TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-519a-3p
miRNA Sequence: AAAGUGCAUCCUUUUAGAGUGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000037chr82820 424 ------
NM_000051chr1152942 2159 707 488 262 --22301 936 13329
NM_000070chr15----1502 --
NM_000081chr12225 33 --11253 11452
NM_000084chrX65427 2021 1757 1042 758 149 14562 15161 --
NM_000088chr172215 152 ------
NM_000089chr71675 ------
NM_000090chr21736 --1697 --
NM_000091chr262851 2483 2131 1916 1847 951 --22442 872 --
NM_000093chr912162 ----1910
NM_000096chr31678 --1864 1288
NM_000103chr153465 116 33 --1811 --
NM_000108chr72543 203 ------
NM_000109chrX1358 --32597 2375 2129 --
NM_000110chr121229 378 --11160 --
NM_000115chr1342085 2065 1963 252 1232 1536 --
NM_000125chr664053 3956 3772 3760 1030 385 --44224 3675 890 45 21001 328
NM_000129chr621408 33 --11449 --
NM_000135chr162726 79 --11010 --
NM_000138chr1532119 1768 455 ------
NM_000142chr411429 ------
NM_000161chr1421837 1626 ------
NM_000163chr532281 765 601 ------
NM_000165chr611384 --2627 503 --
NM_000168chr723234 561 --22661 1315 --
NM_000170chr9153 ----1518
NM_000173chr171407 ------
NM_000176chr51430 22921 703 12593 --
NM_000183chr2169 ----1146
NM_000188chr104590 293 82 38 ------
NM_000194chrX2185 164 --1142 --
NM_000208chr1944187 3898 1511 867 --23144 1850 --
NM_000210chr232040 546 491 --22024 1721 --
NM_000213chr17------1241
NM_000214chr20------11221
NM_000217chr1284173 3686 2092 1495 998 983 783 153 ----13271
NM_000219chr2122486 2425 --22511 272 --
NM_000220chr112821 700 ----1206
NM_000222chr441832 1821 1655 667 ----11329
NM_000227chr181344 ------
NM_000240chrX32293 364 102 --21503 1478 --
NM_000245chr752200 1842 1652 1566 106 ------
NM_000248chr333075 2848 22 ----11088
NM_000259chr15115872 5300 4833 4014 2546 1283 1193 1077 626 608 412 1316 25646 5030 --
NM_000264chr931289 645 298 ------
NM_000266chrX3772 746 248 ------
NM_000267chr1731223 980 582 --23472 102 11192
NM_000276chrX42121 1846 734 454 --3570 562 419 --
NM_000277chr121278 ------
NM_000278chr1011465 ------
NM_000280chr111273 ------
NM_000282chr131262 --1211 --
NM_000284chrX1171 --1712 --
NM_000291chrX2239 53 ------
NM_000297chr442052 1973 1845 1679 --1137 --
NM_000314chr1063156 2966 2544 2259 660 277 --1419 11155
NM_000332chr696465 5551 5467 2450 2131 1390 901 682 62 11122 46930 6445 6044 4635 --
NM_000337chr565059 2621 1670 1422 1184 493 --22592 2263 --
NM_000338chr152766 67 ------
NM_000345chr42784 171 ------
NM_000346chr1732024 797 457 11851 ----
NM_000362chr221118 ------
NM_000368chr974885 4459 4453 4424 852 594 429 --13955 --
NM_000388chr311251 --1218 --
NM_000389chr631455 473 230 --21309 1153 --
NM_000390chrX52287 2144 1276 1032 297 ------
NM_000393chr221693 644 --11426 --
NM_000396chr11234 --2531 67 --
NM_000397chrX1200 22336 2322 ----
NM_000399chr10--1771 1463 --
NM_000401chr111928 11132 ----
NM_000408chr273251 3005 2254 1329 1295 1138 1013 1827 1177 13147
NM_000411chr2152409 2317 2188 1185 958 ------
NM_000430chr1763465 2797 2476 1073 906 46 13237 12875 --
NM_000435chr194978 859 802 661 ------
NM_000439chr52653 302 ------
NM_000441chr752009 1887 1668 411 60 ----1468
NM_000444chrX2332 59 --1113 --
NM_000448chr1162763 2629 2545 2439 2021 57 --13056 1581
NM_000461chr374296 3868 3774 3523 3173 2884 172 --23040 187 13997
NM_000462chr1531642 1336 1231 ------
NM_000474chr73632 265 188 ------
NM_000480chr1151177 1140 576 234 144 11290 21059 22 --
NM_000484chr212715 247 ------
NM_000489chrX1904 --21088 1013 1451
NM_000492chr721499 227 1962 11010 --
NM_000493chr62935 380 ------
NM_000494chr102824 809 155 ----
NM_000503chr871903 1775 1402 1395 1296 635 323 --11240 --
NM_000509chr4----1177 --
NM_000522chr731076 908 130 ------
NM_000527chr1961976 1848 1634 1512 877 859 --22168 820 --
NM_000533chrX21571 345 ------
NM_000538chr13--11238 2160 137 --
NM_000555chrX77469 7110 2677 2325 1785 1205 63 1374 36665 5650 2518 --
NM_000560chr11690 ------
NM_000565chr152277 1435 728 704 673 ------
NM_000572chr12856 645 ------
NM_000578chr22253 233 --11264 --
NM_000596chr71201 ------
NM_000599chr274640 4487 3870 3825 1143 1043 666 14621 11436 14495
NM_000609chr1023155 881 --1252 23129 2195
NM_000610chr111469 13023 1682 12786
NM_000612chr1133512 2432 2378 ------
NM_000615chr1123004 64 --22887 1955 --
NM_000618chr1285916 4080 2630 2122 1587 1402 599 339 14198 31618 625 426 --
NM_000618chr1285916 4080 2630 2122 1587 1402 599 339 14198 31618 625 426 --
NM_000624chr141868 ------
NM_000627chr22599 39 1336 ----
NM_000681chr1021305 867 --11267 --
NM_000686chrX1431 --1528 --
NM_000701chr1----174 --
NM_000702chr142253 2095 2015 1860 --12232 1889
NM_000719chr1255263 5092 2030 1544 1508 --36668 1378 1065 --
NM_000722chr71284 ------
NM_000723chr1721342 400 --1305 --
NM_000724chr1031775 551 538 ------
NM_000726chr211285 1290 ----
NM_000739chr7----197 --
NM_000756chr8------134
NM_000767chr1931488 1177 367 ------
NM_000782chr203467 374 198 ------
NM_000794chr51660 ------
NM_000800chr521236 94 1530 --11521
NM_000806chr52591 38 ------
NM_000808chrX2815 298 ------
NM_000813chr565222 4760 3602 3472 1903 1343 1640 ----
NM_000814chr1533851 3393 1588 ------
NM_000816chr5----1185 --
NM_000817chr21902 --1822 --
NM_000824chr41623 --1108 --
NM_000826chr432535 1755 1667 --32413 1886 1856 11950
NM_000827chr53902 328 244 1655 ----
NM_000828chrX41595 1442 579 516 --12063 --
NM_000829chr1132219 2064 1917 12190 1785 11513
NM_000833chr1641368 1056 482 307 ------
NM_000834chr12--11147 ----
NM_000838chr612433 --22183 672 --
NM_000844chr31990 --2404 350 --
NM_000866chr331867 1331 710 ------
NM_000868chrX22053 348 12251 1143 11905
NM_000875chr1576496 5347 4278 2217 1816 1376 280 --36745 5663 4860 --
NM_000876chr62367 305 --11077 --
NM_000877chr263111 2960 2783 474 263 184 --11024 13081
NM_000880chr82253 137 ------
NM_000885chr211514 --1850 --
NM_000891chr1743640 3246 1379 1046 --22822 492 --
NM_000899chr1254422 4011 3823 2820 1758 --24317 3012 --
NM_000901chr422006 1757 1230 ----
NM_000902chr31101 13092 11175 --
NM_000905chr71170 ------
NM_000912chr823518 2343 --33496 2702 504 --
NM_000917chr102609 35 ------
NM_000919chr51102 ------
NM_000921chr121138 --1121 --
NM_000924chr1221290 945 --21224 193 --
NM_000933chr202403 376 --1172 --
NM_000935chr31909 ----1879
NM_000944chr421503 327 --52053 1938 1914 1477 847 --
NM_000945chr22564 198 ----1809
NM_000950chrX43334 2587 1319 64 ----23243 459
NM_000956chr1441080 251 223 169 --1346 --
NM_000958chr52870 146 11141 ----
NM_000962chr962414 2104 923 571 550 369 ------
NM_000965chr3----11199 --
NM_001001323chr1232171 878 319 --12917 --
NM_001001344chrX62168 1803 966 743 726 151 ------
NM_001001349chr1731712 1214 636 ----1456
NM_001001389chr111469 13023 1682 12786
NM_001001390chr111469 13023 1682 12786
NM_001001391chr111469 13023 1682 12786
NM_001001392chr111515 13069 1728 12832
NM_001001394chr21567 ----1718
NM_001001395chr122692 564 12492 --1383
NM_001001396chr124482 3769 13787 24279 3236 --
NM_001001419chr5115045 4819 4164 4081 3687 2004 1540 1331 1189 834 537 11667 33609 853 417 --
NM_001001420chr5115045 4819 4164 4081 3687 2004 1540 1331 1189 834 537 11667 33609 853 417 --
NM_001001433chr2043115 2509 2316 716 --22488 722 --
NM_001001481chr842556 526 151 56 12484 22624 136 12436
NM_001001484chr1042399 1930 1724 316 --11632 --
NM_001001521chr2185 ------
NM_001001549chr73915 659 402 --11786 12582
NM_001001550chr73915 659 402 --11786 12582
NM_001001555chr73915 659 402 --11786 12582
NM_001001556chr1521162 377 141 11452 --
NM_001001664chr263890 3616 1412 1244 442 303 --34108 844 143 --
NM_001001668chr1973872 3398 3264 3168 3122 865 595 --13352 --
NM_001001740chr1----127 --
NM_001001740chr1----127 --
NM_001001872chr142578 155 --2586 482 --
NM_001001890chr2114127 --1532 1827
NM_001001924chr82510 37 1265 11400 --
NM_001001925chr82510 37 1265 11400 --
NM_001001928chr2295765 5425 2725 2185 1974 834 625 421 176 --13004 --
NM_001001931chr82510 37 1265 11400 --
NM_001001933chr11112 ------
NM_001001971chr101106 ------
NM_001001974chr101126 --12272 --
NM_001001995chrX11909 ------
NM_001002026chr332453 1535 872 ------
NM_001002033chr173301 120 112 --1806 --
NM_001002233chr842042 1718 1610 822 ------
NM_001002243chr21378 ------
NM_001002255chr6160 ------
NM_001002257chr243418 1432 1395 545 --177 33063 2215 140
NM_001002259chr12------1251
NM_001002295chr10----164 --
NM_001002296chr81262 --11351 --
NM_001002838chrX----21853 1481 --
NM_001002843chr15144 --1427 --
NM_001002857chr151307 --1292 --
NM_001002858chr151307 --1292 --
NM_001002860chr1484701 4473 3463 2869 859 421 261 237 31649 1605 1458 44315 1815 392 300 --
NM_001002909chr1742129 1749 808 404 11396 ----
NM_001003652chr18148339 7738 7679 6600 6255 5518 3097 2556 1902 1588 1129 807 392 118 16091 18037 --
NM_001003674chr1844632 1448 868 585 16732 14904 25952 941
NM_001003675chr1844632 1448 868 585 16732 14904 25952 941
NM_001003681chr2211415 ----12124
NM_001003688chr431166 1099 352 --150 --
NM_001003712chr1283167 2699 2663 2524 1031 862 749 299 --12501 13652
NM_001003760chr663669 2866 2848 2393 2250 1268 --1802 --
NM_001003792chr31861 --1103 --
NM_001003793chr31861 --1103 --
NM_001003800chr943505 3361 2466 1170 --31474 827 485 --
NM_001003891chr222872 331 ------
NM_001003940chr1523694 3258 11270 ----
NM_001003942chr1523694 3258 11270 ----
NM_001003943chr1523698 3262 11274 ----
NM_001004023chr11207 ------
NM_001004065chr953320 1362 903 472 75 12765 12498 --
NM_001004308chrX2221 64 --11479 --
NM_001004317chr644548 4013 3787 3277 11172 ----
NM_001004346chr411209 --1163 --
NM_001004360chr22255 150 --11498 --
NM_001004419chr1234483 3085 3078 1929 24444 3281 --
NM_001004439chr1531087 831 302 --1118 --
NM_001004720chr21269 --1947 --
NM_001004722chr23438 72 58 --11116 --
NM_001005242chr1231573 1249 329 ----21585 1411
NM_001005335chr191291 ------
NM_001005354chr122444 75 ------
NM_001005360chr191810 --1231 --
NM_001005361chr191810 --1231 --
NM_001005362chr191810 --1231 --
NM_001005366chr122654 41 ----2842 690
NM_001005386chr252036 666 483 472 453 21958 265 --12106
NM_001005404chr1754474 4368 3580 3208 537 --33367 3247 3042 --
NM_001005463chr1052510 2096 1991 793 413 ------
NM_001005473chr545695 4215 4200 741 11870 11556 --
NM_001005474chr3--11485 ----
NM_001005476chr2----1625 --
NM_001005526chr21119 ------
NM_001005609chrX53380 1247 721 365 319 ------
NM_001005611chrX2457 435 ------
NM_001005619chr17------1241
NM_001005732chr212606 248 ------
NM_001005733chr211563 ------
NM_001005746chr211285 1290 ----
NM_001005747chr211285 1290 ----
NM_001005751chr101152 --1136 --
NM_001005781chr21118 --1244 --
NM_001005782chr2----2693 271 --
NM_001005845chr821290 654 ------
NM_001005849chr17----1196 --
NM_001005909chr3123 ------
NM_001005914chr31404 ------
NM_001005920chr16----1771 --
NM_001006600chr552292 2285 1779 1716 872 --31747 1535 819 1695
NM_001006612chrX160 ------
NM_001006613chrX160 ------
NM_001006614chrX160 ------
NM_001006617chr921160 410 --1593 --
NM_001006618chr91218 1206 ----
NM_001006619chr921160 410 --1593 --
NM_001006620chr921160 410 --1593 --
NM_001006621chr921160 410 --1593 --
NM_001006626chr7----197 --
NM_001006627chr7----197 --
NM_001006628chr7----197 --
NM_001006629chr7----197 --
NM_001006630chr7----197 --
NM_001006631chr7----197 --
NM_001006632chr7----197 --
NM_001006635chr2------1248
NM_001006636chr21371 ----1706
NM_001006657chr242981 941 624 532 --12334 --
NM_001006684chrX155 --1434 --
NM_001007024chr1754024 3293 2944 1492 506 13211 24376 4290 14348
NM_001007025chr1754024 3293 2944 1492 506 13211 24376 4290 14348
NM_001007075chr441101 716 265 95 ------
NM_001007097chr964882 3857 1747 1395 957 156 --25077 319 --
NM_001007099chr11219 ----1790
NM_001007100chr11219 ----1790
NM_001007102chr61335 --51647 1507 1329 1285 1223 --
NM_001007189chr5123 ------
NM_001007226chr1731096 298 127 1579 ----
NM_001007227chr1731096 298 127 1579 ----
NM_001007228chr1731096 298 127 1579 ----
NM_001007229chr1731096 298 127 1579 ----
NM_001007230chr1731096 298 127 1579 ----
NM_001007246chr2131819 1437 179 --11308 1127
NM_001007257chr121098 422 1499 11517 --
NM_001007277chr111382 ------
NM_001007466chr6125092 4894 4780 4726 4444 3994 1959 1087 633 577 463 328 --24711 1691 14015
NM_001007471chr91178 ------
NM_001007553chr11427 --1359 1271
NM_001007559chr1811301 --22043 1791 --
NM_001007565chr32352 112 ------
NM_001007595chr152285 226 ------
NM_001008220chr523679 1057 --1907 --
NM_001008222chrX21191 149 --1872 --
NM_001008225chr72686 550 --2598 590 --
NM_001008239chr1873309 2952 1263 887 716 110 28 --23562 2386 1491
NM_001008388chr41113 --21033 421 --
NM_001008392chr363341 3293 3081 2923 2241 33 --22946 216 --
NM_001008405chr711498 --11457 --
NM_001008408chr766340 5050 4812 4590 4392 1621 24478 2480 --1411
NM_001008495chr832275 2194 1956 12040 1243 --
NM_001008529chr1721291 1041 ------
NM_001008541chr1042206 2130 889 676 ------
NM_001008541chr1042206 2130 889 676 ------
NM_001008564chr1342091 1908 751 544 --12145 --
NM_001008660chr1131273 1155 431 --11396 --
NM_001008701chr1922295 511 ----13014
NM_001008738chr522139 247 --12105 172
NM_001008801chr1921362 1327 --12115 --
NM_001008860chr151274 --2756 343 --
NM_001008892chr151274 --2756 343 --
NM_001008894chr151274 --2756 343 --
NM_001008895chr1311078 2450 220 1389 --
NM_001008897chr61171 --1135 --
NM_001009552chr81588 1173 ----
NM_001009555chr42543 78 ------
NM_001009567chr101108 ----1654
NM_001009571chr72546 321 ----41688 1293 1230 493
NM_001009881chr11622 ------
NM_001009882chr11622 ------
NM_001009899chr376554 6403 5076 4145 1502 913 305 34425 2614 1041 46547 5230 765 214 --
NM_001009960chr721920 87 --12834 --
NM_001009993chr274392 4334 3416 3008 1794 1332 413 12926 13754 --
NM_001010000chr1823326 3105 --13528 --
NM_001010844chr6----126 --
NM_001010861chr12990 29 1215 1979 --
NM_001010888chrX54673 4526 3637 3189 293 1132 21749 97 --
NM_001010891chr556099 5611 2455 797 344 --35794 5013 187 --
NM_001010895chr941968 1668 1380 386 --1727 --
NM_001010908chr101509 ------
NM_001010917chr1032240 611 70 ------
NM_001010924chr1031206 1172 131 ------
NM_001010927chr61538 ------
NM_001010942chr1241269 1080 518 313 ------
NM_001010971chr12896 623 ------
NM_001010983chr3129 ------
NM_001010984chr121700 485 1974 ----
NM_001010986chrX--1136 --1911
NM_001010989chr161415 ------
NM_001010990chr161415 ------
NM_001011513chr484148 3835 2989 2922 1381 1173 770 559 33395 3022 195 33061 2700 1307 11643
NM_001011515chr41878 --21056 1003 --
NM_001011516chr41878 --21056 1003 --
NM_001011537chr331974 1469 820 --12304 --
NM_001011546chr20--1336 ----
NM_001011553chr7----1957 3935 807 196
NM_001011666chr766322 4481 2498 1252 1057 70 26414 2601 26558 4682 --
NM_001011708chr232394 1863 996 12492 12529 --
NM_001011713chr1411089 --1156 --
NM_001011885chr1531731 735 159 ------
NM_001012264chr141720 ------
NM_001012337chr3----149 --
NM_001012393chr1184755 4720 4547 4221 3961 1650 1622 716 --23239 1316 14076
NM_001012398chr163421 296 182 --130 --
NM_001012410chr32317 47 ------
NM_001012506chr3----1154 --
NM_001012507chr6137 ------
NM_001012514chr21889 --194 --
NM_001012516chr21889 --194 --
NM_001012642chr1542091 1746 663 391 --11936 12055
NM_001012751chr1021404 655 1542 21520 1246 1232
NM_001012755chrX25054 1508 --11627 14173
NM_001012761chr51270 ------
NM_001012968chrX62754 2731 2274 861 606 556 --22389 176 --
NM_001012977chrX2944 311 ------
NM_001012979chrX170 ------
NM_001012989chrX------171
NM_001013031chr1043487 2710 2340 541 --23508 1174 --
NM_001013399chr62978 721 ------
NM_001013406chr721511 123 --11119 1450
NM_001013438chr31260 ------
NM_001013439chr31106 ------
NM_001013690chr122391 205 --11786 --
NM_001013699chr12124 --198 2513 105
NM_001013843chr152762 376 --1746 --
NM_001014431chr141774 --2656 98 --
NM_001014432chr141774 --2656 98 --
NM_001014797chr1087836 7224 5146 5084 2632 2137 695 374 16738 57939 5443 3182 2417 1302 --
NM_001014809chr43993 661 602 ------
NM_001014812chr151444 ------
NM_001015045chr431004 490 206 1970 11825 1803
NM_001015508chr82491 91 ------
NM_001015877chrX42978 2746 2005 1117 32543 2219 334 22826 1169 --
NM_001015887chr311354 21829 283 21839 1228 --
NM_001015892chr5151 ------
NM_001017369chr41916 --11091 --
NM_001017371chr21209 ----11054
NM_001017395chr353648 2949 2919 714 331 12589 13193 --
NM_001017396chr231873 785 414 1487 1298 --
NM_001017405chr41243 --1179 --
NM_001017415chr11209 1269 ----
NM_001017416chr11209 1269 ----
NM_001017424chr131780 174 79 ------
NM_001017425chr131780 174 79 ------
NM_001017440chr7107098 6681 5697 5254 4982 3172 2572 2312 710 672 --36342 1433 167 --
NM_001017523chr1221720 751 ------
NM_001017923chr141463 --11569 --
NM_001017926chr821496 527 --11147 --
NM_001017930chrX31301 1189 958 ------
NM_001017962chr102609 35 ------
NM_001017969chr92518 456 ------
NM_001017977chr1--124 ----
NM_001017999chr13745 454 114 ------
NM_001017999chr13745 454 114 ------
NM_001018000chr13745 454 114 ------
NM_001018000chr13745 454 114 ------
NM_001018001chr13745 454 114 ------
NM_001018053chr121619 1513 1304 31898 695 369 --
NM_001018056chr91391 --1146 --
NM_001018057chr113973 574 513 11036 1152 11329
NM_001018064chr931559 1485 333 --1163 --
NM_001018065chr986013 5901 5752 5733 4742 4355 4314 1371 --31497 1383 715 11555
NM_001018066chr986013 5901 5752 5733 4742 4355 4314 1371 --31497 1383 715 11555
NM_001018067chr175172 4697 4211 2031 1698 635 259 --1301 --
NM_001018068chr175172 4697 4211 2031 1698 635 259 --1301 --
NM_001018069chr175172 4697 4211 2031 1698 635 259 --1301 --
NM_001018072chr1221720 751 ------
NM_001018074chr51430 22921 703 12593 --
NM_001018075chr51430 22921 703 12593 --
NM_001018076chr51430 22921 703 12593 --
NM_001018077chr51430 22921 703 12593 --
NM_001020658chr121058 202 1528 11445 --
NM_001020658chr121058 202 1528 11445 --
NM_001020825chr5--1396 168 --
NM_001023567chr1561768 893 797 722 494 218 --11582 --
NM_001023587chr311141 ------
