TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-519a-5p
miRNA Sequence: CUCUAGAGGGAAGCGCUUUCUG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr52916 111 ------
NM_000037chr821947 140 12395 11920 --
NM_000038chr51358 21490 139 11446 --
NM_000044chrX1393 ------
NM_000051chr1142562 2273 1153 755 ----2209 40
NM_000052chrX43322 2136 2123 592 43061 2236 884 489 ----
NM_000067chr83675 112 53 ------
NM_000084chrX146388 5611 5048 4759 4425 2366 2346 2016 1367 987 944 647 500 181 21872 954 --1164
NM_000092chr264479 1840 1512 401 210 151 11352 12827 12923
NM_000104chr242875 2268 2224 569 21923 29 ----
NM_000108chr741834 1600 1301 767 1101 ----
NM_000109chrX22308 803 1836 12323 --
NM_000110chr1--11166 ----
NM_000111chr71143 ------
NM_000112chr5125542 4818 4674 4485 4190 3537 1949 1558 1340 831 462 437 65486 3982 2231 1652 1639 1002 13418 --
NM_000125chr693889 3552 2955 1633 1576 1395 691 126 69 ------
NM_000129chr631282 1193 578 ----1425
NM_000142chr421356 1130 ------
NM_000151chr1721931 480 21560 1552 ----
NM_000161chr1471832 1825 1581 1502 1382 738 699 1149 ----
NM_000163chr51558 21456 820 ----
NM_000165chr631688 1205 521 ------
NM_000168chr743111 2665 2388 185 1336 ----
NM_000176chr523054 384 11240 --13463
NM_000183chr21466 ------
NM_000192chr12------1336
NM_000194chrX274 35 ----1147
NM_000202chrX43947 2582 1377 878 --12800 --
NM_000210chr231970 1882 1838 --146 --
NM_000212chr1731812 1701 1631 1806 22389 793 --
NM_000216chrX63988 3767 3311 3242 165 127 ------
NM_000217chr1253846 3624 1857 1413 292 24629 3612 ----
NM_000222chr441816 1618 1348 144 11640 11426 --
NM_000245chr722120 421 21581 415 ----
NM_000248chr32511 262 21192 155 ----
NM_000252chrX1266 1150 ----
NM_000259chr1596170 4894 4439 4145 3909 1954 1703 1610 1347 26022 2112 16152 16160
NM_000266chrX5856 210 176 132 27 ----1756
NM_000276chrX71901 1727 1558 1416 401 361 185 129 11912 --
NM_000291chrX1243 ------
NM_000319chr1261105 999 963 908 458 163 ------
NM_000321chr1321334 1164 --140 --
NM_000332chr677076 6434 6373 6190 6173 1000 292 12278 24365 1664 --
NM_000337chr545972 4163 514 385 16597 22291 55 14366
NM_000340chr321280 1177 --11360 --
NM_000345chr4--1703 ----
NM_000346chr1731870 788 504 11741 ----
NM_000369chr1421274 1223 1256 1155 1754
NM_000388chr311254 --11070 --
NM_000390chrX2562 480 33101 929 899 ----
NM_000399chr101189 1993 ----
NM_000408chr283424 3034 2661 1048 619 580 505 437 ------
NM_000411chr2152733 2561 2398 184 63 22374 51 ----
NM_000419chr17123 ------
NM_000430chr1783289 2878 2830 2627 1299 776 483 118 1209 23019 40 11251
NM_000447chr12351 74 ----1434
NM_000448chr1151112 993 851 836 49 1723 ----
NM_000449chr12968 198 --1947 --
NM_000450chr141613 1434 458 89 ----11300
NM_000461chr363148 3053 1660 1624 994 432 ------
NM_000462chr152674 570 ----11733
NM_000474chr72703 83 --192 1460
NM_000489chrX52175 1174 992 899 698 ------
NM_000492chr721334 964 1495 --11123
NM_000522chr71519 2965 366 ----
NM_000531chrX1243 ------
NM_000533chrX11303 11957 ----
NM_000539chr361380 1279 1068 1046 645 217 1305 --21085 1024
NM_000544chr6_cox_hap132757 536 318 23012 1068 ----
NM_000554chr1943303 2586 1068 75 21093 969 12241 --
NM_000555chrX97713 7409 5887 5671 2988 2955 2359 2182 180 47423 5268 2026 1094 1449 1788
NM_000572chr13961 382 73 1194 --133
NM_000575chr221043 816 11022 ----
NM_000578chr251727 1635 1291 170 128 ------
NM_000599chr263973 1793 1621 1527 572 157 21699 791 13201 11813
NM_000615chr1172838 2039 2020 847 568 359 137 2957 338 ----
NM_000618chr1256601 2212 1832 634 171 15083 --15242
NM_000618chr1256601 2212 1832 634 171 15083 --15242
NM_000633chr1854583 4452 3721 3477 3299 21678 1089 14200 1874
NM_000681chr1021281 1034 ------
NM_000684chr1011279 --1306 --
NM_000719chr1276112 5522 5428 4623 2012 1803 517 16592 35025 4752 2367 --
NM_000724chr104753 735 646 460 ------
NM_000726chr22262 175 ------
NM_000761chr151103 11347 ----
NM_000788chr42931 583 21341 996 --191
NM_000793chr1474252 3823 3684 3525 3279 659 539 14115 ----
NM_000806chr531590 1560 166 ------
NM_000809chr496785 6661 3727 3588 1884 1797 1196 877 858 --11521 39243 1555 761
NM_000813chr555486 5322 1779 660 642 ------
NM_000814chr1554037 3731 1461 877 562 21128 945 ----
NM_000816chr5----1593 --
NM_000817chr241212 1034 161 47 ------
NM_000829chr11----1699 --
NM_000831chr1176190 6074 5954 5784 5772 5644 5090 4952 4169 4157 3880 2006 1719 1593 775 527 449 46317 5270 5064 4350 35673 4306 1439 1718
NM_000840chr72171 34 1114 ----
NM_000844chr32947 354 ----1290
NM_000859chr521725 1087 ------
NM_000875chr15117043 6670 5968 5467 5054 4587 4574 2386 1526 1499 520 16517 16955 15383
NM_000876chr621286 328 ------
NM_000880chr8137 ------
NM_000885chr232151 660 464 31686 1654 874 12017 --
NM_000891chr1763550 3543 2703 1294 639 326 13022 --122
NM_000895chr12125 ------
NM_000899chr1244152 1572 1071 103 33579 478 278 13229 --
NM_000901chr421555 653 ------
NM_000919chr53579 166 63 ------
NM_000921chr12176 ------
NM_000922chr112804 780 --1985 --
NM_000933chr2021617 1506 11303 ----
NM_000935chr3--31276 836 826 ----
NM_000944chr462250 2046 1605 655 339 123 ------
NM_000945chr2----11710 12062
NM_000949chr52719 603 ----1304
NM_000950chrX52851 2761 2656 144 59 13317 12254 --
NM_000959chr153868 3537 3298 3264 749 43759 3086 2649 584 --11382
NM_000963chr1--32486 2295 1941 ----
NM_000966chr121147 ------
NM_001001323chr1222281 589 12501 --11948
NM_001001395chr1232396 1788 463 21133 729 ----
NM_001001396chr163751 3524 3393 2764 1436 628 11286 13506 13450
NM_001001419chr545109 3643 583 53 13964 11702 14859
NM_001001420chr545109 3643 583 53 13964 11702 14859
NM_001001481chr812870 ------
NM_001001549chr711748 1953 1832 11955
NM_001001550chr711748 1953 1832 11955
NM_001001555chr711748 1953 1832 11955
NM_001001664chr222741 951 13022 ----
NM_001001668chr1993855 3748 3643 3635 3555 1029 377 91 24 ------
NM_001001715chr131403 1568 ----
NM_001001890chr2154100 3808 3751 3664 1033 ------
NM_001001938chr943446 3005 1042 572 33423 2630 1244 14117 1478
NM_001001971chr101109 ------
NM_001001974chr1032018 156 63 ------
NM_001001995chrX1655 11625 --2185 151
NM_001002032chr171108 ------
NM_001002255chr61337 ------
NM_001002257chr233033 1361 681 33435 2393 346 ----
NM_001002814chr852996 933 655 581 205 13654 23135 2827 --
NM_001002838chrX21421 429 --1121 11451
NM_001002857chr151396 164 --1297
NM_001002858chr151396 164 --1297
NM_001002860chr1443761 3433 3215 124 --13547 24178 4025
NM_001002909chr1762101 1563 463 379 304 153 ------
NM_001002919chr21454 ------
NM_001003406chr2273171 3031 2380 1316 1139 786 381 ----1705
NM_001003407chr1043500 976 942 786 14902 13679 --
NM_001003408chr1043500 976 942 786 14902 13679 --
NM_001003652chr1878023 7309 7193 5903 5711 5641 407 56076 3221 2944 516 196 --28310 7085
NM_001003679chr12839 499 1160 ----
NM_001003681chr2232070 753 90 21804 1319 ----
NM_001003688chr42781 419 ----126
NM_001003698chr631407 650 317 ------
NM_001003699chr631407 650 317 ------
NM_001003712chr1233171 843 229 23631 3574 1915 --
NM_001003790chr82586 292 ------
NM_001003791chr82586 292 ------
NM_001003805chr14--1209 --171
NM_001003810chr42791 671 1661 ----
NM_001003940chr1573743 3619 2654 2629 1477 1113 339 22855 47 --11211
NM_001003942chr1573743 3619 2654 2629 1477 1113 339 22855 47 --11211
NM_001003943chr1573747 3623 2658 2633 1481 1117 343 22859 51 --11215
NM_001004065chr973940 3281 3106 2791 908 718 340 13310 22717 190 --
NM_001004127chr13--2355 132 --1108
NM_001004304chr122773 64 12238 ----
NM_001004316chr31282 ------
NM_001004317chr674441 4404 4275 3832 3803 3440 3357 13406 21456 607 --
NM_001004329chr1251007 450 147 133 54 11407 ----
NM_001004419chr1253109 3038 1409 1377 74 11002 1524 1106
NM_001005271chr173818 750 410 --1458 --
NM_001005273chr173818 750 410 --1458 --
NM_001005353chr14514 427 355 114 11261 ----
NM_001005353chr14514 427 355 114 11261 ----
NM_001005375chrY1227 3710 542 274 --21520 60
NM_001005386chr23446 329 267 32422 2310 2060 ----
NM_001005404chr1784097 3670 3335 2833 758 735 617 234 24008 3891 ----
NM_001005417chr11703 ------
NM_001005463chr1022232 851 1980 ----
NM_001005473chr586414 6216 5289 5225 4218 2248 1282 223 22652 1642 15544 14678
NM_001005474chr31227 ----11152
NM_001005502chr1243481 2048 1032 84 54382 4171 3569 1814 830 --14571
NM_001005611chrX3521 334 59 ------
NM_001005746chr22262 175 ------
NM_001005747chr22262 175 ------
NM_001005782chr22347 136 ------
NM_001005861chr32318 187 ----2794 142
NM_001005910chr31246 ------
NM_001005911chr31246 ------
NM_001006118chrY1228 ------
NM_001006120chrY1228 ------
NM_001006612chrX1118 ------
NM_001006613chrX1118 ------
NM_001006614chrX1118 ------
NM_001006938chrX1790 --1165 --
NM_001007023chr1474252 3823 3684 3525 3279 659 539 14115 ----
NM_001007067chr81377 1426 ----
NM_001007068chr81377 1426 ----
NM_001007069chr81377 1426 ----
NM_001007070chr81377 1426 ----
NM_001007097chr944139 3882 3233 1250 24069 913 13851 --
NM_001007237chr142559 443 363 90 12658 12596 --
NM_001007267chr2--2775 593 ----
NM_001007466chr644464 4095 446 21 25073 1081 1172 --
NM_001007526chrY1228 ------
NM_001007565chr31270 ------
NM_001008239chr1853720 3663 2358 1515 390 1307 ----
NM_001008392chr393032 2822 2765 2739 2668 2304 1396 730 46 32892 2336 519 --139
NM_001008410chr222157 1947 --122 22189 906
NM_001008495chr821440 246 ------
NM_001008541chr1021597 333 ----11869
NM_001008541chr1021597 333 ----11869
NM_001008660chr11------11000
NM_001008701chr1962206 2148 1148 810 360 64 --12806 11952
NM_001008707chr1421849 1264 ------
NM_001008708chr2------1245
NM_001008738chr542935 2762 2216 96 12209 ----
NM_001008777chr17--1143 125 1214
NM_001008801chr1921985 718 ------
NM_001008925chr463161 2421 2213 998 528 417 --22569 658 1636
NM_001008938chr11135 ------
NM_001009552chr81212 ------
NM_001009554chr474569 4337 3652 2974 1831 1766 1271 43783 3635 3414 3261 13150 13225
NM_001009554chr474569 4337 3652 2974 1831 1766 1271 43783 3635 3414 3261 13150 13225
NM_001009881chr11167 ------
NM_001009882chr11167 ------
NM_001009899chr385512 5251 5192 5134 4787 4048 3952 566 25714 448 15259 --
NM_001009958chr7--1250 ----
NM_001009959chr252396 1733 1691 825 467 ------
NM_001010846chr164463 3143 3059 1707 554 31 34354 3505 1091 1830 1630
NM_001010853chr622986 2397 ------
NM_001010861chr11299 21909 536 11881 --
NM_001010862chrX62859 2357 1004 860 813 753 23032 567 ----
NM_001010888chrX44027 3018 770 340 24207 935 --21868 1635
NM_001010891chr576800 6739 6722 5508 2458 731 172 22208 453 --36449 4602 1685
NM_001010895chr91139 ------
NM_001010986chrX31874 226 86 ------
NM_001011513chr453611 3515 3425 855 74 1308 23167 3037 --
NM_001011537chr352335 1667 648 582 355 31784 1758 883 --11846
NM_001011538chr44868 846 362 66 ------
NM_001011546chr201121 ------
NM_001011553chr74821 678 631 182 ----1348
NM_001011645chrX1393 ------
NM_001011657chrX11088 21191 63 1358 --
NM_001011666chr796531 6285 5857 5637 4685 2257 1803 1794 685 56169 5679 4637 4051 76 16098 15872
NM_001011708chr222904 2713 ------
NM_001011713chr1421442 610 ------
NM_001011718chr206967 955 887 840 814 640 1877 ----
NM_001012329chr141854 718 360 352 1379 ----
NM_001012393chr1165006 3621 2050 1584 894 114 --14850 --
NM_001012420chr1571156 1058 753 735 658 535 203 22593 2182 ----
NM_001012421chr92633 50 ------
NM_001012423chr1581991 1156 1058 753 735 658 535 203 22593 2182 ----
NM_001012614chr4--3509 499 274 ----
NM_001012732chr421241 199 ------
NM_001012755chrX95081 4733 4366 4341 3502 3316 1023 350 104 --1362 12000
NM_001012761chr512102 12379 12630 --
NM_001012958chr151440 1310 1031 401 182 --171 --
NM_001012958chr151440 1310 1031 401 182 --171 --
NM_001012968chrX41891 532 522 424 32516 2378 2303 ----
NM_001012989chrX1494 1646 --1460
NM_001013031chr1042564 2210 887 185 --22600 344 11073
NM_001013399chr61167 ------
NM_001013439chr31654 ------
NM_001013620chr12125659 3366 3126 2469 1902 1620 1574 1097 1082 864 816 597 27892 7102 18260 15469
NM_001013843chr152862 792 --1352 --
NM_001014380chr1365320 4187 3612 1179 742 661 1314 13979 1496
NM_001014797chr10147953 7158 6882 6789 6470 6156 6109 5744 2609 2261 1394 950 764 369 67541 7397 5876 5380 3070 2371 11544 --
NM_001014972chr2--1214 ----
NM_001015045chr421828 521 --22447 125 175
NM_001015877chrX62878 2536 1196 1121 327 303 42731 2281 1096 946 12582 --
NM_001015882chr9--169 ----
NM_001017368chr1742342 1004 689 567 --11775 --
NM_001017395chr382856 2221 1251 1052 524 287 176 35 1129 ----
NM_001017415chr1181 1176 1122 --
NM_001017416chr1181 1176 1122 --
NM_001017424chr11507 21835 1817 ----
NM_001017425chr11507 21835 1817 ----
NM_001017920chr21139 ------
NM_001017977chr1181 ------
NM_001017999chr1--12042 11749 --
NM_001017999chr1--12042 11749 --
NM_001018000chr1--12042 11749 --
NM_001018000chr1--12042 11749 --
NM_001018001chr1--12042 11749 --
NM_001018004chr151639 ------
NM_001018006chr151639 ------
NM_001018007chr151639 ------
NM_001018008chr15134 ------
NM_001018020chr151639 ------
NM_001018056chr91241 ------
NM_001018057chr112125 69 11332 ----
NM_001018064chr931679 1529 1522 ------
NM_001018065chr955437 4463 1366 328 297 24980 2211 13983 --
NM_001018066chr955437 4463 1366 328 297 24980 2211 13983 --
NM_001018067chr165210 5057 4988 4392 4257 1831 54977 1440 1352 384 211 ----
NM_001018068chr165210 5057 4988 4392 4257 1831 54977 1440 1352 384 211 ----
NM_001018069chr165210 5057 4988 4392 4257 1831 54977 1440 1352 384 211 ----
NM_001018074chr523054 384 11240 --13463
NM_001018075chr523054 384 11240 --13463
NM_001018076chr523054 384 11240 --13463
NM_001018077chr523054 384 11240 --13463
NM_001018089chr1543507 3192 2813 58 --1668 11524
NM_001018108chr1532090 1492 1461 22024 1543 1362 1533
NM_001020658chr1183 ------
NM_001020658chr1183 ------
NM_001023567chr1562008 1739 756 661 213 203 ------
NM_001024094chr523054 384 11240 --13463
NM_001024596chr1962313 1156 578 507 187 168 --12449 --
NM_001024647chr12106688 6040 5672 4820 1972 1799 924 912 302 183 22070 1938 16016 25783 439
NM_001024660chr341312 636 432 361 11433 ----
NM_001024680chr241504 1368 1327 167 ----11389
NM_001024688chr852117 1730 742 612 558 ------
NM_001024847chr312114 32130 764 740 21981 981 --
NM_001024858chr1492597 2518 2185 2073 1995 748 570 556 241 ------
NM_001024934chr6184 ------
NM_001024935chr6184 ------
NM_001024936chr6184 ------
NM_001024948chr143000 947 773 361 22824 433 ----
NM_001024956chr1175737 5722 5303 4325 4055 780 252 25670 1224 22086 617 --
NM_001025068chr321422 36 --11203 --
NM_001025069chr321422 36 --11203 --
NM_001025076chr1065069 5049 3807 3784 1987 1019 31825 1460 855 1505 --
NM_001025077chr1076427 6407 5165 5142 4872 2377 698 65096 4619 2818 2213 997 672 21863 982 --
NM_001025079chr374086 3446 3135 2780 1452 1230 322 --1330 --
NM_001025201chr21199 1713 ----
NM_001025252chr882829 2692 2539 2046 1149 853 631 194 42161 2143 860 334 ----
NM_001025253chr882829 2692 2539 2046 1149 853 631 194 42161 2143 860 334 ----
NM_001025266chr384903 3489 3104 3013 1547 1053 804 523 24602 3377 --13094
NM_001025580chrX72822 1470 1229 644 638 456 209 33396 3083 928 11091 --
NM_001025595chr421651 596 ------
NM_001025596chr111458 1335 ----
NM_001025603chr12968 198 --1947 --
NM_001025780chr911211 ------
NM_001029858chr633092 2862 2763 22608 629 ----
NM_001029859chr1132195 1908 599 --12329 1680
NM_001029875chr522061 963 11062 12707 --
NM_001029884chr642534 2388 2134 269 12687 ----
NM_001030007chr1663223 2739 786 326 213 51 22451 1386 ----
NM_001030055chr1484662 4429 3609 3515 1835 1496 816 50 1965 13484 --
NM_001030287chr14950 836 471 298 ----1103
NM_001031690chr742311 2012 731 452 ----1183
NM_001031692chr7--1312 ----
NM_001031695chr22105316 4044 4016 3610 3480 2153 1978 1517 816 482 --1765 --
NM_001031710chr72806 728 --1343 --
NM_001031716chr21226 ------
NM_001031748chr121508 1238 ----
NM_001031804chr1673780 3536 1486 1468 1460 531 80 24005 1117 --13918
NM_001032280chr631578 1276 638 ------
NM_001032282chr81476 1820 ----
NM_001032283chr122821 687 1846 --1238
NM_001032284chr122821 687 1846 --1238
NM_001032288chr202426 84 ------
NM_001032293chr172487 241 1250 ----
NM_001032380chr1031562 1483 271 ------
NM_001032393chrX2738 566 1303 --1663
NM_001032394chr642808 1051 890 511 12509 --12227
NM_001032395chr642675 918 757 378 12376 --12094
NM_001032730chr1------1692
NM_001033044chr131155 1128 387 ------
NM_001033045chr294403 4235 3998 3572 3404 2867 2812 263 39 23779 2795 1723 --
NM_001033047chr43976 886 705 1915 --11822
