1369 --
NM_032373chr1085646 5012 4531 4332 2103 981 824 127 --31300 915 190 --
NM_032410chr811230 ------
NM_032434chr2--11338 3476 430 204 --
NM_032438chr631558 560 493 ------
NM_032439chr1011375 ------
NM_032440chr102580 409 22908 641 22568 2432 --
NM_032446chr512367 --23852 2852 --
NM_032457chr452858 2735 2491 656 421 --33911 2392 2386 --
NM_032458chrX22105 1309 --13136 12732
NM_032466chr81210 1451 11654 --
NM_032468chr81210 1451 11654 --
NM_032491chr123451 275 115 --1464 --
NM_032505chr322755 954 --12792 --
NM_032514chr201408 ------
NM_032520chr161192 ------
NM_032521chr2033080 1968 37 --22725 2427 12197
NM_032539chrX1710 ------
NM_032552chr911981 ------
NM_032558chr921421 395 --21455 1113 --
NM_032564chr11176 ----1311
NM_032632chr1412004 --11775 --
NM_032664chr831140 1053 87 --11674 --
NM_032727chr101320 1364 ----
NM_032731chr17------1136
NM_032782chr5196 --1183 --
NM_032784chr62138 40 177 ----
NM_032793chr1--1356 ----
NM_032802chr15----130 --
NM_032804chr101476 --12459 --
NM_032810chr101553 1312 1566 --
NM_032842chr721676 1570 11321 31636 1295 287 --
NM_032859chr1333884 3837 3670 --22806 611 --
NM_032866chr1563132 2863 2106 2031 1200 813 1844 133 --
NM_032885chr19154 ------
NM_032906chr41622 ------
NM_032932chr1735069 761 282 --14909 16061
NM_032949chr132574 126 --1223 --
NM_032961chr42866 433 ------
NM_032968chrX33446 2787 581 23321 1406 23254 820 --
NM_032969chrX33446 2787 581 23321 1406 23254 820 --
NM_032973chrY22782 581 23316 1406 13249 --
NM_032993chr41112 ------
NM_033020chr134124 3212 1909 --1319 1531
NM_033030chr21583 --21058 514 --
NM_033031chrX1167 ------
NM_033044chr11387 --1836 --
NM_033049chr3--153 11058 1231
NM_033055chr11243 ------
NM_033056chr101560 ------
NM_033083chr312799 --42556 1182 607 187 --
NM_033089chr2011433 --11446 --
NM_033105chr81145 ------
NM_033124chr12------1114
NM_033131chr111779 ------
NM_033132chr13----21682 1539 --
NM_033135chr1132407 657 159 ------
NM_033136chr521664 1641 ----11845
NM_033137chr521664 1641 ----11845
NM_033138chr711877 --22189 775 --
NM_033139chr711877 --22189 775 --
NM_033140chr711877 --22189 775 --
NM_033157chr711877 --22189 775 --
NM_033181chr633500 1130 312 33811 3314 874 13201 1471
NM_033211chr511401 11691 ----
NM_033222chr911136 11352 ----
NM_033224chr796561 5899 5808 5779 5314 5058 3154 2860 1571 32705 2329 936 15532 --
NM_033225chr862843 2327 2239 1164 1037 72 12786 ----
NM_033261chr101159 ------
NM_033281chr5123 ------
NM_033285chr843655 3538 947 499 ------
NM_033290chrX52569 1472 763 617 321 13330 13472 --
NM_033305chr921354 404 --11398 --
NM_033326chr1152236 2112 2014 1849 784 --21855 979 --
NM_033360chr1264619 4037 3211 1201 781 626 ----1686
NM_033389chr1774357 4238 4175 3619 1673 251 109 --33914 3856 1154 --
NM_033402chr8184 ------
NM_033411chr61222 ------
NM_033425chr1143364 2967 1359 745 11222 --1330
NM_033429chr1562870 2708 2441 1080 885 621 12095 ----
NM_033449chr51231 --1535 --
NM_033480chr632430 2393 667 --1922 --
NM_033481chr632430 2393 667 --1922 --
NM_033495chrX2313 50 ------
NM_033505chr265956 4858 2479 2352 2118 1679 --34366 2257 1504 --
NM_033515chr6142 --11367 --
NM_033535chr441159 1061 1007 286 --1292 --
NM_033624chr1231681 512 39 ------
NM_033631chr132506 2389 1416 --1159 --
NM_033632chr42473 323 11077 ----
NM_033642chrX----1934 1147
NM_033644chr532357 2258 1584 1499 1961 --
NM_033645chr532357 2258 1584 1499 1961 --
NM_033656chr21105645 5546 5461 4360 3738 2119 1269 1151 770 337 --35056 2348 1036 --
NM_052827chr1231005 313 78 ----11105
NM_052834chr1852304 2233 413 179 114 ------
NM_052857chr171492 ------
NM_052875chr1112100 ------
NM_052879chr1254095 2880 2777 569 467 13558 ----
NM_052885chr1234348 3133 1826 --14009 --
NM_052886chr821788 1475 11493 --1746
NM_052898chr821720 1241 ------
NM_052900chr821600 645 --1478 --
NM_052905chr221444 1339 --1308 --
NM_052910chr1312104 1679 1670 --
NM_052917chr253422 1095 1081 329 292 --2962 867 12181