NM_001024071chr143859 648 110 ------
NM_001024094chr51430 22921 703 12593 --
NM_001024226chr1----1408 --
NM_001024227chr1----1408 --
NM_001024228chr1----1408 --
NM_001024455chrX52644 2152 1693 693 241 ------
NM_001024457chr21560 1275 11312 --
NM_001024647chr1296366 5379 5169 4971 2970 2122 1278 809 215 26211 319 26239 4671 15106
NM_001024649chr532866 2857 737 1746 21865 927 --
NM_001024660chr331339 684 642 --11241 --
NM_001024680chr231801 1590 1335 --21276 164 --
NM_001024688chr812160 ------
NM_001024808chr1222296 817 12600 --11821
NM_001024847chr362447 2366 1591 608 473 224 12430 2573 273 1918
NM_001024947chr53972 815 428 ------
NM_001024948chr142643 1209 954 181 1790 23351 2552 --
NM_001024956chr1165196 5188 4810 3762 1422 855 14041 25019 339 --
NM_001025068chr31719 11484 1183 2541 247
NM_001025069chr31719 11484 1183 2541 247
NM_001025076chr1045778 4622 1104 262 15532 36021 2469 2382 --
NM_001025077chr1067136 5980 2462 1620 1315 856 26890 530 37379 4806 4722 14799
NM_001025079chr373912 3523 3062 2608 1549 1225 676 ------
NM_001025100chr1853998 3849 2688 2634 1395 12805 43648 3323 3079 1300 11556
NM_001025105chr52441 50 --21375 254 --
NM_001025108chr263600 3557 3521 3381 921 675 195 1873 --
NM_001025201chr23628 540 82 ------
NM_001025252chr833221 1024 75 12746 ----
NM_001025253chr833221 1024 75 12746 ----
NM_001025356chr1253014 2786 1885 794 25 --32986 2944 2158 --
NM_001025366chr621895 182 11233 ----
NM_001025366chr621895 182 11233 ----
NM_001025367chr621895 182 11233 ----
NM_001025367chr621895 182 11233 ----
NM_001025368chr621895 182 11233 ----
NM_001025368chr621895 182 11233 ----
NM_001025369chr621911 198 11249 ----
NM_001025369chr621911 198 11249 ----
NM_001025370chr621895 182 11233 ----
NM_001025370chr621895 182 11233 ----
NM_001025389chr1151177 1140 576 234 144 11290 21059 22 --
NM_001025390chr1151177 1140 576 234 144 11290 21059 22 --
NM_001025579chr171426 --1327 1994
NM_001025580chrX64170 3804 3046 2867 1264 182 --12608 --
NM_001025595chr421573 298 11406 11046 --
NM_001025616chr421814 1521 ----1358
NM_001025780chr9150 ------
NM_001029858chr662977 2964 2554 1132 355 243 --12256 --
NM_001029860chr8----2294 259 --
NM_001029863chr622675 482 --182 --
NM_001029875chr522993 533 --1998 --
NM_001029882chr11479 ------
NM_001029882chr11479 ------
NM_001029884chr652613 2210 949 924 181 --22578 2153 --
NM_001029989chr153301 249 190 184 ----
NM_001029998chr42910 520 --177 --
NM_001030006chr1721807 1642 --1400 --
NM_001030007chr16103991 3971 3161 3010 2619 1471 593 472 253 227 --43654 2703 2697 1196 --
NM_001030055chr1434668 4184 1131 13674 24300 1507 --
NM_001030272chr113466 107 45 ------
NM_001030273chr113466 107 45 ------
NM_001030287chr111118 1435 ----
NM_001031623chr61357 --11279 --
NM_001031679chr1243162 1097 919 709 ----23318 34
NM_001031680chr172544 2480 2415 2283 2081 1585 102 --1755 1480
NM_001031681chr1752175 1544 810 47 29 --22246 597 --
NM_001031684chr2----21459 1279 --
NM_001031695chr2254392 4141 3724 1559 1183 13523 54840 3930 1190 284 234 --
NM_001031700chr422359 1643 --32349 1970 44 2915 792
NM_001031702chr32305 97 ------
NM_001031711chr51525 --21696 1523 --
NM_001031716chr2--1218 164 --
NM_001031740chr131657 1446 313 ------
NM_001031804chr1683999 3857 3249 2729 2705 1601 1213 889 ----14301
NM_001031812chr522123 504 1725 32247 1604 1563 11544
NM_001032221chr961811 1802 1471 1429 190 137 ------
NM_001032279chr111396 ------
NM_001032280chr621656 1283 --1429 --
NM_001032288chr2011400 ------
NM_001032293chr172549 442 ------
NM_001032296chr1362790 2749 2674 2383 2219 1090 ------
NM_001032363chr132248 2039 1784 --1144 --
NM_001032363chr132248 2039 1784 --1144 --
NM_001032380chr1031355 815 220 11579 11547 1146
NM_001032393chrX2749 207 ------
NM_001032999chr2055307 5222 4966 1966 1819 --1171 --
NM_001033045chr2104260 3880 3410 3302 3092 1307 1226 924 594 381 --11461 --
NM_001033047chr442541 2170 1857 1618 ------
NM_001033049chr212744 247 --11972 --
NM_001033057chr341828 1819 1378 659 --21407 141 --
NM_001033059chr61163 ----1630
NM_001033081chr12163 130 ------
NM_001033082chr12163 130 ------
NM_001033087chr20--13190 22873 147 1856
NM_001033112chr51110 ------
NM_001033117chr353225 1890 1266 1181 840 11678 14548 --
NM_001033503chr5----1362 --
NM_001033506chr11----1412 --
NM_001033518chr731753 1140 65 --11865 --
NM_001033519chr731753 1140 65 --11865 --
NM_001033520chr731753 1140 65 --11865 --
NM_001033551chr1763575 3515 1387 843 538 478 ----13862
NM_001033557chr2173 ------
NM_001033561chr172213 196 ------
NM_001033566chr171990 ------
NM_001033568chr171990 ------
NM_001033578chr862300 2067 1783 840 630 171 --11510 --
NM_001033602chr1332522 2217 339 1175 1492 --
NM_001033723chr842494 1941 1707 431 --22566 1103 --
NM_001033756chr621829 116 11167 ----
NM_001033756chr621829 116 11167 ----
NM_001034841chr1663787 2152 2059 1891 1745 678 --25489 1564 --
NM_001034845chr42445 297 ------
NM_001034852chr143842 749 548 --1132 --
NM_001034954chr1042366 2169 958 599 --12830 1829
NM_001034955chr1042366 2169 958 599 --12830 1829
NM_001034956chr1042366 2169 958 599 --12830 1829
NM_001034957chr1042366 2169 958 599 --12830 1829
NM_001035260chr1021401 656 1235 11309 --
NM_001035521chr21522 ------
NM_001037131chr221136 930 ------
NM_001037132chr741617 871 748 55 --1740 --
NM_001037133chr741617 871 748 55 --1740 --
NM_001037164chr721555 785 --21906 1402 --
NM_001037165chr788937 8034 7827 6519 2909 2583 2561 1607 --11246 --
NM_001037172chr331081 305 229 --11390 --
NM_001037174chr242177 2041 1775 624 --12185 --
NM_001037317chr12990 29 1215 1979 --
NM_001037334chr1832383 637 254 ------
NM_001037339chr141852 1766 701 302 ------
NM_001037340chr141852 1766 701 302 ------
NM_001037341chr141852 1766 701 302 ------
NM_001037341chr141852 1766 701 302 ------
NM_001037535chrX----11386 --
NM_001037536chrX----11386 --
NM_001037540chrX----11386 --
NM_001037553chr2144905 4103 3474 1865 --11369 --
NM_001037582chr411602 --11318 --
NM_001037631chr21195 --1136 --
NM_001037954chr1183093 2910 2695 2431 963 928 706 428 23207 181 ----
NM_001038493chr21588 --1966 --
NM_001038640chr152789 286 1961 ----
NM_001039199chr2064464 3710 1706 1502 1293 597 --44980 4939 3340 1698 11865
NM_001039348chr21918 2160 30 ----
NM_001039349chr21918 2160 30 ----
NM_001039479chr1452259 1923 639 624 436 ------
NM_001039538chr243610 3045 1477 609 --2663 290 --
NM_001039547chr3127712 7620 7534 7410 6691 6670 6403 5724 5513 2297 2091 1955 --23219 1461 --
NM_001039570chr2264640 3314 3107 1597 1387 1005 13919 --1212
NM_001039571chr2264640 3314 3107 1597 1387 1005 13919 --1212
NM_001039574chr11655 --1816 --
NM_001039577chr174325 4143 3884 1506 1115 625 31 11524 --13464
NM_001039580chr454415 3359 1033 637 167 --34444 600 489 13858
NM_001039590chrX33832 1077 354 --13962 12497
NM_001039591chrX33832 1077 354 --13962 12497
NM_001039618chr1165648 5094 4530 3911 3785 2249 --11700 --
NM_001039675chr151231 ------
NM_001039690chr1612372 ------
NM_001039709chr2055307 5222 4966 1966 1819 --1171 --
NM_001039711chr12953 340 --1966 --
NM_001039712chr12953 340 --1966 --
NM_001039802chr131391 1343 136 ------
NM_001039840chrX35887 2197 200 14417 24796 504 1944
NM_001039888chr1----1320 --
NM_001039916chr1221052 965 ------
NM_001039917chr1221052 965 ------
NM_001039918chr1221052 965 ------
NM_001039919chr1221052 965 ------
NM_001039920chr1221052 965 ------
NM_001039937chr1384055 3474 3432 3305 688 494 97 79 --33986 3975 2578 23687 1472
NM_001039938chr1321489 192 --11160 --
NM_001040001chr611885 ------
NM_001040020chr721256 34 21228 639 ----
NM_001040033chr11690 ------
NM_001040092chr81318 ------
NM_001040097chr71154 ------
NM_001040098chr71154 ------
NM_001040099chr71154 ------
NM_001040101chr42485 435 --2330 190 --
NM_001040110chr72428 209 --1161 --
NM_001040113chr161939 ----1252
NM_001040142chr221680 1664 ------
NM_001040143chr221680 1664 ------
NM_001040144chr1612372 ------
NM_001040146chr1612372 ------
NM_001040152chr765115 4636 4576 3869 3697 3147 14740 13367 --
NM_001040153chr132916 127 --1866 2760 170
NM_001040157chr442669 574 430 142 ------
NM_001040159chr4--11182 21485 443 --
NM_001040202chr41521 12155 ----
NM_001040214chr62945 423 --32386 2324 70 --
NM_001040272chr922337 816 --11566 --
NM_001040273chr1022043 1999 ------
NM_003498chr1662521 972 426 255 143 77 --12107 --
NM_003505chr721549 546 11715 ----
NM_003506chr861244 1189 484 315 112 62 ----1102
NM_003507chr21633 --11555 --
NM_003563chr1731096 298 127 1579 ----
NM_003566chr121532 13407 12872 161
NM_003574chr1865432 4037 2274 2261 1369 700 15443 13839 23546 1221
NM_003576chr1362790 2749 2674 2383 2219 1090 ------
NM_003580chr8----149 --
NM_003581chr21269 --1947 --
NM_003582chr11207 ------
NM_003583chr1243706 3204 3184 1268 53272 2453 1573 313 130 12853 1838
NM_003589chr1311078 2450 220 1389 --
NM_003590chr283587 3085 2673 1575 992 758 392 38 ----23837 563
NM_003592chr72343 325 ------
NM_003597chr21772 11443 12152 --
NM_003601chr4173 ------
NM_003603chr4--11682 3678 525 438 --
NM_003607chr133379 3057 1408 --23891 3822 1245
NM_003613chr152654 94 --1268 --
NM_003615chr3--13012 22647 2484 --
NM_003617chr154949 3261 3184 2000 1151 24879 4633 41891 1613 1081 61 --
NM_003618chr2----1301 --
NM_003620chr1711103 --1155 --
NM_003622chr12----1972 1266
NM_003626chr1141395 470 330 51 ----1387
NM_003628chr2----1625 --
NM_003629chr12207 36 ------
NM_003633chr552190 1865 1770 1723 352 --12515 --
NM_003644chr1786595 6515 6018 5996 5015 2383 2166 520 12577 ----
NM_003659chr211199 ------
NM_003670chr341134 1084 421 95 ------
NM_003671chr933329 2962 456 --13025 --
NM_003672chr121381 195 ------
NM_003677chr1242296 2054 796 293 ------
NM_003679chr1----42972 2453 408 177 --
NM_003702chr81805 ----1246
NM_003705chr21715 ----1278
NM_003713chr11459 ------
NM_003714chr533084 2481 638 ----22040 216
NM_003716chr32329 318 --1902 --
NM_003718chr7----1512 --
NM_003722chr322671 2215 ----22014 430
NM_003725chr121418 ------
NM_003735chr521678 627 ------
NM_003736chr521678 627 ------
NM_003743chr222063 120 ------
NM_003749chr1342387 1513 860 526 ------
NM_003750chr103758 675 226 ------
NM_003758chr151616 ------
NM_003758chr151616 ------
NM_003759chr434023 3409 689 14284 ----
NM_003762chr131327 354 346 --1947 --
NM_003763chr2043115 2509 2316 716 --22488 722 --
NM_003768chr131149 654 507 --1364 --
NM_003772chr111332 ------
NM_003774chr1262992 2201 801 768 660 575 22494 1076 1781 12288
NM_003783chr12908 803 --11209 --
NM_003787chr1841307 1237 1197 193 --11449 --
NM_003796chr192559 442 ------
NM_003797chr111164 ------
NM_003799chr1874446 3994 3985 3126 907 431 390 1975 33014 1557 561 --
NM_003800chr63628 535 173 --12018 --
NM_003829chr921204 64 --1203 --
NM_003831chr1811198 11735 ----
NM_003850chr13------1153
NM_003858chr141268 --1586 --
NM_003861chr1432658 759 552 32098 684 629 1406 1347
NM_003872chr212723 1612 22396 1159 --
NM_003873chr1042140 766 615 442 --1466 --
NM_003884chr331838 1704 125 ------
NM_003885chr1752700 2677 2207 2027 166 --141 --
NM_003887chr232043 343 320 --31436 700 546 21672 210
NM_003895chr2141526 1489 104 29 1256 1499 11496
NM_003901chr1062660 2584 2568 2201 2095 1987 22044 1801 ----
NM_003902chr12700 652 --1295 --
NM_003906chr21186 ------
NM_003909chr831204 569 82 22310 99 11091 12451
NM_003913chr684265 3738 3674 3203 1294 966 756 730 --14305 --
NM_003916chrX2413 35 11104 11435 --
NM_003919chr71191 ----1183
NM_003921chr121587 246 --31493 346 203 --
NM_003922chr15----1283 --
NM_003932chr2241411 765 566 165 1691 41826 1762 1536 457 --
NM_003934chr911139 --21102 507 --
NM_003938chr192362 91 ------
NM_003941chr752526 2264 1018 994 914 --1927 12348
NM_003947chr311310 --21272 301 --
NM_003953chr122729 121 1421 1261 --
NM_003958chr673943 2873 2608 2567 757 235 22 11409 23067 2674 --
NM_003966chr5107598 7420 7358 5710 5406 5349 3007 2474 1282 385 26717 1370 36677 4800 116 17794
NM_003968chr32679 189 ------
NM_003971chr171120 ------
NM_003972chr102345 179 11298 ----
NM_003980chr61277 --11100 --
NM_003983chr1674012 3168 2883 1471 1280 1214 785 ------
NM_003987chr1011465 ------
NM_003988chr1011542 ------
NM_003989chr1011401 ------
NM_003990chr1011401 ------
NM_003994chr1254422 4011 3823 2820 1758 --24317 3012 --
NM_003998chr4----1594 --
NM_004004chr1341331 323 293 91 ------
NM_004006chrX1358 --32597 2375 2129 --
NM_004007chrX1358 --32597 2375 2129 --
NM_004009chrX1358 --32597 2375 2129 --
NM_004010chrX1358 --32597 2375 2129 --
NM_004011chrX1358 --32597 2375 2129 --
NM_004012chrX1358 --32597 2375 2129 --
NM_004013chrX1358 --32597 2375 2129 --
NM_004014chrX1358 --32597 2375 2129 --
NM_004015chrX1358 --32597 2375 2129 --
NM_004016chrX1272 --32511 2289 2043 --
NM_004017chrX1358 --32597 2375 2129 --
NM_004018chrX1272 --32511 2289 2043 --
NM_004020chrX1358 --32597 2375 2129 --
NM_004021chrX1272 --32511 2289 2043 --
NM_004022chrX1272 --32511 2289 2043 --
NM_004023chrX1272 --32511 2289 2043 --
NM_004028chr1824124 2897 ------
NM_004034chr10----1425 --
NM_004035chr1775029 4641 3727 3497 3170 1741 597 ----1574
NM_004039chr151307 --1292 --
NM_004040chr221238 894 ------
NM_004050chr1421924 769 --1777 --
NM_004061chr5----1238 --
NM_004063chr8187 ------
NM_004067chr72485 352 --11470 --
NM_004074chr11----173 --
NM_004075chr121431 ------
NM_004078chr1--1753 140 --
NM_004080chr731495 1316 252 ------
NM_004085chrX1801 ------
NM_004093chr1342991 2388 2112 830 11170 1412 --
NM_004094chr1472995 2925 1967 638 460 208 46 11909 23001 805 --
NM_004097chr2----1301 --
NM_004098chr102888 357 --1505 --
NM_004100chr632147 674 442 12132 ----
NM_004105chr21918 2160 30 ----
NM_004109chr1122191 732 ------
NM_004114chrX31125 495 217 ------
NM_004117chr61867 --32207 1437 498 --
NM_004124chr1453574 2719 970 249 90 --11389 12880
NM_004136chr1522756 370 --22830 964 --
NM_004156chr81588 1173 ----
NM_004161chr231332 96 81 ----1605
NM_004162chr351168 975 907 888 834 172 ----
NM_004170chr92610 163 --21395 758 11439
NM_004177chr11125 --1324 --
NM_004185chr11287 ------
NM_004200chr112549 221 ------
NM_004208chrX169 ------
NM_004209chr161931 ------
NM_004226chr2----1108 --
NM_004229chrX42082 2037 1934 1887 --21871 149 --
NM_004232chr1843757 2880 861 331 --22847 28 --
NM_004235chr92661 636 ------
NM_004236chr15----1459 1168
NM_004247chr17----156 --
NM_004249chr41106 ------
NM_004261chr1----2817 220 --
NM_004267chr3----1169 --
NM_004272chr521447 487 --11259 --
NM_004274chr143615 418 208 ------
NM_004277chr671637 1457 1390 1223 363 243 140 --1574 --
NM_004279chr72329 321 ------
NM_004280chr6157 ------
NM_004281chr10----168 --
NM_004293chr922353 170 --32972 781 592 1577
NM_004296chr1423101 438 ------
NM_004302chr1252797 2291 2101 472 331 21797 648 ----
NM_004311chr1032995 421 304 ------
NM_004323chr952274 1978 972 829 216 12503 ----
NM_004326chr11413 185 ----
NM_004330chr153970 170 63 11150 1283 176
NM_004331chr862634 2610 2017 1706 1032 175 ------
NM_004337chr831909 709 71 2823 601 21569 488 --
NM_004338chr1844632 1448 868 585 16732 14904 25952 941
NM_004342chr71536 --21941 415 --
NM_004346chr421421 113 --1493 --
NM_004349chr821160 128 ------
NM_004350chr172544 2480 2415 2283 2081 1585 102 --1755 1480
NM_004354chr43823 227 212 ----1739
NM_004360chr1611511 --12008 --
NM_004370chr622196 734 --1222 --
NM_004378chr151207 ------
NM_004379chr251757 1545 1198 640 161 ------
NM_004380chr16151 ----11680
NM_004381chr6--1135 1429 --
NM_004384chr522123 504 1725 32247 1604 1563 11544
NM_004385chr52674 223 ------
NM_004386chr191354 --22288 592 --
NM_004389chr22578 207 ------
NM_004393chr342368 1812 1607 392 ------
NM_004395chr5183 ------
NM_004396chr171198 ------
NM_004397chr1193410 3383 1708 1676 1233 1158 903 234 207 --33696 1486 390 --
NM_004405chr21230 ------
NM_004411chr72713 201 ------
NM_004414chr2131563 1452 1388 --1293 --
NM_004415chr6----2642 546 --
NM_004417chr52658 463 ------
NM_004419chr101800 --1238 --
NM_004426chr1231974 1839 1645 1322 ----
NM_004430chr862701 2654 2368 1984 1733 807 12468 ----
NM_004432chr932047 1781 243 12278 12413 12070
NM_004438chr272813 2487 1289 1183 1084 1072 235 --33308 75 56 --
NM_004439chr4----143 --
NM_004440chr621653 781 --11429 --
NM_004441chr3183 --1117 --
NM_004449chr2121083 35 --21402 1396 11202
NM_004454chr342287 2095 1793 877 --11698 --
NM_004457chr2----2531 235 --
NM_004458chrX22659 1857 --32569 2200 1040 --
NM_004459chr1741903 1825 1443 1368 ------
NM_004464chr443694 3433 447 191 11279 1583 21517 1496
NM_004474chr12942 133 ------
NM_004475chr1721174 853 ------
NM_004480chr141230 ------
NM_004481chr111759 --22594 559 --
NM_004482chr21707 1649 1123 --
NM_004485chr154373 3314 2842 1238 407 --1485 --
NM_004491chr1953905 2899 1235 1089 57 --34306 1521 1130 --
NM_004499chr5----1423 --
NM_004501chr164142 3769 3380 674 465 452 --1735 --
NM_004503chr121580 ------
NM_004504chr252995 2387 1023 129 68 22256 814 ----
NM_004505chr1741912 1852 1474 1421 ------
NM_004506chr6178 ------
NM_004514chr1732771 1131 466 ----1796
NM_004516chr191367 ------
NM_004520chr52753 218 ------
NM_004525chr241073 216 197 89 1476 ----
NM_004529chr921390 471 ------
NM_004550chr11150 ------
NM_004566chr101946 --1813 --
NM_004569chr141642 ------
NM_004571chr2143234 2615 2493 2463 13304 33095 873 103 --
NM_004575chr411313 --11142 1528
NM_004576chr5189 ------
NM_004578chr13862 273 32 ------
NM_004586chrX74449 3347 1790 1728 1516 841 492 1395 25040 874 25030 3604
NM_004593chr3----1172 --
NM_004598chr51825 --33322 479 64 --
NM_004600chr131191 507 426 --1624 --
NM_004612chr983507 3358 1774 1404 993 636 464 199 --24039 930 --
NM_004614chr161648 12460 1677 --
NM_004615chrX2934 806 --1311 --
NM_004622chr242447 1759 1543 313 --1109 --
NM_004626chr111540 ------
NM_004627chr213667 629 225 1695 ----
NM_004636chr31404 ------
NM_004637chr321281 1258 ------
NM_004642chr121492 --1192 --
NM_004654chrY21036 38 ------
NM_004655chr1741323 1271 1070 531 ------
NM_004660chrY31828 638 511 --11423 1267
NM_004663chr151599 11265 --11135
NM_004667chr153654 591 240 ------