NM_001033049chr2132188 1955 1799 22182 298 --1733
NM_001033056chr131155 1128 387 ------
NM_001033057chr311760 ------
NM_001033081chr191597 1432 1303 686 419 385 228 109 72 11630 1663 11485
NM_001033082chr191597 1432 1303 686 419 385 228 109 72 11630 1663 11485
NM_001033085chr21123 ------
NM_001033503chr52389 119 1370 ----
NM_001033506chr11--1118 ----
NM_001033507chr141749 1417 1214 73 1678 ----
NM_001033557chr21512 21419 1260 ----
NM_001033561chr173881 288 187 ------
NM_001033564chr6----21884 99 --
NM_001033566chr172357 310 1297 ----
NM_001033568chr172357 310 1297 ----
NM_001033578chr812277 --22173 2007 --
NM_001033602chr1331972 1883 364 ------
NM_001033925chr102166 129 ------
NM_001034841chr1675007 1674 1360 527 364 303 136 25176 893 ----
NM_001034845chr4--1416 ----
NM_001034850chr531655 1411 667 --2580 116 --
NM_001034954chr1022672 962 2888 796 22215 751 --
NM_001034955chr1022672 962 2888 796 22215 751 --
NM_001034956chr1022672 962 2888 796 22215 751 --
NM_001034957chr1022672 962 2888 796 22215 751 --
NM_001035254chr932404 2316 335 --143 --
NM_001035505chr2179 ------
NM_001035521chr21120 --1798 --
NM_001037131chr211086 ------
NM_001037164chr72582 43 2697 550 ----
NM_001037172chr32998 66 ------
NM_001037317chr11299 21909 536 11881 --
NM_001037334chr1832001 1943 707 22189 723 177 --
NM_001037535chrX61030 564 447 85 39 23 11372 11390 --
NM_001037536chrX61030 564 447 85 39 23 11372 11390 --
NM_001037540chrX61030 564 447 85 39 23 11372 11390 --
NM_001037954chr1152914 1017 721 218 99 22437 337 1739 --
NM_001038640chr154948 823 728 281 ------
NM_001038707chr142232 2156 596 176 1876 21449 534 1297
NM_001038707chr142232 2156 596 176 1876 21449 534 1297
NM_001039199chr2084973 1981 1662 1192 962 906 639 255 13187 --21711 1582
NM_001039538chr273585 3477 2812 2725 2719 2694 891 12667 12917 --
NM_001039569chr242826 2803 2172 316 1575 ----
NM_001039570chr2274095 3683 3633 3462 684 376 348 14678 14363 12845
NM_001039571chr2274095 3683 3633 3462 684 376 348 14678 14363 12845
NM_001039577chr121526 411 43438 1736 745 366 197 --
NM_001039585chr154125 3794 3555 3521 1006 44016 3343 2906 841 --11639
NM_001039590chrX43916 3575 860 580 13261 ----
NM_001039591chrX43916 3575 860 580 13261 ----
NM_001039618chr1145081 5017 4166 4009 22334 2170 14110 --
NM_001039693chr253749 3641 620 488 36 1610 ----
NM_001039762chr1012090 ----138
NM_001039840chrX105590 5451 4632 4454 1727 1435 1215 1077 1031 365 35352 2163 429 ----
NM_001039916chr1211041 11206 ----
NM_001039917chr1211041 11206 ----
NM_001039918chr1211041 11206 ----
NM_001039919chr1211041 11206 ----
NM_001039920chr1211041 11206 ----
NM_001039937chr1373478 3468 3156 2939 2890 1479 952 ------
NM_001039960chr1221511 449 ----1275
NM_001040020chr721250 244 ------
NM_001040100chr331084 492 171 1311 1203 --
NM_001040101chr441358 1229 623 394 --192 --
NM_001040102chr1061992 1810 943 908 203 154 --12237 1127
NM_001040103chr1061992 1810 943 908 203 154 --12237 1127
NM_001040110chr7131 ------
NM_001040152chr744825 4536 3572 3341 34687 4312 875 11305 --
NM_001040214chr632249 1489 623 --21581 950 --
NM_001040272chr932092 552 477 --11945 --
NM_001040284chr1685910 5467 4750 4639 3967 3864 1883 845 25536 1988 ----
NM_001040402chr452547 919 806 516 357 1490 12635 --
NM_001040424chr2162725 2195 483 405 194 59 ----22717 183
NM_001040429chr1353523 2910 2727 2193 458 23591 3030 12959 --
NM_001040441chr155181 5071 4568 3533 1422 --14816 --
NM_001040450chr1522657 615 1884 --12351
NM_001040453chr1522657 615 1884 --12351
NM_001040709chr12552 432 --12106 1803
NM_001040712chr941305 1236 102 21 12264 12992 --
NM_001042355chr16145351 4997 4537 4222 4085 3639 3580 3510 2084 1932 1608 1529 1094 914 35076 4104 929 14312 1202
NM_001042406chr621151 1143 21243 966 1439 --
NM_001042412chr16145351 4997 4537 4222 4085 3639 3580 3510 2084 1932 1608 1529 1094 914 35076 4104 929 14312 1202
NM_001042413chr953046 936 762 254 203 --13593 --
NM_001042425chr631578 1276 638 ------
NM_001042453chrX41726 1563 315 231 ------
NM_001042479chrX21836 396 ------
NM_001042480chrX21836 396 ------
NM_001042494chr1543107 1080 1061 516 12954 ----
NM_001042495chr1543107 1080 1061 516 12954 ----
NM_001042496chr1543107 1080 1061 516 12954 ----
NM_001042497chr1543107 1080 1061 516 12954 ----
NM_001042548chr22812 199 1636 ----
NM_001042555chr1284641 4278 1599 1271 1223 1129 812 295 ------
NM_001042599chr2107317 6478 6176 5662 2447 2296 1879 1771 1389 70 22261 2051 15454 25370 2551
NM_001042601chr352943 2916 2000 1149 633 11288 12510 --
NM_001042603chr1265123 3582 1826 1481 1089 669 --1285 --
NM_001042604chr384777 3662 3475 3298 3162 1840 1191 740 11132 1555 1635
NM_001042678chr11142 ------
NM_001042679chr11142 ------
NM_001042683chr631747 421 30 --11307 --
NM_001042728chr121147 ------
NM_001043351chr122331 2133 ----1885
NM_001044305chr61463 ------
NM_001044385chr213875 24064 313 13001 --
NM_001046chr562886 2720 905 894 422 322 1843 ----
NM_001048183chr153303 2767 453 112 78 23801 665 ----
NM_001050chr1731463 928 245 1107 11167 1279
NM_001076chr42430 167 ------
NM_001076chr42430 167 ------
NM_001099678chr336160 510 188 35271 2540 1591 15132 13964
NM_001100108chr187629 7340 7215 5195 3185 3000 2935 376 47102 6980 2838 2441 15910 11799
NM_001106chr3199366 9153 8530 8146 7928 7538 7320 7274 6961 6613 3389 2806 2665 2512 2206 1603 1261 1135 712 39758 9607 3058 23808 1735 19080
NM_001113490chrX32694 2313 332 --22390 689 --
NM_001115chr8--186 ----
NM_001117chr1832227 2060 560 12326 ----
NM_001121chr1021562 711 1646 11214 --
NM_001122679chr52916 111 ------
NM_001123chr101132 ------
NM_001126chr121090 196 ------
NM_001128chr1663223 2739 786 326 213 51 22451 1386 ----
NM_001135chr151250 ------
NM_001143chrY141 ------
NM_001144chr16--11263 ----
NM_001148chr421513 313 ----1644
NM_001149chr1021236 1011 --11070 --
NM_001154chr42178 68 ------
NM_001160chr1232039 1782 1079 ------
NM_001167chrX76466 5235 2510 2305 972 476 325 22606 903 14393 --
NM_001173chr1484662 4429 3609 3515 1835 1496 816 50 1965 13484 --
NM_001186chr213859 267 110 12694 --1664
NM_001201chr443849 3824 1530 1242 1281 --12624
NM_001204chr257739 6775 6294 2839 1928 --26574 6268 --
NM_001219chr741949 1890 468 276 ----1606
NM_001254chr173826 255 46 ------
NM_001256chr1742526 1867 1810 435 12536 ----
NM_001259chr7145843 5433 5352 5052 4000 2475 2329 2037 1683 1533 1460 694 128 103 ----12415
NM_001269chr13969 722 394 ------
NM_001270chr531083 329 27 1764 --1929
NM_001271chr1543053 2026 767 83 13291 ----
NM_001284chr51526 ------
NM_001290chr41270 ------
NM_001304chr1763624 3538 3282 1097 469 343 2953 841 ----
NM_001310chr1242526 2061 824 677 ------
NM_001326chr11--1175 ----
NM_001328chr4--3509 499 274 ----
NM_001331chr1132650 2395 477 --12848 1874
NM_001332chr51243 1160 21537 427 --
NM_001351chr31139 1179 --11494
NM_001356chrX32425 2400 1764 21677 646 1325 --
NM_001358chr4--1359 --1280
NM_001364chr1194695 4269 3828 3676 3436 3268 3079 1637 1092 143 11557 --
NM_001386chr821995 786 ------
NM_001391chr181243 1206 ----
NM_001394chr8--1615 ----
NM_001400chr151244 430 390 360 78 ------
NM_001401chr91284 2620 543 1271 --
NM_001412chrX23695 3289 --11457 13584
NM_001415chrX21907 1744 11900 ----
NM_001417chr122495 237 ------
NM_001418chr112488 221 ------
NM_001418chr112488 221 ------
NM_001423chr1241971 1958 1674 759 --12054 --
NM_001424chr163678 667 92 ------
NM_001438chr152959 2496 1360 807 410 ------
NM_001448chrX21358 528 --11554 --
NM_001451chr1611068 1386 1509 --
NM_001458chr71672 ------
NM_001482chr151860 ------
NM_001483chr72797 398 ----1746
NM_001493chrX2746 692 ------
NM_001498chr63892 519 164 --1277 --
NM_001518chr73793 417 131 1194 ----
NM_001521chr21120 --1798 --
NM_001527chr643283 3212 1664 971 14721 24430 429 --
NM_001530chr14--21020 89 ----
NM_001542chr142559 443 363 90 12658 12596 --
NM_001546chr611373 ----1351
NM_001587chrX71901 1727 1558 1416 401 361 185 129 11912 --
NM_001609chr1043479 3165 577 493 23962 792 ----
NM_001610chr111745 ------
NM_001616chr242795 2745 1329 155 12227 ----
NM_001620chr111543 ------
NM_001621chr772878 2783 2465 2452 1095 1032 780 1162 11879 1580
NM_001621chr772878 2783 2465 2452 1095 1032 780 1162 11879 1580
NM_001655chr1131921 1874 765 ------
NM_001656chr5--11382 ----
NM_001659chr1242516 2234 694 287 --31885 916 786 12634
NM_001663chr1411972 --1117 11989
NM_001674chr14950 836 471 298 ----1103
NM_001681chr12----1694 --
NM_001682chr1221995 303 12215 11053 --
NM_001690chr322345 188 ------
NM_001699chr1981816 1577 1513 1434 1271 1249 305 291 --21320 268 21463 1132
NM_001706chr32791 321 ------
NM_001709chr1142188 1764 874 410 11013 ----
NM_001713chr53949 861 33 1179 ----
NM_001718chr6--21200 993 --11316
NM_001731chr12--1720 ----
NM_001742chr721677 624 1189 1390 --
NM_001754chr2154100 3808 3751 3664 1033 ------
NM_001755chr163483 454 99 ------
NM_001760chr64882 393 365 251 ------
NM_001769chr12----1310 --
NM_001777chr374086 3446 3135 2780 1452 1230 322 --1330 --
NM_001788chr74821 678 631 182 ----1348
NM_001789chr341392 1353 1242 528 ------
NM_001796chr16294 50 1232 ----
NM_001822chr21199 1713 ----
NM_001829chr41397 ------
NM_001842chr91540 ------
NM_001855chr91575 ------
NM_001858chr623760 1342 23912 1491 --11310
NM_001859chr983923 3569 3450 3295 2762 2607 1410 1192 --1858 --
NM_001873chr4172 ------
NM_001874chr1243481 2048 1032 84 54382 4171 3569 1814 830 --14571
NM_001880chr2129 ------
NM_001895chr201400 ------
NM_001901chr631057 876 266 ------
NM_001903chr52787 204 1185 ----
NM_001913chr73657 637 290 ------
NM_001918chr179225 8259 6754 6205 3557 3381 948 23638 2883 ----
NM_001921chr421241 199 ------
NM_001938chr12251 122 21690 546 ----
NM_001939chrX93762 3504 1498 973 926 715 617 447 131 ----21162 797
NM_001941chr1843134 1111 1080 41 22883 1487 ----
NM_001942chr1841455 1263 719 42 1113 ----
NM_001946chr1231129 752 334 1368 ----
NM_001949chr643200 2750 805 621 --11233 --
NM_001950chr163658 560 505 1679 ----
NM_001951chr83249 190 53 ------
NM_001955chr6------11102
NM_001957chr432071 1549 1421 --1394 --
NM_001961chr191413 ------
NM_001963chr4--1547 ----
NM_001967chr3--1436 1197 --
NM_001969chr1453676 2508 2417 1023 173 --11281 --
NM_001981chr142076 690 680 674 1321 ----
NM_001982chr12--11275 154 1787
NM_001987chr1263572 3437 2718 1481 1457 370 ----14146
NM_001999chr541189 499 173 167 11087 1471 --
NM_002006chr485420 3853 3834 3754 3626 1914 698 467 44407 878 305 55 ----
NM_002009chr1532484 2342 501 42417 2366 2325 2265 --12358
NM_002014chr121136 ------
NM_002015chr1342596 2503 2468 1309 22445 2091 11182 --
NM_002017chr1131288 1217 1164 ------
NM_002024chrX22237 1536 ------
NM_002025chrX147603 7306 7243 6960 6954 6761 6174 5728 3393 2375 2309 1763 1070 21 36617 6113 881 32741 2441 850 --
NM_002039chr43861 581 152 --189 --
NM_002040chr2142151 2065 100 47 1187 1411 1352
NM_002063chrX1246 ------
NM_002065chr131155 1128 387 ------
NM_002069chr741669 504 302 236 ------
NM_002086chr171153 ------
NM_002089chr4--1182 ----
NM_002090chr41105 ------
NM_002092chr475063 3816 3431 3405 1897 1202 697 64871 4738 4368 3451 921 171 1858 21729 624
NM_002126chr1773689 3561 3453 3029 1022 599 527 --12785 --
NM_002128chr1332178 1974 1874 12219 1172 --
NM_002130chr521725 443 1621 --1614
NM_002135chr12161 ----1441
NM_002136chr121133 ------
NM_002137chr751669 938 719 710 286 ------
NM_002138chr42791 671 1661 ----
NM_002146chr1741043 582 561 60 ----11242
NM_002154chr5--1223 ----
NM_002163chr161513 ------
NM_002165chr201411 ------
NM_002189chr10155 ------
NM_002190chr6--1449 ----
NM_002199chr42208 94 ------
NM_002202chr52372 345 ------
NM_002210chr233205 1377 1139 11307 ----
NM_002211chr1021104 73 ------
NM_002214chr764945 4886 4624 4183 2166 261 ------
NM_002228chr11803 ----1895
NM_002247chr1051725 1522 742 667 528 ------
NM_002253chr431158 565 156 2879 289 ----
NM_002264chr383337 1959 1870 1666 1581 647 522 444 44056 3561 1598 164 ----
NM_002267chr1312065 31775 300 219 1673 --
NM_002268chr321447 528 11393 ----
NM_002270chr555324 4594 3916 831 216 ------
NM_002280chr171164 ------
NM_002293chr142675 986 741 671 1550 ----
NM_002296chr141698 1389 1216 1202 ------
NM_002313chr1043500 976 942 786 14902 13679 --
NM_002317chr51393 ------
NM_002334chr1152044 1670 1577 704 212 ------
NM_002336chr1273774 3101 1805 1627 852 634 68 34431 4016 3987 21268 723 2687 551
NM_002355chr121557 1950 1197 --
NM_002373chr151527 --149 --
NM_002374chr273585 3477 2812 2725 2719 2694 891 12667 12917 --
NM_002382chr1411206 ------
NM_002387chr575061 5020 4807 4789 3679 3154 563 31976 1609 403 1946 --
NM_002392chr122127 57 ------
NM_002399chr151901 ----1546
NM_002448chr43543 215 207 ------
NM_002467chr8--1433 ----
NM_002469chr12----173 --
NM_002485chr852117 1730 742 612 558 ------
NM_002489chr71303 ----132
NM_002500chr2--11284 ----
NM_002505chr651456 605 599 425 407 11148 --21515 1090
NM_002515chr1451862 1834 808 344 249 --11433 --
NM_002545chr1165006 3621 2050 1584 894 114 --14850 --
NM_002556chr11--22055 426 ----
NM_002576chr114973 800 403 285 ------
NM_002577chr363631 3285 3269 2931 1335 199 1663 --33730 2838 828
NM_002581chr995030 4295 1982 1900 1698 607 390 316 271 35160 4450 3491 --1794
NM_002583chr122493 125 ------
NM_002594chr2011724 ------
NM_002595chr121604 11477 --1728
NM_002603chr8--145 ----
NM_002607chr71527 ------
NM_002610chr222499 2367 22635 2206 ----
NM_002613chr1665351 5115 4878 4184 755 603 14372 22122 1265 --
NM_002618chr2----139 --
NM_002623chr202686 225 2632 287 ----
NM_002628chr341060 1049 842 785 ------
NM_002633chr11445 ------
NM_002639chr183941 822 85 --11131 11054
NM_002643chr21169 ------
NM_002655chr853958 1355 918 829 315 21655 1092 ----
NM_002670chr311604 21388 1028 ----
NM_002706chr2--2702 543 ----
NM_002707chr2180 ------
NM_002709chr253045 2672 967 835 583 11356 ----
NM_002710chr121358 ------
NM_002715chr51817 ----1189
NM_002716chr1132310 1332 52 1438 ----
NM_002719chr1452339 2000 1844 1749 1505 ------
NM_002720chr161261 ------
NM_002731chr131963 970 649 13089 ----
NM_002733chr121233 ------
NM_002734chr172867 393 ----12175
NM_002736chr731352 684 488 22160 1581 ----
NM_002737chr1786164 4139 4076 2194 1125 1071 1033 804 35708 5482 5168 1259 --
NM_002739chr196672 564 503 252 141 98 ------
NM_002752chr51216 ------
NM_002753chr41346 ------
NM_002763chr12209 74 ------
NM_002822chr1211304 31541 513 301 ----
NM_002829chr93974 943 441 ----174
NM_002833chr151444 ------
NM_002834chr1243133 2765 838 340 ------
NM_002837chr1234480 4349 126 34022 1744 1596 13740 --
NM_002839chr941305 1236 102 21 12264 12992 --
NM_002844chr611368 1557 ----
NM_002851chr71573 ------
NM_002855chr112527 238 ------
NM_002858chr12530 406 ------
NM_002865chr81220 ------
NM_002880chr33763 337 126 ------
NM_002890chr51679 ------
NM_002892chr1411084 21110 494 11477 --
NM_002893chrX1133 ------
NM_002897chr2187 ------
NM_002902chr15------1466
NM_002906chr111758 31464 929 847 ----
NM_002912chr61635 1853 ----
NM_002938chr42234 218 --11450 --
NM_002942chr3------11005
NM_002955chr631407 650 317 ------
NM_002956chr1251084 1045 948 395 160 21183 127 ----
NM_002957chr973789 3577 3360 2894 1302 1133 427 23473 1582 13414 --
NM_002958chr32318 187 ----2794 142
NM_002959chr174364 3095 2886 2755 1648 1554 1198 --24033 2863 13647
NM_002968chr16----2700 164 --
NM_002970chrX--141 ----
NM_002994chr451833 1361 792 668 60 ----1561
NM_002998chr811627 --11984 1166
NM_002999chr2051561 1484 539 287 32 --11377 --
NM_003010chr1752218 959 894 470 316 22463 908 11841 126
NM_003011chr921628 369 ------
NM_003022chrX--11314 ----
NM_003042chr322250 513 11673 11737 --
NM_003043chr354287 4241 3462 3161 2789 11461 ----
NM_003045chr1354820 3935 3215 2022 1203 ------
NM_003051chr11625 --1309 1302
NM_003060chr561151 1026 974 413 345 302 --2427 194 --
NM_003070chr91130 ------
NM_003071chr3187 275 50 --11997
NM_003095chr12138 --1248 --
NM_003101chr12500 406 ------
NM_003106chr34736 422 365 328 ------
NM_003107chr61427 ------
NM_003108chr256895 6744 4623 2208 317 25518 477 26305 522 --
NM_003112chr732521 1079 27 22969 63 --12645
NM_003114chr81533 1227 ----
NM_003128chr22722 311 --11912 --
NM_003133chr11281 --1153 --
NM_003137chr62381 110 ------
NM_003139chr11----174 --
NM_003144chr641997 782 747 620 --1771 1297
NM_003155chr8----12552 1359
NM_003161chr1711435 ------
NM_003183chr2--1571 --1624
NM_003189chr183345 2762 2409 2249 2065 1103 1068 394 --1600 --
NM_003193chr11164 ------
NM_003198chr1------1198
NM_003199chr1834827 3650 1496 --13695 --