NM_052918chr1032917 972 556 --1675 --
NM_052923chr6----175 --
NM_052927chr5--11621 12069 --
NM_052937chr811781 --12086 --
NM_052940chr11152 ------
NM_053016chr9117358 7116 6382 6132 5231 2676 2602 2245 1807 981 393 --35482 2814 1995 26299 6235
NM_053024chr331532 1287 437 --11315 11131
NM_053025chr331725 580 125 ------
NM_053026chr331725 580 125 ------
NM_053027chr331725 580 125 ------
NM_053028chr331725 580 125 ------
NM_053031chr331725 580 125 ------
NM_053032chr331725 580 125 ------
NM_053035chr7190 ------
NM_053043chr765474 4744 4672 4413 1227 1051 --26239 988 --
NM_053056chr1132083 2073 598 --12042 --
NM_053064chr1452542 2431 1237 1072 268 ------
NM_053281chrX1124 ------
NM_054016chr132040 1755 1296 ------
NM_054016chr132040 1755 1296 ------
NM_054016chr132040 1755 1296 ------
NM_054027chr531479 350 213 ------
NM_054033chr2177 ------
NM_054114chr6236 24 ------
NM_057159chr921642 1326 ------
NM_057169chr1242403 1266 654 410 ------
NM_057170chr1242403 1266 654 410 ------
NM_057175chr4----12573 --
NM_057178chr1732020 610 136 ------
NM_057182chr191493 ------
NM_057749chr821087 530 1542 1132 --
NM_058170chr12535 224 --2603 361 --
NM_058237chr142900 342 ------
NM_058241chr222292 340 --12365 11790
NM_058241chr222292 340 --12365 11790
NM_078473chr852049 1537 731 599 315 ------
NM_080546chr942204 1800 1534 253 --22301 538 --
NM_080597chr183384 289 204 ------
NM_080599chr1011117 ------
NM_080629chr121455 1199 ------
NM_080630chr121455 1199 ------
NM_080632chrX1651 ------
NM_080645chr631730 1618 729 --1337 --
NM_080655chr91223 ------
NM_080669chr17114913 4355 4039 3580 3253 3031 1565 686 431 278 246 ------
NM_080671chr221882 1717 1823 2409 310 --
NM_080672chr20----1384 --
NM_080676chr2033238 2301 2103 --22453 1285 --
NM_080723chr651193 1038 1031 439 181 ------
NM_080743chr612552 --12038 --
NM_080792chr201911 --12040 --
NM_080832chrX1686 --1192 11159
NM_080862chr3----21332 62 --
NM_080867chr1434793 4521 3911 24952 3458 33236 3111 726 1429
NM_080872chr853948 3623 1256 1037 902 --23803 1456 1825
NM_080921chr11916 ----1816
NM_080927chr322163 158 12547 ----
NM_100264chr101657 ------
NM_100486chr101657 ------
NM_130391chr943339 2401 1389 1022 --12684 22821 2764
NM_130392chr943339 2401 1389 1022 --12684 22821 2764
NM_130393chr943339 2401 1389 1022 --12684 22821 2764
NM_130395chr6----1302 --
NM_130434chr153142 107 40 ------
NM_130436chr2132308 1022 330 ------
NM_130438chr2122885 907 ------
NM_130439chr1021810 315 1483 12167 --
NM_130439chr1021810 315 1483 12167 --
NM_130442chr72857 429 ------
NM_130798chr1521252 244 ----11090
NM_130808chr31402 ------
NM_130809chr543143 818 707 320 --32380 971 162 --
NM_130846chr123855 754 336 ------
NM_130847chr1165617 5207 5175 5058 1993 793 13830 ----
NM_133170chr2057257 5579 2924 1196 183 --26749 2873 --
NM_133264chr1743373 3213 1480 733 13813 ----
NM_133265chrX73680 3383 3021 3011 2356 1273 826 ------
NM_133329chr21102 11694 11613 --
NM_133334chr466195 4034 2325 2060 1039 188 --35277 4702 830 --
NM_133367chr633442 2950 2234 --13345 --
NM_133369chr51870 ------
NM_133370chr473259 3167 2673 2295 585 422 357 12834 1645 --
NM_133372chr522419 1789 12476 12245 --
NM_133468chr771635 913 770 739 671 248 207 --1341 --
NM_133476chr122295 226 ------
NM_133478chr242536 2348 2091 896 --12450 --
NM_133496chr153415 777 510 498 143 --34328 3346 1330 --
NM_133503chr122689 641 --2190 53 1495
NM_133504chr122689 641 --2190 53 1495
NM_133505chr122689 641 --2190 53 1495
NM_133506chr122689 641 --2190 53 1495
NM_133507chr122867 819 --3368 231 157 1673
NM_133631chr3----21360 1325 --
NM_133646chr235536 3615 1114 --1944 11425
NM_133647chr1523230 1366 2793 187 1684 --
NM_134265chr172801 265 ------
NM_134268chr17------11201
NM_134442chr2----21306 1218 --
NM_134447chr192516 488 ------
NM_138270chrX1336 --22617 711 --
NM_138287chr372002 1968 1678 1033 636 549 535 --2268 157 --
NM_138333chr932302 1849 93 --12583 --
NM_138335chr43863 288 215 --1113 --