NM_004671chr181208 ------
NM_004684chr41273 --2352 325 --
NM_004686chr81510 ------
NM_004687chr1751768 1496 1318 773 525 11287 21835 1594 11525
NM_004690chr6--2267 258 --2661 602
NM_004703chr1722533 719 --131 --
NM_004709chrX21705 1216 1313 11140 --
NM_004717chr71361 21491 1322 ----
NM_004719chr1272746 2345 1903 1015 805 344 168 --12134 1375
NM_004721chr33309 91 45 ------
NM_004725chr103952 343 209 ------
NM_004726chrX43989 3929 395 250 11487 32207 1347 151 --
NM_004730chr582117 2023 1619 1437 685 672 643 575 --21417 445 --
NM_004731chr1231529 1422 1248 ------
NM_004734chr1342625 2344 816 424 ------
NM_004736chr152244 2106 1740 1502 489 --12154 --
NM_004741chr1021515 546 ------
NM_004742chr341743 1341 1182 246 ----11602
NM_004744chr463124 2565 1262 1011 577 332 11001 11312 --
NM_004745chr845463 2071 1963 1547 --11572 11508
NM_004748chr1531583 1348 23 14209 23460 526 --
NM_004751chr152420 300 ------
NM_004755chr1441138 1003 810 797 --1753 11219
NM_004756chr1941424 1270 1067 505 ------
NM_004757chr41102 ------
NM_004760chr752095 1603 1584 364 86 --11857 --
NM_004762chr1751620 1272 506 490 74 ------
NM_004768chr11394 --1906 --
NM_004770chr8----1192 --
NM_004772chr551546 1499 1394 1341 465 11477 11347 --
NM_004774chr1732389 2071 1066 12916 22319 438 --
NM_004775chr181918 --11997 --
NM_004776chr2043227 2757 2262 2169 ------
NM_004779chr51120 --11220 166
NM_004781chr131701 550 164 ----11736
NM_004781chr131701 550 164 ----11736
NM_004787chr4----1155 --
NM_004788chr1112564 ----11688
NM_004792chr21186 ------
NM_004796chr1412295 --12413 --
NM_004798chr2083388 2975 2665 2483 2281 971 525 37 ------
NM_004799chr11424 --170 --
NM_004800chr131192 --1263 --
NM_004801chr221101 415 --1530 --
NM_004808chr1053150 2701 957 749 564 --32939 631 388 --
NM_004817chr93597 575 300 ------
NM_004822chr1741511 1108 610 300 --33726 3639 2553 --
NM_004831chr194870 163 98 26 --1434 --
NM_004834chr233293 1368 984 --2913 801 --
NM_004836chr21792 --1609 --
NM_004840chrX41623 863 193 185 1495 ----
NM_004842chr631548 1347 364 --11773 --
NM_004846chr21119 ------
NM_004850chr221753 1543 11275 21170 583 --
NM_004856chr15----1462 --
NM_004857chr1464790 3498 1431 879 668 69 1311 21833 539 14102
NM_004859chr1741198 1072 1057 312 --12322 22288 409
NM_004866chr564345 4131 3465 1195 1057 644 31153 323 305 23277 508 --
NM_004867chrX------1104
NM_004871chr1754024 3293 2944 1492 506 13211 24376 4290 14348
NM_004879chr111260 ------
NM_004884chr154656 619 532 113 ------
NM_004887chr521068 164 ------
NM_004896chr1021316 571 1150 11224 --
NM_004898chr421074 918 22891 2074 ----
NM_004902chr20----1622 --
NM_004904chr766322 4481 2498 1252 1057 70 26414 2601 26558 4682 --
NM_004906chr61669 --1556 --
NM_004912chr721511 123 --11119 1450
NM_004915chr212669 574 ------
NM_004921chr172378 2292 2248 969 424 364 147 166 22238 215 --
NM_004929chr8159 ------
NM_004936chr942522 1862 556 403 --1936 11204
NM_004937chr1752540 1909 1698 412 394 --22611 962 --
NM_004938chr921269 1159 --11002 --
NM_004939chr2170 ------
NM_004945chr191810 --1231 --
NM_004946chr5----1422 --
NM_004947chr341946 461 413 111 ------
NM_004948chr1861436 1144 1122 571 525 461 ------
NM_004949chr1832008 802 669 ------
NM_004956chr764236 1753 1194 932 437 145 --41517 562 175 35 11046
NM_004958chr11339 --149 --
NM_004963chr12148 ----1118
NM_004965chr212762 620 ------
NM_004969chr10138 ------
NM_004973chr641737 1440 97 69 --11596 1178
NM_004978chr121318 231 --11479 --
NM_004982chr121146 --1485 --
NM_004984chr122173 130 --132 --
NM_004985chr1264508 4375 3895 3248 1085 78 --14198 --
NM_004992chrX67832 5764 2933 2288 1534 982 --58202 6196 3306 1121 247 --
NM_004992chrX67832 5764 2933 2288 1534 982 --58202 6196 3306 1121 247 --
NM_004998chr153827 807 245 1872 --1707
NM_004999chr664486 4074 3864 3650 2906 1233 147 1470 --
NM_005010chr741617 871 748 55 --1740 --
NM_005011chr72428 209 --1161 --
NM_005020chr71459 ------
NM_005028chr1032218 1538 681 --21472 268 --
NM_005032chrX1996 11103 ----
NM_005036chr2295765 5425 2725 2185 1974 834 625 421 176 --13004 --
NM_005045chr71965 1344 ----
NM_005056chr1244570 4317 2091 501 23910 724 33767 3709 3651 --
NM_005063chr1033848 3513 1021 13226 ----
NM_005065chr1484369 4001 1830 1505 1381 1100 912 738 --34669 941 66 --
NM_005066chr1----2761 75 --
NM_005078chr1521853 130 --11561 --
NM_005079chr833221 1024 75 12746 ----
NM_005080chr22----1627 --
NM_005087chr31106 ------
NM_005088chrX3325 207 200 --1889 --
NM_005093chr2055307 5222 4966 1966 1819 --1171 --
NM_005095chr1--11520 11566 --
NM_005096chrX21030 209 ------
NM_005097chr10----1291 --
NM_005102chr22851 343 1882 1698 --
NM_005109chr322223 992 ------
NM_005110chr51719 ------
NM_005113chr14----1504 --
NM_005116chr2073906 2933 2798 1824 1675 1028 474 24178 772 ----
NM_005119chr11135 11132 ----
NM_005121chr1753113 2506 1137 908 803 --11405 12834
NM_005124chr62344 21 --2687 70 --
NM_005126chr322259 1645 1226 12174 --
NM_005128chr212168 41 --1506 --
NM_005133chr111396 ------
NM_005134chr182344 306 ------
NM_005135chr1543851 3738 1392 1246 ------
NM_005140chrX3771 651 91 --1380 --
NM_005151chr1832383 637 254 ------
NM_005153chr162659 547 ------
NM_005154chr151594 ------
NM_005156chr985407 4866 4719 4153 3781 3732 1868 1135 --24726 368 --
NM_005157chr94767 591 518 468 --21903 1556 --
NM_005160chr22116526 5576 5145 4561 2694 1836 1622 1609 1424 1066 179 --34512 538 458 --
NM_005163chr141774 --2656 98 --
NM_005168chr241481 1353 1232 1171 21266 466 21680 326 --
NM_005171chr1221270 1171 --1360 --
NM_005178chr191389 ------
NM_005180chr1021132 466 ------
NM_005181chr82853 250 ------
NM_005184chr191260 ------
NM_005188chr1111296 13024 37224 2085 214 --
NM_005190chr62978 721 ------
NM_005197chr1436091 2435 1675 --36085 5210 1690 --
NM_005204chr101799 --1291 --
NM_005206chr1721219 1102 ------
NM_005214chr21158 --199 --
NM_005215chr18----1237 --
NM_005216chr12503 211 ------
NM_005219chr511537 ----11692
NM_005230chr121155 1399 1118 --
NM_005233chr322314 503 --12063 --
NM_005235chr267437 7142 7015 6785 6620 2147 12575 17248 11088
NM_005238chr1121347 478 ------
NM_005241chr341359 1311 1103 550 ------
NM_005242chr521266 599 ------
NM_005243chr22126 --1126 --
NM_005249chr14148 ----1742
NM_005252chr143579 528 60 ------
NM_005254chr1521331 898 ------
NM_005256chr112792 610 ------
NM_005257chr1861426 1365 994 518 204 95 --1328 --
NM_005259chr211472 1174 --21422 949
NM_005261chr81855 ------
NM_005277chr441559 1391 349 37 1162 31952 1433 634 11962
NM_005281chr12973 759 ------
NM_005284chr62355 176 ------
NM_005296chrX1268 --1885 --
NM_005302chr7----1417 --
NM_005308chr101453 ------
NM_005311chr73915 659 402 --11786 12582
NM_005313chr151169 ------
NM_005316chr111385 --2859 154 --
NM_005318chr2211196 11114 --1223
NM_005324chr17--1677 31975 644 101 2514 108
NM_005328chr81503 --1242 --
NM_005329chr1632230 2049 1850 11985 --12359
NM_005333chrX3915 151 81 ------
NM_005338chr753688 3477 2874 2766 1609 13019 ----
NM_005339chr433577 3019 504 --21028 458 --
NM_005342chrX42816 2106 509 324 1306 1281 1764
NM_005358chr13--11322 31722 708 411 1733
NM_005359chr1856223 5173 4520 4359 1851 --21362 1038 --
NM_005370chr19------11293
NM_005375chr61757 --3984 898 846 21151 146
NM_005378chr22864 567 ------
NM_005382chr81459 ----1371
NM_005384chr9--129 ----
NM_005385chr352589 2323 2100 1763 662 ------
NM_005386chr203801 782 123 --1567 --
NM_005387chr111711 ------
NM_005388chr9--11642 21502 397 --
NM_005400chr243044 2826 1203 140 11030 ----
NM_005402chr7------11680
NM_005414chr3----2303 209 --
NM_005430chr122692 266 ------
NM_005433chr1832300 851 757 --1964 1466
NM_005435chr72567 207 ------
NM_005436chr1073791 3653 3532 3255 2520 874 107 --11239 --
NM_005438chr111225 ------
NM_005440chr1763275 2630 1191 972 823 446 ----12984
NM_005443chr4175 ------
NM_005450chr171177 ------
NM_005455chr141781 1693 374 282 ------
NM_005461chr2061624 1464 1373 1354 1289 633 --11699 --
NM_005465chr131997 1845 567 ------
NM_005475chr1223234 638 ------
NM_005476chr941236 874 432 380 ------
NM_005477chr1541035 986 721 507 --12449 --
NM_005477chr1541035 986 721 507 --12449 --
NM_005487chr2211415 ----12124
NM_005493chr61101 ------
NM_005494chr71658 --1240 --
NM_005497chr17115712 5371 5160 5057 4630 4258 4187 3729 1581 1405 316 13890 25766 4467 15623
NM_005499chr192663 455 ------
NM_005502chr943117 3084 2709 125 --22097 1037 --
NM_005504chr1266214 2452 2269 1752 1184 580 11776 55955 5882 600 296 71 16071
NM_005509chr531363 1312 145 11823 ----
NM_005513chr311470 ------
NM_005517chr1----31186 1050 30 --
NM_005521chr10------1794
NM_005522chr71447 ------
NM_005523chr711535 11594 ----
NM_005537chr131212 --1703 --
NM_005542chr731933 1863 1624 ------
NM_005544chr21235 --1357 --
NM_005545chr151718 ------
NM_005561chr134970 886 794 686 1142 ----
NM_005563chr14890 610 271 58 ------
NM_005570chr1811074 --121 --
NM_005573chr53676 461 235 ------
NM_005574chr112545 83 ------
NM_005575chr52869 113 ------
NM_005578chr344888 4131 750 272 --24859 3256 --
NM_005587chr151272 1191 125 --
NM_005593chr121551 ------
NM_005595chr1------1658
NM_005596chr996270 6044 5297 5085 4603 4319 2016 1624 1187 21081 257 14928 11577
NM_005598chr1----21288 1155 --
NM_005602chr321210 139 --11294 --
NM_005603chr185694 540 451 241 92 ------
NM_005604chr621830 527 ------
NM_005605chr8------1113
NM_005607chr81758 1102 ----
NM_005611chr161469 11341 ----
NM_005618chr62527 226 ------
NM_005627chr62906 797 ------
NM_005632chr162962 58 ------
NM_005637chr1811301 --22043 1791 --
NM_005638chrX----11194 11247
NM_005639chr1251673 1562 452 126 103 --21206 26 --
NM_005644chr1----1373 --
NM_005647chrX83370 3313 3248 2725 2349 903 801 112 --13102 --
NM_005649chr51396 ------
NM_005655chr8----21313 811 --
NM_005665chr154481 4113 3936 1606 1570 ------
NM_005668chr554110 1742 1325 1300 278 --33266 1755 30 11544
NM_005686chr1195 --2452 136 --
NM_005688chr351129 949 474 431 229 ------
NM_005708chr13----132 --
NM_005715chr682465 2347 2323 1947 1054 717 586 101 --12525 --
NM_005716chr191497 ------
NM_005719chr12145 1215 ----
NM_005721chr2----11080 --
NM_005722chr252036 666 483 472 453 21958 265 --12106
NM_005734chr111528 1615 ----
NM_005737chr242289 1013 1006 531 --1463 1905
NM_005738chr721555 785 --21906 1402 --
NM_005739chr1531835 1565 109 ------
NM_005742chr22830 126 1766 ----
NM_005746chr732731 2239 740 12357 --2975 179
NM_005748chr1253049 2708 2350 796 494 22635 1228 11159 --
NM_005751chr7----1344 --
NM_005759chr294782 4095 3596 2926 1806 1761 728 568 556 23947 1695 14604 --
NM_005765chrX2334 282 ------
NM_005766chr13----1401 --
NM_005776chr141307 --1271 1684
NM_005779chr543337 2689 1395 928 --12602 --
NM_005786chr1861187 1133 847 468 56 36 --1414 --
NM_005788chr11------1716
NM_005789chr1721707 1649 --21454 330 --
NM_005797chr1131749 1202 395 ------
NM_005808chr363341 3293 3081 2923 2241 33 --22946 216 --
NM_005819chr183449 3411 3339 2289 724 483 209 119 --11369 --
NM_005822chr622254 925 1493 ----
NM_005826chr12486 105 ------
NM_005832chr33491 249 236 ------
NM_005833chr91156 ------
NM_005839chr11285 ------
NM_005840chrX96961 5684 5310 4685 3068 2640 2509 2108 1880 16493 25809 2368 --
NM_005841chr421101 781 ------
NM_005842chr131292 ------
NM_005859chr511425 --21063 978 --
NM_005862chr311042 --2810 784 11027
NM_005870chr1321182 238 1567 ----
NM_005871chr101863 1260 3944 316 157 --
NM_005880chr1621129 223 ------
NM_005882chr41243 --1179 --
NM_005885chr51263 --11069 --
NM_005895chr1253685 3452 3363 3224 1396 --11419 --
NM_005898chr1143002 2150 1250 686 --1469 21257 742
NM_005900chr431166 1099 352 --150 --
NM_005901chr18148339 7738 7679 6600 6255 5518 3097 2556 1902 1588 1129 807 392 118 16091 18037 --
NM_005902chr1553668 1483 1134 955 852 ------
NM_005903chr5115045 4819 4164 4081 3687 2004 1540 1331 1189 834 537 11667 33609 853 417 --
NM_005904chr18----11371 --
NM_005906chr62493 126 --1176 --
NM_005908chr42125 46 ------
NM_005909chr554078 3774 821 309 272 --23912 520 1982
NM_005911chr22388 334 ------
NM_005917chr21184 ------
NM_005920chr123103 624 ------
NM_005922chr61389 ------
NM_005923chr62604 274 --1103 --
NM_005924chr74439 375 286 125 ----1780
NM_005926chr151361 ------
NM_005933chr1132693 2588 2492 --12565 --
NM_005934chr1942326 1822 567 521 --1142 --
NM_005937chr1754154 2619 1422 700 366 ------
NM_005941chr843217 2923 1561 1459 21514 760 ----
NM_005955chr195352 4690 4646 3839 3585 2170 1611 366 248 13718 35469 1582 927 --
NM_005962chr1042206 2130 889 676 ------
NM_005962chr1042206 2130 889 676 ------
NM_005963chr17------174
NM_005964chr1711408 --1478 --
NM_005966chr221601 1539 --12397 --
NM_005968chr191171 ------
NM_005977chr1321014 280 1374 ----
NM_005986chr1341874 652 608 439 1473 ----
NM_005999chr11577 31227 1199 1155 1123 --
NM_006007chr963348 1643 1086 742 706 680 --11040 --
NM_006010chr31196 ------
NM_006011chr1544142 1153 1146 956 14168 14205 --
NM_006016chr611474 ----11544
NM_006033chr1842074 509 336 180 ----11613
NM_006036chr222033 1827 1910 32445 1809 402 --
NM_006037chr223955 3174 --23883 1427 11224
NM_006038chr2031343 742 222 --1105 --
NM_006040chr1611290 --1466 --
NM_006043chr161693 ------
NM_006047chr2012993 --12631 --
NM_006054chr1141363 1158 108 70 ------
NM_006064chrX2383 265 ------
NM_006067chr16----1800 --
NM_006070chr32352 112 ------
NM_006076chr72590 86 --1991 --
NM_006080chr722832 2057 --42922 2214 1037 479 --
NM_006084chr141310 ------
NM_006088chr91143 ------
NM_006089chrX143 1234 11732 --
NM_006094chr821967 1867 --32413 952 691 --
NM_006095chr464388 3145 3136 678 499 180 11301 23573 2838 --
NM_006100chr33221 84 51 ------
NM_006106chr1122602 1029 23400 389 1701 11041
NM_006108chr112248 29 --22350 1484 --
NM_006113chr121694 774 --21900 104 --
NM_006133chr1112340 ----12379
NM_006135chr12410 401 --11370 --
NM_006136chr71513 ------
NM_006141chr1662515 1980 995 640 568 533 --12498 --
NM_006143chr121125 ------
NM_006147chr11453 ------
NM_006148chr1712060 --12667 --
NM_006154chr1552588 2008 995 893 138 --32722 2264 430 1194
NM_006157chr111350 ------
NM_006159chr12------1580
NM_006161chr53661 566 476 --1246 --
NM_006164chr22396 43 --1361 --
NM_006166chr1262277 2068 1939 1772 499 272 ----12569
NM_006167chr82675 289 11998 1809 --
NM_006178chr1721274 292 ----1225
NM_006180chr931559 1485 333 --1163 --
NM_006183chr121142 ------
NM_006186chr221069 218 ------
NM_006195chr931204 211 47 --11046 --
NM_006203chr544206 3652 3539 543 35497 2105 1919 33730 3506 893 --
NM_006206chr432043 902 542 --42762 2383 2272 445 --
NM_006209chr81318 ------
NM_006216chr22648 206 --1664 --
NM_006218chr3148 ------
NM_006224chr17--11690 123 --
NM_006226chr221180 334 1405 ----
NM_006237chr1321498 51 --21862 115 --
NM_006243chr1--11065 ----
NM_006246chr1411142 ------
NM_006252chr177477 7244 7171 6007 4895 4690 31 --46042 5462 2558 825 15374
NM_006254chr31155 ------
NM_006255chr142750 694 --11135 --
NM_006256chr152477 2248 2206 1991 782 21074 718 32727 1088 188 --
NM_006258chr1011058 ------
NM_006265chr81346 ------
NM_006267chr22446 231 11741 1218 --
NM_006268chr111265 ------
NM_006281chr841093 998 315 186 ------
NM_006281chr841093 998 315 186 ------
NM_006282chr2064445 4007 3388 2918 231 86 ----1564
NM_006283chr844634 1464 1267 1089 --54117 3667 1921 1199 35 11678
NM_006284chr11------123
NM_006292chr11----1173 --
NM_006298chr682724 2316 2261 2117 1243 1200 628 77 12957 1540 --
NM_006310chr171380 ------
NM_006313chr1241084 510 424 155 11477 21670 1499 --
NM_006315chr464328 4278 3876 3696 2799 639 22870 66 11132 12836
NM_006317chr52874 355 ------
NM_006320chr41943 ------
NM_006322chr132224 45 --1191 --
NM_006323chr42619 93 ------
NM_006333chr21657 --1542 --
NM_006334chr91289 --2220 97 --
NM_006335chr14863 784 732 137 11035 2434 213 --
NM_006345chr41888 11051 1312 --
NM_006352chr142044 1477 839 313 11721 1133 11509
NM_006353chr61946 ----129
NM_006359chrX52336 752 533 201 64 12252 1908 --
NM_006363chr202213 179 ------
NM_006364chr141846 1466 11167 1489
NM_006366chr61167 ------
NM_006367chr1----1283 11075
NM_006373chr1711052 11009 181 --
NM_006379chr7--2739 489 1157 --
NM_006380chr1783658 2856 1722 1619 693 643 356 98 --24375 3398 11687
NM_006386chr2222352 2171 --1578 --
NM_006389chr11----11356 --
NM_006390chr1251842 1732 605 404 140 --31141 480 40 --
NM_006393chr1033094 811 182 24303 759 14233 --
NM_006400chr121375 ------
NM_006401chr91332 ------
NM_006413chr101447 --1218 11027
NM_006416chr6146 --1702 --
NM_006420chr2042698 2199 1123 937 --22976 2118 13312
NM_006421chr8--129 ----
NM_006424chr451760 1557 1364 399 180 --11793 --
NM_006431chr121223 ------
NM_006434chr1042366 2169 958 599 --12830 1829
NM_006457chr484148 3835 2989 2922 1381 1173 770 559 33395 3022 195 33061 2700 1307 11643
NM_006459chr1051860 1560 761 752 280 ------
NM_006460chr17----2448 277 --
NM_006463chr2150 ------
NM_006464chr263299 3254 1496 441 434 369 --1234 --
NM_006465chr151169 ------
NM_006467chr54484 415 232 95 ------
NM_006469chr121117 346 --1208 --
NM_006471chr18----195 --
NM_006472chr131198 1171 801 --1515 --
NM_006482chr1243706 3204 3184 1268 53272 2453 1573 313 130 12853 1838
NM_006489chr14165 --171 --
NM_006496chr121540 294 --11531 --
NM_006504chr1032682 1008 439 --1401 --
NM_006516chr141501 1178 1100 647 ------
NM_006517chrX1115 166 ----
NM_006519chr61108 ------
NM_006520chrX------1473
NM_006526chr2041388 816 672 124 --21949 1654 --
NM_006527chr42563 230 --184 --
NM_006530chr121152 --1350 --
NM_006534chr2052587 1301 1263 924 53 --1719 --
NM_006537chr15----2623 95 --
NM_006538chr264099 4062 3351 1034 884 638 --23579 1171 --
NM_006540chr821336 241 ----1995
NM_006544chr14115370 4779 4696 4673 3990 2251 1626 1530 1313 1221 1070 --1348 --
NM_006546chr1756066 1186 693 529 247 --24055 1463 --
NM_006547chr722053 1996 --2551 272 11914
NM_006548chr331657 1639 1383 --11159 --
NM_006549chr1212227 --42858 2395 424 261 --
NM_006554chr2------1248
NM_006557chr911737 --21655 298 --
NM_006559chr12927 166 ------