NM_003202chr531787 1749 1737 ------
NM_003217chr1221911 1627 ----11789
NM_003220chr631578 1276 638 ------
NM_003222chr201181 1309 ----
NM_003236chr233162 3019 2861 43318 2685 2260 1046 --12406
NM_003242chr312114 32130 764 740 21981 981 --
NM_003247chr631584 790 92 11829 ----
NM_003253chr2121419 613 ----11634
NM_003257chr1531336 1216 90 ------
NM_003262chr343997 1339 837 781 ------
NM_003269chr611024 ------
NM_003274chr2132587 1938 521 31850 696 507 ----
NM_003275chr91200 ------
NM_003286chr2021058 221 ------
NM_003288chr201632 ------
NM_003298chr355611 5309 4028 3939 706 1258 14363 1783
NM_003320chr1184432 3742 3380 3136 1530 1288 1164 665 23300 1105 23980 1743 11002
NM_003337chr531197 630 480 1136 1342 --
NM_003340chr41417 1205 ----
NM_003341chr32438 261 ------
NM_003342chr1732701 1283 699 ------
NM_003344chr721487 1160 11629 1157 --
NM_003345chr161535 1432 --1422
NM_003348chr1241589 492 471 215 1636 --1461
NM_003349chr202426 84 ------
NM_003352chr22347 136 ------
NM_003360chr4--1237 ----
NM_003368chr1181 1176 1122 --
NM_003369chr1132002 511 244 --1559 12597
NM_003375chr102172 147 ----1325
NM_003383chr91241 ------
NM_003392chr393925 3110 2809 1529 1510 1493 1291 803 461 23289 84 ----
NM_003404chr2022013 1761 ------
NM_003406chr8--11876 2571 544 --
NM_003409chr1811321 3889 511 299 ----
NM_003410chrX32199 1149 133 21990 673 ----
NM_003411chrY51752 1590 1584 508 128 1636 ----
NM_003412chr363057 1949 957 695 562 327 ----12682
NM_003413chrX21232 730 21971 1872 11919 --
NM_003418chr3--1613 ----
NM_003432chr51498 1582 ----
NM_003457chr172487 241 1250 ----
NM_003458chr393786 3375 3176 3083 3033 2743 2567 2474 587 --290 64 --
NM_003466chr272458 2362 1921 1801 1782 537 412 ------
NM_003471chr341579 781 635 115 12125 ----
NM_003473chr101172 ------
NM_003478chr1133148 2940 2545 32573 2339 28 ----
NM_003483chr1222879 2472 22392 507 ----
NM_003487chr171185 ------
NM_003489chr2163077 2927 2544 2536 967 783 --11077 --
NM_003506chr8--1919 ----
NM_003517chr1139 ------
NM_003559chr1793391 2993 2871 1423 1045 1027 558 164 125 23421 656 22831 1305 13549
NM_003566chr121924 2785 249 ----
NM_003567chr1------124
NM_003569chr61574 ------
NM_003574chr1854944 4887 4128 2038 394 11398 --11906
NM_003583chr1293805 3637 3346 3228 2882 2482 1157 683 548 22644 751 11102 --
NM_003590chr263141 1532 701 575 475 121 33846 3558 301 --12818
NM_003597chr262110 1630 639 542 420 308 1380 ----
NM_003603chr41528 1685 --11514
NM_003607chr164178 3793 3701 2891 2739 769 ------
NM_003615chr33849 631 133 23375 2905 12492 --
NM_003618chr21390 ----132
NM_003620chr17--1338 ----
NM_003626chr1121088 1074 1192 ----
NM_003629chr153154 2563 1295 992 31 11318 --1187
NM_003630chr62648 178 ------
NM_003632chr171605 --1838 --
NM_003633chr512160 11671 11774 --
NM_003642chr21123 ------
NM_003645chr151177 ------
NM_003655chr171298 --1489 1716
NM_003663chr343186 996 960 217 23434 1039 1437 --
NM_003664chr5------2145 24
NM_003671chr972825 2767 2247 2229 1013 914 274 12341 --2680 39
NM_003672chr12415 57 1538 ----
NM_003676chr11624 --141 --
NM_003679chr153418 2594 2491 2480 667 ------
NM_003692chr91935 2400 134 ----
NM_003701chr13--1819 --1836
NM_003713chr141285 549 469 251 --11221 --
NM_003718chr73454 225 51 139 ----
NM_003743chr251882 1829 1764 520 313 1763 --11851
NM_003749chr1332241 1535 537 ----11617
NM_003758chr1511160 ------
NM_003758chr1511160 ------
NM_003759chr463903 3784 3010 1208 509 113 11678 11044 --
NM_003760chr1----1712 --
NM_003768chr151473 1329 1198 252 160 --1659 11515
NM_003769chr12--1325 ----
NM_003780chr11703 ------
NM_003787chr1851648 1490 1240 1060 205 11501 ----
NM_003800chr622254 2170 32150 392 360 ----
NM_003816chr821383 1371 1946 --1503
NM_003825chr1521362 197 --11302 --
NM_003829chr921113 830 2777 152 ----
NM_003831chr1831729 1488 506 11555 ----
NM_003860chr111352 ------
NM_003861chr1432499 452 245 22526 2477 --12746
NM_003872chr222165 805 ------
NM_003873chr1032227 1827 839 11656 ----
NM_003877chr121243 --186 1839
NM_003895chr212841 544 ----1266
NM_003909chr83693 541 152 ------
NM_003913chr6103785 3361 3214 3054 3021 2906 2851 2723 557 156 13388 13414 --
NM_003924chr421474 1221 1440 11277 --
NM_003927chr182936 151 ------
NM_003930chr731990 1780 395 155 ----
NM_003931chr6184 ------
NM_003948chr452584 2115 766 685 587 32202 1694 150 --11766
NM_003968chr31256 ------
NM_003970chr81453 ------
NM_003972chr1041300 348 312 112 ------
NM_003980chr631326 1142 103 ------
NM_003983chr1673517 3250 1433 916 898 749 458 --13895 --
NM_003994chr1244152 1572 1071 103 33579 478 278 13229 --
NM_003998chr41619 ------
NM_004006chrX22308 803 1836 12323 --
NM_004007chrX22308 803 1836 12323 --
NM_004009chrX22308 803 1836 12323 --
NM_004010chrX22308 803 1836 12323 --
NM_004011chrX22308 803 1836 12323 --
NM_004012chrX22308 803 1836 12323 --
NM_004013chrX22308 803 1836 12323 --
NM_004014chrX22308 803 1836 12323 --
NM_004015chrX22308 803 1836 12323 --
NM_004016chrX32222 1005 717 1750 12237 --
NM_004017chrX22308 803 1836 12323 --
NM_004018chrX32222 1005 717 1750 12237 --
NM_004020chrX22308 803 1836 12323 --
NM_004021chrX32222 1005 717 1750 12237 --
NM_004022chrX32222 1005 717 1750 12237 --
NM_004023chrX32222 1005 717 1750 12237 --
NM_004024chr121309 1195 ----1462
NM_004036chr21106 2504 114 ----
NM_004039chr151396 164 --1297
NM_004050chr1452572 2316 2195 2081 913 22639 998 ----
NM_004056chr81821 1430 ----
NM_004075chr122536 452 ------
NM_004080chr711115 1448 ----
NM_004081chrY1227 3710 542 274 --21520 60
NM_004085chrX3595 586 246 ------
NM_004093chr1333184 675 586 --1480 --
NM_004094chr1432866 571 314 11219 ----
NM_004096chr1051545 1393 654 602 142 11938 ----
NM_004100chr661837 471 406 290 172 76 ------
NM_004114chrX31051 186 66 ------
NM_004124chr1473384 3175 3131 2792 1270 720 703 23156 553 ----
NM_004156chr81212 ------
NM_004161chr21330 11149 ----
NM_004162chr3--1406 ----
NM_004171chr11119525 8596 8090 7220 7159 6542 3704 3601 3363 2032 1953 48478 7646 2671 2379 38577 6195 3393 1466
NM_004175chr22----1111 --
NM_004180chr22398 138 --1576 --
NM_004202chrY3678 575 259 --1621 --
NM_004215chr81457 ------
NM_004227chr753004 2566 2405 1942 1006 2600 450 ----
NM_004229chrX11430 --1571 --
NM_004232chr1863888 2601 1142 914 677 216 32952 744 528 ----
NM_004234chr192503 150 ------
NM_004236chr151527 ------
NM_004238chr21220 ------
NM_004242chr61324 ------
NM_004244chr121434 ------
NM_004252chr173492 163 137 ------
NM_004253chr91711 1838 ----
NM_004272chr561784 640 630 618 406 333 1174 ----
NM_004274chr1462481 2257 2157 443 220 100 1398 --13194
NM_004277chr641525 1485 1228 95 21158 155 ----
NM_004280chr61166 --162 --
NM_004281chr10145 --1437 --
NM_004282chr62208 197 ------
NM_004287chr1782472 2246 2087 2010 1875 1670 851 714 12602 11649 --
NM_004293chr933127 546 185 31224 982 566 13708 --
NM_004301chr3156 ------
NM_004311chr1043121 2169 1047 314 3985 752 141 12794 --
NM_004326chr13966 497 451 ------
NM_004331chr811701 2246 216 ----
NM_004342chr761740 1734 1502 676 646 175 21986 359 ----
NM_004346chr42498 380 1463 11266 --
NM_004349chr811268 --1234 --
NM_004370chr621966 1628 1786 ----
NM_004380chr1641873 770 665 70 11896 ----
NM_004385chr51245 ------
NM_004392chr1322112 966 1887 ----
NM_004397chr1163667 3561 3483 3463 1532 496 23422 1151 12980 --
NM_004415chr61688 ------
NM_004423chr352108 1077 384 268 202 --12359 12079
NM_004426chr1241636 428 281 198 41807 1583 1472 1416 ----
NM_004430chr832803 1934 1799 ------
NM_004432chr912072 1806 ----
NM_004434chr1421849 1264 ------
NM_004437chr163170 2684 2427 1080 921 172 12216 23534 3104 --
NM_004438chr223217 3150 32929 2142 767 12649 --
NM_004440chr6--1458 ----
NM_004447chr1231078 1065 161 ------
NM_004449chr21----1325 --
NM_004450chr142405 114 ------
NM_004454chr33888 511 122 1542 1142 --
NM_004456chr7--178 ----
NM_004458chrX32603 223 190 11826 12313 21946 61
NM_004463chrX268 41 ------
NM_004481chr112663 ------
NM_004482chr21766 ------
NM_004496chr141333 ------
NM_004501chr163646 2687 1404 1151 1031 69 43077 2920 1422 127 ----
NM_004505chr1721340 397 ----11862
NM_004516chr191276 11186 ----
NM_004523chr1041387 1262 1099 523 11293 ----
NM_004537chr1231364 1070 1029 11526 ----
NM_004540chr212898 105 ------
NM_004543chr2165 ------
NM_004571chr2163338 3169 2573 2397 2254 660 ------
NM_004575chr421173 1128 ------
NM_004586chrX45157 4377 4307 2088 ------
NM_004592chr121245 ------
NM_004593chr32783 775 ------
NM_004602chr201505 ------
NM_004612chr934721 4076 299 33578 1850 1178 1979 14452
NM_004627chr211109 ----1714
NM_004637chr311309 11104 ----
NM_004654chrY1551 11210 ----
NM_004660chrY52296 1697 1476 246 215 --1323 --
NM_004661chr52900 312 11130 ----
NM_004664chr121268 ------
NM_004685chr1373011 2875 2850 2336 1982 1179 1140 33023 2910 2891 ----
NM_004687chr1731966 647 518 31528 1486 238 1504 --
NM_004703chr1752083 1590 407 136 22 --154 --
NM_004709chrX31708 1235 146 --1508 --
NM_004721chr31258 ------
NM_004723chr12882 249 1871 ----
NM_004726chrX105307 5171 4964 4894 4373 3841 979 570 523 296 24857 1473 ----
NM_004733chr3124 ------
NM_004734chr1322389 1256 2611 576 12400 12162
NM_004736chr1174 --1846 --
NM_004738chr2052451 2352 2333 1609 1006 22371 191 2971 841 --
NM_004744chr473900 3518 3345 2690 1441 1047 116 --11580 --
NM_004745chr835200 2745 2075 35021 4765 2120 24795 315 14874
NM_004747chr1061621 1485 1424 1293 271 68 ------
NM_004757chr41114 ------
NM_004762chr1731864 1614 1492 ----11513
NM_004768chr1--1173 ----
NM_004772chr521266 400 --1132 --
NM_004775chr181829 --1573 --
NM_004776chr2041025 660 486 478 22156 1214 22749 899 12641
NM_004789chr9152 ------
NM_004796chr1422099 132 11878 21818 285 1747
NM_004798chr2052884 2725 2565 350 191 23626 1443 13549 --
NM_004799chr11291 ------
NM_004804chr232748 2617 1119 21686 974 ----
NM_004817chr91501 ------
NM_004827chr441284 676 670 315 41483 662 287 149 ----
NM_004831chr191813 1797 1929 --
NM_004841chr11749 --1808 --
NM_004845chrX104067 3929 3813 3380 1588 1318 1297 591 240 208 --13918 --
NM_004849chr641714 1256 1125 382 11427 ----
NM_004855chr151207 ------
NM_004856chr151580 ----1467
NM_004857chr1434138 4129 194 ----23984 108
NM_004859chr1722476 804 53018 2847 2641 2363 195 ----
NM_004863chr1475198 5139 3939 3606 1765 971 310 15209 13387 --
NM_004866chr574982 4924 4714 4672 3872 3701 3560 34749 3914 559 23596 359 --
NM_004869chr1811412 ----11325
NM_004879chr114728 378 255 157 ------
NM_004897chr103220 148 29 1652 ----
NM_004898chr432139 572 125 ------
NM_004902chr20175 ----1272
NM_004904chr796531 6285 5857 5637 4685 2257 1803 1794 685 56169 5679 4637 4051 76 16098 15872
NM_004906chr61565 ------
NM_004915chr212615 200 159 ----
NM_004929chr841493 1237 402 327 ------
NM_004936chr942938 2327 2171 559 23055 1190 --1604
NM_004946chr52459 405 152 ----
NM_004948chr1831049 155 98 ----1395
NM_004956chr773056 3020 2953 1021 956 746 685 23414 846 13551 --
NM_004958chr14891 759 168 52 ----1293
NM_004964chr11410 ------
NM_004965chr21--1714 --1109
NM_004966chr105992 951 398 172 124 ------
NM_004969chr10--1402 ----
NM_004973chr63553 129 57 1419 ----
NM_004975chr20----1292 196
NM_004976chr1174487 3254 1629 1070 690 668 95 --24210 649 24060 1639
NM_004985chr1254046 3742 3506 1530 481 33820 3545 3343 11324 --
NM_004992chrX97229 6943 6686 6471 5879 2435 2304 958 650 38037 2792 2373 21575 509 18305
NM_004992chrX97229 6943 6686 6471 5879 2435 2304 958 650 38037 2792 2373 21575 509 18305
NM_004999chr654275 3667 1759 1733 1255 43444 1201 586 578 --1317
NM_005006chr22923 362 ------
NM_005011chr7131 ------
NM_005023chr511070 ------
NM_005028chr1032363 2315 195 12063 ----
NM_005044chrX31473 629 257 122 ----
NM_005056chr1265367 3826 2070 1725 1333 913 --1529 --
NM_005058chrY1228 ------
NM_005063chr101221 23506 3105 ----
NM_005066chr1149 ------
NM_005068chr651486 1463 1426 1293 591 --11221 --
NM_005076chr164198 3538 3504 2967 1199 345 13456 1263 13203
NM_005077chr91506 ------
NM_005079chr882829 2692 2539 2046 1149 853 631 194 42161 2143 860 334 ----
NM_005087chr31654 ------
NM_005088chrX1698 --1167 --
NM_005102chr22812 199 1636 ----
NM_005105chr142158 1482 1378 242 ----1775
NM_005109chr342437 1972 1900 503 12234 --1125
NM_005112chr4--1703 2185 23 --
NM_005116chr2043929 3459 3056 766 ------
NM_005117chr112170 110 1126 ----
NM_005121chr1733513 602 197 --11132 --
NM_005126chr322119 2074 ------
NM_005135chr1543107 1080 1061 516 12954 ----
NM_005151chr1832001 1943 707 22189 723 177 --
NM_005153chr16178 2794 231 190 --
NM_005156chr924547 3875 1964 ----
NM_005159chr1541999 1769 1684 1604 --11494 1439
NM_005160chr22106570 6060 5913 5509 5184 4545 4396 2186 1856 552 22707 2067 ----
NM_005168chr241304 1175 500 475 --11111 --
NM_005180chr10176 ------
NM_005188chr1197820 7642 7355 6994 5933 5694 5600 2985 28 48238 7296 6310 594 47509 5910 2263 1714 --
NM_005190chr61167 ------
NM_005197chr1445517 4863 4341 1647 22116 1865 26047 4749 --
NM_005230chr123638 481 140 ------
NM_005235chr2107317 6478 6176 5662 2447 2296 1879 1771 1389 70 22261 2051 15454 25370 2551
NM_005238chr1183043 2984 2878 2841 2336 1306 511 270 23341 1323 ----
NM_005243chr221129 ------
NM_005245chr42546 32 2672 612 1141 --
NM_005254chr1511335 1511 11287 1174
NM_005256chr112842 815 3691 616 269 ----
NM_005261chr8----1238 --
NM_005311chr711748 1953 1832 11955
NM_005316chr111960 --11113 2923 64
NM_005324chr172720 615 21809 1705 --21726 770
NM_005338chr743918 3823 1621 1353 --23408 3125 --
NM_005339chr453364 3283 3258 283 124 12910 14071 --
NM_005342chrX62519 2173 2047 1915 1064 192 22055 808 --1152
NM_005349chr41405 ------
NM_005358chr1321172 317 11244 1136 --
NM_005359chr18125964 5657 5614 5238 5179 5152 4734 4460 2528 1970 1326 781 36300 4027 2012 --11956
NM_005373chr121506 1395 11158 ----
NM_005384chr9--132 ----
NM_005388chr921371 1282 21395 579 1453 --
NM_005399chr193770 3753 3645 3391 3106 2952 1733 1087 57 --23212 1158 13747
NM_005402chr721308 336 2608 467 11525 --
NM_005406chr1811058 ----11381
NM_005409chr42369 352 1261 --1424
NM_005436chr1074047 3716 3686 3416 3139 120 80 23539 2846 12833 --
NM_005440chr1763139 2230 1195 794 603 563 12613 1435 --
NM_005458chr952264 2163 668 471 86 ------
NM_005465chr11390 1413 ----
NM_005471chr531247 1087 954 155 --168
NM_005475chr1262893 2836 1316 1161 987 517 ----22468 2055
NM_005476chr92879 66 ------
NM_005487chr2232070 753 90 21804 1319 ----
NM_005493chr6183 ------
NM_005494chr71502 ------
NM_005497chr1766044 3963 3832 1527 251 93 --2465 144 16142
NM_005503chr1521088 251 ----1846
NM_005504chr1255948 5664 5246 4294 1175 24556 2069 25534 1325 --
NM_005517chr141337 511 453 233 ------
NM_005537chr1331112 920 850 1217 ----
NM_005546chr542303 1534 932 250 42110 2067 2053 2005 ----
NM_005563chr11753 1103 ----
NM_005570chr1821141 432 ------
NM_005575chr52838 127 ------
NM_005578chr344350 4043 1665 1653 23914 858 1956 --
NM_005587chr153967 937 634 ------
NM_005591chr1121081 127 22259 741 ----
NM_005593chr121450 ------
NM_005595chr12870 159 ------
NM_005596chr996192 6177 6139 4779 4368 4113 1664 630 422 --15954 15247
NM_005598chr151708 1456 1321 402 35 ------
NM_005607chr82978 50 ------
NM_005610chr12228 28 ------
NM_005611chr163925 264 64 1278 ----
NM_005613chr141889 1810 412 278 11994 1404 150
NM_005625chr81377 1426 ----
NM_005627chr6--1687 --1119
NM_005634chrX1207 ------
NM_005639chr123354 305 46 11314 ----
NM_005647chrX62523 2290 2137 1337 1179 133 1538 ----
NM_005649chr52481 427 --1350 --
NM_005655chr81476 1820 ----
NM_005664chr151274 --11039 --
NM_005665chr153962 3622 1500 1437 1195 33993 3421 285 ----
NM_005668chr5--1538 --34147 1721 1337
NM_005669chr551810 1713 745 605 241 11738 ----
NM_005688chr31487 --134 --
NM_005715chr62880 698 11033 12445 21777 434
NM_005717chr11820 ----1854
NM_005722chr23446 329 267 32422 2310 2060 ----
NM_005725chr111816 41635 578 365 231 --1675
NM_005730chr1263066 3001 2586 1283 1245 141 13123 ----
NM_005734chr11----1220 --
NM_005738chr72582 43 2697 550 ----
NM_005742chr21635 --1536 --
NM_005748chr1213009 43267 3068 1200 850 12301 --
NM_005749chr171516 ------
NM_005756chrX51128 1001 413 189 116 ------
NM_005761chr12--1160 ----
NM_005765chrX1158 1306 ----
NM_005766chr132978 228 ------
NM_005776chr142853 246 ------
NM_005795chr242499 2255 2124 1999 32634 2359 1075 ----
NM_005797chr1121805 134 --1154 --
NM_005808chr393032 2822 2765 2739 2668 2304 1396 730 46 32892 2336 519 --139
NM_005813chr242502 2259 1628 1027 11985 ----
NM_005819chr152817 2633 1402 1391 1023 23382 2265 12511 --