NM_138391chr1----1261 --
NM_138423chr1522153 2013 12050 ----
NM_138426chr762413 2302 1892 1861 1755 762 --1213 --
NM_138444chr1334845 3161 1058 1502 11872 14454
NM_138468chr266118 4474 1753 1316 1177 815 11995 ----
NM_138555chr151217 --1440 --
NM_138558chr121133 440 --11084 --
NM_138576chr1454673 3739 3395 1784 912 --34782 1583 922 --
NM_138633chr671721 1624 1531 634 497 444 324 --1342 --
NM_138638chr1451533 1501 950 570 230 1929 --1176
NM_138713chr1687762 7586 6120 5025 3089 2368 2221 1882 --27991 1999 1345
NM_138714chr1687762 7586 6120 5025 3089 2368 2221 1882 --27991 1999 1345
NM_138730chr6286 33 ------
NM_138731chr1423726 1366 --3954 858 769 --
NM_138736chr1664200 3466 1350 1014 358 255 ------
NM_138771chr71443 11340 21486 406 --
NM_138773chr5155 ------
NM_138782chr52501 160 --147 --
NM_138811chr7----1968 --
NM_138927chr211999 ------
NM_138959chr186650 6108 5481 4852 2464 1980 710 241 1581 25864 1614 11843
NM_138969chr841179 473 459 174 --1249 --
NM_138971chr1143159 3058 2993 862 --1474 --
NM_138971chr1143159 3058 2993 862 --1474 --
NM_138972chr1143159 3058 2993 862 --1474 --
NM_138972chr1143159 3058 2993 862 --1474 --
NM_138973chr1143159 3058 2993 862 --1474 --
NM_138973chr1143159 3058 2993 862 --1474 --
NM_139012chr622259 887 --22218 807 --
NM_139035chrX128 --1184 --
NM_139045chr92659 80 ------
NM_139046chr101183 ------
NM_139048chr321121 452 ------
NM_139057chr1522240 972 12885 12654 1149
NM_139068chr51659 ------
NM_139069chr51659 ------
NM_139070chr51528 ------
NM_139072chr2----1588 --
NM_139131chr112646 43 --1217 --
NM_139157chr111606 ------
NM_139168chr521815 258 ------
NM_139207chr1222050 1817 --12164 21689 1583
NM_139241chr121179 ------
NM_139246chr931925 426 329 11859 ----
NM_139276chr1721905 142 ------
NM_139316chr7----11076 --
NM_139321chr2063721 3573 3113 2581 596 455 --23267 477 --
NM_144567chr162814 2678 2253 1916 495 473 ------
NM_144570chr1622733 642 --12349 --
NM_144571chr4127033 6595 6517 6234 5132 1854 1768 1669 1397 1097 484 38 --32779 1876 892 1902
NM_144574chr142603 148 --1441 --
NM_144578chr1444175 3355 1232 626 --21133 654 14548
NM_144590chr1032800 514 85 --12102 --
NM_144598chr151123 ------
NM_144599chr1555353 1630 1409 1324 483 25485 1598 ----
NM_144625chr11397 ------
NM_144628chr2032847 2401 1959 --32320 2189 903 --
NM_144632chr242162 1824 1614 845 --21891 117 11780
NM_144633chr351230 588 543 526 478 ------
NM_144642chr31262 ------
NM_144664chr1132401 1925 1006 11947 ----
NM_144665chr11268 24 ------
NM_144667chr12----11103 --
NM_144723chr52557 77 ------
NM_144726chr521111 1014 ------
NM_144728chr12851 296 --1183 --
NM_144729chr12851 296 --1183 --
NM_144736chr22630 251 ------
NM_144778chr132470 168 --22247 476 --
NM_144963chr832428 1844 1024 --12542 --
NM_144967chrX1223 ------
NM_144973chr1234501 3781 231 ------
NM_144981chr11----197 --
NM_145000chr51416 ------
NM_145005chr9----1199 --
NM_145049chr51771 --1347 --
NM_145055chr1883538 3493 3066 2875 2523 1371 911 78 --11087 --
NM_145115chr722053 470 --21479 803 12026
NM_145117chr1153269 3219 3104 383 306 --12367 --
NM_145176chr633031 1381 102 1795 ----
NM_145251chr14----11363 --
NM_145259chr235662 4408 420 25324 308 34488 1518 78 25332 2430
NM_145284chrX1953 11757 1558 21856 128
NM_145307chr101956 1127 53273 1784 1682 1233 608 13605
NM_145331chr61333 ------
NM_145341chr1021342 266 --11671 11749
NM_145690chr8159 --21847 1713 --
NM_145716chr1------183
NM_145735chr1362691 2367 2024 1089 691 436 ------
NM_145800chrX1947 ----199
NM_145802chrX1896 ----148
NM_145808chr743044 2490 2148 2026 --11954 --
NM_145858chr211422 ------
NM_145859chr31140 ----1267
NM_145860chr31140 ----1267
NM_145891chr1661705 1689 1525 398 366 310 ------
NM_145892chr1661705 1689 1525 398 366 310 ------
NM_145893chr1661827 1811 1647 520 488 432 ------
NM_147147chr634012 3723 3224 --44239 4154 3110 1042 --
NM_147175chrX11485 ----12097
NM_147181chr431394 1341 956 ------