NM_006561chr1045778 4622 1104 262 15532 36021 2469 2382 --
NM_006565chr1621178 793 --11162 11170
NM_006570chr9------1375
NM_006574chr3----1295 --
NM_006575chr14184 --1132 11210
NM_006577chr211208 ------
NM_006595chr1111283 --11313 --
NM_006599chr1697753 7060 7043 6772 6578 5377 2856 2005 398 --25818 5489 --
NM_006601chr121718 --11061 --
NM_006603chrX81925 1839 1736 1657 370 327 246 145 ------
NM_006605chr221131 ------
NM_006609chr261896 1884 1873 1159 270 243 --170 --
NM_006614chr32184 156 13298 --1254
NM_006621chr111351 11707 ----
NM_006622chr51481 ------
NM_006624chr1022088 2079 --1250 --
NM_006625chr121025 171 --1205 --
NM_006625chr121025 171 --1205 --
NM_006625chr121025 171 --1205 --
NM_006628chr1564533 4504 3912 1144 688 185 --13607 --
NM_006633chr52598 226 ------
NM_006636chr2----1330 --
NM_006648chr91117 ------
NM_006650chr523679 1057 --1907 --
NM_006654chr1294040 3999 3785 3681 3187 1258 1220 819 614 14482 24059 971 --
NM_006662chr16----1264 --
NM_006667chrX1109 ------
NM_006675chr1253347 2280 2232 274 81 --23335 2403 --
NM_006682chr772252 1083 792 572 361 141 63 11144 1168 --
NM_006690chr2032310 1764 142 ------
NM_006700chr122583 54 --1805 --
NM_006706chr53332 127 80 ------
NM_006710chr21707 --1921 --
NM_006713chr52151 30 ------
NM_006717chr973141 2952 2857 2795 2405 2112 177 --12415 13312
NM_006722chr333075 2848 22 ----11088
NM_006724chr61389 ------
NM_006727chr5187 ------
NM_006729chrX65155 4659 1319 657 635 76 --44119 146 105 54 --
NM_006732chr1932138 1637 508 --22050 1380 --
NM_006734chr671441 1167 1076 638 413 279 219 ----1632
NM_006735chr71327 ------
NM_006738chr1523483 1235 --12949 --
NM_006745chr41916 --11091 --
NM_006746chrX----11386 --
NM_006749chr821269 1059 ------
NM_006751chr2182 1901 ----
NM_006756chr831353 1286 1243 ------
NM_006759chr2185 ------
NM_006761chr171796 ------
NM_006765chr8--2238 28 ----
NM_006766chr822669 1889 1493 22528 966 --
NM_006769chr1--1159 ----
NM_006772chr611487 ------
NM_006775chr672912 991 903 761 443 236 122 --13015 --
NM_006777chrX52685 1871 1859 494 371 ------
NM_006783chr132526 281 ------
NM_006788chr1821751 1308 --12032 --
NM_006791chr152585 491 ------
NM_006805chr5------1633
NM_006806chr21----1172 --
NM_006807chr17----2382 241 --
NM_006811chr201781 ----1404
NM_006814chr202892 344 ------
NM_006815chr123527 377 359 ------
NM_006823chr821215 114 --21170 68 --
NM_006826chr231152 837 514 --11204 --
NM_006827chr142751 295 ------
NM_006832chr143948 675 150 --21073 710 --
NM_006852chr171304 ----12184
NM_006857chr23779 758 82 ------
NM_006861chr122147 30 ------
NM_006870chr20--1336 ----
NM_006874chr421068 862 --1394 --
NM_006885chr1633357 871 391 --23724 1446 11310
NM_006888chr1453094 2781 2685 632 239 --43404 2927 1101 555 --
NM_006892chr20----11155 --
NM_006892chr20----11155 --
NM_006895chr241944 1550 1426 371 ------
NM_006908chr731031 541 339 ------
NM_006910chr16------1116
NM_006912chr141698 1656 346 255 --22534 962 --
NM_006914chr92532 331 ----1119
NM_006915chrX32478 580 504 ------
NM_006918chr1165196 5188 4810 3762 1422 855 14041 25019 339 --
NM_006920chr231742 1540 1291 --1362 1581
NM_006922chr222410 1761 --22013 384 --
NM_006924chr171123 23158 2781 ----
NM_006927chr1642017 1789 371 168 ------
NM_006930chr541736 751 638 314 --1164 197
NM_006931chr1231941 1741 1481 ------
NM_006937chr17----1196 --
NM_006939chr143305 262 91 ------
NM_006940chr1221481 730 ------
NM_006948chr2132393 1712 593 --1775 1309
NM_006951chr10----2779 265 --
NM_006955chr1082783 2592 2540 2320 2178 767 702 651 1302 23422 2280 --
NM_006965chr181343 --1482 11026
NM_006981chr922257 289 ------
NM_006991chr331005 386 175 --1721 --
NM_006996chr131818 1596 683 --21860 104 11190
NM_006997chr101110 --1399 --
NM_006999chr511791 --31881 607 296 --
NM_007005chr941536 1517 350 45 ------
NM_007006chr1642832 2731 2554 2159 --12543 --
NM_007008chr24922 899 381 144 ------
NM_007011chr1575946 5626 5416 1951 1454 615 215 14324 11477 --
NM_007013chr81951 --1790 136
NM_007019chr20----1172 --
NM_007023chr21143 --1893 --
NM_007033chr122183 1638 1173 11651 --
NM_007034chr1----21025 870 1723
NM_007035chr122644 184 --1683 --
NM_007038chr2186050 5946 5447 4619 4426 1296 1268 171 --25614 1036 --
NM_007040chr191184 ----11032
NM_007042chr332443 918 209 --1320 --
NM_007043chr122860 285 ------
NM_007045chr6----1116 --
NM_007050chr2047589 2293 1610 1343 --37801 5043 2388 --
NM_007052chrX1146 --131 --
NM_007054chr551412 1201 423 238 219 --1526 --
NM_007064chr331339 684 642 --11241 --
NM_007073chr642852 1541 1484 68 ------
NM_007078chr1042770 2560 1951 1206 --31221 244 170 --
NM_007084chr1331193 574 233 --1294 --
NM_007096chr91253 ------
NM_007106chr133688 563 363 ------
NM_007107chr332281 2196 912 --11877 --
NM_007111chr131841 ------
NM_007114chr352211 2090 2028 1232 980 23015 43 11139 --
NM_007118chr53812 175 124 ------
NM_007124chr631630 1275 732 --1757 --
NM_007125chrY1434 --1192 --
NM_007137chrX34307 1859 182 --25520 3967 --
NM_007145chr191152 --11235 1452
NM_007146chr1742393 862 486 135 --2521 505 --
NM_007150chrX32110 1428 230 ------
NM_007157chrX72872 2659 2647 2593 1971 1061 837 --32791 1894 436 --
NM_007158chr11427 --1359 1271
NM_007159chr311733 ------
NM_007166chr1131273 1155 431 --11396 --
NM_007170chr1----1270 --
NM_007174chr1211951 --22144 243 --
NM_007176chr1411152 --1677 --
NM_007185chr1----21001 333 --
NM_007187chr135770 746 349 338 198 ------
NM_007189chr751205 1029 607 158 101 ------
NM_007190chr1011048 --31158 757 24 --
NM_007191chr121618 1556 ----
NM_007197chr12------1180
NM_007198chr821276 33 --11521 --
NM_007200chr1523483 1235 --12949 --
NM_007202chr172753 662 ------
NM_007203chr953320 1362 903 472 75 12765 12498 --
NM_007204chr12427 99 ------
NM_007212chr121735 67 12107 22289 868 --
NM_007217chr3----127 --
NM_007220chrX54660 4649 1094 884 554 --43158 771 116 92 --
NM_007222chr821496 527 --11147 --
NM_007231chrX22080 884 --2573 286 --
NM_007236chr1522345 685 --11647 --
NM_007246chr4183 --1103 --
NM_007249chr13119387 9267 8375 7617 6931 5949 3473 2692 2185 1446 1105 18243 59343 7018 3761 3694 2553 18991
NM_007270chr731518 1479 258 11413 ----
NM_007285chr16----1109 1325
NM_007286chr522120 1325 --11938 --
NM_007287chr31101 13092 11175 --
NM_007288chr31101 13092 11175 --
NM_007289chr31101 13092 11175 --
NM_007292chr1775029 4641 3727 3497 3170 1741 597 ----1574
NM_007308chr41171 ------
NM_007313chr94767 591 518 468 --21903 1556 --
NM_007315chr221394 1048 --11121 --
NM_007324chr11424 --170 --
NM_007325chrX41595 1442 579 516 --12063 --
NM_007331chr462606 2287 1746 956 190 168 --1479 12613
NM_007345chr18165 --21769 503 --
NM_007347chr1553235 3072 2199 375 88 23161 898 ----
NM_007349chr7----3450 377 77 --
NM_007358chr12723 31 11433 11563 --
NM_007359chr171622 11470 ----
NM_007361chr14----2556 514 --
NM_007363chrX31000 223 123 --1981 --
NM_007372chr171879 ------
NM_007373chr1021314 117 --11149 --
NM_007375chr172785 2460 2116 1077 979 574 90 12730 32452 2159 1725 --
NM_012069chrX32137 1762 549 ------
NM_012072chr2093627 3091 1807 1358 1064 1033 807 712 520 --13967 --
NM_012081chr553480 3451 3294 3096 937 --22963 167 --
NM_012082chr84657 385 362 316 ------
NM_012089chr1--11233 11506 --
NM_012095chr1073242 3031 2179 1280 1041 817 106 --1601 --
NM_012096chr3122815 2799 2494 1490 1088 851 681 613 582 314 203 172 1420 1619 --
NM_012097chr242177 2041 1775 624 --12185 --
NM_012099chr191184 1336 ----
NM_012104chr1123025 3005 ------
NM_012104chr1123025 3005 ------
NM_012118chr41461 ------
NM_012120chr622955 703 --1884 12558
NM_012124chr111114 ------
NM_012129chr722505 1689 --12511 --
NM_012137chr132963 2891 2216 --12787 --
NM_012141chr1384055 3474 3432 3305 688 494 97 79 --33986 3975 2578 23687 1472
NM_012154chr81647 ------
NM_012156chr2032322 206 25 ------
NM_012158chr1331235 742 448 11817 --1358
NM_012161chr4----31104 1088 60 --
NM_012175chr11----2690 665 --
NM_012193chr11135380 4930 4463 3600 1812 1112 997 898 778 639 564 533 53 --24562 1528 --
NM_012197chr921382 516 ------
NM_012199chr174294 3993 3735 3234 1497 1487 1129 1721 44513 4503 1003 921 14383
NM_012214chr2156267 6107 5954 5824 5610 1503 1293 1235 957 927 818 649 604 348 249 --15296 --
NM_012215chr1031705 1507 764 --31605 621 600 --
NM_012218chr1932976 1908 1201 ----137
NM_012219chr322899 72 --22836 2282 --
NM_012224chr42432 42 ------
NM_012229chr1041237 1024 426 181 ------
NM_012233chr23907 836 354 ------
NM_012234chr332652 2283 454 11355 32338 2316 767 --
NM_012238chr101518 11302 2694 178 --
NM_012242chr102764 273 1224 ----
NM_012243chr11297 --1763 --
NM_012247chr1021004 962 ------
NM_012248chr161169 ------
NM_012249chr21694 ----1652
NM_012252chr744816 4393 1149 320 31173 1160 948 25311 1213 --
NM_012255chr201105 --1429 --
NM_012257chr7----1859 1837
NM_012259chr611400 --21286 1085 --
NM_012261chr20168 ------
NM_012262chr163551 3442 1800 1372 345 193 25191 1233 55038 4693 3198 879 458 25089 938
NM_012264chr221218 11374 ----
NM_012264chr221218 11374 ----
NM_012281chr732411 950 176 12002 1797 1580
NM_012282chrX3756 352 243 ------
NM_012286chrX1573 ------
NM_012294chr753742 3005 2735 899 37 11011 21422 920 --
NM_012297chr482647 1988 1879 1803 586 476 462 55 --11714 --
NM_012300chr522402 1719 1860 1375 --
NM_012302chr121009 374 ------
NM_012304chr551848 992 644 526 206 1291 --1255
NM_012307chr1821095 253 ------
NM_012308chr1121751 330 --12218 1696
NM_012309chr1134328 3434 365 11156 33365 535 504 --
NM_012316chr184960 4856 4647 4286 3914 1737 650 444 12020 13580 13436
NM_012317chrX1662 1739 1723 --
NM_012319chr182926 81 ------
NM_012325chr2011137 --1140 --
NM_012328chr711217 --1945 --
NM_012329chr172104 49 ------
NM_012330chr101412 --1484 --
NM_012333chr11605 11434 ----
NM_012342chr10171 ------
NM_012343chr5----2781 420 --
NM_012345chr131718 1617 11291 --
NM_012382chr544337 3290 1433 799 --21673 756 1411
NM_012384chr2032457 752 691 --1830 --
NM_012398chr1942435 1149 356 246 ------
NM_012399chr2221665 1608 ------
NM_012402chr1131383 1163 866 ------
NM_012412chr7142 1606 --1559
NM_012419chr61637 --1443 --
NM_012420chr103913 437 158 --22292 1950 --
NM_012428chr152736 357 --1963 --
NM_012431chr763431 1202 468 269 209 87 ------
NM_012434chr6----1109 --
NM_012446chr51614 ------
NM_012454chr61538 ------
NM_012464chr442874 2416 2132 144 --1513 1634
NM_012479chr731981 974 409 --22168 642 --
NM_012482chr11634 ------
NM_013229chr1292663 2652 2095 902 520 468 290 263 116 ------
NM_013230chrY21790 1301 1508 ----
NM_013231chr1454116 3617 3146 2757 148 24050 1269 2120 112 --
NM_013233chr21567 --11288 --
NM_013237chr5----169 --
NM_013253chr113973 574 513 11036 1152 11329
NM_013255chr7106841 5831 5814 5563 3028 2272 2240 1921 1081 624 13199 42736 2730 2686 1431 --
NM_013256chr192504 265 ------
NM_013257chr862300 2067 1783 840 630 171 --11510 --
NM_013261chr453501 3332 2352 1157 631 ------
NM_013262chr621135 46 --11304 --
NM_013269chr1234410 3012 3005 1856 24371 3208 --
NM_013275chr162799 628 --2734 130 --
NM_013277chr123200 83 61 --1910 --
NM_013281chr2041288 370 252 119 ------
NM_013283chr55776 583 140 94 57 ------
NM_013296chr1----1421 --
NM_013300chr121245 --1212 --
NM_013302chr1684696 3480 3237 1577 1300 858 766 101 1840 1462 --
NM_013305chr181802 --1138 --
NM_013309chr1522321 2118 ----1340
NM_013313chr2272795 2782 2256 2200 1044 767 393 --23117 1380 --
NM_013316chr72383 212 ------
NM_013323chr1721060 443 11190 ----
NM_013326chr18154 ------
NM_013330chr12213 174 ------
NM_013341chr232394 1863 996 12492 12529 --
NM_013371chr11319 ------
NM_013372chr1523203 424 ------
NM_013374chr33236 101 70 --1842 12293
NM_013381chr1231734 580 80 ------
NM_013382chr1432261 2041 869 --11685 --
NM_013386chr151342 1311 1151 602 286 --21515 105 --
NM_013390chr921739 67 ------
NM_013423chrX11088 ----11016
NM_013427chrX11088 ----11016
NM_013433chr1921326 65 ------
NM_013436chr22162 33 ------
NM_013437chr831431 1297 870 ------
NM_013438chr941729 1589 1525 374 --3509 422 131 1227
NM_013444chrX21161 1080 --31025 440 142 1358
NM_013448chr141119 ------
NM_013449chr1221931 427 ------
NM_013450chr221177 790 ------
NM_013943chr143021 824 724 532 33041 2893 634 11215 --
NM_013951chr242438 1977 1918 434 ------
NM_013986chr22126 --1126 --
NM_013993chr61826 ------
NM_013994chr61826 ------
NM_013995chrX52499 2024 1036 817 752 --1404 1973
NM_013996chr72388 73 ------
NM_013996chr72388 73 ------
NM_013997chr72388 73 ------
NM_013997chr72388 73 ------
NM_013998chr72388 73 ------
NM_013998chr72388 73 ------
NM_014000chr10--11396 21981 653 --
NM_014010chr91603 ------
NM_014011chr222257 294 ----12616
NM_014016chr321699 1543 ------
NM_014021chr141350 1325 627 305 12991 22380 2311 --
NM_014023chr102968 731 ----12707
NM_014028chr653146 2777 2319 2112 289 --22423 413 --
NM_014031chr51108 --1302 --
NM_014034chr621294 587 1283 11256 --
NM_014048chr16105177 4680 4598 3588 1670 886 623 455 230 91 14567 35298 4011 448 --
NM_014057chr921305 300 1394 ----
NM_014079chr31835 1178 ----
NM_014089chr1342091 1908 751 544 --12145 --
NM_014106chr1592901 2452 2343 2287 2072 480 232 117 92 12443 173 12618
NM_014112chr8124897 4882 4375 2007 1993 1833 1703 1590 1423 1352 973 270 11817 23947 2204 --
NM_014117chr1652684 2171 795 761 463 ------
NM_014153chr162663 575 ------
NM_014154chr31492 --21443 1433 --
NM_014155chr1187317 6789 6605 5890 2355 1541 798 138 --12991 --
NM_014157chr1633794 3757 759 1247 ----
NM_014181chr242929 2797 2090 370 --1363 --
NM_014191chr1231051 728 423 ------
NM_014212chr122927 639 ------
NM_014217chr131780 174 79 ------
NM_014223chr13705 293 133 ----1580
NM_014231chr1231560 255 157 --12155 --
NM_014233chr1721884 447 --21983 290 --
NM_014240chr383918 3708 2865 1588 1460 1440 795 536 12821 23216 1361 --
NM_014243chr432131 1342 183 --21783 1503 --
NM_014245chr31161 ------
NM_014249chr15----1518 --
NM_014250chr2211415 ----12124
NM_014253chrX12178 --32450 2369 1590 --
NM_014263chr1021059 522 --21194 1143 --
NM_014264chr4----1501 --
NM_014268chr181389 --1152 --
NM_014271chrX1101 ------
NM_014278chr41350 --1158 --
NM_014279chr91963 ------
NM_014280chr11717 --3706 647 295 --
NM_014282chr9135 1872 1133 1466
NM_014283chr111227 ------
NM_014289chrX31136 1017 457 11338 11178 --
NM_014290chr9----1196 --
NM_014294chr831108 925 151 --1136 --
NM_014299chr1942226 1414 709 333 --1679 --
NM_014300chr151131 ------
NM_014305chr13192 ------
NM_014309chr2254382 4131 3714 1549 1173 13513 54830 3920 1180 274 224 --
NM_014319chr1231737 633 271 --1762 1561
NM_014331chr4127717 7097 6678 6575 5247 4754 2491 1981 1589 1380 562 495 16944 57354 2816 2810 1038 868 14879
NM_014333chr1142745 2490 1973 573 12004 11782 --
NM_014342chr112287 91 11241 21441 948 --
NM_014344chr111675 --1776 --
NM_014351chr22169 ------
NM_014363chr1321112 517 --2267 64 --
NM_014372chr162043 1577 1547 1357 687 418 ------
NM_014382chr321771 368 --11711 1295
NM_014391chr10143 ------
NM_014392chr42485 435 --2330 190 --
NM_014393chr861726 1544 1516 880 441 247 ------
NM_014399chr71277 --1774 --
NM_014410chr18------1365
NM_014415chr331444 478 305 1596 21458 337 1368
NM_014421chr42800 56 ------
NM_014423chr5105316 4032 3954 3462 2265 1170 793 755 680 652 --15358 1748
NM_014445chr342418 1816 933 426 --11575 12045
NM_014447chr421572 298 11405 11045 --
NM_014452chr611203 --2857 340 --
NM_014454chr631023 857 789 ------
NM_014456chr1041466 298 118 98 ------
NM_014458chr121028 147 --11116 11252
NM_014462chr8182 ------
NM_014470chr121731 ------
NM_014488chr112524 233 ------
NM_014491chr71759 ------
NM_014494chr1641984 886 489 398 --22380 697 --
NM_014504chr741315 615 489 111 ------
NM_014515chr122879 384 ------
NM_014554chr1222095 142 ------
NM_014572chr1321605 223 2369 269 11195 --
NM_014574chr1421195 234 ------
NM_014575chr31197 ------
NM_014577chr222853 682 --3920 716 634 --
NM_014585chr241171 1113 347 63 --11137 --
NM_014586chr2174738 4670 3882 3268 3257 1844 1303 --34546 4446 4030 --
NM_014587chr1631245 556 415 --11356 --
NM_014588chr203708 216 56 --1597 --
NM_014591chr10----11312 --
NM_014593chr18133 ------
NM_014600chr221459 1140 --11647 --
NM_014602chr3166 ------
NM_014607chr21405 ------
NM_014612chr941080 416 379 237 1251 11295 11004
NM_014613chr543007 2538 2516 2441 --23055 2060 --
NM_014614chr21152 --1585 --
NM_014615chr1641121 977 784 488 --13550 --
NM_014616chr363434 2862 2125 635 543 283 --11307 --
NM_014629chr821227 207 1410 ----
NM_014630chr1521084 795 ----13521
NM_014634chr2243411 2814 1221 182 1800 ----
NM_014636chr964119 4055 2972 2778 1223 1028 --23750 539 --
NM_014637chr821304 1236 --11170 --
NM_014647chr1652166 1975 1567 790 237 ------
NM_014655chr122318 902 1521 21644 498 --
NM_014660chr71307 ----21093 283
NM_014663chr13372 257 161 ------
NM_014666chr521138 189 ------
NM_014667chr382339 2190 2019 1710 960 739 484 320 168 1165 12447
NM_014670chr21232 --1586 --
NM_014671chr721051 488 ------
NM_014674chr332957 2883 597 --33747 1572 843 --
NM_014676chr121058 202 1528 11445 --
NM_014678chr221121 ------
NM_014679chr112545 255 21090 183 21040 267 --
NM_014682chr872147 1897 1685 502 258 127 76 --42232 2125 1872 353 1108
NM_014683chr1741653 1501 1334 597 ------
NM_014685chr161415 ------
NM_014686chr1951893 1684 899 887 518 --12400 --
NM_014701chr15183 --12925 1826
NM_014702chr663078 2669 2520 2455 801 494 --1168 13369
NM_014705chr7285 29 --21712 762 --
NM_014706chr122803 74 ------
NM_014707chr711814 ------
NM_014713chr21364 1126 1340 --
NM_014721chr697309 6847 6649 5934 5097 5054 4763 1771 79 25736 1588 76899 5625 5311 5252 2266 1417 1064 --
NM_014723chr2043119 2998 1028 722 ------
NM_014727chr19----1257 --
NM_014729chr842114 1810 708 275 1119 ----
NM_014730chr1215105 23279 1787 14669 --
NM_014730chr1215105 23279 1787 14669 --
NM_014731chr20122 ------
NM_014732chr1675305 5218 5135 3616 2201 2035 2012 11104 35717 5180 1587 --
NM_014733chr532028 1877 787 31827 1426 269 --22138 308
NM_014735chrX31678 742 327 ------
NM_014736chr153326 274 215 1109 ----