NM_005822chr662284 1922 1771 869 558 218 1210 12058 --
NM_005824chr7--2749 68 ----
NM_005826chr1----149 --
NM_005839chr1----185 --
NM_005840chrX57261 4718 3046 2408 1950 36475 6303 2162 15960 15530
NM_005842chr131485 ------
NM_005852chr173818 750 410 --1458 --
NM_005853chr16--1579 ----
NM_005859chr51471 1494 ----
NM_005871chr101371 ------
NM_005872chr12523 223 1118 ----
NM_005880chr1621417 451 11275 ----
NM_005896chr21228 1116 ----
NM_005898chr1152130 1245 1055 916 758 ------
NM_005899chr17----1197 --
NM_005900chr42781 419 ----126
NM_005901chr1878023 7309 7193 5903 5711 5641 407 56076 3221 2944 516 196 --28310 7085
NM_005902chr1564502 4380 3995 1722 409 253 1373 ----
NM_005903chr545109 3643 583 53 13964 11702 14859
NM_005909chr523597 544 33681 3457 3046 ----
NM_005920chr143580 2757 2534 1223 13371 1452 1742
NM_005927chr521249 399 2875 842 ----
NM_005930chr142823 193 ------
NM_005935chr424242 1142 55161 3364 3243 1472 289 --13829
NM_005941chr822700 246 ------
NM_005955chr195170 5107 4058 3588 3407 2141 1710 732 25 14405 11057 --
NM_005962chr1021597 333 ----11869
NM_005962chr1021597 333 ----11869
NM_005964chr1721468 1232 ------
NM_005966chr222064 341 1445 --128
NM_005977chr132382 347 ------
NM_005999chr141506 1281 1149 418 11396 ----
NM_006010chr31250 ----1202
NM_006015chr121140 829 ------
NM_006016chr692246 2077 1743 1677 1546 1449 1418 776 683 ------
NM_006024chr7--1614 ----
NM_006029chr14122 ------
NM_006032chr141209 ------
NM_006038chr2041882 1874 857 342 ------
NM_006040chr1651324 1114 525 401 380 ------
NM_006041chr171194 --1148 --
NM_006047chr2042858 991 296 209 23338 3110 --23429 2378
NM_006070chr31270 ------
NM_006080chr71238 1825 ----
NM_006094chr82812 744 150 ----
NM_006095chr431626 849 557 ------
NM_006099chr14737 335 97 88 1218 1230 --
NM_006106chr1173369 3152 2451 2314 2143 1382 1180 21131 1044 ----
NM_006107chr17--1443 ----
NM_006110chr161131 ------
NM_006135chr13464 354 127 ------
NM_006136chr72405 264 11244 ----
NM_006139chr221784 562 1569 165 --
NM_006141chr1662765 2260 1744 999 935 222 ------
NM_006147chr12320 68 ----1388
NM_006154chr1532670 1018 598 22649 2528 31907 266 220 --
NM_006158chr841752 1541 1455 736 ------
NM_006166chr1221043 494 158 --12597
NM_006180chr931679 1529 1522 ------
NM_006186chr211173 1245 ----
NM_006194chr141208 ------
NM_006197chr842043 504 372 175 3687 643 621 ----
NM_006202chr194699 583 519 483 2495 273 ----
NM_006203chr555263 4993 3842 1866 1100 14262 --14120
NM_006206chr42826 387 32790 2201 619 146 --
NM_006212chr1245302 5204 4790 4467 4368 4308 4280 4241 4213 3663 3490 1994 1987 1975 1739 1725 1662 1553 1010 908 847 718 624 269 21022 551 22064 510 --
NM_006218chr3----134 1220
NM_006224chr1772316 1947 1863 1650 673 584 152 12031 ----
NM_006228chr81316 ------
NM_006237chr1321798 876 ----1505
NM_006241chr322207 1724 22008 1704 12180 1306
NM_006247chr191143 ------
NM_006251chr562998 2217 1247 1038 910 473 23359 2065 ----
NM_006256chr11795 22388 2232 ----
NM_006275chr2032137 1594 825 1842 1409 --
NM_006279chr12844 801 ------
NM_006298chr651194 929 563 149 106 1496 11073 22191 244
NM_006300chr1922288 140 1295 --1198
NM_006304chr7154 ------
NM_006306chrX64006 2251 1565 814 171 30 34940 1098 409 55839 5088 4797 732 61 --
NM_006313chr121660 ------
NM_006315chr441726 1310 476 82 1494 11511 --
NM_006325chr12--1325 ----
NM_006329chr141514 ----1754
NM_006350chr51337 ------
NM_006352chr141843 1796 1777 464 --1187 1138
NM_006366chr621276 102 ------
NM_006367chr12677 74 ----1970
NM_006369chr1----1337 --
NM_006371chr395151 4929 4406 2060 1702 1601 1577 862 648 ----24170 2114
NM_006372chr6--1450 ----
NM_006379chr71766 12180 --1364
NM_006380chr1753738 2887 2695 820 780 23880 1175 1767 13384
NM_006390chr1241572 525 438 288 ----11412
NM_006393chr1063256 984 941 873 219 163 33635 1189 546 13724 33643 2923 1717
NM_006407chr321345 1028 11385 1953 --
NM_006413chr101211 ------
NM_006415chr911001 1818 ----
NM_006416chr62606 591 1219 ----
NM_006420chr2022772 297 23118 2753 22673 2535 --
NM_006431chr12139 ------
NM_006434chr1022672 962 2888 796 22215 751 --
NM_006449chr212107 1172 ----
NM_006457chr453611 3515 3425 855 74 1308 23167 3037 --
NM_006460chr172626 404 1229 ----
NM_006464chr243904 3656 1554 1544 ----44048 3246 173 23
NM_006482chr1293805 3637 3346 3228 2882 2482 1157 683 548 22644 751 11102 --
NM_006489chr1451862 1834 808 344 249 --11433 --
NM_006496chr151777 1271 684 494 136 21227 300 ----
NM_006520chrX21704 1079 1241 ----
NM_006527chr4--1632 --1592
NM_006534chr2042876 1252 412 276 12685 ----
NM_006537chr151217 ------
NM_006538chr233230 761 484 24043 3314 ----
NM_006544chr14115606 5533 5497 5452 5352 4341 3686 2053 1571 1210 729 65480 4539 1641 1275 1170 368 --11554
NM_006546chr1765222 4580 2019 1869 1466 235 --24337 2517 15396
NM_006548chr32683 565 1478 ----
NM_006560chr111458 1335 ----
NM_006561chr1065069 5049 3807 3784 1987 1019 31825 1460 855 1505 --
NM_006572chr1793534 3359 3106 2984 2707 2508 2233 1371 575 12864 ----
NM_006575chr143314 246 135 ------
NM_006587chr421096 292 11193 11211 --
NM_006593chr2------1714
NM_006599chr1688154 7378 6021 5014 1876 1411 954 673 46052 6036 5893 2987 1893 16291
NM_006601chr121383 ------
NM_006609chr22471 273 22248 1914 22450 531 --
NM_006614chr333151 2564 256 11396 ----
NM_006620chr674596 3588 3254 1467 1450 109 29 1852 21022 673 --
NM_006621chr141431 821 288 217 --1186 1678
NM_006624chr1011310 2359 85 ----
NM_006626chr941011 961 424 276 --1325 1435
NM_006628chr1551647 1620 1351 595 257 13767 14369 --
NM_006629chr1821875 669 ------
NM_006646chr1352311 2300 909 839 486 32782 2010 1123 1983 --
NM_006651chr4----11156 1569
NM_006654chr1284641 4278 1599 1271 1223 1129 812 295 ------
NM_006660chr151129 ------
NM_006682chr722317 2258 ----168
NM_006691chr113996 243 202 11239 ----
NM_006700chr122123 114 ------
NM_006703chr61528 ------
NM_006704chr13------1134
NM_006708chr631205 1189 919 182 21199 936 --
NM_006711chr163772 107 67 ------
NM_006713chr5137 ------
NM_006717chr982549 2240 2174 2091 1179 1070 932 681 23315 1001 ----
NM_006720chr1043500 976 942 786 14902 13679 --
NM_006721chr101132 ------
NM_006722chr32511 262 21192 155 ----
NM_006726chr41983 ------
NM_006729chrX94790 4695 4566 4398 2244 2222 2101 2043 859 2962 559 11346 --
NM_006738chr1544609 3765 3434 1122 13563 ----
NM_006746chrX61030 564 447 85 39 23 11372 11390 --
NM_006749chr811054 ------
NM_006750chr16168125 7893 6807 6484 6478 6348 6232 5501 2860 1878 1695 1495 991 686 331 194 37829 5509 2307 17057 1638
NM_006751chr23895 738 116 ------
NM_006762chr131242 275 194 ------
NM_006766chr842660 2418 957 115 1149 ----
NM_006769chr12744 135 ------
NM_006771chr173985 808 243 ----172
NM_006774chr721110 295 2188 157 21056 368 --
NM_006777chrX62498 2422 2181 778 693 459 2471 151 --11796
NM_006788chr1861679 1393 438 429 206 22 12099 ----
NM_006801chr193477 241 212 ------
NM_006806chr212311 175 ------
NM_006811chr203902 877 715 --1992 --
NM_006824chr12210 161 ------
NM_006826chr231170 899 832 ------
NM_006828chr6162 1252 ----
NM_006832chr141937 ------
NM_006838chr1261914 1393 1243 632 475 378 21623 232 ----
NM_006856chr123891 744 340 ------
NM_006861chr123696 438 333 ------
NM_006870chr201121 ------
NM_006885chr1631280 1210 658 13564 ----
NM_006888chr1432651 639 406 ----22272 36
NM_006897chr121206 ------
NM_006898chr2--1806 ----
NM_006908chr721168 1113 ------
NM_006915chrX1414 ------
NM_006918chr1175737 5722 5303 4325 4055 780 252 25670 1224 22086 617 --
NM_006920chr231631 333 83 11406 11834 --
NM_006922chr242030 583 377 310 1795 --1822
NM_006924chr1744061 3679 1081 613 12784 ----
NM_006931chr1282146 2013 1945 1612 1496 1424 1326 487 ------
NM_006939chr143962 450 437 1465 ----
NM_006948chr2162225 2047 693 287 280 124 21770 1673 ----
NM_006981chr912939 ------
NM_006988chr21--1296 ----
NM_006996chr111287 21323 668 ----
NM_007005chr921597 629 ------
NM_007006chr161661 13366 13247 --
NM_007007chr1264737 4301 3639 3573 1753 691 23778 1461 ----
NM_007011chr1566538 4705 4326 4223 906 824 22026 1504 11418 142
NM_007026chr171238 --1376 --
NM_007034chr11793 2664 417 1337 --
NM_007035chr122628 594 ------
NM_007039chr1461638 1611 1474 689 423 293 ----12037
NM_007043chr1251901 1779 1681 1672 469 22075 582 ----
NM_007050chr20107918 7659 6723 6352 5995 5892 1785 1256 516 494 15782 32649 2593 2283 15423
NM_007052chrX190 ------
NM_007064chr341312 636 432 361 11433 ----
NM_007078chr1041045 659 449 256 ------
NM_007084chr1321474 1258 11303 11004 --
NM_007106chr1352743 2586 2316 2176 722 1423 ----
NM_007112chr1137 ------
NM_007114chr353202 3149 2386 2371 715 13069 ----
NM_007124chr621669 1445 11498 ----
NM_007125chrY11258 ------
NM_007144chr171416 ------
NM_007157chrX42587 927 511 67 ----12861
NM_007166chr11------11000
NM_007170chr11303 ------
NM_007172chr2252737 2650 2487 2165 1168 33004 1333 1082 11003 --
NM_007181chr191162 ------
NM_007187chr132716 104 ------
NM_007191chr121715 ------
NM_007195chr1853632 3440 2573 1143 773 13493 ----
NM_007197chr1221042 302 ------
NM_007200chr1544609 3765 3434 1122 13563 ----
NM_007203chr973940 3281 3106 2791 908 718 340 13310 22717 190 --
NM_007212chr121914 871 ------
NM_007214chr61374 ------
NM_007231chrX31710 879 205 2681 49 ----
NM_007236chr1562021 1906 798 769 615 467 --12349 --
NM_007246chr41781 --1263 --
NM_007249chr13108708 8687 8470 7958 7629 6467 2910 2121 2102 1832 27000 2472 16157 17643
NM_007286chr562096 1898 1490 495 165 127 11636 2698 653 --
NM_007308chr4--1703 ----
NM_007324chr11291 ------
NM_007331chr442511 2317 2014 575 ------
NM_007345chr1832279 2020 938 32328 2266 1804 ----
NM_007350chr1234280 3582 3337 74498 3087 1628 1079 1020 606 268 ----
NM_007358chr131751 1348 437 21863 250 11916 --
NM_007361chr141649 ------
NM_007372chr172899 285 146 2305 233 --
NM_007373chr1021416 550 2661 156 ----
NM_007375chr112199 12011 12324 1160
NM_012062chr122777 288 1745 ----
NM_012069chrX42327 902 389 59 22630 2128 --11082
NM_012074chr142449 22 1924 1101 --
NM_012081chr543232 2665 2486 326 3743 591 479 23000 73 --
NM_012082chr8--1367 ----
NM_012090chr1--11150 ----
NM_012092chr211511 1140 1591 11376
NM_012095chr1043547 3323 1053 95 22806 2639 ----
NM_012096chr332710 2351 795 22825 954 --13603
NM_012104chr1133485 1532 678 --21038 483 --
NM_012104chr1133485 1532 678 --21038 483 --
NM_012105chr211142 ----1354
NM_012120chr622950 2120 1683 12527 --
NM_012129chr732182 1663 902 ------
NM_012141chr1373478 3468 3156 2939 2890 1479 952 ------
NM_012153chr1121989 742 1388 11020 --
NM_012157chr33984 712 155 ----149
NM_012175chr112252 38 1308 ----
NM_012183chr11409 ------
NM_012193chr1174987 4521 4363 3685 3637 1446 264 31802 961 548 12039 --
NM_012199chr154429 4417 4146 1752 1111 --24484 405 --
NM_012210chr961264 1053 589 298 280 195 1125 11428 --
NM_012214chr295737 4832 4777 4566 2486 2217 2182 1716 989 46124 6018 5565 4751 ----
NM_012215chr1021700 1214 ----21859 89
NM_012223chr22252 109 1493 ----
NM_012233chr231014 458 437 --1340 --
NM_012234chr333233 3041 2609 22706 987 13501 12519
NM_012238chr1041363 1256 404 52 ------
NM_012247chr10----1269 --
NM_012249chr222498 1290 --12999 --
NM_012250chr11189 ------
NM_012255chr202455 306 ------
NM_012281chr741967 1738 636 180 21784 1772 ----
NM_012287chr364304 3825 1482 1099 436 255 11589 2666 272 13383
NM_012288chr695536 4646 3773 2124 2043 1779 1208 1170 1022 35120 1318 277 15268 --
NM_012290chr211177 11239 ----
NM_012294chr743288 3018 542 408 33103 3039 2617 32560 1023 476 --
NM_012297chr432481 873 208 ------
NM_012300chr52117 35 --22213 555 --
NM_012301chr731935 504 293 ------
NM_012302chr131025 271 121 1949 ----
NM_012304chr531710 1600 655 12565 ----
NM_012307chr181926 ------
NM_012309chr11104947 4053 3983 3883 3841 3326 3106 1365 1180 1053 21630 1190 1370 24640 1641
NM_012316chr1135616 4422 4204 4185 4026 3748 3588 1764 1623 1332 1004 730 65 --25244 174 11364
NM_012328chr721330 935 --11095 --
NM_012329chr1721567 487 21434 160 11295 --
NM_012330chr1021832 407 --11818 --
NM_012333chr121482 624 ------
NM_012334chr544705 1573 1024 51 2932 117 11491 --
NM_012382chr564461 4304 3863 1582 1487 923 --33997 2915 78 --
NM_012428chr15122 ------
NM_012430chr31731 ----1557
NM_012433chr2--1265 ----
NM_012443chr102354 94 --1121 --
NM_012461chr142646 608 1227 --1495
NM_012463chr1251665 1519 1402 1356 1302 ------
NM_012464chr452610 859 689 642 626 22681 2448 ----
NM_012465chr1063243 2815 2730 2175 1147 364 12720 --12340
NM_012471chrX41654 1527 1396 1320 2792 27 11426 --
NM_012473chr222559 246 ------
NM_012479chr732696 2042 233 12055 ----
NM_012486chr12351 74 ----1434
NM_013227chr151250 ------
NM_013229chr1232039 1782 1079 ------
NM_013231chr1453271 3118 1587 1037 967 2868 855 --13660
NM_013233chr231363 522 211 2902 473 ----
NM_013249chr11------1169
NM_013253chr112125 69 11332 ----
NM_013255chr7128677 8039 7985 7124 6330 5660 2997 2887 2502 1894 1544 1489 15775 25894 2545 28540 530
NM_013257chr812277 --22173 2007 --
NM_013261chr413191 33118 2947 1260 13388 --
NM_013269chr1243036 2965 1336 1304 1929 1451 133
NM_013277chr123952 351 229 1363 ----
NM_013281chr2031522 1192 1056 --1605 --
NM_013286chr373078 1525 1322 985 826 472 225 --11066 --
NM_013300chr121216 ------
NM_013309chr1532528 2275 1873 1434 11004 --
NM_013313chr2263522 2735 1095 890 437 241 23035 1164 1861 --
NM_013330chr1141 ------
NM_013341chr222904 2713 ------
NM_013348chr1971001 940 478 410 353 285 254 21253 870 --11263
NM_013354chr82964 66 --1435 --
NM_013374chr323043 86 1703 ----
NM_013388chr21144 --148 --
NM_013390chr931689 1395 177 --1357 --
NM_013396chr2131460 330 150 11522 ----
NM_013400chr74856 439 345 302 11094 --11032
NM_013410chr14514 427 355 114 11261 ----
NM_013423chrX11091 1479 ----
NM_013427chrX11091 1479 ----
NM_013943chr122615 686 22920 2195 1272 22830 735
NM_013951chr272458 2362 1921 1801 1782 537 412 ------
NM_013952chr272535 2439 1998 1878 1859 614 489 ------
NM_013953chr272535 2439 1998 1878 1859 614 489 ------
NM_013986chr221129 ------
NM_013989chr1474252 3823 3684 3525 3279 659 539 14115 ----
NM_013992chr272535 2439 1998 1878 1859 614 489 ------
NM_013995chrX4999 875 655 294 21622 323 22584 777 1109
NM_014011chr222227 287 1488 --12642
NM_014021chr142901 2302 2233 901 --1701 11070
NM_014023chr103765 608 224 1557 ----
NM_014043chr31568 1154 ----
NM_014048chr1663992 3733 973 879 364 71 13254 1289 --
NM_014055chr121213 ----1370
NM_014106chr1562467 1147 635 356 195 33 1175 ----
NM_014112chr854703 4062 3951 1491 726 34486 961 347 1687 --
NM_014117chr1662662 2541 2166 1841 902 152 32158 1849 1088 ----
NM_014141chr785079 1618 999 951 587 443 307 249 12065 11094 --
NM_014154chr32563 238 21501 119 ----
NM_014155chr1155535 4885 2091 2001 1613 46370 6296 5764 1379 57513 5789 4871 2798 1835 --
NM_014181chr232484 2295 85 22691 62 12507 --
NM_014211chr521387 457 ------
NM_014213chr21140 ------
NM_014214chr18------1346
NM_014217chr11507 21835 1817 ----
NM_014223chr11772 ------
NM_014241chr10--1322 ----
NM_014243chr441958 563 555 154 1332 ----
NM_014250chr2232070 753 90 21804 1319 ----
NM_014253chrX42408 2373 951 79 ------
NM_014267chr11--1702 ----
NM_014271chrX--1321 1715 1114
NM_014278chr41447 ------
NM_014283chr121332 328 11352 ----
NM_014289chrX2261 228 --11155 191
NM_014294chr811345 ------
NM_014309chr22105306 4034 4006 3600 3470 2143 1968 1507 806 472 --1755 --
NM_014317chr101213 ------
NM_014323chr222833 395 ----1176
NM_014326chr1511442 ----11247
NM_014331chr4117767 7540 7252 5701 4980 2049 1423 1201 612 520 82 37091 6786 1179 14850 --
NM_014332chrX2160 119 ------
NM_014333chr1162666 2637 2544 968 454 46 12171 ----
NM_014361chr112367 35 ------
NM_014372chr121897 244 1169 ----
NM_014374chr74856 439 345 302 11094 --11032
NM_014382chr3--2444 58 ----
NM_014392chr441358 1229 623 394 --192 --
NM_014398chr331810 227 37 ----21381 239
NM_014410chr181349 ------
NM_014415chr311222 --1521 --
NM_014423chr575471 4599 3469 2230 2172 1903 1554 22007 784 34224 4216 3693 14694
NM_014445chr34843 538 346 176 11486 ----
NM_014447chr421650 596 ------
NM_014454chr62199 129 31035 393 31 ----
NM_014458chr121399 386 ------
NM_014469chr111532 ------
NM_014497chr2--1214 ----
NM_014504chr74758 591 541 280 21456 79 ----
NM_014552chr241329 302 292 48 11213 ----
NM_014569chr751448 233 205 143 125 1472 ----
NM_014574chr1431354 1278 583 ------
NM_014575chr31498 ------
NM_014608chr151160 ------
NM_014616chr323325 2322 33351 1401 1085 ----
NM_014629chr821277 906 ------