NM_147182chr431394 1341 956 ------
NM_147183chr431394 1341 956 ------
NM_147189chr831931 570 327 12179 1871 --
NM_147223chr252041 1779 634 481 285 --12330 --
NM_147233chr251858 1596 451 298 102 --12147 --
NM_148174chr852007 1895 1662 1359 135 ------
NM_148921chr1722319 1486 --21964 758 --
NM_148955chr1576598 6344 5020 2578 2251 2134 353 --12106 --
NM_148976chr111112 ------
NM_152133chr6236 24 ------
NM_152230chr10179 ------
NM_152236chr22----1185 --
NM_152237chr22----11679 --
NM_152244chr1731182 360 285 1152 11001 --
NM_152261chr1221832 1779 11745 11919 --
NM_152265chr121328 157 ------
NM_152271chr81424 ------
NM_152272chr8----3520 289 265 --
NM_152277chr541923 1810 813 769 --162 --
NM_152282chr321345 513 --1951 11219
NM_152291chr4----131 --
NM_152317chr12----2179 166 --
NM_152330chr142651 87 11978 ----
NM_152352chr1842521 2235 645 216 ------
NM_152409chr532892 2823 155 --12246 --
NM_152414chr821386 1159 --11489 --
NM_152422chr92492 209 11453 11739 --
NM_152424chrX5872 769 660 633 170 --33920 3775 1707 1568
NM_152450chr152613 354 11431 ----
NM_152470chr1832780 404 91 1491 ----
NM_152495chr121171 1090 ------
NM_152519chr261872 1753 1531 729 374 210 ------
NM_152520chr2----1788 --
NM_152523chr21545 --1590 --
NM_152542chr421692 397 --1843 --
NM_152546chr521036 538 1228 1984 --
NM_152549chr51119 ----1163
NM_152556chr752257 2013 500 304 210 --2280 135 --
NM_152574chr9151 ------
NM_152588chr123566 122 78 --1218 --
NM_152590chr12----2286 107 --
NM_152608chr142515 2473 920 232 --2581 262 --
NM_152609chr11268 11082 1451 --
NM_152622chr582891 2458 2377 1245 1235 1216 864 429 --13413 --
NM_152624chr511443 --25693 5214 --
NM_152629chr933617 1315 1171 11342 33276 2752 1489 --
NM_152638chr121464 21285 133 ----
NM_152641chr1232911 2377 1975 --1953 --
NM_152667chr2041259 1251 1121 978 ------
NM_152673chr334045 2855 367 11427 --1659
NM_152678chr332291 641 112 12724 ----
NM_152692chrX------154
NM_152695chrX31862 1837 753 --1519 1399
NM_152703chr721007 807 --2883 870 --
NM_152705chr1321208 343 ------
NM_152707chr101315 ----1305
NM_152713chr111210 ------
NM_152721chr182742 618 163 ----
NM_152733chr696375 5776 4451 4181 4136 1923 908 569 373 --22335 767 --
NM_152734chr634633 3870 3664 --11277 --
NM_152737chr61666 --12060 --
NM_152744chr733576 2737 1337 --11213 --
NM_152753chr631516 710 237 ----1407
NM_152754chr73511 390 288 --13780 --
NM_152755chr7--1596 ----
NM_152756chr523424 483 --23210 3119 13532
NM_152758chr862857 2758 2006 867 463 432 ----12251
NM_152787chrX32775 1031 791 --33156 2811 1401 --
NM_152789chr731478 1261 508 ------
NM_152793chr723459 2078 1493 34194 3573 248 25197 593
NM_152826chr1576598 6344 5020 2578 2251 2134 353 --12106 --
NM_152835chr132451 918 168 ----12644
NM_152838chr2052823 1412 1277 727 666 ------
NM_152862chr2--1410 ----
NM_152879chr212562 ------
NM_152902chr121368 53 --22001 1632 --
NM_152903chr1352761 2550 2488 2417 1954 ------
NM_152910chr131453 --153 --
NM_152924chr1556380 2688 1498 869 181 --25979 384 --
NM_152989chr1251827 1541 1513 1354 642 ----11769
NM_152994chr21232 ----1415
NM_152996chr152082 1855 1324 575 472 ------
NM_152999chr774911 4612 3539 885 760 174 26 --11675 23532 49
NM_153005chr62105 28 1232 ----
NM_153020chr61606 --31100 470 122 --
NM_153050chr2244762 3125 3048 1712 13713 34695 4503 4381 --
NM_153051chr2244762 3125 3048 1712 13713 34695 4503 4381 --
NM_153184chr331403 124 77 --2608 388 --
NM_153188chr574988 4942 4120 3998 2027 1362 174 13566 ----
NM_153215chr3------1883
NM_153223chr551594 1370 1182 599 553 ------
NM_153226chr102456 359 ------
NM_153235chr622377 1826 --1165 --
NM_153251chr132269 254 ------
NM_153256chr1051830 1688 1426 1146 311 ------
NM_153260chr15----31157 404 301 --
NM_153261chr1621069 429 1457 11443 --
NM_153262chr121187 310 ------
NM_153267chr92899 285 ------
NM_153321chr17------1838
NM_153322chr17------1838
NM_153332chr82329 41 ------
NM_153341chr11350 ------
NM_153354chr51710 ----1694