NM_014739chr673202 3017 2998 1611 267 187 90 13943 ----
NM_014740chr17147 ------
NM_014741chr11----12184 --
NM_014743chr432941 2675 2201 1408 12254 --
NM_014746chr264279 3103 2754 1339 680 621 1470 31515 712 568 --
NM_014750chr141213 ------
NM_014751chr852075 1755 1527 872 417 ------
NM_014752chr1191938 1734 1643 1541 1338 585 334 302 226 ------
NM_014755chr253363 1701 1379 939 438 --31060 689 683 1512
NM_014758chr1122492 889 1737 --11838
NM_014764chr1251324 820 201 148 52 --1870 11248
NM_014772chr1852725 2401 1154 1082 683 --12711 --
NM_014774chr122611 2238 --1388 --
NM_014776chr1262814 2686 2560 2446 2314 1933 11080 23070 2670 --
NM_014779chr311111 --1258 --
NM_014781chr83416 380 295 ------
NM_014786chr111900 1428 ----
NM_014787chr152700 2684 2281 2097 1037 ------
NM_014790chr5------1194
NM_014795chr23945 306 191 21125 268 2878 478 --
NM_014803chr1041085 1024 901 188 12728 12374 --
NM_014807chr111274 --1647 --
NM_014810chr143466 3082 988 643 --1757 1111
NM_014812chr12777 632 ----11984
NM_014813chr1193 ----2614 54
NM_014819chr5--12199 11918 --
NM_014820chr322025 1567 1577 11765 --
NM_014822chr4--1138 2256 31 --
NM_014824chr112581 352 ------
NM_014826chr133379 3057 1408 --23891 3822 1245
NM_014827chr111624 ----1385
NM_014829chr522218 140 --2609 361 --
NM_014830chr1212897 --12758 12378
NM_014835chr2041577 1513 1421 645 ----11940
NM_014836chr1031355 815 220 11579 11547 1146
NM_014839chr142312 2010 1949 724 ------
NM_014840chr1263221 2942 2415 711 325 229 ------
NM_014841chr61177 ------
NM_014846chr81242 --1105 --
NM_014847chr11496 ------
NM_014848chr1552272 1008 918 764 305 --12159 1477
NM_014850chr353225 1890 1266 1181 840 11678 14548 --
NM_014857chr1------122
NM_014862chr1523533 2977 14067 ----
NM_014864chr173470 3356 3015 2803 990 762 490 --14320 --
NM_014868chr123878 586 330 ------
NM_014870chr114261 11165 24287 4071 --
NM_014872chr911614 22149 348 3705 568 166 1409
NM_014873chr144845 3864 1936 63 --44780 4493 951 729 13087
NM_014874chr121780 1405 ------
NM_014876chr2221971 1638 --11991 1215
NM_014877chr1757083 5612 5294 2442 551 1373 47226 5709 5328 187 --
NM_014883chr431004 490 206 1970 11825 1803
NM_014887chr131799 --138 --
NM_014888chr721256 34 21228 639 ----
NM_014890chr31102 --1233 --
NM_014891chr731482 1271 232 ------
NM_014897chr1763257 3190 2850 951 372 77 --1238 --
NM_014899chr513039 22242 390 ----
NM_014901chr5--22135 1715 32201 177 119 --
NM_014903chr1232341 483 210 ------
NM_014905chr221737 225 ----2463 339
NM_014906chr1753740 3026 948 904 749 --23239 2954 13127
NM_014912chr1043143 2967 1156 100 --1228 1397
NM_014913chr1821438 504 ------
NM_014914chr221136 930 ------
NM_014915chr10--11449 --11388
NM_014916chr74619 608 485 269 --1793 --
NM_014918chr15----11582 --
NM_014920chr663450 3237 2584 501 286 258 --12934 --
NM_014921chr1922295 511 ----13014
NM_014923chr1341456 1437 168 50 2633 93 ----
NM_014924chr1452692 2597 2516 1138 786 ------
NM_014926chr311018 --1947 --
NM_014932chr311477 ------
NM_014933chr4--1124 ----
NM_014935chr131508 474 120 13177 13881 --
NM_014937chr103465 232 79 ------
NM_014939chr18----11178 --
NM_014942chr622588 1738 --12437 --
NM_014945chr51128 ----130
NM_014946chr212850 --13057 --
NM_014947chr142963 2928 2742 712 13137 12303 --
NM_014949chr1----160 --
NM_014950chr1431730 1663 1614 ----1462
NM_014952chr1532058 1311 78 --11957 --
NM_014961chr421653 377 1544 12159 --
NM_014962chr2042845 2686 2051 632 --12382 --
NM_014964chr1732272 1592 1518 ------
NM_014969chr171134 1117 944 912 814 318 271 ------
NM_014974chr1031617 1299 677 --11568 --
NM_014978chr1031709 1171 679 ------
NM_014982chr1454248 1349 579 558 296 11423 54949 3641 1983 1757 727 15275
NM_014988chr4--1101 2470 207 --
NM_014989chr631343 787 758 --31932 1534 1262 --
NM_014991chr412585 13275 12795 --
NM_014992chr141262 ------
NM_014994chr1552381 2321 1831 1616 485 --21928 463 --
NM_014999chr1241386 1140 286 196 ------
NM_015000chr1262276 2105 1051 751 695 274 ----12667
NM_015002chr1232114 2078 1859 --2401 357 --
NM_015008chr353648 2949 2919 714 331 12589 13193 --
NM_015017chr131148 1026 821 ------
NM_015020chr1693594 3328 3115 3064 2776 1468 918 880 534 --13698 --
NM_015024chr811036 --11241 --
NM_015025chr242577 1929 761 648 --12194 11718
NM_015026chr1253781 3316 1711 1688 1582 11163 24705 329 31877 1746 540
NM_015027chr16128 ------
NM_015032chr1332610 2525 777 ------
NM_015037chr10--1246 ----
NM_015040chr243400 2427 1316 401 23302 529 1178 1742
NM_015045chr1042124 2028 167 159 --32018 1985 1815 --
NM_015049chr243121 3026 1005 58 --12624 --
NM_015056chr2162626 1978 1711 913 804 48 --1364 1957
NM_015061chr91886 ------
NM_015062chr101210 ------
NM_015068chr773967 3488 3428 2721 2549 1088 985 13592 ----
NM_015071chr576245 5877 4434 4195 4002 478 231 16232 ----
NM_015072chr142250 76 --1386 --
NM_015074chr184884 4202 4086 3282 1316 1108 176 137 --33711 596 347 --
NM_015075chrX1648 --21797 1521 --
NM_015076chr6114196 4068 3528 3147 1651 1225 862 536 288 270 63 13508 21550 1326 14518
NM_015080chr111714 ------
NM_015087chr132756 443 1383 --12413
NM_015090chr136057 2430 799 --21572 564 --
NM_015091chr141281 --190 --
NM_015092chr16104647 3510 3351 1759 1547 1224 898 459 176 146 --44003 1847 1394 964 --
NM_015093chr61592 --11624 11434
NM_015094chr2234509 1586 900 ------
NM_015097chr322346 1876 --21849 284 --
NM_015100chr111255 --1783 --
NM_015107chrX1110 ------
NM_015110chr922294 822 ----1270
NM_015115chr473098 2247 915 799 411 353 103 12494 ----
NM_015116chr1321656 1629 --11115 11141
NM_015124chr2232409 604 557 ------
NM_015125chr19----2484 421 --
NM_015130chr4----11125 --
NM_015132chr721976 461 ------
NM_015137chr81183 --12377 11901
NM_015138chr15----22659 706 --
NM_015141chr392728 2464 2199 2174 1928 1743 1690 543 176 --2752 596 --
NM_015143chr431016 257 134 --21205 50 --
NM_015144chr1664008 3727 3196 2898 672 498 23051 2554 ----
NM_015149chr121748 1417 ------
NM_015151chr214865 655 316 158 11015 1330 --
NM_015153chr61553 ------
NM_015155chr1042825 2446 1082 646 2561 276 22080 1062 --
NM_015156chr1473285 3243 2728 2504 1408 1365 1148 ------
NM_015157chr1111173 ------
NM_015161chr1631287 563 66 ------
NM_015162chr152396 95 ------
NM_015169chr81369 ------
NM_015170chr82623 150 --1342 --
NM_015176chr161248 1208 1101 711 678 214 ------
NM_015180chr142920 289 ------
NM_015184chr3177 ------
NM_015192chr2032799 2769 761 --32792 2064 2006 --
NM_015196chr41107 ------
NM_015198chr721230 920 ------
NM_015199chr331112 294 67 --11864 --
NM_015200chr432591 1968 851 ----11675
NM_015203chr1123 ----1196
NM_015206chr1553508 2816 2785 216 118 --22893 624 --
NM_015208chr1874050 3837 3385 2824 1513 828 240 --11124 --
NM_015209chr13745 454 114 ------
NM_015210chr182969 38 --1975 --
NM_015215chr152896 2710 2362 1165 799 --42691 2108 204 198 --
NM_015216chr551504 1176 1036 977 314 ----172
NM_015225chr973049 2598 2359 1184 855 393 104 --22646 186 --
NM_015226chr161137 23233 2744 ----
NM_015231chr112129 76 ------
NM_015233chr1332522 2217 339 1175 1492 --
NM_015236chr421246 90 ------
NM_015247chr16114962 4846 4698 3899 3576 1328 1157 481 275 196 190 11903 25194 3958 --
NM_015250chr931807 1663 768 --1348 --
NM_015251chr162764 673 --21476 147 --
NM_015262chr101152 ----1137
NM_015263chr152821 748 1247 ----
NM_015265chr232657 2365 2246 --21969 884 1328
NM_015267chr1221746 1583 22021 57 --12058
NM_015269chr11622 ------
NM_015270chr1221969 509 --11860 --
NM_015271chr474085 3831 2918 1663 799 696 39 13043 11484 12616
NM_015272chr1612010 --2566 291 --
NM_015275chr121527 11430 11536 --
NM_015277chr1841337 1279 587 447 --3431 60 52 --
NM_015278chr623099 316 1238 33212 2740 2161 --
NM_015285chr1852299 2203 1924 365 345 ------
NM_015288chr543865 3196 2976 1512 ------
NM_015291chr132773 2421 2145 --13388 --
NM_015294chr17----21148 944 --
NM_015296chr132893 477 --11102 --
NM_015299chr1431227 878 785 --1983 --
NM_015308chr111880 --1765 --
NM_015310chr896809 6716 6490 5750 3259 3068 1671 559 115 25101 1679 26867 3081 18327
NM_015313chr1184501 4469 3679 1477 1158 920 769 187 --14678 1310
NM_015315chr512206 --12789 --
NM_015320chr221006 157 ------
NM_015326chr1--11034 ----
NM_015327chr1----1314 --
NM_015328chr732870 2862 2604 12052 ----
NM_015329chr1942267 2101 1829 527 ------
NM_015331chr1----1579 --
NM_015335chr1242457 2171 862 124 --12128 --
NM_015336chr122683 334 1962 22011 1789 12528
NM_015338chr2031708 1460 339 ------
NM_015344chr852133 2031 1959 1912 347 ----1551
NM_015347chr1292677 2288 2247 1909 1853 850 776 341 256 1953 52345 2095 1902 1153 689 --
NM_015349chr662702 2678 2604 2005 1041 284 --1926 --
NM_015355chr1741921 727 610 493 --1222 1334
NM_015358chr2121056 134 ------
NM_015359chr822412 135 ------
NM_015361chr21746 --2784 173 1872
NM_015365chrX64170 3804 3046 2867 1264 182 --12608 --
NM_015375chr1124361 4337 3962 3882 3782 3714 3573 3131 3076 1979 936 726 11190 24916 1673 --
NM_015378chr142373 2206 419 253 ------
NM_015381chr2211786 ----1753
NM_015382chr141492 ------
NM_015385chr1042366 2169 958 599 --12830 1829
NM_015387chr231931 49 24 ----12116
NM_015397chr921922 1847 1140 ----
NM_015409chr1242710 772 664 205 --12716 11923
NM_015423chr1131588 497 207 21687 1410 ----
NM_015424chr11162 ------
NM_015429chr321031 382 ----11068
NM_015435chr841491 1426 1167 205 ------
NM_015443chr172279 211 --1618 --
NM_015446chr1----21568 434 21660 1177
NM_015455chr573541 3487 3175 3048 650 622 496 --13088 14041
NM_015457chr11--1699 ----
NM_015458chr864940 4908 4149 3939 906 879 --13375 --
NM_015460chr311782 --11465 --
NM_015464chr7------1226
NM_015475chr22889 132 1693 ----
NM_015477chr152963 62 ----1388
NM_015483chr71979 ----1446
NM_015488chr2--11646 11620 --
NM_015508chr341321 217 111 49 11358 ----
NM_015520chr332526 2517 2076 --22105 839 --
NM_015523chr11----1235 --
NM_015525chr6----125 --
NM_015530chr22264 209 --1399 1842
NM_015534chr11988 ------
NM_015535chr264049 1627 1521 1228 548 229 22959 2681 32694 497 410 --
NM_015542chr10----11125 --
NM_015548chr63956 769 243 138 --1989
NM_015549chr141550 ------
NM_015550chr743483 3305 629 387 --22530 543 --
NM_015554chr152164 97 2346 201 52264 2181 545 451 23 11137
NM_015555chr61357 --11279 --
NM_015560chr332797 219 153 ------
NM_015564chr553381 3177 827 815 213 1776 ----
NM_015567chr1321155 852 --31136 930 821 134
NM_015571chr631921 1757 821 22122 205 1686 12632
NM_015575chr243689 3472 1233 540 ------
NM_015576chr372953 1911 1087 824 655 496 316 ------
NM_015577chr531612 380 101 ------
NM_015578chr1931529 1411 276 ------
NM_015607chr1------1147
NM_015609chr142967 170 124 70 ------
NM_015610chr731753 1140 65 --11865 --
NM_015622chr7189 ------
NM_015626chr1721197 128 --1134 --
NM_015627chr13665 613 366 ------
NM_015630chr221114 862 --1259 --
NM_015635chr941365 803 432 123 --11983 --
NM_015640chr175172 4697 4211 2031 1698 635 259 --1301 --
NM_015641chr731239 328 197 --31220 1057 53 --
NM_015646chr1241269 1080 518 313 ------
NM_015649chr191154 1344 ----
NM_015652chr10160 ------
NM_015675chr19----1564 --
NM_015678chr1351430 1369 1162 1108 570 --1679 --
NM_015680chr2122 ------
NM_015686chrX52485 2465 2326 1848 812 ------
NM_015691chrX52925 1970 1088 426 357 ----1524
NM_015702chr2127 1118 ----
NM_015711chr191770 ------
NM_015714chr12299 243 --1367 --
NM_015726chr141826 1492 1247 98 --1619 21739 601
NM_015833chr212744 247 --11972 --
NM_015850chr842456 2235 1680 1525 ------
NM_015855chr111686 ------
NM_015866chr121098 422 1499 11517 --
NM_015872chr121628 1380 ------
NM_015878chr811793 --1698 11486
NM_015879chr18148012 7401 7300 6944 6865 6436 5963 2757 1947 1416 1259 923 185 142 27551 2031 88558 8219 8004 6674 1520 597 591 231 --
NM_015881chr113973 574 513 11036 1152 11329
NM_015885chr11----2356 165 --
NM_015888chr153000 2724 2637 2115 1096 ------
NM_015889chr222872 331 ------
NM_015891chr632079 1417 1336 ------
NM_015902chr83798 761 631 --1737 --
NM_015905chr71476 1584 ----
NM_015906chr154014 3903 3831 3030 517 --1758 --
NM_015912chr82894 411 --11984 --
NM_015913chr11738 1313 ----
NM_015939chr204671 613 604 246 --1174 1225
NM_015955chr2------1425
NM_015975chrX21182 205 1297 31833 741 27 11174
NM_015980chr521564 89 --1621 --
NM_015990chr441101 716 265 95 ------
NM_015995chr1565094 4846 4498 2113 949 323 ------
NM_016003chr731753 1140 65 --11865 --
NM_016018chr832432 391 51 --32728 2671 2005 --
NM_016019chr74946 878 730 364 ------
NM_016021chr672968 2567 2037 1997 623 490 56 --12940 12893
NM_016022chr1------1227
NM_016025chr1621381 548 --11789 --
NM_016032chrX21191 149 --1872 --
NM_016040chr122006 1874 12620 32493 619 257 1189
NM_016041chr172276 127 ------
NM_016061chr221092 1025 --31659 1515 1142 --
NM_016072chr1252443 1916 1580 423 374 --22217 1586 --
NM_016073chr1511096 ------
NM_016075chr1312581 1602 ----
NM_016076chr143120 2686 2081 798 22302 431 12053 --
NM_016078chr17----2885 341 --
NM_016083chr673835 3539 3334 3055 1520 1410 1179 --52827 2810 2415 748 556 --
NM_016090chr1111067 ------
NM_016096chr831840 1338 304 ------
NM_016098chr6--2404 338 ----
NM_016099chr81262 --11351 --
NM_016103chr5----1362 --
NM_016107chr52895 310 ------
NM_016120chrX1748 190 ----
NM_016121chr11351 11039 ----
NM_016123chr1231309 1098 474 ------
NM_016129chr42376 76 ------
NM_016131chr211692 --42157 1510 258 239 --
NM_016133chr21249 ------
NM_016141chr32815 217 ------
NM_016144chr5155 ------
NM_016152chr3----11199 --
NM_016169chr1033283 2877 2025 --1413 --
NM_016185chr173301 120 112 --1806 --
NM_016192chr2----1107 --
NM_016195chr102617 93 ------
NM_016201chr341997 1961 1860 1546 --11467 --
NM_016203chr72254 191 ------
NM_016205chr431338 504 139 --1965 --
NM_016206chr397876 7144 6416 6056 2735 1835 1818 1055 193 16910 38477 6433 5492 1943
NM_016211chr4--1124 ----
NM_016213chr15145 ------
NM_016217chr632263 807 458 --23560 222 --
NM_016221chr562155 1485 1463 453 330 111 ------
NM_016224chr621744 1688 1247 1751 1138
NM_016227chr111227 ------
NM_016230chr61404 ------
NM_016231chr1721574 90 ------
NM_016235chr1621272 1231 ------
NM_016240chr821576 433 ------
NM_016248chr1373888 3812 3078 2432 734 341 142 23475 1565 13440 23355 976
NM_016255chr652831 2680 1323 308 276 ------
NM_016258chr1----1690 --
NM_016260chr287507 6847 5033 5003 2458 1920 1252 722 26629 959 46879 6871 5090 2526 25369 65
NM_016269chr421167 981 --2403 341 --
NM_016270chr193420 352 339 ------
NM_016271chr1842136 1686 675 327 --1263 --
NM_016275chr342294 2233 83 34 ------
NM_016277chr661558 1521 1502 1223 478 45 ------
NM_016279chr5169 ------
NM_016281chr1221021 465 --11102 --
NM_016284chr16----2360 188 --
NM_016287chr141812 1627 661 156 --167 --
NM_016289chr232283 1720 40 --22118 740 --
NM_016291chr3123 ------
NM_016297chr253541 2655 2444 2359 478 --23151 317 1187
NM_016303chrX160 ------
NM_016308chr121796 500 11286 ----
NM_016315chr211205 --11632 --
NM_016322chr993069 2971 2117 2031 1044 1032 944 518 61 --11194 --
NM_016333chr161479 ------
NM_016338chr521075 473 1846 ----
NM_016339chr1721585 57 ------
NM_016374chr141394 1222 1129 23 1143 21268 152 131
NM_016374chr141394 1222 1129 23 1143 21268 152 131
NM_016376chr1753483 3391 3056 1455 813 13768 33832 797 781 13878
NM_016377chr631548 1347 364 --11773 --
NM_016395chr1541747 1265 336 175 --11291 --
NM_016396chr1552222 2154 2120 542 523 --196 1693
NM_016422chr1153079 2898 2080 1186 979 12733 --22743 603
NM_016424chr171536 ------
NM_016436chr2082606 2467 2393 2385 2182 2140 1662 752 ------
NM_016441chr262325 1703 1676 832 631 428 --181 --
NM_016447chr71184 ------
NM_016448chr131805 1240 255 ------
NM_016451chr11175 ------
NM_016467chr22532 75 ------
NM_016472chr141996 ----11249
NM_016480chr51110 ------
NM_016485chr631919 901 299 --1911 --
NM_016486chr11420 --1197 --
NM_016507chr171872 11115 1108 1315
NM_016513chr663450 3237 2584 501 286 258 --12934 --
NM_016520chr92320 107 ------
NM_016525chr91238 --1244 --
NM_016530chr1514055 31143 488 408 33725 2603 692 11659
NM_016531chr494124 3704 3555 3460 3353 3310 3049 3035 1068 ----13373
NM_016538chr174474 398 158 31 ------
NM_016542chrX11474 1604 ----
NM_016546chr1231225 415 255 --1421 --
NM_016559chr341130 1113 582 49 ------
NM_016578chr111494 ------
NM_016584chr12----1277 --
NM_016603chr552223 1880 1821 1532 262 22060 80 2122 68 --
NM_016604chr511164 ------
NM_016605chr51350 --22285 438 --
NM_016617chr1321536 659 183 ----
NM_016620chr111340 --1484 --
NM_016621chr1133389 2962 664 --13959 --
NM_016623chr81244 --1521 --
NM_016626chr1841524 1472 524 390 ------
NM_016628chr101664 ----181
NM_016644chr54349 178 112 69 ------
NM_016651chr1411023 ------
NM_016654chr1521331 898 ------
NM_016656chrX2383 265 ------
NM_016818chr212669 574 ------
NM_016823chr1721089 972 ------
NM_016830chr12----1517 --
NM_016930chr41925 --168 --
NM_016936chr166692 515 366 276 146 136 12095 ----
NM_016946chr143640 2624 410 335 --21427 33 --
NM_016950chr4--11182 21485 443 --
NM_016953chr21117 15456 45533 4778 4747 1721 --
NM_017409chr121571 ------
NM_017410chr1231224 1124 296 ------
NM_017412chr81265 --11003 --
NM_017415chr574148 4017 4008 3934 3301 1434 1171 --34260 1346 573 --
NM_017420chr1483674 3558 3043 2929 1360 912 509 182 12953 13008 --
NM_017423chr431901 1776 1467 --12078 --
NM_017426chr41264 1502 1427 --
NM_017447chr2131674 836 442 --22741 540 11313
NM_017455chr152736 357 --1963 --
NM_017456chr1751620 1272 506 490 74 ------
NM_017519chr61264 --1327 --
NM_017545chr201598 ------
NM_017548chr341996 815 351 137 --21909 1898 --
NM_017551chr1012697 ------
NM_017553chr153844 830 159 ------
NM_017558chr161453 ------
NM_017563chr386390 5937 5727 4995 4268 418 330 138 --12260 --
NM_017567chr2----1119 --
NM_017569chr13147 ------
NM_017577chr31493 ------
NM_017580chr1032338 2290 1884 21921 370 ----
NM_017582chr141779 1201 667 577 --11236 --
NM_017590chr2221012 508 --22715 2505 --
NM_017593chr41134 --175 --
NM_017594chr922607 672 --12917 21103 115
NM_017595chr1731712 1214 636 ----1456
NM_017602chrX4766 702 257 162 ------
NM_017610chr1521895 1476 --2425 263 1713