NM_014636chr921370 263 33887 1419 744 --33500 3286 1615
NM_014637chr8199 ------
NM_014660chr7--11062 1767 --
NM_014661chr1063888 3642 3479 2622 2476 57 ------
NM_014665chr831164 353 46 --23209 2948 --
NM_014666chr521165 954 ------
NM_014671chr72245 186 ------
NM_014674chr373812 3608 3495 3304 3010 2811 1433 12840 11106 13445
NM_014676chr1183 ------
NM_014683chr1731711 1669 1608 ------
NM_014690chr742311 2012 731 452 ----1183
NM_014701chr1511154 11105 12270 11217
NM_014702chr653184 2933 2445 350 37 22526 1275 13206 --
NM_014705chr7--1429 ----
NM_014709chr22477 247 ------
NM_014711chr1632101 827 112 --11872 --
NM_014713chr21497 ------
NM_014715chr113910 771 289 ----1213
NM_014720chr1021535 115 11457 1269 1699
NM_014721chr657460 6361 6140 4563 1871 24769 2333 --15543
NM_014729chr822221 279 12040 --1154
NM_014730chr1274200 3766 3438 1153 598 571 436 21642 560 13683 24138 3360
NM_014730chr1274200 3766 3438 1153 598 571 436 21642 560 13683 24138 3360
NM_014740chr172269 67 ------
NM_014743chr422513 157 ------
NM_014746chr274366 3098 1755 1051 1003 915 347 31661 608 488 --14285
NM_014747chr1135613 5549 5510 5096 4961 4784 4620 3796 3786 3759 2034 551 92 --22187 1477 --
NM_014751chr832060 829 513 2570 358 2782 145 --
NM_014754chr8------1910
NM_014755chr253115 2753 1704 479 412 1527 13371 --
NM_014756chr11135 ------
NM_014757chr512333 --1414 --
NM_014764chr122101 73 --1278 --
NM_014774chr132713 1079 87 122 --1990
NM_014776chr1221127 33 12052 ----
NM_014781chr81819 --11082 1247
NM_014783chr1521429 674 21241 718 11349 11195
NM_014787chr162399 2044 1117 512 409 220 --1951 1745
NM_014793chr152615 70 ------
NM_014802chr122348 189 1360 ----
NM_014810chr163441 3396 2786 505 310 100 32690 2384 1431 ----
NM_014819chr552356 2071 1783 1753 221 1128 ----
NM_014822chr4170 1141 ----
NM_014824chr1111746 1659 ----
NM_014826chr164178 3793 3701 2891 2739 769 ------
NM_014827chr121098 95 1102 ----
NM_014830chr1253469 3409 1557 1383 315 13924 ----
NM_014832chr132829 285 21923 1686 11513 --
NM_014836chr1031562 1483 271 ------
NM_014838chr2222001 954 31146 887 542 ----
NM_014839chr132016 1740 832 11682 ----
NM_014840chr1242522 2243 1193 353 ------
NM_014873chr174822 4384 3963 3651 3395 3304 1219 21556 1542 14157 2547 405
NM_014877chr1756588 6312 5310 1922 573 15698 27585 5490 --
NM_014883chr421828 521 --22447 125 175
NM_014887chr133868 815 747 ------
NM_014888chr721250 244 ------
NM_014893chrY12342 31926 1759 936 1116 11905
NM_014897chr1742810 2804 2280 577 23063 1181 ----
NM_014899chr573147 2667 932 564 429 282 271 22273 2152 --1220
NM_014900chr211023 ----1228
NM_014903chr1222397 193 ------
NM_014904chr1022514 731 43840 1137 553 544 ----
NM_014906chr1732944 1611 974 --23888 1420 1145
NM_014912chr101554 23172 89 13051 --
NM_014914chr211086 ------
NM_014921chr1962206 2148 1148 810 360 64 --12806 11952
NM_014923chr13--31748 745 302 ----
NM_014924chr1492510 2252 1141 900 699 651 396 312 62 199 ----
NM_014934chr1341387 1071 288 82 13011 --22964 2910
NM_014935chr1103845 3758 3470 3126 3098 3058 2897 2837 2790 2711 --1447 12518
NM_014945chr51362 21723 660 --11902
NM_014946chr272603 2293 1118 1112 1076 658 110 ------
NM_014951chr1012621 2205 81 ----
NM_014953chr1333994 2769 1287 1399 ----
NM_014962chr202729 237 42339 716 681 481 ----
NM_014974chr1031404 1161 32 ------
NM_014982chr1444085 4055 1325 1014 25161 4413 --15216
NM_014991chr432758 2378 704 22909 378 32778 2506 2098 --
NM_014997chr762765 2739 2433 2175 1061 970 2362 120 22023 1860 --
NM_014999chr1211391 ----11202
NM_015000chr1221989 438 22190 983 --12325
NM_015008chr382856 2221 1251 1052 524 287 176 35 1129 ----
NM_015012chr11165 --1351 --
NM_015013chr1166 ------
NM_015020chr1622825 288 --1486 11419
NM_015023chr181860 1780 1570 1469 631 365 289 182 --1663 --
NM_015025chr232162 450 339 ------
NM_015026chr1233229 2937 909 11166 24331 4258 14004
NM_015032chr131171 1872 ----
NM_015035chr20126340 6146 5011 4977 4759 4293 2511 1278 1095 863 725 449 1525 35024 4719 2562 --
NM_015039chr1153552 3499 3346 3222 3123 1645 1381 1300 425 411 386 347 333 308 199 12771 33407 373 295 --
NM_015040chr253336 2811 764 685 137 ------
NM_015042chr1533904 2783 83 --23862 1516 14077
NM_015045chr101441 --1863 --
NM_015051chr953031 2798 2219 1125 438 --22186 965 --
NM_015057chr131592 ------
NM_015068chr743677 3388 2424 1480 23539 3164 21320 157 --
NM_015069chr163441 263 237 ------
NM_015071chr575594 4890 4684 4658 4236 1152 150 25386 1593 25515 1509 12188
NM_015076chr624159 3502 1384 ----
NM_015077chr1784535 3485 3379 3174 3066 3028 287 182 --14507 13602
NM_015090chr165583 1647 1137 924 716 552 1661 --1777
NM_015091chr14--1617 ----
NM_015092chr1643566 3211 1876 1851 24261 4202 ----
NM_015097chr321940 1491 --11704 --
NM_015101chr192890 2676 2643 2359 2318 2309 1838 1030 44 12391 12625 --
NM_015107chrX42436 1542 410 166 22299 2137 ----
NM_015113chr174967 913 713 51 ------
NM_015115chr452547 919 806 516 357 1490 12635 --
NM_015116chr1311323 ------
NM_015120chr2--2285 119 1300 --
NM_015130chr41488 ------
NM_015138chr15----1259 --
NM_015144chr1633190 3060 479 23981 3547 --11167
NM_015149chr131984 1628 1481 --1731 --
NM_015151chr212983 337 1151 ----
NM_015156chr1423706 271 22693 448 1100 11626
NM_015161chr1691468 1193 1176 1102 356 334 313 276 73 ------
NM_015163chr1451915 1716 1686 1346 807 ------
NM_015172chr131462 1051 299 21548 1175 ----
NM_015173chr41199 --1250 --
NM_015187chr43769 322 275 1680 ----
NM_015191chr1112005 ------
NM_015199chr3--32002 538 188 --12866
NM_015200chr442097 1892 419 316 ----11796
NM_015206chr1553804 2811 2386 607 164 1222 --22447 387
NM_015208chr1832827 884 846 13231 ----
NM_015209chr1--12042 11749 --
NM_015213chr111163 ------
NM_015216chr531210 467 389 21230 152 ----
NM_015225chr932999 2588 1003 ------
NM_015231chr111256 1785 ----
NM_015233chr1331972 1883 364 ------
NM_015236chr421259 413 31533 1137 567 ----
NM_015239chr91354 1427 ----
NM_015245chr652044 1975 1963 1957 723 --2351 331 --
NM_015247chr16145351 4997 4537 4222 4085 3639 3580 3510 2084 1932 1608 1529 1094 914 35076 4104 929 14312 1202
NM_015251chr161589 12002 150 1846
NM_015252chr22887 37 --1741 --
NM_015260chr1911498 11228 ----
NM_015266chr2073659 2810 2740 2590 1436 828 637 14281 4742 709 684 176 --
NM_015267chr1241995 1369 531 333 21845 301 ----
NM_015269chr11167 ------
NM_015271chr444235 4018 3063 188 13785 1577 --
NM_015272chr1631801 1695 84 ----21686 1491
NM_015275chr1221808 1781 ----1110
NM_015277chr181382 ------
NM_015278chr652584 2410 1141 690 575 12869 3542 85 26 --
NM_015285chr1821724 1617 ------
NM_015286chr1551658 790 538 453 269 12437 ----
NM_015291chr172739 2502 1114 983 481 216 107 2495 121 ----
NM_015293chr62583 121 1453 --1546
NM_015299chr1463829 3732 2836 2461 1395 1179 11198 32723 1558 390 --
NM_015310chr8127585 7470 7232 6469 5086 2852 2465 2320 2230 1535 844 414 37999 7983 3328 26073 1766 18413
NM_015313chr112438 425 43864 3714 3062 1863 11783 11375
NM_015315chr573430 3419 2773 2713 491 479 323 11304 21038 1000 --
NM_015326chr152307 2280 525 518 24 12627 ----
NM_015330chr22102591 2387 2269 2183 2136 964 796 762 615 106 --1769 --
NM_015332chr752493 2255 1205 628 494 12681 --12604
NM_015335chr1242666 970 581 25 ------
NM_015336chr1221918 621 --12158 --
NM_015339chr203921 846 688 ------
NM_015347chr1212183 12979 1820 1407
NM_015349chr642516 2424 1097 207 12593 ----
NM_015355chr1711548 2413 297 11572 --
NM_015365chrX72822 1470 1229 644 638 456 209 33396 3083 928 11091 --
NM_015367chr2261559 1351 1226 438 102 83 --1387 --
NM_015375chr184935 4152 1625 1494 1083 398 223 30 ------
NM_015378chr13427 274 198 21960 637 ----
NM_015382chr141508 ------
NM_015385chr1022672 962 2888 796 22215 751 --
NM_015387chr23746 408 66 11349 11748 --
NM_015396chr3--21163 1007 ----
NM_015409chr1222325 2180 41931 1814 1021 320 --11090
NM_015429chr311004 ------
NM_015435chr82978 370 ------
NM_015436chr452980 2240 817 347 236 --22388 477 1455
NM_015447chr91156 ------
NM_015455chr533160 2548 1461 23780 2717 ----
NM_015460chr331991 1971 798 ------
NM_015463chr2153 ------
NM_015465chr5189 --1187 1634
NM_015475chr21383 ------
NM_015488chr281690 1400 1390 1377 1312 1129 713 500 ------
NM_015496chr83240 98 81 1231 ----
NM_015497chr1521026 992 ------
NM_015520chr322458 1842 --21800 433 --
NM_015525chr621027 905 21036 355 ----
NM_015534chr1----2426 171 --
NM_015535chr21159 13088 2576 342 --
NM_015541chr31272 11247 ----
NM_015542chr1031112 505 109 ------
NM_015553chr655118 4822 4051 1273 461 11441 1276 --
NM_015554chr1522504 2294 51947 1798 793 204 185 ----
NM_015560chr352698 2590 2562 2353 724 1845 ----
NM_015564chr51778 33002 868 337 --12959
NM_015565chr2121430 546 1379 2741 176 1124
NM_015569chr154093 4018 1007 316 206 --13586 1756
NM_015570chr721765 1451 ------
NM_015571chr632272 1890 337 12262 ----
NM_015578chr1931597 1546 37 ------
NM_015601chr10----1828 --
NM_015626chr171252 1939 ----
NM_015635chr931901 710 316 ------
NM_015640chr165210 5057 4988 4392 4257 1831 54977 1440 1352 384 211 ----
NM_015676chr14------1258
NM_015695chr61743 22036 1921 ----
NM_015697chr41116 ----1287
NM_015711chr19--1822 ----
NM_015713chr843071 2624 934 525 32748 803 541 1859 21319 794
NM_015723chr72229 114 143 ----
NM_015726chr121321 1213 --1116 11832
NM_015833chr2132188 1955 1799 22182 298 --1733
NM_015872chr11342 ------
NM_015874chr41405 ------
NM_015878chr81194 1452 123 --
NM_015879chr18137729 7493 7441 7169 6508 2779 2518 2430 1776 1634 1560 371 203 36692 6360 1011 25589 2096 25692 5267
NM_015881chr112125 69 11332 ----
NM_015886chr875572 4950 4872 4345 4049 1792 1010 22049 563 ----
NM_015888chr143030 2993 2370 686 12891 ----
NM_015891chr641990 1863 1656 327 11649 ----
NM_015904chr21524 ------
NM_015905chr7134 ----1422
NM_015906chr131401 713 464 14170 --14766
NM_015955chr21142 ------
NM_015975chrX51645 552 476 151 77 ------
NM_015995chr1585045 4971 4768 4392 2070 2045 1961 521 --24914 328 15246
NM_015999chr11476 1101 ----
NM_016018chr842348 2050 1871 430 ------
NM_016025chr16--1441 ----
NM_016057chr123809 259 224 --21005 875 --
NM_016076chr172982 2921 2173 2111 475 233 36 --183 12234
NM_016083chr683971 3593 3050 1316 1047 868 861 775 161 --1592
NM_016089chr361714 1364 854 770 392 350 12130 11398 --
NM_016103chr52389 119 1370 ----
NM_016107chr541254 1203 1016 388 ------
NM_016120chrX1388 ------
NM_016125chr17--1118 ----
NM_016127chr8--1597 --166
NM_016131chr242328 1629 1517 1476 11986 ----
NM_016132chr1542734 2254 452 299 --11254 --
NM_016133chr221269 465 21593 1570 ----
NM_016141chr31271 2597 163 ----
NM_016200chr71283 1257 ----
NM_016206chr3138764 8074 8016 7188 6543 5949 5584 2974 2336 2063 1686 879 581 57009 6982 5533 2880 1258 23086 2657 18347
NM_016217chr683643 3284 3064 3025 2869 2517 2331 386 12285 ----
NM_016221chr51565 2958 924 ----
NM_016227chr121332 328 11352 ----
NM_016255chr652949 2878 1147 454 212 22526 92 12646 --
NM_016257chr173164 2650 2503 1166 215 111 69 --33468 3278 2209 1579
NM_016260chr266975 6907 6313 6164 5712 4978 46994 6599 6024 1383 12683 --
NM_016271chr181497 2866 828 ----
NM_016272chr2272717 2639 2555 2132 1946 1912 890 1125 1719 --
NM_016275chr332654 1847 894 22475 2206 1862 --
NM_016277chr631649 667 175 ------
NM_016287chr12631 167 ------
NM_016303chrX1118 ------
NM_016308chr131615 665 328 ------
NM_016315chr22600 548 11580 ----
NM_016322chr932975 2095 230 13140 ----
NM_016337chr141189 ------
NM_016359chr153680 268 88 ------
NM_016376chr1784139 3394 3139 3124 2898 1530 1195 951 13956 1444 --
NM_016396chr1521936 556 1680 12727 1221
NM_016413chr13------1448
NM_016418chr2252518 701 648 271 60 ------
NM_016422chr1152907 2610 2297 576 206 32777 720 344 ----
NM_016424chr171512 11948 ----
NM_016426chr225856 760 638 520 70 ------
NM_016436chr201460 32129 735 702 --12488
NM_016441chr221942 912 ------
NM_016448chr141475 250 134 103 ------
NM_016467chr21913 11342 ----
NM_016470chr201522 ------
NM_016506chr111167 ----1507
NM_016507chr17--12091 ----
NM_016522chr1131402 1063 369 ------
NM_016525chr93860 814 667 ----1682
NM_016530chr15103915 3666 3575 3552 3540 3157 2990 1429 1000 370 11130 --11164
NM_016542chrX41726 1563 315 231 ------
NM_016571chr6----127 --
NM_016578chr11--1117 ----
NM_016603chr531527 789 230 11980 ----
NM_016605chr522357 1728 12137 21809 1787 1603
NM_016613chr432643 1808 287 22053 641 ----
NM_016620chr11535 21054 946 ----
NM_016654chr1511335 1511 11287 1174
NM_016818chr212615 200 159 ----
NM_016824chr1021562 711 1646 11214 --
NM_016836chr2187 ------
NM_016839chr2187 ------
NM_017412chr821065 229 1294 ----
NM_017420chr1443569 3284 1515 100 --1133 --
NM_017437chr14--3742 408 385 1567 1279
NM_017443chr91495 ------
NM_017447chr2144216 3121 177 169 34093 4052 1305 11066 --
NM_017452chr201505 ------
NM_017453chr201505 ------
NM_017454chr201505 ------
NM_017455chr15122 ------
NM_017456chr1731864 1614 1492 ----11513
NM_017488chr211228 --122 --
NM_017491chr4--1703 2185 23 --
NM_017520chr13179 ------
NM_017528chr7--177 ----
NM_017545chr201536 1198 ----
NM_017551chr1032635 2165 1786 22488 867 --12543
NM_017553chr1511194 --1306 --
NM_017563chr376073 5941 5189 4506 2339 1531 33 31647 820 461 --12441
NM_017580chr1062317 1795 1487 703 603 194 1477 12270 --
NM_017590chr2242387 1826 1016 525 12698 ----
NM_017594chr933333 2742 872 33353 2047 782 1183 23105 1179
NM_017610chr1552049 692 428 321 204 1736 --1453
NM_017612chr121232 ------
NM_017623chr251048 1010 273 199 115 ----1961
NM_017628chr474639 4312 4120 3801 3374 760 194 35076 4912 3945 ----
NM_017632chr42362 133 ------
NM_017634chr851787 1423 770 488 126 185 1705 --
NM_017635chr111417 11106 11367 --
NM_017637chr978441 8401 7828 7226 3612 3335 2701 38853 3004 2249 --16893
NM_017643chr171951 22210 434 1643 --
NM_017644chr384967 4497 3518 3279 1912 1501 1344 1121 21680 446 14310 --
NM_017645chr932937 2415 747 --23073 2168 --
NM_017650chr752302 1541 1200 1099 522 1467 35901 732 117 --
NM_017654chr731435 366 105 21645 1478 11295 --
NM_017658chr1443709 3653 1644 398 1383 ----
NM_017660chr1953421 2474 2358 738 269 21095 61 11168 --
NM_017667chr71577 ------
NM_017672chr151534 ------
NM_017686chr14794 284 243 123 11057 ----
NM_017694chr21598 ------
NM_017699chr3--11484 --1487
NM_017709chr162926 1443 1413 1036 1027 75 11727 --21357 1167
NM_017712chr1965249 5133 4943 2165 1754 66 56124 5559 4924 1658 116 12232 16317
NM_017719chr341972 1633 1600 417 1273 ----
NM_017730chr33709 551 215 ------
NM_017737chr121709 376 11533 1496 --
NM_017738chr921053 269 1876 ----
NM_017747chr53436 106 23 ------
NM_017752chrX21892 566 ----11735
NM_017754chr664350 3646 3513 3167 1649 1375 11786 ----
NM_017761chr12344 231 ------
NM_017762chr1542194 817 661 515 ------
NM_017769chr1452846 2195 2162 935 544 2756 510 1378 --
NM_017778chr81458 ------
NM_017780chr81766 ------
NM_017798chr2021173 401 1939 --11243
NM_017811chr943085 2599 2407 336 ------
NM_017813chr874570 3770 3705 2246 1495 1471 1176 11290 --15395
NM_017824chr1021984 774 32490 2259 801 --12361
NM_017831chr1833697 3493 3409 21392 974 ----
NM_017842chr121699 ------
NM_017847chr141737 753 517 226 ----1773
NM_017848chrX73222 3017 1683 543 351 283 194 24273 1482 11674 --
NM_017849chr272804 2768 2681 1276 827 443 149 32693 2495 2109 ----
NM_017856chrX21836 396 ------
NM_017869chr161593 ------
NM_017880chr21294 ------
NM_017890chr811380 21625 736 ----
NM_017902chr10115733 5575 4608 4593 4200 3793 2189 1664 1606 906 833 15521 2827 554 11580
NM_017913chr91437 ------
NM_017919chr964312 2302 1833 1825 1182 1047 14639 24591 866 --
NM_017921chr1741749 1639 737 491 ------
NM_017925chr931738 1336 316 157 ----
NM_017933chr251597 1409 1071 407 245 ------
NM_017944chr1122833 1038 32931 1009 611 23027 2067 --
NM_017988chr12--1718 ----
NM_017993chr131129 ----126
NM_018010chr341442 1164 1147 1084 1590 ----
NM_018014chr231006 972 418 ------
NM_018017chr1082743 2533 2467 2337 2174 2036 1975 804 52516 2307 2247 1857 715 ----
NM_018027chr1063086 2441 2419 2165 962 841 1280 12023 --
NM_018028chr1911291 ------
NM_018030chr182400 324 1423 --11122
NM_018046chr53755 653 28 11921 --1439
NM_018061chr1--21754 1523 1585 --
NM_018063chr103428 345 323 ------
NM_018085chr1117930 7627 7252 7232 6812 6016 5973 5169 3261 1020 484 2883 702 35588 2788 1555 2965 236
NM_018086chr221834 574 --1141 --
NM_018092chr1621152 1043 ------
NM_018095chr111167 ----1507
NM_018100chr6103268 3223 2489 2371 2113 2097 1349 917 833 293 --12892 --
NM_018105chr821176 55 11183 ----