NM_153365chr412484 --21871 719 --
NM_153371chr1342216 763 568 420 --22036 2008 --
NM_153456chr1395817 5361 5096 3896 2458 511 400 245 86 --16267 --
NM_153607chr521229 1164 --12694 12930
NM_153616chr1541594 1488 657 221 --1839 1355
NM_153617chr1541594 1488 657 221 --1839 1355
NM_153618chr1541594 1488 657 221 --1839 1355
NM_153619chr1552832 2726 1459 946 74 --21255 500 --
NM_153634chr121347 ------
NM_153682chr21------157
NM_153693chr12--1572 ----
NM_153695chr9----1107 --
NM_153756chr141399 1333 475 305 ------
NM_153810chr1044632 3919 3405 866 13820 11060 --
NM_153828chr23627 211 178 ------
NM_153836chr251957 1604 183 116 73 1657 11927 --
NM_170606chr71688 ------
NM_170665chr1244392 4177 1481 1033 11267 ----
NM_170674chr1511104 --1451 --
NM_170677chr1511104 --1451 --
NM_170679chr5----21071 1015 --
NM_170692chr11899 --1304 --
NM_170695chr182159 36 ------
NM_170706chr143509 2753 1118 466 --14228 --
NM_170709chr81398 1243 1286 --
NM_170710chr413150 1151 22420 2107 13167
NM_170719chr13----11457 1956
NM_170721chr1721241 1180 --11014 --
NM_170750chrX1815 ------
NM_170751chr61146 1220 ----
NM_170752chr61146 1220 ----
NM_170775chr52210 39 ------
NM_171825chr52965 109 --23133 1044 --
NM_171999chr181735 ------
NM_172016chr621221 1129 --21279 1147 --
NM_172058chr821665 1531 --11356 --
NM_172059chr821665 1531 --11356 --
NM_172060chr821665 1531 --11356 --
NM_172069chr262267 1994 897 754 424 273 --11596 --
NM_172070chr241792 1652 317 233 --42265 1524 739 427 --
NM_172071chr144950 2904 1230 1124 16440 57304 5976 4688 2628 1562 --
NM_172193chr142426 142 11359 ----
NM_172240chr1231396 1166 360 --21135 109 --
NM_172315chr1511104 --1451 --
NM_172316chr1511104 --1451 --
NM_172344chr21102 11694 11613 --
NM_172373chr1331281 860 262 --1962 --
NM_173054chr71379 --2943 786 --
NM_173163chr161479 ------
NM_173165chr161360 ------
NM_173171chr221141 328 --1184 --
NM_173172chr221449 636 --1492 --
NM_173173chr221141 328 --1184 --
NM_173198chr931913 787 303 12544 --11820
NM_173199chr91159 ------
NM_173200chr931913 787 303 12544 --11820
NM_173207chr182159 36 ------
NM_173208chr182159 36 ------
NM_173209chr182159 36 ------
NM_173210chr182159 36 ------
NM_173211chr182159 36 ------
NM_173214chr1687762 7586 6120 5025 3089 2368 2221 1882 --27991 1999 1345
NM_173353chr12292 66 ------
NM_173463chr474068 4056 3950 3356 2739 1448 734 1564 1345 14395
NM_173468chr435601 3856 792 --34213 1482 1190 21672 1640
NM_173469chr151139 --11232 --
NM_173470chrX21959 1000 1909 --1832
NM_173471chr34718 709 173 141 --11034 --
NM_173478chr171186 --1793 --
NM_173491chr5154 ------
NM_173495chrX22311 687 22218 1807 11916 --
NM_173508chr111123 ------
NM_173510chr2231931 1014 159 --11905 --
NM_173511chr223212 3093 --1973 --
NM_173515chr61315 ------
NM_173517chr72416 167 ------
NM_173552chr342278 1679 289 230 --4769 680 541 531 1998
NM_173557chr182613 560 ------
NM_173582chr1155334 4359 4320 3983 2415 --45905 2425 926 478 14246
NM_173591chr121363 ----2883 67
NM_173595chr1243602 1548 854 812 ------
NM_173602chr1232664 406 30 12828 2399 310 --
NM_173609chr15----1479 --
NM_173642chr198166 7810 5681 2295 1879 1772 1741 995 847 --16962 --
NM_173644chr2031840 1452 196 ------
NM_173645chr21472 ------
NM_173647chr21314 --11015 --
NM_173653chr331321 452 224 --11403 --
NM_173654chr31896 --31481 191 185 --
NM_173681chr721908 160 ------
NM_173694chrX22537 883 --11581 --
NM_173808chr144401 1567 1296 749 --24426 3792 --
NM_173822chr22773 483 1729 ----
NM_173833chr841580 1508 1404 163 ------
NM_173848chr81328 --1769 --
NM_173851chr873796 3406 2545 2515 1250 109 57 --13956 11602
NM_174858chr131247 1075 1010 --1821 --
NM_174886chr182159 36 ------
NM_174890chr10------2806 714
NM_174911chr853981 3922 3434 1214 326 --21567 376 --
NM_175061chr741901 1769 666 649 --11355 --
NM_175607chr321391 360 --41733 1402 615 579 --
NM_175612chr321391 360 --41733 1402 615 579 --
NM_175736chr1256019 2848 1072 932 745 ------
NM_175767chr511839 --1404 --