NM_017617chr941405 1374 204 60 --1163 --
NM_017626chr1021300 68 ------
NM_017629chr13627 227 132 11193 11279 --
NM_017632chr41309 ------
NM_017633chr663565 2813 2752 2477 1555 1426 12773 11563 --
NM_017634chr821805 1662 --1354 --
NM_017635chr1141283 523 190 94 --11470 --
NM_017637chr989338 7338 6099 3632 3486 1805 1460 795 21445 1211 59135 8455 2438 820 85 31941 121 78
NM_017640chr6----1248 --
NM_017641chr121168 ----179
NM_017643chr1742442 2048 551 273 --11242 --
NM_017644chr331927 888 440 14876 11902 --
NM_017650chr765301 5157 3910 3762 825 170 23930 457 65894 4300 4244 2247 1047 152 14998
NM_017657chr21378 ------
NM_017658chr14114440 4016 3963 1502 1246 1217 515 279 146 92 44 --31483 1020 255 --
NM_017661chr15144 --1427 --
NM_017679chr173622 278 187 ------
NM_017680chr92732 342 ------
NM_017686chr11423 21054 792 --1375
NM_017693chr13--1480 ----
NM_017694chr221760 1600 --21580 1473 --
NM_017700chr41129 --1543 --
NM_017709chr173282 3144 1260 1242 1033 650 87 --11352 --
NM_017714chr202123 37 1158 --1667
NM_017715chr73537 511 165 ------
NM_017719chr31539 2673 295 12330 1317
NM_017734chr12242 52 ------
NM_017736chr1641932 1165 758 110 --1459 --
NM_017737chr121352 159 --12060 --
NM_017738chr93887 275 68 1479 ----
NM_017742chr1861914 1839 1300 1254 1214 495 11536 11804 --
NM_017744chr132192 301 122 12272 1444 11726
NM_017752chrX32115 1812 179 ------
NM_017753chr91252 ------
NM_017754chr645028 3061 1847 282 24635 3581 13611 --
NM_017758chr1711506 --1449 --
NM_017761chr13504 432 133 11512 2471 180 --
NM_017762chr1572305 2179 1778 963 622 604 126 ------
NM_017778chr851327 1102 1066 463 129 --11248 --
NM_017780chr82675 192 ------
NM_017786chr82607 126 ------
NM_017787chr1032855 1867 1857 11825 1146 --
NM_017798chr20----1166 1157
NM_017799chr141279 ----1660
NM_017801chr3144 ------
NM_017811chr94763 528 221 25 --12594 --
NM_017813chr864475 3643 1155 708 627 344 25570 4058 --15268
NM_017824chr1032355 885 209 22292 139 179 --
NM_017831chr1844026 3557 1690 568 --24636 1286 1149
NM_017847chr141759 790 603 201 ------
NM_017848chrX64173 1391 1265 1214 723 660 1373 24021 1802 --
NM_017851chr151813 ----1306
NM_017856chrX51942 1696 675 155 99 ------
NM_017857chr111682 ------
NM_017869chr16----1627 --
NM_017893chr1041167 1020 982 547 ------
NM_017902chr1064852 4841 3577 2048 1696 255 15755 --1105
NM_017910chr2191 --1369 --
NM_017913chr9----191 --
NM_017921chr1742323 1835 1684 616 --11958 --
NM_017922chr141240 --1271 --
NM_017925chr941826 1304 453 156 --11367 --
NM_017933chr231637 1609 1429 ----11034
NM_017935chr41224 --1256 --
NM_017938chrX31485 761 267 --12037 --
NM_017944chr1152992 2723 2557 209 194 --12236 1694
NM_017948chr91349 --1173 --
NM_017952chr283874 3097 2948 2916 2865 2798 1698 1501 21107 224 12909 --
NM_017953chr131164 474 59 1237 1220 --
NM_017954chr72546 321 ----41688 1293 1230 493
NM_017958chr272578 2135 782 482 287 141 70 --22595 993 --
NM_017964chr2174 ------
NM_017969chr2----1171 --
NM_017974chr2----11041 --
NM_017987chr101509 --21379 363 --
NM_017988chr122699 92 --1868 --
NM_017994chr732531 1899 1142 --22605 442 --
NM_018010chr311287 --11471 --
NM_018011chr131425 ------
NM_018013chr621215 466 12594 21168 568 11941
NM_018014chr2--1978 1486 --
NM_018017chr1021031 161 ------
NM_018027chr1053318 2714 1249 540 219 ------
NM_018030chr181839 --2881 133 2908 216
NM_018032chr162391 240 ------
NM_018046chr551874 1719 1458 1383 601 1617 ----
NM_018048chr1212030 ----11620
NM_018061chr131469 384 171 --2228 119 --
NM_018063chr101351 1136 ----
NM_018078chr43839 795 178 11074 ----
NM_018084chr252075 1180 1032 487 263 --41284 1053 936 855 23080 2994
NM_018085chr167593 6134 5043 1837 1416 1203 32917 2614 1627 77168 5382 5349 2634 1746 1280 81 --
NM_018086chr241871 1606 1547 684 ------
NM_018092chr161513 --21088 608 --
NM_018098chr3290 77 --11036 --
NM_018103chr1----188 --
NM_018105chr8----1912 --
NM_018116chr11507 --1119 --
NM_018117chr101492 --1695 --
NM_018120chr81458 --1135 --
NM_018121chr1042597 2571 2452 2341 --73052 2775 2658 2130 984 962 561 --
NM_018126chr43601 200 56 --11087 --
NM_018128chr1711419 --11019 --
NM_018133chr321981 1633 ----1873
NM_018137chr12515 273 1244 ----
NM_018150chr11894 ------
NM_018151chr21614 ------
NM_018155chr342851 2225 2192 21 --12557 43411 3382 3176 763
NM_018156chr142373 2206 419 253 ------
NM_018157chr1253269 2827 2244 1097 751 --22235 2050 --
NM_018159chrX3645 186 89 11102 ----
NM_018164chr12169 ------
NM_018171chr122295 244 ------
NM_018176chr431549 1189 1118 2342 258 --1173
NM_018181chr1851760 1421 562 510 304 --21778 1265 --
NM_018182chr1711989 --31413 900 588 --
NM_018184chr351899 1858 1524 617 138 11397 32025 1977 1411 --
NM_018192chr3------11049
NM_018200chr1531682 831 543 --12365 --
NM_018206chr16--1301 ----
NM_018208chr131186 151 39 ------
NM_018211chr111857 --21832 394 1426
NM_018237chr101225 ------
NM_018243chr453315 3205 2817 2606 1268 --31448 912 410 --
NM_018247chr632341 2210 1919 --12168 --
NM_018254chr142056 947 658 490 11829 ----
NM_018257chr2021930 1847 --11830 --
NM_018263chr21651 1843 --22465 237
NM_018266chr31942 1371 ----
NM_018270chr202611 337 ------
NM_018287chr1021044 421 --4954 354 242 113 --
NM_018293chr332970 2557 2308 --22889 2796 --
NM_018299chr842556 526 151 56 12484 22624 136 12436
NM_018307chr171990 ------
NM_018310chr82434 22 ------
NM_018313chr321874 719 --1112 --
NM_018314chr111754 --1711 --
NM_018325chr921577 1455 --11017 --
NM_018327chr2021529 1395 ----11772
NM_018330chr1011675 --31489 1277 1267 --
NM_018334chr71187 ------
NM_018361chr853786 3447 2977 1169 766 --21176 321 --
NM_018362chr1153559 3083 3065 2849 1394 23592 3538 41301 528 521 316 --
NM_018364chr153760 3728 3027 582 403 13006 --13392
NM_018368chr6----154 --
NM_018370chr1221799 1594 1469 ----
NM_018374chr733781 1319 191 15040 ----
NM_018383chr21672 ------
NM_018387chr91451 ------
NM_018388chrX11009 11344 ----
NM_018398chr3----1324 --
NM_018403chr373133 2993 2735 1278 1053 922 599 ------
NM_018413chr121273 ------
NM_018416chr1222567 1759 11836 --1937
NM_018426chr61567 ------
NM_018429chr542096 1774 588 204 12193 ----
NM_018433chr22580 574 ------
NM_018440chr8137946 7856 7332 6385 6171 5880 5317 3087 2502 1286 827 715 333 28682 5562 38043 2572 2121 --
NM_018441chr21539 --166 --
NM_018442chr1--124 ----
NM_018444chr851752 1717 1543 900 459 1109 1218 --
NM_018445chr151224 ------
NM_018446chr3129 ------
NM_018448chr12147 1173 ----
NM_018457chr122444 75 ------
NM_018462chr31221 ------
NM_018464chr101145 --1360 --
NM_018465chr91221 ------
NM_018469chr1751499 1419 1309 1114 73 --21024 555 11462
NM_018471chr2----1440 --
NM_018477chr1441024 829 743 136 ------
NM_018482chr832091 1914 600 1247 --1805
NM_018488chr17169 --1584 --
NM_018489chr151786 776 585 303 293 1142 ----
NM_018490chr1131871 1536 89 ------
NM_018557chr241492 1289 662 212 --1365 1340
NM_018566chr1115085 4994 4412 4260 4073 3500 1606 1544 1143 990 886 ----14695
NM_018571chr21114 ------
NM_018584chr12960 84 --1484 --
NM_018638chr1254953 4904 4675 4126 455 --11398 14394
NM_018640chr122692 564 12492 --1383
NM_018650chr131750 1539 66 1633 ----
NM_018652chr152789 286 1961 ----
NM_018657chr31651 --3845 797 290 --
NM_018667chr163506 315 151 ------
NM_018671chr151231 ------
NM_018682chr72715 76 --1545 --
NM_018685chr71822 --185 --
NM_018689chr1532443 920 811 --22691 659 --
NM_018695chr552292 2285 1779 1716 872 --31747 1535 819 1695
NM_018696chr181132 ------
NM_018700chr531508 1284 1066 11242 1458 --
NM_018703chr16------1116
NM_018704chr1--11548 1677 --
NM_018710chr83988 924 160 --1440 --
NM_018712chr1121437 522 ------
NM_018713chr13875 264 40 1892 1246 --
NM_018715chr132086 861 61 --1118 --
NM_018717chr432736 2383 503 --12354 --
NM_018718chr732072 599 60 ------
NM_018719chr711035 --1341 --
NM_018728chr1511128 --123 1539
NM_018834chr52234 106 --1825 --
NM_018840chr201381 ------
NM_018841chr123915 3397 13317 33852 3720 2960 --
NM_018844chr721740 90 --11699 --
NM_018847chr951685 1438 661 450 164 ------
NM_018890chr731031 541 339 ------
NM_018898chr512264 1158 ----
NM_018899chr512264 1158 ----
NM_018900chr512264 1158 ----
NM_018901chr512264 1158 ----
NM_018902chr512264 1158 ----
NM_018903chr512264 1158 ----
NM_018904chr512264 1158 ----
NM_018905chr512264 1158 ----
NM_018906chr512264 1158 ----
NM_018907chr512264 1158 ----
NM_018908chr512264 1158 ----
NM_018909chr512264 1158 ----
NM_018910chr512264 1158 ----
NM_018911chr512264 1158 ----
NM_018912chr521678 627 ------
NM_018913chr521678 627 ------
NM_018914chr521678 627 ------
NM_018915chr521678 627 ------
NM_018916chr521678 627 ------
NM_018917chr521678 627 ------
NM_018918chr521678 627 ------
NM_018919chr521678 627 ------
NM_018920chr521678 627 ------
NM_018921chr521678 627 ------
NM_018922chr521678 627 ------
NM_018923chr521678 627 ------
NM_018924chr521678 627 ------
NM_018925chr521678 627 ------
NM_018926chr521678 627 ------
NM_018927chr521678 627 ------
NM_018928chr521678 627 ------
NM_018929chr521678 627 ------
NM_018945chr653018 2809 1417 1127 543 --21441 911 --
NM_018951chr711159 --1811 --
NM_018970chr722856 2500 11133 ----
NM_018976chr1232810 2271 1020 --12480 --
NM_018979chr1222551 149 --32587 2570 862 1105
NM_018993chr2011326 --11432 --
NM_018999chr1064638 4512 4290 3942 1490 665 --24353 3989 --
NM_019001chr374724 4048 1909 382 264 148 90 --34169 3274 188 --
NM_019004chr71934 1644 12305 31680 766 196
NM_019006chr15----1618 --
NM_019027chr451973 1752 669 348 268 ------
NM_019035chr421940 1277 --11560 1104
NM_019041chr632134 1912 167 ----12630
NM_019042chr7----2379 65 --
NM_019044chr294462 4314 3542 3319 3292 1560 960 881 245 1519 --1291
NM_019045chrX1328 ------
NM_019046chr102773 210 ------
NM_019049chr11160 --1113 --
NM_019050chr452020 649 532 498 197 ------
NM_019059chr73518 328 154 ------
NM_019063chr252275 1954 458 410 309 ------
NM_019071chr72272 198 --196 --
NM_019074chr15159 ------
NM_019084chr1022433 730 ----12599
NM_019091chr231165 1100 992 --1103 --
NM_019095chr201153 ------
NM_019114chr921853 554 --1830 --
NM_019116chr1643709 2476 1084 428 --33212 3009 161 --
NM_019117chrX12655 --11362 --
NM_019555chr351409 1373 579 88 58 ------
NM_019557chr11334 ------
NM_019558chr2--1318 1361 --
NM_019593chr2033061 2709 298 1375 22497 441 --
NM_019596chr2162567 2124 1848 714 667 459 12575 ----
NM_019597chrX2749 207 ------
NM_019600chr151203 --2785 516 --
NM_019606chr7----1397 --
NM_019842chr61357 ------
NM_019848chrX269 62 ------
NM_019854chr121697 ------
NM_019859chr10----1599 --
NM_019885chr242811 2518 1123 675 --12924 --
NM_019891chr131115 964 345 ------
NM_020066chr11289 2921 402 ----
NM_020116chr4------21399 52
NM_020122chr2105974 5928 5421 4940 4735 3738 2349 1963 1824 932 --12002 --
NM_020123chr1031006 334 114 1404 1978 --
NM_020132chr2144905 4103 3474 1865 --11369 --
NM_020134chr22394 190 --1809 --
NM_020137chrX----1352 --
NM_020141chr1----11889 --
NM_020144chr772079 1686 1413 1311 727 604 546 --21640 733 --
NM_020148chr1872982 2056 1089 581 412 212 113 ------
NM_020150chr1012252 --11703 --
NM_020154chr15124 ------
NM_020156chr72600 45 1586 165 --
NM_020159chr431719 596 51 ------
NM_020163chr322300 2149 ----12016
NM_020168chr151917 --11357 --
NM_020177chr512291 ------
NM_020178chr172880 212 --21109 966 --
NM_020182chr2043327 1134 618 59 ------
NM_020190chr11465 ------
NM_020193chr1121229 89 1101 2193 23 --
NM_020194chr23589 534 84 --1611 --
NM_020198chr1721128 322 11077 11099 --
NM_020199chr5--192 31216 1161 174 --
NM_020205chr133130 2275 205 --1803 23447 3250
NM_020210chr15----1977 --
NM_020225chr41302 ------
NM_020226chr41313 --1497 --
NM_020228chr1152427 1613 1037 438 424 ------
NM_020245chr6124998 4800 4686 4632 4350 3900 1865 993 539 483 369 234 --24617 1597 13921
NM_020309chr191835 --1709 --
NM_020310chr1732819 2781 185 ------
NM_020315chr22--21039 328 ----
NM_020317chr11100 --142 1109
NM_020319chr74820 695 682 70 --1933 --
NM_020337chr42440 243 --21173 1139 --
NM_020338chr1053286 3268 3171 3060 1329 ------
NM_020340chr612281 12067 2879 74 --
NM_020341chr203482 399 96 --12045 --
NM_020342chr252353 1921 534 106 67 ------
NM_020346chr1131535 1262 517 --1219 1372
NM_020348chr1012627 22756 2484 21055 1004 --
NM_020357chr32546 509 11413 ----
NM_020382chr12----1243 --
NM_020390chr354944 4653 3782 3272 398 13707 74597 4397 4184 3221 1525 1415 451 --
NM_020403chr1311671 --2305 260 1569
NM_020405chr1774005 3558 3026 1284 1204 995 925 --34486 3634 1436 --
NM_020423chr1----1237 --
NM_020428chr1921139 191 ------
NM_020432chr731638 1588 401 --1719 1222
NM_020440chr122460 205 --12593 --
NM_020443chr147034 5630 2483 1290 11534 --12747
NM_020452chr122074 1648 ------
NM_020453chr43709 271 109 --11979 --
NM_020456chr1351490 1461 609 201 34 11565 12274 --
NM_020463chr211210 --11451 --
NM_020466chr6104804 3983 3688 3246 1957 1537 1216 784 448 331 23851 1358 33454 544 178 23109 54
NM_020473chrX91861 1414 1378 1270 1259 776 757 625 336 ----1198
NM_020474chr1821977 1871 --11292 --
NM_020478chr82820 424 ------
NM_020482chr61234 ------
NM_020529chr141465 ----1104
NM_020532chr24922 899 381 144 ------
NM_020546chr543176 2101 1236 193 --21174 658 --
NM_020631chr141223 1060 943 486 --21043 154 --
NM_020640chr352307 1862 792 490 461 ----21526 696
NM_020644chr112859 651 ------
NM_020647chr812156 --1380 22196 929
NM_020648chr1822781 753 ----11930
NM_020651chr221293 106 ------
NM_020654chr321452 64 --1335 --
NM_020655chr1621439 962 ------
NM_020673chr2067144 5515 1877 1703 549 346 11068 12386 26727 2379
NM_020689chr2031699 1073 437 ------
NM_020692chr14135 --1391 1997
NM_020693chr11178 ------
NM_020699chr165332 5235 4023 1713 1590 91 11916 --1581
NM_020703chr11587 ------
NM_020713chr2022305 2179 --32949 2686 2098 --
NM_020718chr1676129 5824 1874 1862 1616 1431 859 --76498 4175 1263 1113 962 515 96 --
NM_020726chr51208 ----1539
NM_020727chr2144050 3477 3361 817 12966 22881 2767 12828
NM_020728chr742855 2639 1074 986 23067 2117 1813 11241
NM_020732chr61264 --1327 --
NM_020734chr1243364 2464 2155 731 1964 11067 12065
NM_020739chr1531583 1348 23 14209 23460 526 --
NM_020749chr82510 37 1265 11400 --
NM_020750chr631409 983 84 ------
NM_020752chr1052200 2001 1943 1078 1036 12773 22254 857 --
NM_020755chr61170 11114 ----
NM_020760chr221848 378 --11391 11990
NM_020762chr1231016 413 173 ------
NM_020765chr12101 75 ------
NM_020766chrX3750 518 455 --14604 --
NM_020771chr62961 528 ------
NM_020772chr1767940 7826 7779 7101 5332 1296 22889 1483 37120 5721 5639 27809 1953
NM_020773chr432534 1874 666 ----11896
NM_020774chr1845754 4310 2343 2138 46022 5581 4353 1268 54935 4122 842 612 297 --
NM_020779chr242981 941 624 532 --12334 --
NM_020782chr1234607 1416 736 33303 1799 1016 24403 4013 14179
NM_020783chr1822207 2146 --31783 1506 897 --
NM_020786chr1622045 811 11431 ----
NM_020791chr1741324 1003 509 183 ------
NM_020792chr332254 1779 682 --32385 454 70 11870
NM_020794chr121389 226 ------
NM_020796chr5--12283 --12749
NM_020800chr321405 117 ----21394 231
NM_020801chr532089 891 805 ----11619
NM_020804chr62783 168 ------
NM_020805chr1861982 545 468 441 350 84 11818 11784 --
NM_020809chr1111614 1305 22213 1512 --
NM_020810chr141908 --32892 2877 109 --
NM_020819chr621125 1097 ------
NM_020824chr102153 130 ------
NM_020825chr1683365 3154 3092 2340 925 665 380 331 --23073 2553 --
NM_020841chr1283167 2699 2663 2524 1031 862 749 299 --12501 13652
NM_020843chr15----1134 --
NM_020850chr1643136 3121 3108 2371 --13289 --
NM_020854chr184540 144 109 73 1360 164 --
NM_020856chr1971170 1128 413 406 396 363 288 1313 ----
NM_020858chr1532329 517 401 --22386 191 --
NM_020860chr43936 736 457 ----11189
NM_020861chr63905 426 170 ------
NM_020868chr22255 150 --11498 --
NM_020870chr41226 --1468 --
NM_020871chrX32408 622 560 ----12535
NM_020872chr3----11726 --
NM_020888chr14784 447 399 189 ------
NM_020899chr1732514 1865 718 --11717 --
NM_020909chr274142 4090 1581 1438 1085 809 607 24059 792 1439 --
NM_020917chr1963934 3724 2789 1146 1136 581 1328 ----
NM_020918chr1063403 2723 2523 2374 1002 984 11108 43432 3050 2832 1434 --
NM_020921chr1452978 2875 2709 1370 643 12527 22343 34 12738
NM_020922chrX----21853 1481 --
NM_020935chr284555 4096 3802 3742 1617 1084 235 31 11112 ----
NM_020940chr1082718 2255 2230 2171 1125 801 365 274 --11146 --
NM_020946chr941753 1257 538 276 11529 ----
NM_020948chr163170 2912 2693 2449 2362 1143 12648 11015 --
NM_020952chr91178 ------
NM_020960chr954856 3757 3525 3062 162 13679 44764 3902 3564 1622 --
NM_020962chr1532403 2366 502 ----1581
NM_020967chr2031204 346 96 --1192 --
NM_020977chr471977 1850 1758 1535 721 305 135 --21441 1433 --
NM_020980chr1521139 343 --1695 --
NM_020983chr1221969 509 --11860 --
NM_020987chr1021283 1183 ------
NM_020993chr1222296 817 12600 --11821
NM_021005chr151199 1996 1430 1324
NM_021007chr221680 1664 ------
NM_021012chr171638 --33214 2934 2476 --
NM_021033chr1333380 1074 952 ------
NM_021038chr353136 2763 1346 931 295 --12452 13194
NM_021061chr824180 3755 1148 --1417
NM_021069chr4--11682 3678 525 438 --
NM_021072chr51552 ------
NM_021079chr1733321 2956 687 12908 12618 --
NM_021083chrX73565 3492 3309 3273 2937 2557 298 13551 11405 --
NM_021088chr231873 785 414 1487 1298 --
NM_021090chr2244202 1868 1145 793 --21762 88 --
NM_021097chr262927 2762 2686 924 245 138 ------
NM_021101chr352197 1958 1677 805 613 ------
NM_021111chr92551 348 11282 1410 --
NM_021116chr799066 8285 6726 6488 6272 5793 5643 1750 775 17884 --18485
NM_021132chr10--1507 ----
NM_021136chr143583 468 163 1513 1727 1720
NM_021137chr1751586 597 591 502 191 11969 12135 --
NM_021140chrX----1206 --
NM_021145chr72940 719 ------
NM_021149chr1631205 1174 335 ------
NM_021151chr71394 3986 337 25 ----
NM_021159chr421228 345 ------
NM_021160chr61204 ----1178
NM_021180chr1----1774 --
NM_021183chrX12418 1699 21880 1737 --
NM_021189chr11165 --1242 --
NM_021190chr131075 974 530 ----31246 844 340
NM_021191chr1222002 181 22013 1776 --11956