NM_018110chr1641108 997 896 533 ------
NM_018112chr94988 965 384 165 ------
NM_018121chr1052083 1233 850 727 334 ----12011
NM_018124chr1632301 780 310 41625 340 143 101 ----
NM_018126chr411580 11566 ----
NM_018133chr32750 656 ------
NM_018155chr343000 2698 2186 1043 ----1228
NM_018156chr13427 274 198 21960 637 ----
NM_018157chr1222468 1994 22013 1060 ----
NM_018159chrX41522 633 446 176 21213 1092 ----
NM_018167chr14--3830 283 219 --1373
NM_018179chr121238 ------
NM_018184chr33827 470 440 1461 ----
NM_018191chr1332110 636 36 22141 689 ----
NM_018195chr1132037 684 462 --1808 --
NM_018200chr1552204 1894 956 933 436 22492 1718 22057 498 --
NM_018222chr1161823 1673 1647 1361 1265 1194 ------
NM_018227chr432587 2476 1236 --1286 1858
NM_018234chr222157 1947 --122 22189 906
NM_018243chr423652 78 23596 1176 13186 --
NM_018247chr611060 13081 ----
NM_018254chr142081 1608 219 96 ------
NM_018287chr1031350 1302 959 ------
NM_018290chr411285 ------
NM_018293chr342567 1099 776 105 2526 151 1937 --
NM_018299chr812870 ------
NM_018307chr172357 310 1297 ----
NM_018312chr1142214 1970 1773 141 11412 161 11673
NM_018313chr351899 1805 1623 815 594 12122 ----
NM_018318chr12--1149 --1732
NM_018323chr411231 2490 35 11510 1298
NM_018325chr911426 11259 --1508
NM_018326chr74754 320 87 41 1580 ----
NM_018327chr2011243 ------
NM_018330chr102308 63 1481 ----
NM_018339chr921663 38 11535 1734 --
NM_018340chr1674536 4433 3775 3450 3207 3191 734 24446 3123 --14683
NM_018354chr20130 ------
NM_018362chr1123716 3127 1341 ----
NM_018364chr143577 3401 3161 552 33265 1166 711 --1294
NM_018374chr784994 3652 3201 1697 1299 1150 1017 764 34685 3926 1108 --14886
NM_018375chr1461181 622 527 459 396 173 ----11922
NM_018383chr241917 1779 1690 698 --2823 34 11955
NM_018388chrX11401 --11169 --
NM_018403chr342997 1448 681 484 23544 1462 --13953
NM_018429chr571973 1966 875 615 605 109 79 141 ----
NM_018433chr22519 147 ------
NM_018440chr8147761 7584 7508 7103 6816 6677 2221 2134 831 751 730 612 104 44 27953 3081 11638 17159
NM_018442chr1181 ------
NM_018444chr851783 1519 748 441 126 22106 1956 ----
NM_018451chr131796 1238 ----
NM_018454chr153680 268 88 ------
NM_018465chr91200 ------
NM_018482chr842488 2111 1816 631 1808 ----
NM_018490chr11--21901 1423 11226 --
NM_018509chr1761509 1072 657 535 490 288 11058 ----
NM_018555chr19--21716 1694 32096 769 611 --
NM_018566chr153282 1920 1751 742 55 --13545 14882
NM_018590chr1041381 1110 326 133 ------
NM_018602chr1551550 1190 493 301 218 --1408 --
NM_018638chr12104472 4221 3848 3837 2160 2154 1619 1044 837 422 ------
NM_018640chr1232396 1788 463 21133 729 ----
NM_018649chr10--1236 ----
NM_018650chr122159 306 --12108 --
NM_018652chr154948 823 728 281 ------
NM_018698chrX3388 348 142 ------
NM_018717chr452891 2428 2396 982 512 ------
NM_018719chr71910 11081 ----
NM_018845chr11205 ------
NM_018846chr72806 728 --1343 --
NM_018847chr931620 780 227 --1549 11278
NM_018890chr721168 1113 ------
NM_018898chr531745 634 217 21940 150 --1603
NM_018899chr531745 634 217 21940 150 --1603
NM_018900chr531745 634 217 21940 150 --1603
NM_018901chr531745 634 217 21940 150 --1603
NM_018902chr531745 634 217 21940 150 --1603
NM_018903chr531745 634 217 21940 150 --1603
NM_018904chr531745 634 217 21940 150 --1603
NM_018905chr531745 634 217 21940 150 --1603
NM_018906chr531745 634 217 21940 150 --1603
NM_018907chr531745 634 217 21940 150 --1603
NM_018908chr531745 634 217 21940 150 --1603
NM_018909chr531745 634 217 21940 150 --1603
NM_018910chr531745 634 217 21940 150 --1603
NM_018911chr531745 634 217 21940 150 --1603
NM_018945chr623695 1447 ------
NM_018947chr754604 3726 1626 1207 331 64994 3617 3313 3257 3065 1025 ----
NM_018948chr13951 442 140 ------
NM_018970chr7122 21248 409 ----
NM_018976chr1262831 2117 1905 1872 961 642 11813 ----
NM_018979chr1212559 11616 --1508
NM_018994chr11449 ------
NM_018999chr1054862 4584 3814 3575 3017 33343 3286 3006 14336 --
NM_019000chr531655 1411 667 --2580 116 --
NM_019001chr384777 3662 3475 3298 3162 1840 1191 740 11132 1555 1635
NM_019004chr721962 522 1417 ----
NM_019005chr7145 2305 249 --1290
NM_019022chr1832522 774 67 22760 1262 --1925
NM_019026chr13523 111 36 ------
NM_019027chr442561 2530 2489 2068 ------
NM_019030chr51172 ------
NM_019036chr621151 1143 21243 966 1439 --
NM_019050chr432130 836 799 1284 ----
NM_019053chr102701 337 --11092 1901
NM_019063chr2--12208 11639 --
NM_019071chr71315 --1580 --
NM_019072chr594042 3510 2940 2920 2884 490 362 334 170 1775 ----
NM_019083chr121150 1052 1466 --1204
NM_019084chr1021696 555 1698 ----
NM_019094chr1221023 219 ----13385
NM_019095chr20--1228 ----
NM_019117chrX63061 2968 2852 2554 1284 254 1413 13010 11222
NM_019590chr1021298 571 ------
NM_019593chr2053162 2616 2282 761 369 11064 --12635
NM_019594chr931481 1035 338 --11410 --
NM_019597chrX2738 566 1303 --1663
NM_019842chr6137 1300 ----
NM_019891chr121319 1298 5984 835 524 517 277 11206 --
NM_019903chr1021562 711 1646 11214 --
NM_020066chr12404 136 1978 ----
NM_020122chr254552 2316 2102 1641 187 ----15933
NM_020123chr1021434 1186 ----11252
NM_020134chr22397 352 ------
NM_020140chr12176 ------
NM_020150chr1021587 455 --140 --
NM_020152chr212840 156 ------
NM_020156chr7--1402 ----
NM_020159chr411403 11112 11364 1305
NM_020177chr543158 2720 1084 671 11093 ----
NM_020180chr1831360 1165 499 ------
NM_020182chr2052961 2522 2399 587 291 13304 12785 12730
NM_020199chr53497 256 179 21105 277 ----
NM_020205chr162804 2777 2632 1344 609 410 1538 11381 --
NM_020207chr92245 125 2859 535 11262 --
NM_020211chr151166 ------
NM_020239chr142232 2156 596 176 1876 21449 534 1297
NM_020248chr141854 718 360 352 1379 ----
NM_020341chr2061516 1260 821 635 592 100 ----11375
NM_020342chr231855 1839 581 11949 --1843
NM_020347chr351968 1517 736 277 117 2726 133 ----
NM_020357chr331076 478 295 11422 ----
NM_020381chr631425 1371 547 --21753 525 --
NM_020382chr122311 229 ------
NM_020383chr10----2119 40 --
NM_020390chr333249 1572 1127 13494 14413 --
NM_020403chr132180 103 ------
NM_020420chrY1227 3710 542 274 --21520 60
NM_020423chr1124 ------
NM_020432chr721986 900 ------
NM_020436chr20------150
NM_020443chr176332 5089 2673 2618 2399 1896 1695 26787 6129 26434 670 --
NM_020455chr642808 1051 890 511 12509 --12227
NM_020463chr211108 2930 356 11254 --
NM_020474chr1831682 317 153 11983 ----
NM_020475chr821884 77 12332 11857 --
NM_020476chr821884 77 12332 11857 --
NM_020477chr821884 77 12332 11857 --
NM_020478chr821947 140 12395 11920 --
NM_020480chr821884 77 12332 11857 --
NM_020640chr331499 655 199 2746 500 ----
NM_020644chr111753 ------
NM_020651chr251758 1699 1384 1340 95 ------
NM_020653chr171158 ------
NM_020676chr32962 748 ------
NM_020679chr171125 ----1413
NM_020697chr84887 319 171 57 21148 160 ----
NM_020699chr165018 4811 4711 4371 1811 1566 11972 --1749
NM_020708chr2032499 2229 690 ------
NM_020711chr252396 1733 1691 825 467 ------
NM_020717chrX93968 3920 3885 3770 3743 3611 1819 1604 803 23815 1052 ----
NM_020718chr1694781 2566 2488 1790 1765 1730 908 303 280 56427 2393 2307 594 51 --25966 5578
NM_020727chr21113647 3597 3590 1534 1522 1452 1446 476 392 378 207 13205 --1177
NM_020734chr1221342 497 22596 1170 ----
NM_020742chrX12415 21993 1825 --11972
NM_020747chr5--1834 ----
NM_020748chr1721547 537 1148 ----
NM_020752chr1032767 702 670 --11109 --
NM_020754chr32991 479 148 ----
NM_020766chrX64303 4240 3618 3109 3043 1598 --1389 --
NM_020768chr542698 2689 1093 195 12749 ----
NM_020772chr1798186 7602 6212 5539 5435 3063 2292 1708 619 57112 6060 1231 834 705 --12496
NM_020774chr1875347 4925 4817 4245 2486 1524 626 35849 5693 1665 14204 11192
NM_020776chr1822808 940 156 22531 2003 12070
NM_020782chr1231893 1689 1545 24833 780 ----
NM_020791chr1711337 ------
NM_020792chr341893 780 774 487 2545 339 1359 2950 581
NM_020794chr12433 217 ------
NM_020796chr52982 143 11068 --12490
NM_020801chr511786 11652 12345 1159
NM_020803chr431498 768 507 ------
NM_020805chr1821301 660 140 ----
NM_020808chr13394 294 272 ------
NM_020809chr111256 31875 1638 819 ----
NM_020810chr1443360 3302 3082 1425 1408 ----
NM_020819chr641240 1210 872 175 ------
NM_020824chr102490 22 ------
NM_020841chr1233171 843 229 23631 3574 1915 --
NM_020844chr876858 6032 5561 2576 1539 1469 1205 17178 --12648
NM_020854chr1821502 563 ------
NM_020856chr1931347 382 125 ------
NM_020861chr62852 261 1441 ----
NM_020866chr13------1845
NM_020870chr431838 662 198 1790 ----
NM_020871chrX41024 433 391 363 1476 ----
NM_020872chr321699 1435 ------
NM_020873chr31720 1828 1196 --
NM_020899chr1722485 1652 12442 --11870
NM_020901chr11----1374 1282
NM_020917chr1963257 1104 1092 871 599 212 --12721 --
NM_020918chr1053468 3303 2835 957 715 63378 3246 2610 805 605 362 ----
NM_020921chr1453325 2463 2254 1281 351 22727 623 ----
NM_020922chrX21421 429 --1121 11451
NM_020925chr121237 979 156 ----
NM_020927chr1611701 2510 277 12332 --
NM_020948chr143665 1268 267 129 ------
NM_020962chr1532459 2191 664 ------
NM_020975chr101382 ------
NM_020977chr421513 313 ----1644
NM_020987chr1021236 1011 --11070 --
NM_020988chr16--1213 ----
NM_021025chr5------1364
NM_021033chr1312685 ----1676
NM_021061chr853694 3249 1771 1273 953 13643 --33235 3108 2800
NM_021069chr41528 1685 --11514
NM_021090chr2284949 4896 4131 4047 3809 3707 3241 1476 --11020 12009
NM_021096chr2273171 3031 2380 1316 1139 786 381 ----1705
NM_021097chr222168 763 32823 652 235 1770 --
NM_021115chr221119 ------
NM_021116chr778108 7097 3239 1873 702 530 22 29079 3258 --18291
NM_021120chrX32703 147 120 --1358 --
NM_021127chr1821259 309 11018 11361 --
NM_021140chrX1970 ----1993
NM_021141chr21191 1300 --1723
NM_021144chr9--1355 --1466
NM_021155chr1972609 2417 2308 2194 1153 969 67 11899 --22557 101
NM_021159chr421265 578 ------
NM_021183chrX22009 977 ------
NM_021188chr141494 ------
NM_021190chr111056 ----11331
NM_021202chr2082688 2542 2117 1134 1022 692 323 270 12135 ----
NM_021215chr2042295 1788 638 78 22404 331 ----
NM_021224chr91405 ------
NM_021240chr91210 ----1705
NM_021252chr1022061 1747 2379 299 ----
NM_021255chr1453261 3136 2915 2785 1303 23946 440 2640 66 --
NM_021260chr1421264 958 ----11388
NM_021622chr1032018 156 63 ------
NM_021629chr353695 3101 1174 915 39 13770 ----
NM_021631chr8--186 ----
NM_021633chr121129 509 11040 ----
NM_021639chr1--1842 ----
NM_021643chr231864 1527 1345 ------
NM_021645chr1352290 2278 781 749 203 31918 1631 170 ----
NM_021647chr474569 4337 3652 2974 1831 1766 1271 43783 3635 3414 3261 13150 13225
NM_021705chr651456 605 599 425 407 11148 --21515 1090
NM_021728chr1431023 269 226 --1795 --
NM_021809chr2052046 1782 979 847 481 --12006 12250
NM_021815chr242788 1233 1042 59 ------
NM_021825chr11--1146 ----
NM_021905chr64919 136 116 36 ----1230
NM_021911chr555486 5322 1779 660 642 ------
NM_021912chr1554037 3731 1461 877 562 21128 945 ----
NM_021913chr1981816 1577 1513 1434 1271 1249 305 291 --21320 268 21463 1132
NM_021940chr61463 ------
NM_021943chr642111 1836 764 129 --11712 --
NM_021961chr11117284 7198 6500 6346 5902 4992 2910 2903 2803 1356 1151 37461 2972 1940 1500 --
NM_021964chr366203 4303 4191 2383 1097 233 12222 --24451 39
NM_021988chr202426 84 ------
NM_022037chr22641 347 ------
NM_022048chr1555851 5532 4960 4498 1927 15265 ----
NM_022070chr17121 1118 ----
NM_022073chr141500 --21534 1098 1537
NM_022079chr10----1828 --
NM_022114chr113562 14246 ----
NM_022123chr14280 67 1510 ----
NM_022129chr10180 ------
NM_022130chr511352 --11412 --
NM_022133chr841697 1616 565 29 147 --1551
NM_022143chr7--1396 ----
NM_022145chr53504 238 193 ------
NM_022166chr16106207 5784 4887 4746 4348 4340 2353 612 453 406 14445 24123 1578 --
NM_022170chr721136 609 --1381 --
NM_022173chr22641 347 ------
NM_022336chr222189 1637 12312 159 --
NM_022351chr843370 1489 1142 360 22647 2565 13027 --
NM_022373chr71127 ------
NM_022442chr202426 84 ------
NM_022456chr12106688 6040 5672 4820 1972 1799 924 912 302 183 22070 1938 16016 25783 439
NM_022459chr1373888 2455 1427 1267 603 225 27 1351 11259 --
NM_022461chr32195 175 ------
NM_022462chr19223077 3054 2736 2710 2679 2672 2649 2527 2491 2372 1490 1483 1426 1391 1385 1327 1237 791 637 554 215 189 73048 2744 2619 2499 2438 2356 1367 43681 3215 2558 823 --
NM_022465chr124804 579 532 350 12078 12028 22465 755
NM_022474chr1452620 2580 2381 1791 208 ------
NM_022484chr72363 343 ------
NM_022491chr1283405 3008 2950 2387 2364 736 147 37 12916 11064 --
NM_022494chr102392 91 ------
NM_022497chr33932 882 380 --2809 393 1110
NM_022552chr211200 ------
NM_022572chr281690 1400 1390 1377 1312 1129 713 500 ------
NM_022648chr253943 3719 3072 795 616 ------
NM_022650chr51679 ------
NM_022652chr1231129 752 334 1368 ----
NM_022726chr62522 348 ------
NM_022748chr721971 1958 22136 552 12527 --
NM_022753chr162464 2367 2318 1088 837 829 --1939 11761
NM_022763chr333078 2389 975 ----13038
NM_022781chr942876 2422 1001 230 12856 ----
NM_022817chr222074 376 22302 128 1653 --
NM_022818chr1631481 1274 462 128 21232 654 --
NM_022836chr121522 574 11213 ----
NM_022841chr151392 ------
NM_022843chr131976 ------
NM_022845chr163437 408 53 ------
NM_022893chr253044 2839 2789 912 104 12242 ----
NM_022894chr21473 --11425 --
NM_022898chr1434193 3249 837 ----11710
NM_022902chr51278 ------
NM_022912chr272942 2917 2531 2134 1051 850 616 1363 1706 11171
NM_022913chr5------123
NM_022965chr421356 1130 ------
NM_022977chrX32603 223 190 11826 12313 21946 61
NM_023000chr1411084 21110 494 11477 --
NM_023001chr1411084 21110 494 11477 --
NM_023037chr131346 1335 11151 --
NM_023067chr331276 863 108 1887 1121 --
NM_023071chr12162 ------
NM_023076chr1642719 2260 2188 1874 32819 2100 928 ----
NM_023079chr1751226 1192 683 611 575 ------
NM_023923chr153303 2767 453 112 78 23801 665 ----
NM_023929chr852839 2769 2594 1809 570 1773 ----
NM_024007chr532937 2276 1998 1513 1740 --
NM_024017chr1731736 1267 573 1222 1193 --
NM_024057chr12------1115
NM_024061chr7--1250 ----
NM_024089chr13--1182 ----
NM_024090chr421516 1398 1500 --31406 396 266
NM_024094chr82696 631 194 ----
NM_024095chr1241402 1348 277 39 21225 393 --1313
NM_024345chr995950 5854 5198 5126 2210 1931 1321 728 63 75543 4413 4370 2176 1251 669 84 --12353
NM_024411chr2041444 1355 566 173 ------
NM_024511chr453076 2503 837 767 643 1298 ----
NM_024520chr2132 ------
NM_024529chr13817 314 196 126 --2417 279
NM_024539chrX2383 244 21107 435 ----
NM_024546chr132812 112 ------
NM_024551chr1232074 1808 836 11756 --21030 920
NM_024551chr1232074 1808 836 11756 --21030 920
NM_024556chr114454 446 346 29 ------
NM_024561chr1321344 1311 --1292 --
NM_024567chr8138 ------
NM_024574chr41183 ------
NM_024586chr1--1503 ----
NM_024611chr1543507 3192 2813 58 --1668 11524
NM_024612chr1711010 ------
NM_024613chr821255 96 ------
NM_024624chr231179 1116 63 ------
NM_024626chr141638 1388 1361 128 1121 ----
NM_024631chr111531 ------
NM_024639chr652604 2394 2258 1931 893 32330 2280 1140 --11912
NM_024646chr163953 3447 3430 3313 2504 1549 11406 12648 --
NM_024665chr354630 4410 3952 1046 493 34012 3110 254 13176 --
NM_024686chr11392 2487 230 ----
NM_024692chr241769 1300 368 230 ------
NM_024713chr1511351 21177 1030 11517 --
NM_024721chr83890 795 519 22658 625 ----
NM_024740chr1163305 2604 993 743 387 135 13595 ----
NM_024744chr242255 2071 985 33 --11768 --
NM_024749chr132309 2165 1442 --11654 --
NM_024755chr152862 792 --1352 --
NM_024757chr9--1869 ----
NM_024761chr934146 3835 2014 14162 25042 452 --
NM_024770chr295480 5465 4946 4700 4622 2649 1805 1448 1200 12626 15766 --
NM_024780chr162116 85 1382 ----
NM_024798chr1552918 2083 1996 1036 926 32048 1136 959 --12230
NM_024817chr1565933 4500 2153 1805 1732 1608 15156 ----
NM_024825chr191118 --1298 --
NM_024831chr81578 2624 590 1184 --
NM_024841chr116876 532 420 353 282 117 11694 ----
NM_024873chr41780 ------
NM_024896chr931995 765 316 ------
NM_024920chr411285 ------
NM_024927chr171148 ------
NM_024945chr91989 153 ----
NM_024947chr3109533 9346 7859 6568 6402 6011 1013 655 543 506 57773 6283 6220 565 82 11804 --
NM_024953chr1242646 1946 1129 720 ------
NM_024969chr24879 734 372 150 1580 ----
NM_024989chr276918 6306 5446 2651 1643 1455 1283 27048 5620 25544 899 23285 2032
NM_024991chr1022672 962 2888 796 22215 751 --
NM_024993chr211298 ------
NM_024997chr1621036 262 ------
NM_025047chr31188 1160 ----
NM_025054chr843184 1529 982 622 24191 2614 --14006
NM_025126chr122750 558 ------
NM_025133chr221071 912 ----1846
NM_025134chr161488 1126 ----
NM_025135chr181453 ------
NM_025146chr31490 1731 ----