NM_175848chr2011170 --11211 --
NM_175848chr2011170 --11211 --
NM_175849chr2011170 --11211 --
NM_175849chr2011170 --11211 --
NM_175850chr2011170 --11211 --
NM_175850chr2011170 --11211 --
NM_175854chr1322727 2571 --2410 196 --
NM_175856chr51666 ------
NM_175861chr1255391 4695 548 442 371 15113 ----
NM_175873chr521325 931 ----11371
NM_175907chr18----22834 2790 --
NM_176792chr1021328 344 ------
NM_176814chr71235 ------
NM_176815chr342790 2552 2453 180 --1238 --
NM_176863chr1732039 1987 760 ------
NM_177398chr121536 1368 11302 ----
NM_177399chr121536 1368 11302 ----
NM_177402chr13838 765 706 ------
NM_177438chr1473600 3059 3032 1408 1212 1182 829 11243 14145 --
NM_177441chr172818 225 ------
NM_177553chr112833 120 ------
NM_177937chr9--1660 1638 --
NM_177947chrX21667 1134 --31681 304 247 --
NM_177948chrX21667 1134 --31681 304 247 --
NM_177967chr131359 --1162 1188
NM_177968chr21716 ------
NM_177969chr21571 --1221 --
NM_177974chr1522153 2013 12050 ----
NM_177990chr2031429 500 491 1233 ----
NM_177995chr92492 209 11453 11739 --
NM_177996chr2013125 --1703 --
NM_178010chr1251827 1541 1513 1354 642 ----11769
NM_178011chr1022621 1300 --22186 1995 --
NM_178031chr111167 ------
NM_178037chr124528 293 119 26 --13009 --
NM_178038chr124528 293 119 26 --13009 --
NM_178126chr171434 --11484 --
NM_178140chr522453 2316 --12424 --
NM_178151chrX67725 7219 6749 5076 2451 89 12923 37881 6113 2586 16718
NM_178152chrX67725 7219 6749 5076 2451 89 12923 37881 6113 2586 16718
NM_178153chrX67725 7219 6749 5076 2451 89 12923 37881 6113 2586 16718
NM_178232chr153661 223 84 --1591 --
NM_178313chr271834 1793 1772 787 601 553 364 11571 ----
NM_178424chr51565 ------
NM_178450chr51740 ------
NM_178496chr331174 224 69 ------
NM_178498chr1144073 4015 582 314 1592 1105 --
NM_178539chr1221327 195 --1736 --
NM_178554chr333326 3052 241 --23437 1280 --
NM_178578chr2042041 1993 692 327 12683 1540 --
NM_178585chr432712 1198 1140 --1634 22894 2061
NM_178812chr83556 530 465 ----11403
NM_178815chr1041699 1093 995 291 --22141 1853 --
NM_178818chr1642493 1908 194 107 --12308 --
NM_181054chr141796 11120 ----
NM_181077chr1542078 2041 849 421 1250 ----
NM_181265chr413150 1151 22420 2107 13167
NM_181302chr142603 148 --1441 --
NM_181308chr142603 148 --1441 --
NM_181310chr611876 ------
NM_181332chrX32535 2186 2134 ------
NM_181349chr752926 2207 949 778 409 ------
NM_181351chr1132647 2524 2241 --11928 12376
NM_181354chr821244 1142 --11500 --
NM_181357chr141515 ----21705 247
NM_181358chr133519 2772 588 1865 ----
NM_181481chr1876699 5866 4589 4403 1727 1330 1304 26832 771 16639 --
NM_181482chr1876699 5866 4589 4403 1727 1330 1304 26832 771 16639 --
NM_181483chr1876699 5866 4589 4403 1727 1330 1304 26832 771 16639 --
NM_181504chr553744 3539 3479 3383 603 ------
NM_181505chr171225 ------
NM_181509chr201408 ------
NM_181523chr553744 3539 3479 3383 603 ------
NM_181524chr553744 3539 3479 3383 603 ------
NM_181656chr17----2961 689 --
NM_181659chr201621 --33431 585 147 --
NM_181659chr201621 --33431 585 147 --
NM_181705chr575501 4455 4224 1801 1129 360 317 21356 159 1936 --
NM_181706chr1162241 1496 1483 681 578 58 12126 1265 --
NM_181712chr162036 1316 807 728 630 257 --21744 1627 --
NM_181714chr641757 1459 699 268 ----11967
NM_181762chrX------179
NM_181777chrX------179
NM_181782chr672302 2148 1934 1723 593 405 125 1397 --12119
NM_181784chr232608 2413 2299 ------
NM_181809chr163354 3337 2974 2680 860 413 ----11601
NM_181837chr6--1255 ----
NM_181838chr5--1579 11235 --
NM_181839chr81235 ----1195
NM_181886chr441360 1290 1042 967 --11436 --
NM_181887chr441360 1290 1042 967 --11436 --
NM_181888chr441360 1290 1042 967 --11436 --
NM_181889chr441360 1290 1042 967 --11436 --
NM_181890chr441360 1290 1042 967 --11436 --
NM_181891chr441360 1290 1042 967 --11436 --
NM_181892chr451407 1337 1089 1014 43 --11483 --
NM_181893chr441360 1290 1042 967 --11436 --
NM_182485chr463518 964 712 605 562 323 --33078 3044 462 13261