NM_021192chr2----1429 --
NM_021202chr2052511 2206 2074 1921 775 ------
NM_021204chr43959 646 326 ------
NM_021205chr11413 11893 32877 2401 992 --
NM_021215chr2031746 439 367 --3874 743 325 1587
NM_021218chr92991 779 1360 ----
NM_021222chr111437 --21449 467 --
NM_021229chr12130 --21126 896 --
NM_021238chr1231994 771 628 --32053 2012 1614 --
NM_021239chr1431184 358 163 11328 --1343
NM_021240chr9----2475 171 1493
NM_021242chrX3731 280 240 ------
NM_021244chr62175 66 ------
NM_021252chr1031841 1315 696 --21786 1535 --
NM_021255chr1421443 1000 ------
NM_021260chr14------1240
NM_021614chr5----1257 --
NM_021622chr101126 --12272 --
NM_021627chr331059 150 69 ------
NM_021629chr374443 3937 3426 3223 1960 1425 261 --24784 329 --
NM_021633chr131070 311 274 ----1141
NM_021643chr221231 739 1382 ----
NM_021648chr642713 1767 978 211 --22641 1721 1443
NM_021705chr611260 2416 301 ----
NM_021728chr141768 ------
NM_021738chr10----1742 2623 254
NM_021785chrX2367 50 171 ----
NM_021807chr721063 483 1969 ----
NM_021809chr2052345 2293 571 529 164 --11892 --
NM_021813chr655871 5587 4557 3714 862 1650 35197 4813 4705 --
NM_021814chr631147 598 220 ------
NM_021871chr4----147 --
NM_021907chr21251 ------
NM_021911chr565222 4760 3602 3472 1903 1343 1640 ----
NM_021912chr1533851 3393 1588 ------
NM_021913chr1931710 1449 702 ------
NM_021914chr1462263 1831 943 511 501 405 ------
NM_021940chr641364 1224 239 151 ------
NM_021943chr6187 ------
NM_021945chr632364 1309 264 --2654 476 --
NM_021947chr171955 --21145 484 --
NM_021949chrX52463 2098 1038 1021 446 ------
NM_021950chr1121443 1386 --12229 --
NM_021956chr621373 266 ------
NM_021961chr11137081 6943 6315 6207 6004 5623 4988 4588 2252 1381 1007 788 362 26364 5430 36592 4928 659 --
NM_021964chr3106384 4629 4138 4020 2311 1998 1155 560 221 34 32244 2103 927 56547 5925 1294 395 156 1753
NM_021973chr4----2578 115 --
NM_021976chr6----1676 --
NM_021979chr141363 ------
NM_021980chr1041410 1393 380 170 ------
NM_021988chr2011400 ------
NM_021994chr73954 829 436 ----1178
NM_021998chrX--21524 1136 31532 1207 982 --
NM_022006chr19----1372 --
NM_022037chr22677 355 ------
NM_022041chr1612671 --2450 330 --
NM_022048chr1535712 1955 1396 24451 1493 35415 4089 752 --
NM_022051chr13567 179 109 ------
NM_022060chr1411353 ------
NM_022062chr1121433 358 --11761 --
NM_022068chr18182 ------
NM_022075chr13835 802 65 ------
NM_022080chr2031794 627 248 --32432 1897 375 22631 672
NM_022097chr162252 155 --1269 --
NM_022098chr2261407 1196 1006 306 105 93 ------
NM_022114chr154628 4044 3849 3697 556 --24658 4056 24467 1691
NM_022118chr13----2187 69 --
NM_022123chr14285 58 ------
NM_022130chr5----188 --
NM_022132chr52119 35 --1125 --
NM_022137chr143842 749 548 --1132 --
NM_022138chr61315 --2107 100 1266
NM_022143chr72989 517 ------
NM_022154chr41296 138 ----
NM_022165chr19264 29 ------
NM_022166chr1666116 5764 4151 2259 1132 220 --15483 --
NM_022170chr721559 1082 ------
NM_022171chr341497 1211 621 207 11113 ----
NM_022173chr22677 355 ------
NM_022346chr4----2346 125 --
NM_022361chr62408 161 ------
NM_022373chr72964 360 ------
NM_022374chr21199 ------
NM_022442chr2011400 ------
NM_022444chr751571 768 443 423 310 --21950 529 --
NM_022456chr1296366 5379 5169 4971 2970 2122 1278 809 215 26211 319 26239 4671 15106
NM_022457chr1----127 --
NM_022459chr13106150 5730 4912 4638 4350 4265 1883 1439 1396 47 ----24692 1811
NM_022465chr1233057 2991 591 --12411 --
NM_022470chr351246 1036 481 396 380 ------
NM_022473chr1554470 3522 2982 1516 1311 13145 ----
NM_022474chr1452787 2768 2066 1023 453 11857 22487 936 --
NM_022475chr4--141 ----
NM_022476chr163421 296 182 --130 --
NM_022479chr711449 ------
NM_022483chr531896 692 586 ------
NM_022485chr32361 87 ------
NM_022488chr31130 ------
NM_022494chr101352 ------
NM_022497chr3123776 3752 3653 3285 3111 2636 1207 1199 997 826 677 123 13256 ----
NM_022566chr152603 177 ------
NM_022572chr2--11646 11620 --
NM_022650chr51206 ------
NM_022652chr121125 --11073 --
NM_022658chr1231339 1173 457 --21130 467 --
NM_022716chr143169 3036 2774 276 --12058 --
NM_022719chr22103843 3789 3723 3215 3127 2490 2424 2385 948 598 ------
NM_022726chr621723 1566 ------
NM_022728chr72679 562 ------
NM_022733chr11778 1274 ----
NM_022739chr17----2852 453 --
NM_022749chr821398 309 --11390 --
NM_022751chr18189 ------
NM_022753chr121736 60 11962 --12580
NM_022763chr332873 2488 2386 --22207 578 1426
NM_022771chr123872 123 58 --1308 --
NM_022776chr321582 78 ------
NM_022780chr221391 1161 --3588 493 53 1266
NM_022781chr962418 2274 2228 908 250 131 ------
NM_022782chr12284 41 ------
NM_022802chr1021257 663 ------
NM_022818chr1631164 500 268 ------
NM_022823chr22438 32 ------
NM_022824chr531641 1189 723 1438 1389 --
NM_022826chr2--1931 ----
NM_022828chr531420 1246 59 1167 11487 11611
NM_022841chr1572728 2586 2138 1989 763 672 618 ------
NM_022843chr1331408 1335 185 --2525 396 11039
NM_022844chr161939 ----1252
NM_022845chr164803 528 503 165 --31518 404 186 21857 1498
NM_022893chr213151 22997 2167 22018 292 --
NM_022894chr221268 550 11441 21135 260 --
NM_022898chr1454631 3849 1381 663 270 --24482 3708 11402
NM_022900chr71226 --11110 --
NM_022918chr1122191 693 ------
NM_022965chr411429 ------
NM_022977chrX22659 1857 --32569 2200 1040 --
NM_023000chr141483 1281 21651 393 --
NM_023001chr141483 1281 21651 393 --
NM_023008chr192325 133 ------
NM_023009chr1----1673 --
NM_023011chr132796 335 ------
NM_023012chr124774 756 536 104 ------
NM_023016chr232511 1920 103 12062 2492 486 12017
NM_023037chr1311043 ------
NM_023067chr351293 1243 403 270 238 ------
NM_023072chr19185 1865 ----
NM_023076chr1641853 992 481 385 22966 566 32166 775 162 --
NM_023105chr842456 2235 1680 1525 ------
NM_023106chr842456 2235 1680 1525 ------
NM_023110chr842456 2235 1680 1525 ------
NM_023111chr842456 2235 1680 1525 ------
NM_023112chr14148 ------
NM_023923chr193756 2486 1414 948 760 538 150 136 83 --23704 1103 --
NM_023925chr12------1251
NM_023927chr5----11054 --
NM_023929chr841796 1081 902 422 --22107 34 --
NM_023940chr431022 292 237 --1956 --
NM_023948chr71154 ------
NM_024007chr532978 1989 1981 --1578 --
NM_024019chr41260 --1163 --
NM_024037chr11840 ------
NM_024052chr1752222 1045 609 594 262 --11998 --
NM_024054chr71341 ------
NM_024060chr11----1221 --
NM_024071chr141445 --1564 --
NM_024089chr13----1164 --
NM_024090chr41759 ------
NM_024102chr1----11196 --
NM_024107chr171583 --1594 --
NM_024117chr921160 410 --1593 --
NM_024312chr122381 47 137 1410 --
NM_024315chr7--122 ----
NM_024324chr22----1150 --
NM_024325chr2021240 1071 ------
NM_024344chr15----1502 --
NM_024345chr971966 1785 1576 1351 1313 1289 153 ----24522 4104
NM_024348chr91251 ------
NM_024408chr123480 3218 --1333 --
NM_024416chr921305 300 1394 ----
NM_024429chr72254 191 ------
NM_024490chr151539 ------
NM_024491chr3----1621 --
NM_024494chr11287 ------
NM_024496chr14--1281 ----
NM_024501chr22494 141 ------
NM_024511chr443330 2783 828 652 1211 ----
NM_024524chr312097 12957 12662 --
NM_024525chr11559 ------
NM_024539chrX31190 1085 474 --21075 972 --
NM_024541chr1051730 1544 494 487 139 11838 ----
NM_024546chr1351228 1203 976 896 803 ------
NM_024548chr321386 291 --21164 241 --
NM_024551chr12151 --22265 2015 --
NM_024551chr12151 --22265 2015 --
NM_024554chr141612 1245 492 185 1241 ----
NM_024556chr111386 ------
NM_024557chr11--11573 188 --
NM_024561chr1321070 444 --21087 73 --
NM_024569chr122806 198 1498 1338 --
NM_024574chr4----1107 --
NM_024582chr44746 392 252 217 ------
NM_024583chr21854 --1243 --
NM_024607chr883598 3511 3230 1696 1195 984 661 226 --34447 1615 584 --
NM_024612chr175979 801 363 352 106 1767 ----
NM_024615chr5--1230 ----
NM_024617chr91715 ------
NM_024635chr91228 ------
NM_024643chr141120 ------
NM_024645chr8142 ------
NM_024659chr21371 ----1706
NM_024663chr20151 ------
NM_024665chr384674 3679 1852 1341 1300 961 587 74 1251 44251 3506 3344 1332 14213
NM_024670chr1031760 1549 1364 --1462 1269
NM_024674chr173158 3150 2675 2465 777 667 84 --1699 11290
NM_024692chr221564 1234 --1293 --
NM_024700chr11228 --31147 796 783 --
NM_024702chr172527 87 ------
NM_024704chr201741 --1914 --
NM_024713chr1531335 235 26 11357 1263 --
NM_024721chr842382 871 514 338 --2984 206 1898
NM_024745chr163936 719 311 ------
NM_024749chr11459 --152 --
NM_024751chr43741 655 598 2535 355 1450 --
NM_024755chr152762 376 --1746 --
NM_024757chr911170 ------
NM_024759chr81768 ------
NM_024761chr955252 2147 1235 1228 617 11040 21977 286 --
NM_024770chr295894 5714 5613 4935 4618 4464 1948 888 677 --1148 --
NM_024792chr172953 182 ------
NM_024804chr11129 --1340 --
NM_024824chr1441556 408 277 52 --11409 --
NM_024834chr103516 480 446 ------
NM_024835chr17------1297
NM_024841chr1151848 1627 952 712 348 ----12144
NM_024881chr1993578 3446 2591 1288 1085 986 763 352 341 13814 1921 --
NM_024884chr1494432 3770 561 365 286 126 66 57 26 ------
NM_024896chr952254 982 649 515 225 ------
NM_024899chr182456 167 ------
NM_024900chr431684 1475 855 --11726 11702
NM_024900chr431684 1475 855 --11726 11702
NM_024911chr11204 ------
NM_024930chr5----180 --
NM_024946chr162590 447 ------
NM_024947chr389315 9246 8842 8820 8587 6501 2852 1147 29394 1332 57715 3301 2827 2508 177 26793 2366
NM_024949chr474302 1249 836 804 453 434 321 --23725 3420 --
NM_024953chr1242616 2181 2073 1842 1606 ----
NM_024960chr203450 435 93 ------
NM_024971chr91178 ------
NM_024979chr1341572 1501 1345 468 ------
NM_024991chr1042366 2169 958 599 --12830 1829
NM_024993chr2124 ------
NM_025040chr1952470 2301 2036 1541 1522 --1742 --
NM_025054chr833058 1410 1132 ------
NM_025065chr1195 ------
NM_025069chr81191 ------
NM_025073chr153801 3641 1515 539 316 ----1722
NM_025076chr2----1198 --
NM_025126chr12------1527
NM_025133chr23947 772 423 ------
NM_025134chr1631694 502 200 --11828 --
NM_025137chr15273 31 ------
NM_025138chr131912 --1159 --
NM_025146chr321038 431 --129 12459
NM_025147chr23729 225 96 ------
NM_025151chr842042 1718 1610 822 ------
NM_025154chr721273 362 11086 2287 281 --
NM_025160chr153882 2794 1555 1343 418 --1624 24174 3671
NM_025164chr112866 485 1580 11905 --
NM_025179chr144944 3856 3390 1316 --24526 3703 --
NM_025180chr3103270 3177 2582 2434 2206 734 675 308 174 164 --1905 --
NM_025181chr21181 ------
NM_025184chrX----1835 --
NM_025187chr162465 447 ------
NM_025191chr123457 3374 --1647 1518
NM_025195chr831501 635 45 1687 11538 --
NM_025201chr1531530 1434 323 --11313 --
NM_025203chr241329 341 112 98 1363 ----
NM_025208chr1122443 590 --32211 2103 706 1216
NM_025212chr4131 ------
NM_025235chr1062226 2032 421 294 249 209 1372 11617 --
NM_025237chr171312 ------
NM_025238chr1521528 532 ----1588
NM_025244chr2------182
NM_025248chr1732382 887 865 ------
NM_025250chr742902 2709 797 377 --12861 --
NM_025263chr641221 719 665 192 ------
NM_030583chr82810 390 ------
NM_030594chr1541323 1236 389 161 --1135 1867
NM_030621chr1483953 3812 3574 3075 1509 1453 1312 749 --22905 1389 11646
NM_030625chr101626 ------
NM_030627chr573936 3870 3271 1584 1219 882 45 --13191 23079 797
NM_030629chr16----11473 --
NM_030637chr142678 141 ------
NM_030647chr766016 4878 1703 1515 718 568 16254 2875 147 --
NM_030648chr4105587 3593 3537 2031 1962 1198 976 800 232 54 25296 1127 --13650
NM_030650chr264252 3866 3282 3257 1689 982 176 33948 3340 736 --
NM_030661chr721365 453 1676 1418 --
NM_030664chr1042399 1930 1724 316 --11632 --
NM_030665chr1711419 ------
NM_030670chr1241969 1897 1580 566 ------
NM_030671chr1241969 1897 1580 566 ------
NM_030674chr1255017 4084 1839 1482 254 11699 25659 5425 1883
NM_030751chr1031518 1294 505 --11347 --
NM_030751chr1031518 1294 505 --11347 --
NM_030752chr61171 --1135 --
NM_030755chr1432067 995 321 ------
NM_030756chr10196 ------
NM_030758chr22163 1438 ----
NM_030759chr102536 176 --1662 --
NM_030762chr121682 --21572 1367 --
NM_030780chr821732 1407 --1331 --
NM_030791chr1421141 605 --1148 11360
NM_030799chr542223 815 638 428 --12117 --
NM_030803chr2----11041 --
NM_030806chr1108841 8752 8698 6591 6507 6427 5796 3253 2621 847 --28444 2489 --
NM_030808chr171340 --1241 1908
NM_030815chr201310 --1560 --
NM_030816chr133116 940 849 ----33650 1170 609
NM_030817chr1232863 2666 2355 --43519 3442 3307 2737 11495
NM_030881chr2222352 2171 --1578 --
NM_030884chr322205 254 --22239 1422 --
NM_030885chr322339 85 ------
NM_030906chr112416 53 --1410 --
NM_030911chr1311639 --150 --
NM_030913chr11232 ------
NM_030915chr252343 1635 825 803 480 ------
NM_030917chr41187 ------
NM_030918chr155161 4632 1379 1172 1130 --14108 --
NM_030920chr121889 754 --1336 --
NM_030922chr151274 --2756 343 --
NM_030926chr21889 --194 --
NM_030937chr121289 1107 ----1428
NM_030938chr1721021 151 ------
NM_030939chr61238 --1124 --
NM_030949chr611379 --21101 58 --
NM_030962chr1131231 220 204 --21485 1110 --
NM_030963chr6----2616 93 --
NM_030981chr1131158 338 97 ------
NM_031203chr191171 ------
NM_031208chr163715 344 134 1624 ----
NM_031216chr182645 183 ------
NM_031217chr111129 ------
NM_031226chr153465 116 33 --1811 --
NM_031243chr711613 ------
NM_031262chr911121 --197 --
NM_031263chr911178 --1154 --
NM_031266chr5----1423 --
NM_031267chr7----1512 --
NM_031268chr1654607 4498 4362 3697 134 --33917 3714 1347 --
NM_031283chr22294 138 1619 1318 --
NM_031296chr442671 1762 930 423 ----11970
NM_031305chr421814 1521 ----1358
NM_031362chr262777 2409 2057 1842 1773 877 --22368 798 --
NM_031365chr262913 2545 2193 1978 1909 1013 --22504 934 --
NM_031366chr262913 2545 2193 1978 1909 1013 --22504 934 --
NM_031371chr141394 1222 1129 23 1143 21268 152 131
NM_031371chr141394 1222 1129 23 1143 21268 152 131
NM_031407chrX1341 --1409 --
NM_031411chr512264 1158 ----
NM_031412chr1231126 792 486 ------
NM_031417chr191764 ----11940
NM_031418chr1142698 1065 740 681 --11964 --
NM_031419chr3--11485 ----
NM_031422chr181503 ------
NM_031427chr1454378 4166 1921 1768 1557 14115 55384 5313 5076 3877 2036 --
NM_031435chr1273411 2982 2749 2490 1154 649 358 33096 2991 69 ----
NM_031442chrX63014 2904 2199 2168 2143 383 ------
NM_031453chr1032050 1006 325 1586 ----
NM_031457chr112368 125 ------
NM_031461chr81725 12235 1548 22116 382
NM_031468chr7107098 6681 5697 5254 4982 3172 2572 2312 710 672 --36342 1433 167 --
NM_031469chr644056 1268 814 765 --42883 1178 273 33 --
NM_031483chr2022953 418 --11387 --
NM_031844chr164142 3769 3380 674 465 452 --1735 --
NM_031845chr243610 3045 1477 609 --2663 290 --
NM_031847chr243610 3045 1477 609 --2663 290 --
NM_031849chr512264 1158 ----
NM_031857chr512264 1158 ----
NM_031860chr512264 1158 ----
NM_031886chr1962626 2113 1902 1700 1676 386 12568 --1917
NM_031890chr2252625 2411 2185 815 777 13022 1862 1205
NM_031892chrX1970 ------
NM_031934chr172338 89 ------
NM_031935chr12389 148 --1970 --
NM_031942chr231051 929 359 ----11277
NM_031992chr721559 1082 ------
NM_032021chr11----11101 --
NM_032042chr532816 868 152 12012 ----
NM_032047chr322058 430 ------
NM_032052chr222985 325 ------
NM_032088chr521678 627 ------
NM_032092chr521678 627 ------
NM_032102chr1133019 2260 2050 1931 42960 2495 1092 749 --
NM_032120chr71108 ------
NM_032121chrX11728 --22758 2403 --
NM_032124chr182416 134 --31069 957 832 --
NM_032138chr13----1436 --
NM_032142chr181228 ----1191
NM_032144chr221672 1140 1547 1154 --
NM_032146chr3------1119
NM_032153chr341807 717 678 332 --12762 --
NM_032156chr12------1251
NM_032174chr111488 ------
NM_032177chr52410 86 ------
NM_032182chr101375 ----11053
NM_032186chr111340 --1484 --
NM_032189chr1354840 4305 3666 1893 1229 ------
NM_032193chr1131384 788 732 ------
NM_032199chr1053722 2910 2735 2406 364 13465 13869 23796 996
NM_032208chr222795 2415 ------
NM_032217chr42993 213 --11200 --
NM_032221chr2021489 270 ------
NM_032226chr9----3833 816 776 --
NM_032228chr1143408 2884 1368 962 --22831 2388 --
NM_032229chr131999 --1445 --
NM_032231chr151320 ------
NM_032233chr141670 --2760 331 --
NM_032236chr11180 --1706 --
NM_032239chr441215 924 905 345 --1152 --
NM_032242chr343325 2455 1189 1047 ------
NM_032246chr15----11154 1324
NM_032256chr12--1791 ----
NM_032281chr1922597 1271 --23167 2086 --
NM_032288chr331974 1469 820 --12304 --
NM_032289chr521907 1899 --21685 1312 --
NM_032291chr131626 290 248 --2386 104 --
NM_032299chr11----192 --
NM_032303chr9--11386 1668 --
NM_032320chr114322 193 69 53 ------
NM_032321chr242739 680 269 167 32835 1033 859 1158 --
NM_032352chr1441428 1209 581 424 11403 11133 --
NM_032373chr10105845 5700 4940 4748 4135 3925 2199 878 154 39 14207 11993 14790
NM_032382chr161463 ------
NM_032403chr521678 627 ------
NM_032408chr71217 --11285 --
NM_032410chr811211 ------
NM_032411chr21215 ------
NM_032420chr51347 ------
NM_032424chr1121380 1020 21088 573 11469 --
NM_032431chr1111098 ------
NM_032433chr192617 557 11481 11257 11343
NM_032437chr1----2149 123 --
NM_032438chr61335 --51647 1507 1329 1285 1223 --
NM_032439chr102461 360 ------
NM_032440chr1062876 2614 2004 1860 154 123 ------
NM_032445chr151938 --22411 419 --
NM_032446chr511090 ------
NM_032457chr453678 3113 2452 1307 1167 --11265 --
NM_032458chrX33308 3076 2335 32873 2549 664 13156 --
NM_032466chr83534 460 161 ------
NM_032468chr83534 460 161 ------
NM_032482chr1922736 181 ----1740
NM_032491chr1221049 469 --11025 --
NM_032494chr2142 ------
NM_032499chr1561451 537 467 445 235 69 ------
NM_032505chr382467 1863 941 819 510 495 307 216 1323 32777 2447 2343 --
NM_032509chr81108 --2874 587 12473
NM_032511chr6----1444 --
NM_032521chr20----33040 2387 1165 --
NM_032523chr21156 ------
NM_032532chr6----1656 --
NM_032539chrX1553 --1287 --
NM_032547chr41361 ------
NM_032557chr4124 1302 ----
NM_032558chr911373 --1991 --
NM_032576chrY122 ------
NM_032580chr171233 ------
NM_032582chr1731864 1497 1284 ------
NM_032595chr1731405 624 500 ------
NM_032603chr23732 684 119 ------
NM_032632chr1461981 1560 497 313 218 150 --21463 371 --
NM_032638chr331398 1094 70 ------
NM_032646chr1711807 ------
NM_032663chr1272040 1911 1691 1592 1380 70 44 ------
NM_032682chr363379 2347 864 253 232 223 ----12778