NM_025154chr711038 ------
NM_025160chr121569 526 33919 798 396 ----
NM_025184chrX2841 62 ------
NM_025191chr133185 904 157 22638 2527 1315 --
NM_025205chr42246 235 ------
NM_025208chr11143 ----2678 406
NM_025211chr91236 ------
NM_025222chr311006 22873 2008 ----
NM_025235chr1041622 1423 852 784 21893 469 ----
NM_025246chr31145 ------
NM_030621chr1454211 3900 1306 1250 987 23802 3195 12600 --
NM_030625chr1021995 332 12613 ----
NM_030627chr543049 1387 1124 1017 ------
NM_030637chr141111 1502 ----
NM_030647chr7105776 5729 4777 4293 3976 2185 517 430 409 46 ------
NM_030648chr444445 1869 1372 649 33766 3396 1471 11954 14729
NM_030650chr253225 2844 1031 1007 249 13499 13017 --
NM_030674chr12135270 5168 4840 4668 4514 3943 3664 2276 2226 2037 1088 792 662 32181 1014 416 35663 5646 1810 15036
NM_030755chr1443040 486 350 114 --12097 12746
NM_030758chr22--1378 ----
NM_030759chr101507 ------
NM_030762chr1231974 1711 1239 21665 546 ----
NM_030769chr1181 1411 --2525 188
NM_030786chr121815 171 --11907 --
NM_030789chr201272 ------
NM_030791chr1421250 699 2627 227 ----
NM_030799chr532127 1630 1414 21543 1394 ----
NM_030800chr153626 432 53 ----186
NM_030809chr1252468 2333 2268 971 479 21974 901 ----
NM_030816chr143153 1402 1346 670 23272 2354 ----
NM_030817chr1273293 2933 2689 2670 1074 1034 371 33169 2730 1521 11172 --
NM_030820chr62868 683 ------
NM_030918chr1105389 5090 4975 4576 3457 1673 630 470 268 106 11499 159 1989
NM_030920chr141771 448 428 243 ------
NM_030934chr1--11747 ----
NM_030939chr61389 ------
NM_030953chr521053 190 11393 2649 53 --
NM_030958chr81398 ------
NM_031157chr121133 ------
NM_031216chr1831698 1493 360 --11630 --
NM_031243chr751669 938 719 710 286 ------
NM_031262chr91935 ------
NM_031267chr73454 225 51 139 ----
NM_031268chr1665351 5115 4878 4184 755 603 14372 22122 1265 --
NM_031275chr111140 1391 ----
NM_031291chr41555 ------
NM_031296chr44694 619 606 248 ------
NM_031369chr42791 671 1661 ----
NM_031370chr42791 671 1661 ----
NM_031372chr461597 1542 1153 603 583 114 ----1653
NM_031411chr531745 634 217 21940 150 --1603
NM_031419chr31227 ----11152
NM_031422chr18----1512 --
NM_031427chr1465531 5227 5200 1907 575 445 45937 5817 5045 217 15597 13882
NM_031435chr1243426 3150 3141 2168 ------
NM_031438chr551842 1591 1445 696 552 1321 ----
NM_031442chrX32528 905 672 2370 181 ----
NM_031445chr263266 2854 2625 1188 1030 932 22906 2557 ----
NM_031461chr821783 1497 1212 ----
NM_031469chr662837 2672 1405 1390 824 557 13614 ----
NM_031483chr2071357 1071 950 803 776 336 141 22604 2318 23292 101 11402
NM_031844chr163646 2687 1404 1151 1031 69 43077 2920 1422 127 ----
NM_031845chr273585 3477 2812 2725 2719 2694 891 12667 12917 --
NM_031847chr273585 3477 2812 2725 2719 2694 891 12667 12917 --
NM_031849chr531745 634 217 21940 150 --1603
NM_031857chr531745 634 217 21940 150 --1603
NM_031858chr17----1197 --
NM_031860chr531745 634 217 21940 150 --1603
NM_031862chr17----1197 --
NM_031866chr1031006 876 665 ------
NM_031922chr61203 ----1414
NM_031992chr721136 609 --1381 --
NM_032012chr964501 3941 3656 3556 3351 2026 21883 31 24733 2080 --
NM_032027chr1156 ------
NM_032047chr331914 1718 1681 41641 651 214 151 1763 --
NM_032050chr222833 395 ----1176
NM_032052chr2221218 338 ----1561
NM_032116chr1365320 4187 3612 1179 742 661 1314 13979 1496
NM_032128chr431050 801 264 ------
NM_032138chr131145 1112 ----
NM_032144chr231314 1292 620 ------
NM_032145chr611737 11188 ----
NM_032153chr332586 1799 1067 22095 743 12532 --
NM_032174chr141401 1141 967 582 21509 1155 --1108
NM_032175chr531692 1638 469 --1343 1398
NM_032182chr1011084 ------
NM_032186chr11535 21054 946 ----
NM_032189chr1364415 4198 3892 2018 1166 151 21871 1241 25023 3711 --
NM_032199chr1063056 1270 1091 1007 811 179 ------
NM_032208chr231382 1257 21 22513 1443 --1245
NM_032228chr1133413 3206 1396 1321 --11198
NM_032231chr151229 ------
NM_032246chr1531072 902 298 ------
NM_032288chr352335 1667 648 582 355 31784 1758 883 --11846
NM_032291chr131519 522 194 21537 1305 ----
NM_032293chr92249 29 ------
NM_032305chr1133 ------
NM_032315chr1--177 148 125
NM_032320chr111188 --1607 --
NM_032352chr141314 2977 508 ----
NM_032373chr1065878 4717 4548 4440 1569 962 35329 5086 468 13888 --
NM_032408chr72469 392 ------
NM_032424chr1131253 353 291 1536 142 --
NM_032433chr1941230 1061 485 62 ----1330
NM_032434chr221214 1089 1458 --21178 593
NM_032439chr101315 ------
NM_032440chr1011964 1395 ----
NM_032441chrX11088 21191 63 1358 --
NM_032446chr553684 3621 2832 2674 1060 3657 625 230 13463 --
NM_032457chr453613 2991 2475 1423 152 11211 ----
NM_032458chrX53208 2866 2082 657 633 33061 2611 1276 12912 --
NM_032491chr123367 330 178 ------
NM_032499chr1521666 705 --1145 --
NM_032505chr322327 417 31977 1840 692 ----
NM_032509chr831904 939 166 1353 12026 11867
NM_032521chr2013207 ------
NM_032547chr431328 1175 933 11100 ----
NM_032582chr1721359 408 ----11874
NM_032601chr21181 ------
NM_032622chr411541 --11198 --
NM_032623chr41267 1107 ----
NM_032626chr161236 128 ----
NM_032663chr1221940 1544 21286 445 ----
NM_032682chr363080 2987 2731 2408 2215 107 ----1953
NM_032737chr19295 77 1283 21815 864 --
NM_032765chr51264 ------
NM_032796chrX2291 58 ------
NM_032804chr1011897 ------
NM_032813chr131728 ------
NM_032832chr631307 189 70 51506 1468 1406 1167 338 ----
NM_032833chr132324 1892 103 ----1831
NM_032837chr1752100 1645 1344 711 648 11531 ----
NM_032842chr731090 400 30 11582 1126 11331
NM_032859chr1352706 1263 1194 715 625 42520 1599 744 69 ----
NM_032866chr1543104 2947 2101 1987 21207 1084 ----
NM_032870chr61561 ------
NM_032873chr1163245 3046 1824 1624 1240 289 --3878 624 204 --
NM_032875chr172185 50 ------
NM_032876chr1471964 1904 1605 725 635 318 117 --1746 --
NM_032884chr1--1332 ----
NM_032900chr1031529 859 617 23441 3168 23247 962 12517
NM_032932chr1796289 4804 4737 2555 1205 541 378 353 112 66273 5945 5111 2511 1676 1057 34838 4482 2149 --
NM_032933chr182654 491 --1370 --
NM_032936chr71161 ------
NM_032961chr411247 1958 2304 216 --
NM_032968chrX83164 2993 2689 1099 697 670 452 403 ------
NM_032969chrX83164 2993 2689 1099 697 670 452 403 ------
NM_032973chrY83537 3159 2988 1099 697 670 452 403 ------
NM_032978chr181243 1206 ----
NM_032979chr181243 1206 ----
NM_032981chr181243 1206 ----
NM_032991chr42498 380 1463 11266 --
NM_032999chr73793 417 131 1194 ----
NM_033000chr73793 417 131 1194 ----
NM_033001chr73793 417 131 1194 ----
NM_033012chr13--1819 --1836
NM_033020chr131401 713 464 14170 --14766
NM_033023chr7------1505
NM_033044chr1--11150 ----
NM_033071chr62583 121 1453 --1546
NM_033121chr1221203 606 1516 1298 --
NM_033135chr11143 ----2678 406
NM_033138chr761740 1734 1502 676 646 175 21986 359 ----
NM_033139chr761740 1734 1502 676 646 175 21986 359 ----
NM_033140chr761740 1734 1502 676 646 175 21986 359 ----
NM_033157chr761740 1734 1502 676 646 175 21986 359 ----
NM_033181chr683971 3593 3050 1316 1047 868 861 775 161 --1592
NM_033207chr1061992 1810 943 908 203 154 --12237 1127
NM_033211chr531456 1428 198 1448 ----
NM_033222chr921398 975 1229 ----
NM_033224chr757363 7074 5125 4876 488 36937 6368 6045 36585 2744 429 --
NM_033225chr863226 3055 1260 1067 962 96 22600 484 1593 --
NM_033281chr51136 ------
NM_033285chr853923 1426 1151 620 134 23621 231 ----
NM_033290chrX62778 1499 1398 1386 506 218 1725 1876 --
NM_033326chr1162530 1698 1658 1581 709 357 1437 ----
NM_033331chr972825 2767 2247 2229 1013 914 274 12341 --2680 39
NM_033360chr1254167 3863 3627 1651 602 33941 3666 3464 11445 --
NM_033393chr431978 1076 676 ------
NM_033425chr1152914 1017 721 218 99 22437 337 1739 --
NM_033426chr1442861 2804 1933 1811 1712 ----
NM_033427chr72767 557 ------
NM_033449chr561682 542 298 269 244 159 --1353 1206
NM_033502chr6--1137 ----
NM_033503chr1573743 3619 2654 2629 1477 1113 339 22855 47 --11211
NM_033505chr2116403 6357 6207 5573 5423 4867 4343 4315 4247 2220 580 26632 4466 --14493
NM_033515chr621217 215 11145 ----
NM_033542chr2042014 1528 1285 362 41878 1622 815 758 11673 --
NM_033551chr573430 3419 2773 2713 491 479 323 11304 21038 1000 --
NM_033631chr1113866 3738 3707 2668 2586 2412 1255 920 586 490 358 1886 ----
NM_033642chrX31051 186 66 ------
NM_033644chr52117 35 --22213 555 --
NM_033645chr52117 35 --22213 555 --
NM_033656chr2175288 4887 4776 4723 4444 4214 1129 25810 888 --1717
NM_052818chr1331923 1905 1851 --1235 --
NM_052834chr1821724 1617 ------
NM_052860chr52705 126 --1875 --
NM_052867chr132399 28 ------
NM_052879chr1243570 3373 3277 624 21409 1040 12654 --
NM_052885chr1234479 4318 3988 44598 4018 3421 131 14087 --
NM_052886chr832011 1945 1810 1453 --11580
NM_052898chr811186 ------
NM_052900chr82634 608 ------
NM_052904chr611199 --1267 --
NM_052905chr221543 1400 ------
NM_052907chr1253398 1710 678 413 364 34232 3614 3565 --1517
NM_052911chr181248 ------
NM_052917chr263367 3283 2911 1353 907 631 1147 ----
NM_052918chr1042763 2409 1086 384 --22799 543 11272
NM_052927chr512087 ----11865
NM_052932chr1141996 1762 855 197 42513 1000 924 551 ----
NM_052937chr872592 2495 1950 970 954 320 41 31875 1750 777 ----
NM_052958chr82252 98 ------
NM_052962chr631258 1173 634 ------
NM_052978chr1431723 454 275 --3664 282 109 --
NM_053001chr82276 26 ------
NM_053016chr9137761 7272 6996 6937 6333 5326 5051 2084 1275 873 524 472 401 27637 1311 ----
NM_053023chr1133278 1300 512 --2485 352 --
NM_053024chr341382 1371 1164 1107 180 ----
NM_053025chr331142 650 274 --1436 --
NM_053026chr331142 650 274 --1436 --
NM_053027chr331142 650 274 --1436 --
NM_053028chr331142 650 274 --1436 --
NM_053031chr331142 650 274 --1436 --
NM_053032chr331142 650 274 --1436 --
NM_053064chr1462899 2853 2248 2212 1117 80 22585 120 1128 1393
NM_054016chr181862 1793 1609 1572 1427 1278 791 480 11683 ----
NM_054016chr181862 1793 1609 1572 1427 1278 791 480 11683 ----
NM_054016chr181862 1793 1609 1572 1427 1278 791 480 11683 ----
NM_057158chr8--1615 ----
NM_057159chr91284 2620 543 1271 --
NM_057169chr1221127 33 12052 ----
NM_057170chr1221127 33 12052 ----
NM_057175chr43983 446 302 ----1994
NM_057178chr1742342 1004 689 567 --11775 --
NM_058170chr121542 1102 --11096 --
NM_058172chr431766 1208 672 11258 ----
NM_058191chr211229 1157 ----
NM_058237chr142710 354 ----1277
NM_078487chr943241 2630 2474 862 13358 --1907
NM_079837chr161593 ------
NM_080391chr12598 42 177 ----
NM_080392chr12647 91 1126 ----
NM_080546chr931717 1627 755 32033 2016 550 ----
NM_080594chr163772 107 67 ------
NM_080597chr182400 324 1423 --11122
NM_080599chr1031112 505 109 ------
NM_080616chr201127 ----1253
NM_080617chr201135 ------
NM_080645chr621966 1628 1786 ----
NM_080654chr111170 21183 914 ----
NM_080664chr1431900 1461 108 --1184 --
NM_080671chr21433 1788 ----
NM_080717chr12------1336
NM_080759chr1322112 966 1887 ----
NM_080760chr1322112 966 1887 ----
NM_080792chr2062120 2114 1777 734 117 22 --1493 1537
NM_080867chr1445078 1275 683 151 11265 ----
NM_080872chr853977 3526 3436 576 465 3930 534 527 ----
NM_080927chr343286 1326 474 412 --1612 --
NM_130391chr941305 1236 102 21 12264 12992 --
NM_130392chr941305 1236 102 21 12264 12992 --
NM_130393chr941305 1236 102 21 12264 12992 --
NM_130439chr1021597 333 ----11869
NM_130439chr1021597 333 ----11869
NM_130798chr1521362 197 --11302 --
NM_130831chr352698 2590 2562 2353 724 1845 ----
NM_130832chr352698 2590 2562 2353 724 1845 ----
NM_130833chr352698 2590 2562 2353 724 1845 ----
NM_130834chr352698 2590 2562 2353 724 1845 ----
NM_130835chr352698 2590 2562 2353 724 1845 ----
NM_130836chr352698 2590 2562 2353 724 1845 ----
NM_130837chr352698 2590 2562 2353 724 1845 ----
NM_130838chr152674 570 ----11733
NM_130839chr152674 570 ----11733
NM_133170chr20107918 7659 6723 6352 5995 5892 1785 1256 516 494 15782 32649 2593 2283 15423
NM_133264chr1773594 3158 2654 2629 1380 884 745 1695 1176 --
NM_133265chrX32694 2313 332 --22390 689 --
NM_133329chr231572 239 221 ------
NM_133372chr542935 2762 2216 96 12209 ----
NM_133433chr51366 ------
NM_133445chr993456 2433 1369 744 602 456 423 211 112 21460 1446 23379 185 --
NM_133446chr101264 ------
NM_133465chr92303 292 1237 ----
NM_133468chr752258 948 938 764 458 1229 1438 --
NM_133476chr1211041 11206 ----
NM_133496chr124220 1597 33362 1572 401 12799 13629
NM_133638chr531205 1194 506 ------
NM_133647chr1543107 1080 1061 516 12954 ----
NM_133650chr62583 121 1453 --1546
NM_134265chr171252 1939 ----
NM_138270chrX52175 1174 992 899 698 ------
NM_138285chr21421 1121 ----
NM_138286chr1964084 3895 3839 2791 1620 1450 14347 --13866
NM_138287chr342428 1684 642 163 11898 22551 2030 --
NM_138288chr1451849 1621 1584 560 92 ------
NM_138292chr1142562 2273 1153 755 ----2209 40
NM_138333chr932166 672 146 ------
NM_138426chr722408 946 ------
NM_138440chr162464 410 --1153 --
NM_138444chr1334542 976 188 1542 13006 --
NM_138459chr653670 3304 2906 701 630 11388 ----
NM_138468chr231979 271 76 21728 1151 1137 14963
NM_138555chr151580 ----1467
NM_138559chr23996 962 408 ------
NM_138576chr1434193 3249 837 ----11710
NM_138621chr233230 761 484 24043 3314 ----
NM_138694chr652848 2614 2468 1413 56 --31090 923 345 --
NM_138713chr1688154 7378 6021 5014 1876 1411 954 673 46052 6036 5893 2987 1893 16291
NM_138714chr1688154 7378 6021 5014 1876 1411 954 673 46052 6036 5893 2987 1893 16291
NM_138730chr61349 ------
NM_138731chr1444187 2994 1601 1086 34171 3263 936 --13734
NM_138736chr16114173 4023 3882 3277 3249 3071 2622 1628 938 583 452 1647 21524 1427 --
NM_138766chr53579 166 63 ------
NM_138771chr741320 1304 1297 1176 ------
NM_138773chr53857 232 44 131 ----
NM_138782chr521707 382 ------
NM_138821chr53579 166 63 ------
NM_138822chr53579 166 63 ------
NM_138931chr32791 321 ------
NM_138957chr22267 39 2163 146 ----
NM_138967chr1592414 2166 2044 1977 1878 1789 1657 360 311 ----11854
NM_138970chr1422099 132 11878 21818 285 1747
NM_138971chr1133485 1532 678 --21038 483 --
NM_138971chr1133485 1532 678 --21038 483 --
NM_138972chr1133485 1532 678 --21038 483 --
NM_138972chr1133485 1532 678 --21038 483 --
NM_138973chr1133485 1532 678 --21038 483 --
NM_138973chr1133485 1532 678 --21038 483 --
NM_138980chr41215 ------
NM_138981chr41346 ------
NM_138982chr41215 ------
NM_138991chr211142 ----1354
NM_139045chr91130 ------
NM_139048chr3153 1141 --11160
NM_139070chr51216 ------
NM_139135chr121140 829 ------
NM_139168chr532014 1630 1551 1716 ----
NM_139207chr1252038 1744 1703 1405 1379 22200 253 ----
NM_139215chr171185 ------
NM_139245chr321853 1435 ------
NM_139279chr263559 3159 3021 2713 1119 66 ------
NM_139321chr2043735 2850 1607 533 13538 --13938
NM_139323chr2022013 1761 ------
NM_144571chr475294 5242 2644 2140 1451 1210 1110 25741 5123 25936 2172 --
NM_144574chr141502 ------
NM_144578chr1445562 4947 1254 716 25075 1714 --1954
NM_144582chr292515 2299 2243 2196 1816 1788 831 476 359 --31878 544 129 --
NM_144586chr21510 --11186 --
NM_144590chr1052629 2190 2111 1020 65 --12740 --
NM_144598chr15------1116
NM_144599chr1575545 5217 4831 4193 3554 3541 413 12144 ----
NM_144628chr2062805 2781 2363 1182 1172 889 1748 ----
NM_144633chr331478 177 77 21419 1318 1988 --
NM_144635chr341075 860 827 241 ----11145
NM_144642chr32312 126 1396 ----
NM_144643chr4--1356 132 --
NM_144664chr1122573 2456 2846 406 ----
NM_144667chr1231075 409 27 1810 ----
NM_144668chr121124 ----1116
NM_144721chr442474 2066 995 480 12635 22533 116 11026
NM_144726chr52817 787 --137 --
NM_144767chr1544609 3765 3434 1122 13563 ----
NM_144778chr133671 454 135 ------
NM_144949chr222227 287 1488 --12642
NM_144963chr862025 1994 1937 1077 947 906 1977 --22316 652
NM_144973chr1224496 3593 15088 ----
NM_144988chr11241 ----125
NM_145000chr5--1259 ----
NM_145005chr93905 830 108 ------
NM_145055chr1853720 3663 2358 1515 390 1307 ----
NM_145102chr751448 233 205 143 125 1472 ----
NM_145112chr1411206 ------
NM_145113chr1411478 ------
NM_145115chr732074 892 502 11443 --22298 850
NM_145117chr1143099 2571 2035 1322 11177 ----
NM_145176chr663564 3376 2780 2199 502 396 1754 ----
NM_145203chr131157 169 --1623
NM_145206chr1043283 2850 2395 227 --1310 --
NM_145246chr101376 ------
NM_145251chr1421420 1288 ------
NM_145259chr276802 6297 6247 5152 4965 2730 426 56872 6855 2131 2092 837 ----
NM_145261chr3--1180 --1892
NM_145263chr422320 435 12186 1176 --
NM_145307chr1063660 3634 3474 3174 688 230 2565 474 13948 --
NM_145315chr6--1471 2116 30 --
NM_145332chr64661 623 156 54 ------
NM_145333chr64661 623 156 54 ------
NM_145647chr8167 1205 ----
NM_145690chr8--11876 2571 544 --