NM_182487chr963842 3420 1699 1016 782 527 --14379 --
NM_182493chr1644552 4316 1901 1672 11533 12131 --
NM_182515chr1955577 5129 4784 4417 82 1693 34239 1630 1608 --
NM_182551chr21111 --31245 1175 856 22890 2307
NM_182580chr142082 2041 1935 283 12342 1145 --
NM_182641chr1741993 1532 1397 570 ------
NM_182646chr463518 964 712 605 562 323 --33078 3044 462 13261
NM_182666chr31447 ----1211
NM_182678chr21164 --1370 --
NM_182691chr7----1286 --
NM_182692chr7----1286 --
NM_182715chr71340 --1930 --
NM_182728chr1411215 ------
NM_182734chr2043006 2533 2507 430 --11149 12981
NM_182752chr1------11505
NM_182756chr22248 97 ------
NM_182758chr1523519 3304 --22513 60 --
NM_182763chr132144 1999 1740 ------
NM_182767chr1242040 1483 1443 738 ------
NM_182789chr5----1791 --
NM_182797chr203548 532 290 ------
NM_182798chr52305 78 --1969 --
NM_182799chr52305 78 --1969 --
NM_182801chr52305 78 --1969 --
NM_182898chr765697 5599 5502 4542 4199 1732 ------
NM_182899chr765697 5599 5502 4542 4199 1732 ------
NM_182907chr63931 864 472 ------
NM_182920chr31433 128 ----
NM_182948chr152266 2224 2216 206 137 ------
NM_182964chr1153269 3219 3104 383 306 --12367 --
NM_182972chr121760 821 --42798 2095 1009 412 --
NM_183227chr641486 1477 255 67 --11644 --
NM_183244chr20----1384 --
NM_183246chr20----1384 --
NM_183323chr5----1791 --
NM_183393chr32945 889 --1132 --
NM_183394chr32945 889 --1132 --
NM_183397chr2045054 4532 1590 1386 --14388 --
NM_184234chr20----1107 --
NM_194071chr763798 3529 1756 405 240 67 12051 ----
NM_194247chr263412 3303 1002 870 225 196 ------
NM_194250chr23124 85 47 ------
NM_194277chrX2791 258 ------
NM_194283chr533983 2677 202 ------
NM_194285chr1143091 2661 2532 540 --2147 133 --
NM_194286chr12115956 5877 5827 5332 5261 4636 2315 1665 1178 924 773 12136 24838 4562 --
NM_194291chr842950 2506 1000 508 --1285 --
NM_194298chr101546 --131 --
NM_194314chr1--1627 21360 84 --
NM_194317chr252538 2218 538 177 72 --12108 --
NM_194356chr1232050 520 145 --32359 2164 195 --
NM_194434chr1844640 4198 2281 1634 --34688 2114 1655 --
NM_194442chr111385 --31514 310 49 --
NM_194449chr183967 918 126 --1363 --
NM_194454chr71503 --11268 --
NM_194455chr71503 --11268 --
NM_194456chr71503 --11268 --
NM_194463chrX31062 793 138 ------
NM_197941chr552946 2231 1998 1988 1921 --31191 757 33 --
NM_197956chr93397 271 29 --11583 --
NM_197968chr131290 ----1169
NM_197970chr21583 --21058 514 --
NM_198057chrX----11016 --
NM_198074chr12244 222 11397 1147 --
NM_198123chr821600 645 --1478 --
NM_198124chr821600 645 --1478 --
NM_198128chr1832289 117 42 --11647 --
NM_198158chr322197 1973 --12371 --
NM_198159chr322197 1973 --12371 --
NM_198177chr322197 1973 --12371 --
NM_198178chr322197 1973 --12371 --
NM_198181chr1532457 1980 436 ------
NM_198195chr32588 439 --176 --
NM_198196chr342525 1753 273 207 ------
NM_198215chr10165 --1566 11406
NM_198225chr1051645 1381 1300 662 626 ------
NM_198240chr12----1444 2345 265
NM_198268chr133519 2772 588 1865 ----
NM_198269chr133519 2772 588 1865 ----
NM_198270chrX42866 2341 1119 606 ----1356
NM_198320chr1254871 3178 1525 963 760 --1643 11822
NM_198336chr731154 698 229 --1546 --
NM_198337chr721289 364 --1681 --
NM_198391chr2031252 405 132 ------
NM_198400chr1541961 513 408 36 ------
NM_198401chr821281 320 ------
NM_198404chr13----1267 --
NM_198465chrX11812 ------
NM_198467chr71545 ------
NM_198484chr345632 2137 1713 1411 1622 26384 4622 15699
NM_198503chr131584 547 400 ------
NM_198504chr31756 --2345 62 --
NM_198513chr811840 --21498 1476 --
NM_198560chr332717 2388 1383 --13163 --
NM_198569chr61191 --12688 187
NM_198570chr7----1233 --
NM_198581chr277028 4813 2508 2318 2249 2118 583 ------
NM_198595chr484282 3898 3505 3057 1914 1422 307 270 13753 1651 23850 3629
NM_198715chr176191 5826 5493 1954 1543 1180 766 26358 4806 24377 231 11871
NM_198793chr3104000 3987 3776 3709 3636 3364 3335 3312 3018 1612 --23762 615 --
NM_198794chr1431130 436 302 --11156 --