NM_032701chr191634 ------
NM_032727chr1011386 --149 --
NM_032765chr52995 800 ------
NM_032772chr101366 ------
NM_032778chr343124 2533 745 160 --11213 --
NM_032780chr111799 --1164 --
NM_032784chr6----1229 --
NM_032801chr1152535 2513 1626 567 88 ------
NM_032802chr151239 ------
NM_032804chr1031787 949 271 ------
NM_032806chr31359 ------
NM_032815chr1642502 2448 1948 1797 --22495 638 --
NM_032829chr1211163 ----11090
NM_032837chr1731463 475 174 --22167 2128 --
NM_032844chr10----1251 --
NM_032859chr1343976 2800 2775 25 --23452 420 --
NM_032867chr11----1125 1595
NM_032870chr62538 107 --1401 --
NM_032873chr1194456 4269 4218 3758 2977 2795 1116 712 694 --1835 23701 1238
NM_032875chr17----1797 --
NM_032883chr201566 ------
NM_032885chr192271 97 ------
NM_032900chr1043889 3424 2745 2665 --1107 --
NM_032905chr1041169 888 316 308 ------
NM_032906chr41203 --1746 1797
NM_032918chr1231150 228 84 1333 11258 --
NM_032932chr17116442 6096 5858 5770 5714 4519 4451 1933 1609 1102 687 11231 35514 1537 223 --
NM_032936chr71190 ------
NM_032961chr42898 358 ------
NM_032971chrY31022 942 848 ------
NM_032972chrY31022 942 848 ------
NM_032975chr1853324 3255 3072 1239 406 --11109 --
NM_032978chr181151 ------
NM_032979chr181151 ------
NM_032980chr1853324 3255 3072 1239 406 --11109 --
NM_032981chr181151 ------
NM_032991chr421421 113 --1493 --
NM_032998chr12953 340 --1966 --
NM_033014chr921305 300 1394 ----
NM_033016chr221997 --11506 --
NM_033020chr154014 3903 3831 3030 517 --1758 --
NM_033055chr1----195 --
NM_033117chr92375 120 --169 --
NM_033127chr1--2285 137 ----
NM_033132chr1332152 1803 557 --1442 --
NM_033133chr17----12782 13704
NM_033135chr1122443 590 --32211 2103 706 1216
NM_033138chr71536 --21941 415 --
NM_033139chr71536 --21941 415 --
NM_033140chr71536 --21941 415 --
NM_033141chr1442208 1995 1708 114 --31576 607 126 --
NM_033143chr444025 3764 778 522 11610 1914 21848 1827
NM_033147chr21251 ------
NM_033148chr21251 ------
NM_033150chr12287 56 ------
NM_033157chr71536 --21941 415 --
NM_033181chr673835 3539 3334 3055 1520 1410 1179 --52827 2810 2415 748 556 --
NM_033211chr551987 523 388 177 70 11909 ----
NM_033222chr921144 1108 --31278 1016 174 --
NM_033224chr788020 7456 5319 2981 2140 2128 1390 478 16968 17706 1389
NM_033227chr51567 ------
NM_033228chr51607 ------
NM_033254chr3----1126 --
NM_033260chr61144 --181 --
NM_033272chr21333 ------
NM_033285chr8114454 4372 3412 3229 3064 2844 1316 856 698 428 300 --14448 12900
NM_033300chr13399 244 48 ------
NM_033326chr1112381 --184 11759
NM_033331chr933329 2962 456 --13025 --
NM_033334chr91108 --1254 --
NM_033337chr31289 ------
NM_033340chr1021356 22 --1474 --
NM_033360chr1264629 4496 4016 3369 1206 199 --24319 136 --
NM_033387chr922272 2135 1679 --12637
NM_033389chr1734718 4342 1394 13597 24194 78 --
NM_033394chr231125 1076 646 --21617 1483 --
NM_033396chr111314 --1158 --
NM_033425chr1183093 2910 2695 2431 963 928 706 428 23207 181 ----
NM_033426chr1432380 2091 672 1553 12236 --
NM_033427chr72636 310 ------
NM_033430chr443975 3116 304 277 ------
NM_033437chr443975 3116 304 277 ------
NM_033449chr531983 1556 1374 ------
NM_033496chr104590 293 82 38 ------
NM_033497chr104590 293 82 38 ------
NM_033498chr104590 293 82 38 ------
NM_033500chr104590 293 82 38 ------
NM_033503chr1523694 3258 11270 ----
NM_033505chr2116559 5566 5257 5044 4945 4892 4333 2512 2226 715 115 --36544 2079 1325 12346
NM_033512chr852895 2811 2606 602 96 1136 ----
NM_033535chr4----31104 1088 60 --
NM_033540chr32802 100 ------
NM_033546chr181161 ------
NM_033550chr2052271 2056 2008 1810 441 --1144 --
NM_033551chr512206 --12789 --
NM_033624chr1232114 2078 1859 --2401 357 --
NM_033642chrX31125 495 217 ------
NM_033644chr522402 1719 1860 1375 --
NM_033645chr522402 1719 1860 1375 --
NM_033656chr2165555 4821 2108 757 739 546 147 1166 15144
NM_052827chr1211053 ----1211
NM_052832chr852993 2886 1872 247 66 --11997 12966
NM_052834chr1852299 2203 1924 365 345 ------
NM_052865chr201286 1916 ----
NM_052869chr1711807 ------
NM_052879chr121408 12518 12831 1697
NM_052880chr2231394 1159 899 --11462 --
NM_052885chr12----34251 1562 1149 --
NM_052886chr811924 12059 1681 --
NM_052896chr142614 2553 2544 962 ------
NM_052897chr12----1840 --
NM_052898chr811424 ------
NM_052900chr821290 209 ------
NM_052904chr611022 ----1387
NM_052905chr22752 587 --11605 --
NM_052910chr1331983 1674 1656 ------
NM_052911chr181878 ------
NM_052918chr1043686 2909 2539 740 --23707 1373 --
NM_052927chr541781 1578 146 92 ------
NM_052937chr832117 272 60 --2951 392 --
NM_052950chr1332132 1648 259 ------
NM_052958chr81733 ------
NM_052971chr5----178 --
NM_052978chr1431768 358 74 11579 ----
NM_053001chr8------1347
NM_053002chr33476 69 40 ------
NM_053016chr986616 6228 5400 3019 2705 1020 576 39 11205 67987 7902 7883 6487 5251 1784 --
NM_053023chr1153073 2987 2941 966 509 184 32412 2306 808 --
NM_053024chr331233 996 220 --11472 11520
NM_053025chr321125 337 11177 ----
NM_053026chr321125 337 11177 ----
NM_053027chr321125 337 11177 ----
NM_053028chr321125 337 11177 ----
NM_053031chr321125 337 11177 ----
NM_053032chr321125 337 11177 ----
NM_053043chr766340 5050 4812 4590 4392 1621 24478 2480 --1411
NM_053044chr42920 879 ------
NM_053056chr1183105 2623 2409 2088 1963 1216 1019 93 --43085 1113 560 335 --
NM_053064chr1462935 2257 2169 986 346 92 --11873 12359
NM_053067chr9----1131 1227
NM_053274chr1142 ------
NM_053279chr842581 1862 814 555 ------
NM_053281chrX----1410 --
NM_054027chr531714 911 705 --11486 --
NM_057089chr72503 167 ------
NM_057161chr61511 ------
NM_057169chr1262814 2686 2560 2446 2314 1933 11080 23070 2670 --
NM_057170chr1262814 2686 2560 2446 2314 1933 11080 23070 2670 --
NM_057175chr442302 1749 792 77 ------
NM_058172chr42704 417 --21383 88 --
NM_058191chr213901 133 52 1671 1562 --
NM_058229chr8167 ------
NM_058237chr142807 421 2799 368 1718 1320
NM_058240chr1441538 1246 89 60 ------
NM_058241chr222268 613 22259 1705 --1836
NM_058241chr222268 613 22259 1705 --1836
NM_078467chr631455 473 230 --21309 1153 --
NM_078469chr102413 109 ------
NM_079837chr16----1627 --
NM_080390chrX1151 ------
NM_080391chr11593 ------
NM_080392chr11642 ------
NM_080422chr181286 ------
NM_080423chr181286 ------
NM_080546chr91212 ------
NM_080591chr962414 2104 923 571 550 369 ------
NM_080597chr181839 --2881 133 2908 216
NM_080599chr10----11125 --
NM_080626chr12--1325 ----
NM_080645chr622196 734 --1222 --
NM_080664chr1421970 103 ------
NM_080669chr1724928 1599 ------
NM_080676chr20--13190 22873 147 1856
NM_080678chr21268 ------
NM_080723chr6----11326 --
NM_080743chr641819 963 365 258 12123 ----
NM_080748chr20152 ------
NM_080829chr203414 95 73 ------
NM_080832chrX21786 576 --1200 --
NM_080867chr1474924 4497 4227 1867 1668 1586 1548 ----1693
NM_080872chr843224 2920 1585 638 32991 2858 524 23049 990 --
NM_080874chr411604 --11436 --
NM_080881chr5183 ------
NM_080927chr333247 2922 2729 --32723 1175 277 13228
NM_100264chr101664 ----181
NM_100486chr101664 ----181
NM_130391chr963028 3021 2694 2321 2199 79 --13005 11403
NM_130392chr963028 3021 2694 2321 2199 79 --13005 11403
NM_130393chr963028 3021 2694 2321 2199 79 --13005 11403
NM_130434chr15--1447 ----
NM_130435chr1032682 1008 439 --1401 --
NM_130436chr2122484 759 ------
NM_130438chr2133061 1336 78 ------
NM_130439chr1042206 2130 889 676 ------
NM_130439chr1042206 2130 889 676 ------
NM_130440chr12281 272 ------
NM_130466chr1221767 716 --11913 --
NM_130468chr15----1743 1727
NM_130808chr31349 --182 --
NM_130809chr52790 653 --1326 --
NM_130811chr201281 ------
NM_130831chr332797 219 153 ------
NM_130832chr332797 219 153 ------
NM_130833chr332797 219 153 ------
NM_130834chr332797 219 153 ------
NM_130835chr332797 219 153 ------
NM_130836chr332797 219 153 ------
NM_130837chr332797 219 153 ------
NM_130838chr1531642 1336 1231 ------
NM_130839chr1531642 1336 1231 ------
NM_130846chr121282 --1187 --
NM_133170chr2047589 2293 1610 1343 --37801 5043 2388 --
NM_133264chr1753378 3183 2559 1099 458 ------
NM_133266chr112405 317 --1363 --
NM_133330chr43715 541 190 13219 12155 --
NM_133331chr43715 541 190 13219 12155 --
NM_133334chr496205 6069 5658 5502 5305 1524 1168 1105 769 --15874 --
NM_133335chr43715 541 190 13219 12155 --
NM_133369chr51906 1916 ----
NM_133372chr522139 247 --12105 172
NM_133444chr1951751 1310 1099 452 278 ------
NM_133445chr933626 3335 338 --22401 1055 --
NM_133446chr103311 118 109 ------
NM_133462chr31357 ------
NM_133473chr1941803 1484 283 74 1653 ----
NM_133476chr1221052 965 ------
NM_133478chr232167 972 761 --148 --
NM_133493chr643802 3637 1720 1318 --24623 3002 --
NM_133496chr133880 1816 1498 --34206 1079 848 --
NM_133510chr14------1281
NM_133625chr31133 ------
NM_133631chr31348 --1323 --
NM_133646chr295264 5247 5100 5022 4821 3820 3706 1875 643 --1111 --
NM_133647chr1543851 3738 1392 1246 ------
NM_134265chr1721197 128 --1134 --
NM_134421chr23791 759 720 ------
NM_134442chr251757 1545 1198 640 161 ------
NM_134447chr192559 442 ------
NM_138270chrX1904 --21088 1013 1451
NM_138285chr21167 ------
NM_138292chr1152942 2159 707 488 262 --22301 936 13329
NM_138300chr131722 1603 1156 ------
NM_138316chr101275 --11097 --
NM_138319chr1531017 854 345 --11203 --
NM_138333chr932540 1832 832 --22308 746 --
NM_138335chr42635 42 --1172 --
NM_138340chr181274 --123 --
NM_138346chr11163 ------
NM_138357chr10--1466 11231 --
NM_138370chr2175 --1756 --
NM_138375chr181855 158 1485 --
NM_138391chr1------1214
NM_138409chr611338 --21393 389 --
NM_138423chr1531640 1508 681 ----11441
NM_138426chr782418 2396 1815 1745 791 677 512 221 --2632 241 --
NM_138444chr1323801 314 11581 --13214
NM_138453chr5156 ------
NM_138459chr633641 3555 3106 ------
NM_138468chr265979 3963 2219 1602 1392 579 14542 56240 5703 4369 4263 1332 16291
NM_138473chr1253886 786 699 456 246 --32036 1565 301 --
NM_138476chr14126 ------
NM_138494chr721920 87 --12834 --
NM_138555chr15----1462 --
NM_138559chr2--1968 1476 --
NM_138576chr1454631 3849 1381 663 270 --24482 3708 11402
NM_138621chr264099 4062 3351 1034 884 638 --23579 1171 --
NM_138633chr631548 1347 364 --11773 --
NM_138638chr1462263 1831 943 511 501 405 ------
NM_138694chr673650 3535 1243 464 443 242 21 --1621 --
NM_138713chr1697753 7060 7043 6772 6578 5377 2856 2005 398 --25818 5489 --
NM_138714chr1697753 7060 7043 6772 6578 5377 2856 2005 398 --25818 5489 --
NM_138727chr132192 301 122 12272 1444 11726
NM_138728chr132192 301 122 12272 1444 11726
NM_138731chr1434260 3325 2897 --1438 1688
NM_138732chr111714 ------
NM_138734chr111714 ------
NM_138735chr221101 415 --1530 --
NM_138761chr19150 ------
NM_138765chr19150 ------
NM_138766chr51102 ------
NM_138771chr761449 1049 970 561 466 214 ------
NM_138773chr51684 ----1930
NM_138775chr111583 ------
NM_138782chr541680 878 145 54 --12046 --
NM_138793chr1731454 1106 675 --167 --
NM_138799chr252074 1863 1813 685 250 --11645 --
NM_138806chr31884 --1780 --
NM_138811chr711030 ------
NM_138821chr51102 ------
NM_138822chr51102 ------
NM_138927chr211694 --1820 --
NM_138931chr321021 387 ------
NM_138959chr165565 4485 4165 2109 1766 1409 --42697 2433 2324 152 --
NM_138967chr15--1489 12251 --
NM_138970chr1412295 --12413 --
NM_138971chr1123025 3005 ------
NM_138971chr1123025 3005 ------
NM_138972chr1123025 3005 ------
NM_138972chr1123025 3005 ------
NM_138973chr1123025 3005 ------
NM_138973chr1123025 3005 ------
NM_138983chr2151284 1061 438 310 110 ------
NM_139012chr641802 1660 903 534 --1893 --
NM_139035chrX1744 ------
NM_139045chr9------1759
NM_139057chr1522797 2570 1164 1906 --
NM_139058chrX1420 ------
NM_139062chr171403 ------
NM_139067chr12----1334 --
NM_139068chr51497 ------
NM_139069chr51497 ------
NM_139070chr51366 ------
NM_139071chr1221596 1521 ------
NM_139076chr41172 1316 1604 1157
NM_139131chr111711 ------
NM_139136chr12--1194 1161 --
NM_139159chr192530 104 ------
NM_139167chr81170 ------
NM_139168chr53746 325 24 --1233 11239
NM_139169chr1052127 1464 754 170 76 1834 ----
NM_139207chr1231448 167 36 ------
NM_139241chr121151 ------
NM_139242chr1511147 --11035 --
NM_139244chr62957 134 ------
NM_139276chr1762285 1488 841 628 163 53 --22304 453 --
NM_139279chr241290 1210 372 107 ------
NM_139283chr1232106 1660 457 ----12423
NM_139312chr1021059 522 --21194 1143 --
NM_139316chr71736 --1263 --
NM_139321chr2053374 3328 1696 1155 857 --14182 --
NM_139323chr2051982 1795 1703 1505 476 ------
NM_144498chr2041577 1513 1421 645 ----11940
NM_144570chr1632332 2285 2228 --13016 --
NM_144571chr445799 5615 2493 2184 1505 46985 6013 5118 1439 11658
NM_144574chr14--1188 ----
NM_144578chr1455057 4504 3990 3389 738 15289 34663 3561 154 --
NM_144582chr292414 2323 2170 1951 1916 1647 1609 986 706 --11055 --
NM_144586chr2131 --1209 --
NM_144595chr132916 127 --1866 2760 170
NM_144600chr1631666 1645 1634 --1600 --
NM_144609chr172106 82 ------
NM_144611chr17--1493 1535 --
NM_144618chr131449 1240 24 ------
NM_144628chr2033004 2113 730 ------
NM_144632chr271881 1854 1648 1525 917 784 536 --12053 1584
NM_144642chr321329 543 --1364 --
NM_144643chr4----1477 --
NM_144660chr101277 ------
NM_144664chr1142479 581 154 22 12386 22565 2534 --
NM_144703chr2011030 ----180
NM_144721chr452592 2192 1806 654 128 --1417 --
NM_144732chr191184 ----11032
NM_144767chr1523483 1235 --12949 --
NM_144775chr1711881 --24950 4807 --
NM_144778chr1322589 37 12778 21788 1101 --
NM_144949chr222257 294 ----12616
NM_144963chr8--1443 22020 240 --
NM_144967chrX--11064 ----
NM_144973chr1285271 1666 1354 1038 790 766 509 436 --24982 861 --
NM_144979chr41612 --1707 --
NM_144981chr11------177
NM_145018chr111212 --1236 --
NM_145025chr61103 ------
NM_145055chr1873309 2952 1263 887 716 110 28 --23562 2386 1491
NM_145062chr62211 22 ------
NM_145112chr1411194 ------
NM_145113chr1421466 94 ------
NM_145117chr1132604 915 214 --33082 1254 230 --
NM_145159chr142649 324 --1897 --
NM_145185chr19----1686 --
NM_145203chr13149 ----1254
NM_145206chr1043341 825 580 87 22402 1301 ----
NM_145239chr164328 291 226 206 --2366 272 --
NM_145251chr1411235 --1305 --
NM_145259chr247090 6284 4904 1455 --57099 7039 6821 6492 1854 --
NM_145263chr42187 165 1248 ----
NM_145266chr51144 --1252 --
NM_145284chrX11702 --11558 --
NM_145287chr181179 ------
NM_145290chr4--172 --1279
NM_145291chr41388 --1362 --
NM_145305chrX31299 184 25 ----11289
NM_145307chr1054333 4260 3339 2879 1772 --13086 --
NM_145313chr1021167 40 1166 21515 1371 --
NM_145315chr6----1105 --
NM_145320chr743483 3305 629 387 --22530 543 --
NM_145321chr743483 3305 629 387 --22530 543 --
NM_145322chr743483 3305 629 387 --22530 543 --
NM_145331chr61234 --1137 --
NM_145332chr62382 143 --1285 --
NM_145333chr62382 143 --1285 --
NM_145341chr1041466 298 118 98 ------
NM_145686chr233293 1368 984 --2913 801 --
NM_145687chr233293 1368 984 --2913 801 --
NM_145690chr841818 1305 415 272 1433 11536 --
NM_145698chr1022045 162 ------
NM_145730chr222694 197 ------
NM_145735chr1342749 2187 1943 874 --42856 2252 2066 139 --
NM_145739chr21156 ------
NM_145753chr321575 428 --2585 342 --
NM_145800chrX173 ------
NM_145808chr772609 2546 2501 2392 2040 1161 476 --13009 --
NM_145810chr231051 929 359 ----11277
NM_145858chr212478 435 --1110 --
NM_145859chr3----127 --
NM_145860chr3----127 --
NM_145888chr1931325 203 118 ------
NM_145891chr1651571 1130 1071 615 416 --11396 --
NM_145892chr1651571 1130 1071 615 416 --11396 --
NM_145893chr1651693 1252 1193 737 538 --11518 --
NM_147147chr642852 1541 1484 68 ------
NM_147150chr953320 1362 903 472 75 12765 12498 --
NM_147156chr101215 --11514 --
NM_147164chr91112 ------
NM_147166chr7----1859 --
NM_147171chr7----1344 --
NM_147175chrX1762 11552 12031 --
NM_147185chr7----1344 --
NM_147202chr91637 --1525 --
NM_147223chr222246 303 ------
NM_147233chr222063 120 ------
NM_148174chr811793 --1698 11486
NM_148177chr8167 ------
NM_148571chr172540 234 ------
NM_148894chr41886 ------
NM_148898chr71759 ------
NM_148899chr71759 ------
NM_148921chr1732272 1592 1518 ------
NM_148955chr15106515 6194 6151 6103 5481 4677 4477 4094 2317 1608 --21954 1893 --
NM_148977chr101275 --11097 --
NM_148978chr101275 --11097 --
NM_152240chr351246 1036 481 396 380 ------
NM_152244chr1721060 443 11190 ----
NM_152261chr1222484 22 --12283 12493
NM_152263chr1104460 4043 3725 2098 1475 1415 1406 1343 1205 993 --36046 4758 210 --
NM_152265chr131338 1276 147 --2177 170 --
NM_152271chr82245 47 ------
NM_152277chr532117 1854 1514 11455 ----
NM_152278chrX----169 --
NM_152280chr113417 --12539 --
NM_152282chr331081 305 229 --11390 --
NM_152284chr82294 222 --1723 --
NM_152309chr1012211 22116 1859 1325 1353
NM_152328chr14----1119 --
NM_152330chr1422625 2030 --52451 2062 743 257 166 --
NM_152332chr1422784 2393 2962 393 --11998
NM_152335chr151644 ------
NM_152344chr171129 ------
NM_152371chr121376 774 11228 ----
NM_152380chr121049 28 --11335 --
NM_152384chr221873 440 ----11996
NM_152388chr253746 3302 2541 901 624 --13159 --
NM_152390chr23691 567 479 ------
NM_152407chr533058 199 93 1406 ----
NM_152409chr593308 3181 3158 2765 1285 1141 930 775 172 21293 511 ----
NM_152414chr81494 --11208 --
NM_152415chr83205 196 87 ------
NM_152417chr8----1855 --
NM_152418chr821412 83 --21798 427 --
NM_152423chrX21121 537 --21491 359 --
NM_152424chrX84687 4240 4049 3951 3417 1277 531 229 --13487 --
NM_152431chr111386 ------
NM_152441chr121166 --1684 --
NM_152446chr141395 ------
NM_152450chr1531385 320 85 --1495 --
NM_152463chr171509 1207 ----
NM_152470chr1813993 --13891 --
NM_152493chr121533 234 ------
NM_152519chr212218 --1811 --
NM_152520chr21897 ------
NM_152522chr23893 363 226 ------
NM_152523chr21621 --1696 --
NM_152529chr2104260 3880 3410 3302 3092 1307 1226 924 594 381 --11461 --
NM_152536chr321094 464 ------
NM_152538chr311354 21829 283 21839 1228 --
NM_152542chr42848 613 ------
NM_152549chr51447 ------
NM_152550chr5------147
NM_152553chr62202 35 ------
NM_152556chr711947 1239 2858 388 1453
NM_152586chr103303 94 52 ------
NM_152588chr1231892 1477 740 1249 --