NM_198859chr3145029 4801 4790 4673 3872 3701 3454 3132 1934 1670 1162 1138 843 281 --21873 921 14126
NM_198880chr31232 ------
NM_198900chr1256019 2848 1072 932 745 ------
NM_198925chr15----1986 --
NM_198965chr121155 ------
NM_198966chr121155 ------
NM_199000chr752093 2043 1765 685 476 ------
NM_199003chr821442 1024 ------
NM_199040chr1252733 637 513 333 109 --22538 561 13350
NM_199144chr201202 ------
NM_199188chr1254095 2880 2777 569 467 13558 ----
NM_199189chr51737 ------
NM_199190chr1254095 2880 2777 569 467 13558 ----
NM_199203chr201202 ------
NM_199205chr82173 22 --1250 --
NM_199235chr2------1245
NM_199245chr1272596 2493 2458 2349 1604 441 108 21806 612 ----
NM_199246chr5----1338 1399
NM_199320chr452382 835 486 150 40 1593 12590 12675
NM_199320chr452382 835 486 150 40 1593 12590 12675
NM_199324chr453272 2447 1407 1370 804 --13190 --
NM_199328chr212162 143 --11029 --
NM_199334chr172520 209 ------
NM_199415chr2012064 --1619 --
NM_199421chr1434793 4521 3911 24952 3458 33236 3111 726 1429
NM_199436chr21729 --11209 --
NM_199440chr2----1183 --
NM_199464chr131128 --1262 --
NM_199478chrX31423 417 200 ------
NM_199511chr31720 ------
NM_199512chr31720 ------
NM_201266chr272673 2562 2354 2339 793 219 92 --2663 595 --
NM_201279chr272673 2562 2354 2339 793 219 92 --2663 595 --
NM_201280chr641407 1033 618 410 ------
NM_201434chr171167 ------
NM_201436chr72706 37 ------
NM_201437chr811025 ------
NM_201516chr72762 93 ------
NM_201517chr72706 37 ------
NM_201613chr121823 ------
NM_201999chr41452 ------
NM_203304chr19----1618 --
NM_203307chr1931266 214 130 11623 ----
NM_203327chr20104561 4202 3602 3424 2993 1744 1579 1349 854 300 --1412 --
NM_203350chr1----2300 213 --
NM_203364chr11--11027 ----
NM_203390chr821871 281 --1183 --
NM_203391chrX31249 273 185 ------
NM_203399chr12843 229 --171 --
NM_203401chr12843 229 --171 --
NM_203403chr9165 ------
NM_203406chr572955 2546 1951 1825 992 923 225 22053 836 158 12303
NM_203417chr21----11302 --
NM_203418chr21----11302 --
NM_203437chr21788 ------
NM_203446chr2133017 903 691 12787 177 --
NM_203458chr163600 3003 1008 958 874 855 ------
NM_203459chr132581 2458 130 11930 42591 2359 2214 409 --
NM_203463chr254945 4680 1467 388 146 --14090 13661
NM_203487chr132421 285 1548 1400 --
NM_203504chr422240 2163 --11759 --
NM_203505chr422240 2163 --11759 --
NM_205768chr111904 ------
NM_205836chr53531 117 26 ------
NM_205848chr132623 2119 288 --22750 1841 12020
NM_205861chr111486 --1552 --
NM_205864chr6--158 ----
NM_206594chr141367 1349 1082 822 --13244 --
NM_206595chr141367 1349 1082 822 --13244 --
NM_206808chr13121 ------
NM_206853chr624039 3334 11101 11477 --
NM_206854chr625300 4595 --11086 --
NM_206855chr636265 5560 263 1618 12051 --
NM_206860chr10----1185 --
NM_206861chr10----1185 --
NM_206862chr10----1185 --
NM_206866chr2122787 2723 --1287 --
NM_206876chr232705 1124 88 12198 ----
NM_206909chr897990 7827 5921 2553 2520 2442 2285 2074 699 ------
NM_206933chr122436 97 11058 1421 --
NM_207015chr311767 31994 376 125 12187 --
NM_207043chr152298 1983 1893 1734 768 --21753 458 --
NM_207044chr152298 1983 1893 1734 768 --21753 458 --
NM_207047chr152298 1983 1893 1734 768 --21753 458 --
NM_207171chr12442 227 --11741 --
NM_207303chr1063676 2982 2830 1606 1508 671 --11570 --
NM_207304chr132357 55 --22134 363 --
NM_207325chr1952031 1415 618 515 150 --21909 1557 --
NM_207337chr122875 354 1230 --1204
NM_207406chr495438 4212 1754 1658 1416 1332 1190 668 102 --24282 95 --
NM_207422chrX3268 157 134 ------
NM_207481chr2154 ------
NM_207517chr15----31908 1888 642 --
NM_207520chr23627 211 178 ------
NM_207521chr23627 211 178 ------
NM_207578chr11307 ----1735
NM_212460chr711717 1757 --1110
NM_212464chr1531802 1638 507 --1456 --
NM_213589chr235139 806 571 --34828 3460 462 25294 1150
NM_213594chr123451 275 115 --1464 --
NM_213606chr102671 479 --11746 --
NM_213609chr31443 ----1795
NM_213618chr111606 ------
NM_213654chr3----1319 1182