NM_145693chr23993 534 203 ------
NM_145728chr1551658 790 538 453 269 12437 ----
NM_145808chr71454 --2752 662 --
NM_145891chr1631242 607 257 ------
NM_145892chr1631242 607 257 ------
NM_145893chr1631364 729 379 ------
NM_145909chr621103 1055 2328 59 ----
NM_147150chr973940 3281 3106 2791 908 718 340 13310 22717 190 --
NM_147164chr91540 ------
NM_147175chrX51886 1813 1717 274 127 ------
NM_147223chr262065 2012 1947 1560 703 496 21568 946 --12034
NM_147233chr251882 1829 1764 520 313 1763 --11851
NM_148174chr81194 1452 123 --
NM_148904chr1--1503 ----
NM_148905chr1--1503 ----
NM_148906chr1--1503 ----
NM_148907chr1--1503 ----
NM_148908chr1--1503 ----
NM_148909chr1--1503 ----
NM_148957chr1322602 85 --12496 22193 925
NM_152261chr121989 1705 ----
NM_152263chr174470 4405 3888 1876 1346 695 27 22353 942 24580 77 --
NM_152275chr241825 1471 548 526 21528 567 22403 1504 --
NM_152277chr532037 1769 596 3693 378 267 ----
NM_152280chr12878 525 11325 33326 1350 752 --
NM_152282chr32998 66 ------
NM_152309chr1032118 656 637 41757 872 596 396 ----
NM_152329chr141138 ------
NM_152388chr213875 24064 313 13001 --
NM_152409chr5--22711 31 33298 822 253 --
NM_152420chr9--1137 ----
NM_152424chrX54673 4655 3888 3831 470 --13093 --
NM_152433chr113654 311 26 --1328 11290
NM_152437chr1242203 1935 829 586 11542 ----
NM_152440chr1221165 879 31054 424 196 ----
NM_152443chr144578 491 451 380 ------
NM_152446chr14----1399 --
NM_152448chr152415 139 ------
NM_152449chr1551274 650 579 500 32 ------
NM_152455chr1542724 1815 156 115 21826 51 ----
NM_152470chr1873041 2653 1338 1036 883 463 399 23916 773 ----
NM_152496chr12487 290 ------
NM_152520chr241183 447 425 179 ------
NM_152529chr294403 4235 3998 3572 3404 2867 2812 263 39 23779 2795 1723 --
NM_152536chr321042 926 2329 61 ----
NM_152542chr442166 1532 693 533 ------
NM_152545chr41480 ------
NM_152556chr732595 273 233 ------
NM_152564chr811380 21625 736 ----
NM_152594chr1511819 ------
NM_152597chr151627 ------
NM_152608chr172345 2305 2262 2014 984 894 369 ------
NM_152609chr121063 457 ------
NM_152622chr563080 2344 2129 1015 1004 705 12796 ----
NM_152624chr587057 6780 5957 5517 5084 1475 1212 792 35795 1837 569 36736 6083 533 --
NM_152629chr953046 936 762 254 203 --13593 --
NM_152641chr1222365 718 32307 961 529 ----
NM_152643chr10--21174 1132 11148 --
NM_152666chr11288 1296 ----
NM_152678chr322556 889 ------
NM_152688chr63751 150 114 1981 ----
NM_152699chr333750 3710 606 --23585 2596 --
NM_152707chr101149 ------
NM_152715chr11176 ------
NM_152734chr664584 4224 1744 1317 901 727 1516 11835 --
NM_152737chr652003 1775 1733 1444 1302 21907 1794 22019 1916 --
NM_152738chr61124 1404 ----
NM_152739chr7--122 ----
NM_152740chr71121 --2706 671 --
NM_152753chr662072 1945 1771 537 252 162 --1559 --
NM_152756chr533328 3020 864 13620 ----
NM_152765chr851924 1882 925 880 371 ------
NM_152774chr732366 561 201 12330 ----
NM_152787chrX43838 3177 2997 1243 12796 --1428
NM_152788chr12176 ------
NM_152793chr765217 4495 4325 3489 1995 259 ------
NM_152835chr13803 316 115 22138 294 11824 --
NM_152836chr841697 1616 565 29 147 --1551
NM_152837chr841697 1616 565 29 147 --1551
NM_152838chr2042858 991 296 209 23338 3110 --23429 2378
NM_152896chr92676 248 ------
NM_152903chr1332524 2261 1035 2987 137 ----
NM_152924chr1566538 4705 4326 4223 906 824 22026 1504 11418 142
NM_152991chr111624 ------
NM_152995chr4142 ------
NM_152998chr7--178 ----
NM_153018chr1733191 2816 2278 1584 --1685
NM_153020chr631334 1214 168 1564 11156 --
NM_153029chr1694068 4021 3694 3271 2848 2786 1218 1145 1078 ----1840
NM_153042chr651512 640 555 497 241 --1318 --
NM_153050chr2284949 4896 4131 4047 3809 3707 3241 1476 --11020 12009
NM_153051chr2284949 4896 4131 4047 3809 3707 3241 1476 --11020 12009
NM_153184chr311530 --11439 --
NM_153188chr555324 4594 3916 831 216 ------
NM_153207chr1243024 1150 476 347 ------
NM_153211chr181447 ------
NM_153226chr102364 152 178 ----
NM_153234chr552806 2437 938 548 95 12606 12593 --
NM_153235chr621638 618 22390 2370 ----
NM_153256chr103714 552 140 --1599 --
NM_153260chr1531172 535 496 ------
NM_153261chr1631211 1077 222 ------
NM_153262chr132049 1130 730 22691 2344 ----
NM_153365chr422444 1112 11710 --12374
NM_153371chr13143 11559 ----
NM_153456chr1376111 5709 4895 4537 2328 1673 1585 21140 251 14929 15051
NM_153487chr6114850 4807 4442 3384 3073 1678 1348 1301 1216 1146 488 11290 24454 4012 --
NM_153605chr311519 ----11202
NM_153607chr543199 2403 1168 1131 32881 2002 399 --1838
NM_153634chr121517 ----11190
NM_153645chr2252737 2650 2487 2165 1168 33004 1333 1082 11003 --
NM_153649chr122331 2133 ----1885
NM_153686chr462451 2349 2118 1842 1707 91 12408 ----
NM_153690chr31273 ----1659
NM_153707chr9--123 ----
NM_153712chr253792 3512 3505 2690 307 1638 1377 --
NM_153759chr211200 ------
NM_153810chr1074573 3997 3278 1730 1204 908 885 14526 14511 1961
NM_153831chr82978 50 ------
NM_170606chr741356 1277 333 154 11870 ----
NM_170665chr1263635 3040 1752 1356 942 607 --24529 129 --
NM_170674chr151901 ----1546
NM_170675chr15--1327 --1222
NM_170676chr15--1327 --1222
NM_170677chr151901 ----1546
NM_170692chr11749 --1808 --
NM_170706chr1153552 3499 3346 3222 3123 1645 1381 1300 425 411 386 347 333 308 199 12771 33407 373 295 --
NM_170707chr11664 --1740 1315
NM_170708chr11664 --1740 1315
NM_170709chr812277 --22173 2007 --
NM_170720chr1971001 940 478 410 353 285 254 21253 870 --11263
NM_170731chr1142188 1764 874 410 11013 ----
NM_170732chr1142188 1764 874 410 11013 ----
NM_170733chr1142188 1764 874 410 11013 ----
NM_170734chr1142188 1764 874 410 11013 ----
NM_170735chr1142188 1764 874 410 11013 ----
NM_171998chrX11754 42294 2232 2016 791 --12349
NM_171999chr181754 ------
NM_172037chr82959 388 31421 1078 308 ----
NM_172070chr231731 225 193 ------
NM_172071chr137180 6402 599 25618 2437 25470 2826 --
NM_172103chr661837 471 406 290 172 76 ------
NM_172105chr661837 471 406 290 172 76 ------
NM_172127chr41703 1419 ----
NM_172128chr41659 1375 ----
NM_172159chr341579 781 635 115 12125 ----
NM_172160chr341579 781 635 115 12125 ----
NM_172193chr1411223 ------
NM_172200chr10155 ------
NM_172218chr81533 1227 ----
NM_172242chr102361 101 --1128 --
NM_172315chr151901 ----1546
NM_172316chr151901 ----1546
NM_172337chr1431023 269 226 --1795 --
NM_172344chr231572 239 221 ------
NM_172373chr1351268 1224 1154 897 475 ------
NM_173074chr21313 --1103 --
NM_173075chr411351 ----11573
NM_173083chr111242 --11106 --
NM_173092chr17157 ------
NM_173157chr12161 ----1441
NM_173163chr161494 1543 ----
NM_173165chr161375 1424 ----
NM_173171chr211173 1245 ----
NM_173172chr221481 1003 1553 ----
NM_173173chr211173 1245 ----
NM_173198chr912939 ------
NM_173200chr912939 ------
NM_173214chr1688154 7378 6021 5014 1876 1411 954 673 46052 6036 5893 2987 1893 16291
NM_173355chr23876 694 389 1203 ----
NM_173468chr446035 1718 1361 86 64350 1557 1460 1444 1407 963 23820 2244 14062
NM_173469chr1531096 327 186 ------
NM_173470chrX2326 119 21822 1107 --12223
NM_173473chr1032006 511 24 22567 783 ----
NM_173491chr52329 105 130 ----
NM_173500chr1511380 11008 11309 1875
NM_173508chr1------1768
NM_173511chr222603 516 33373 2437 138 ----
NM_173576chr1042348 2156 1458 730 ----1720
NM_173595chr1255250 4940 4227 884 490 24163 58 ----
NM_173602chr1283220 2626 1503 1478 1320 972 940 61 1316 --12862
NM_173642chr198595 6465 3560 3373 3124 2065 1516 704 73 69227 6576 3514 2328 2130 1628 18932 18750
NM_173644chr2031809 1548 29 12022 --11560
NM_173647chr221065 74 ------
NM_173648chr2--1729 ----
NM_173654chr341768 1638 669 536 21826 1502 --1792
NM_173667chr511584 11532 ----
NM_173694chrX31940 292 152 ------
NM_173794chrX----196 1510
NM_173797chr531207 963 425 ------
NM_173808chr154230 3859 874 512 250 43992 3967 3228 1177 ----
NM_173848chr8--1155 ----
NM_173851chr853448 2679 1525 1326 800 21098 1006 ----
NM_173854chr131880 1870 329 41837 1517 303 104 52127 1945 567 510 377 12097
NM_173872chr41329 ------
NM_174890chr102311 68 ------
NM_174900chr411276 3232 207 76 ----
NM_174902chr1111296 11258 --1650
NM_174907chr3189 ------
NM_174963chr12844 801 ------
NM_174964chr12844 801 ------
NM_174965chr12863 820 ------
NM_174966chr12844 801 ------
NM_174967chr12863 820 ------
NM_174968chr12844 801 ------
NM_174969chr12844 801 ------
NM_174970chr12863 820 ------
NM_174971chr12844 801 ------
NM_175061chr721841 501 12130 1249 --
NM_175566chr112367 35 ------
NM_175607chr351438 1189 1115 536 137 ------
NM_175610chr1531336 1216 90 ------
NM_175612chr351438 1189 1115 536 137 ------
NM_175623chr12106688 6040 5672 4820 1972 1799 924 912 302 183 22070 1938 16016 25783 439
NM_175624chr12106783 6135 5767 4915 2067 1894 1019 1007 397 278 22165 2033 16111 25878 534
NM_175625chr12106783 6135 5767 4915 2067 1894 1019 1007 397 278 22165 2033 16111 25878 534
NM_175629chr211200 ------
NM_175634chr811268 --1234 --
NM_175635chr811268 --1234 --
NM_175636chr811268 --1234 --
NM_175736chr12137023 7000 6937 4806 2190 2129 1403 1045 1015 566 411 401 395 --16621 11517
NM_175744chr11142 ------
NM_175854chr1331693 846 229 11914 ----
NM_175856chr5--1733 --1523
NM_175861chr1285488 5347 5341 5335 5066 4558 1117 332 11985 ----
NM_175866chr11216 11417 1962 --
NM_175920chr52838 127 ------
NM_175921chr594270 4062 3920 3720 3378 3217 2999 2799 1553 --1357 --
NM_176814chr72561 461 1997 1966 --
NM_176823chr143909 3041 2593 1124 23238 2601 ----
NM_177398chr141749 1417 1214 73 1678 ----
NM_177399chr141749 1417 1214 73 1678 ----
NM_177414chr141285 549 469 251 --11221 --
NM_177424chr11290 ------
NM_177438chr1454211 3900 1306 1250 987 23802 3195 12600 --
NM_177553chr112842 815 3691 616 269 ----
NM_177559chr201400 ------
NM_177560chr201400 ------
NM_177966chr3--11921 ----
NM_177968chr211366 --11476 11860
NM_177969chr2--2702 543 ----
NM_177972chr1184432 3742 3380 3136 1530 1288 1164 665 23300 1105 23980 1743 11002
NM_177983chr2180 ------
NM_177989chr3156 ------
NM_177990chr2061516 1260 821 635 592 100 ----11375
NM_178013chr1422264 371 --12538 --
NM_178042chr3156 ------
NM_178123chr24899 792 714 389 ----11076
NM_178126chr1712031 --1392 --
NM_178151chrX97713 7409 5887 5671 2988 2955 2359 2182 180 47423 5268 2026 1094 1449 1788
NM_178152chrX97713 7409 5887 5671 2988 2955 2359 2182 180 47423 5268 2026 1094 1449 1788
NM_178153chrX97713 7409 5887 5671 2988 2955 2359 2182 180 47423 5268 2026 1094 1449 1788
NM_178191chr12482 343 --21144 991 --
NM_178313chr242159 1813 1539 45 31724 804 547 12051 --
NM_178423chr71216 ----1990
NM_178425chr71216 ----1990
NM_178441chr1421264 958 ----11388
NM_178505chr1023247 1404 ----13090
NM_178565chr841593 685 647 187 11325 --1507
NM_178581chr201272 ------
NM_178585chr432758 2378 704 22909 378 32778 2506 2098 --
NM_178586chr1452339 2000 1844 1749 1505 ------
NM_181054chr14--31166 830 235 ----
NM_181077chr1562006 1737 756 661 538 203 ------
NM_181302chr141502 ------
NM_181308chr141502 ------
NM_181332chrX12415 21993 1825 --11972
NM_181351chr1172838 2039 2020 847 568 359 137 2957 338 ----
NM_181353chr202668 478 ------
NM_181354chr831433 528 190 ------
NM_181358chr123394 155 11220 13192 14019
NM_181442chr203921 846 688 ------
NM_181443chr202729 237 42339 716 681 481 ----
NM_181457chr221180 169 11061 ----
NM_181458chr221313 302 11194 ----
NM_181459chr221079 68 1960 ----
NM_181460chr221126 115 11007 ----
NM_181486chr12------1336
NM_181500chr73657 637 290 ------
NM_181504chr522718 1267 23546 1553 1384 155
NM_181521chr16136510 6359 5929 5824 4893 4699 4590 2761 2751 2409 2346 1438 1324 44638 4515 4474 993 ----
NM_181523chr522718 1267 23546 1553 1384 155
NM_181524chr522718 1267 23546 1553 1384 155
NM_181552chr71988 ------
NM_181659chr2042876 1252 412 276 12685 ----
NM_181659chr2042876 1252 412 276 12685 ----
NM_181671chr171133 ------
NM_181702chr8----1238 --
NM_181713chr21146 1281 ----
NM_181715chr11112 ------
NM_181782chr611840 2429 164 ----
NM_181787chr833701 3553 2978 1570 ----
NM_181789chr15--22294 102 ----
NM_181828chr2252518 701 648 271 60 ------
NM_181829chr2252518 701 648 271 60 ------
NM_181830chr2252518 701 648 271 60 ------
NM_181832chr2252533 716 663 286 75 ------
NM_181836chr5--11056 1358 --
NM_181844chr1791795 1538 1259 724 707 698 656 645 621 31397 734 629 --21318 538
NM_181861chr1232039 1782 1079 ------
NM_181868chr1232039 1782 1079 ------
NM_181869chr1232124 1867 1164 ----182
NM_181886chr41417 1205 ----
NM_181887chr41417 1205 ----
NM_181888chr41417 1205 ----
NM_181889chr41417 1205 ----
NM_181890chr41417 1205 ----
NM_181891chr41417 1205 ----
NM_181892chr41464 1252 ----
NM_181893chr41417 1205 ----
NM_182485chr431270 946 834 21254 722 ----
NM_182493chr16105308 5173 4536 4070 3883 3672 2162 2033 1081 279 24354 689 11289 --
NM_182503chr6115342 4997 4635 4609 4371 3996 3449 1792 1039 743 284 55605 1753 559 257 170 23937 1636 --
NM_182515chr1976245 5707 5042 2432 2266 1891 1034 15441 ----
NM_182551chr233033 1361 681 33435 2393 346 ----
NM_182569chr171272 1215 ----
NM_182607chrX21454 347 1701 ----
NM_182620chr1731877 640 90 22254 1852 12153 --
NM_182643chr82812 744 150 ----
NM_182646chr431270 946 834 21254 722 ----
NM_182663chr14654 374 354 94 ----11812
NM_182664chr14784 504 484 224 ----11942
NM_182665chr14654 374 354 94 ----11812
NM_182666chr32438 261 ------
NM_182691chr7--41261 1225 961 230 ----
NM_182692chr7--41261 1225 961 230 ----
NM_182697chr721487 1160 11629 1157 --
NM_182700chr761931 1574 1517 1300 657 352 --11921 --
NM_182765chr1042341 1929 641 64 ------
NM_182797chr2021637 1526 11323 ----
NM_182896chr341478 1304 210 104 2381 262 ----
NM_182898chr796531 6285 5857 5637 4685 2257 1803 1794 685 56169 5679 4637 4051 76 16098 15872
NM_182899chr796531 6285 5857 5637 4685 2257 1803 1794 685 56169 5679 4637 4051 76 16098 15872
NM_182915chr222157 1947 --122 22189 906
NM_182918chr21----1325 --
NM_182943chr3--31276 836 826 ----
NM_182948chr131963 970 649 13089 ----
NM_182961chr62583 121 1453 --1546
NM_182964chr1143099 2571 2035 1322 11177 ----
NM_182972chr141959 1043 326 298 ------
NM_182975chr1172 ------
NM_183004chr1453676 2508 2417 1023 173 --11281 --
NM_183043chr132382 347 ------
NM_183044chr132382 347 ------
NM_183227chr631649 667 175 ------
NM_183238chr1263082 2913 2446 1369 882 662 2309 154 32984 1141 1124 --
NM_183353chrX1388 ------
NM_183397chr2094117 4084 4025 3626 1337 1275 1256 729 673 --44859 3928 3402 495 --
NM_183416chr1----11754 --
NM_183419chr82978 370 ------
NM_184234chr20175 ----1272
NM_194247chr233912 2832 654 24460 824 ----
NM_194250chr21367 ------
NM_194259chr161535 1432 --1422
NM_194260chr161535 1432 --1422
NM_194261chr161535 1432 --1422
NM_194271chr122750 558 ------
NM_194282chr453001 2689 2408 898 689 4522 473 403 72 ----
NM_194283chr563072 3060 3031 2722 2681 1623 13944 136 --
NM_194285chr1143339 725 90 29 ------
NM_194286chr1245246 5019 4441 1762 --35624 2040 167 15990
NM_194291chr822421 780 12977 12796 22891 1985
NM_194314chr165016 2143 2004 943 334 100 14600 ----
NM_194317chr222681 870 ----1444
NM_194318chr1361892 1775 1636 1018 971 123 22378 2096 ----
NM_194328chr942876 2422 1001 230 12856 ----
NM_194329chr942876 2422 1001 230 12856 ----
NM_194330chr942876 2422 1001 230 12856 ----
NM_194332chr942876 2422 1001 230 12856 ----
NM_194356chr1232179 1519 799 12366 ----
NM_194434chr1854944 4887 4128 2038 394 11398 --11906
NM_194442chr141698 1389 1216 1202 ------
NM_194449chr181191 ------
NM_194463chrX2383 244 21107 435 ----
NM_197941chr512399 ------
NM_197972chr1141 ------
NM_198081chr672539 2401 2328 2108 1067 1021 334 1506 --1463
NM_198086chr1471964 1904 1605 725 635 318 117 --1746 --
NM_198120chr81457 ------
NM_198123chr82634 608 ------
NM_198124chr82634 608 ------
NM_198128chr181497 2866 828 ----
NM_198158chr32511 262 21192 155 ----
NM_198159chr32511 262 21192 155 ----
NM_198177chr32511 262 21192 155 ----
NM_198178chr32511 262 21192 155 ----
NM_198181chr1562526 1186 1177 1077 890 294 12361 1767 1574
NM_198182chr241329 302 292 48 11213 ----
NM_198195chr31256 ------
NM_198215chr101109 ------
NM_198217chr1331112 920 850 1217 ----
NM_198218chr1331112 920 850 1217 ----
NM_198219chr1331112 920 850 1217 ----
NM_198225chr1031562 1483 271 ------
NM_198240chr1251084 1045 948 395 160 21183 127 ----
NM_198243chr153688 315 40 1278 ----
NM_198267chr72661 598 1775 ----
NM_198268chr123394 155 11220 13192 14019
NM_198269chr123394 155 11220 13192 14019
NM_198270chrX43382 1297 228 171 32797 1061 431 2915 384 --
NM_198273chr531159 684 95 22826 46 ----
NM_198320chr1243481 2048 1032 84 54382 4171 3569 1814 830 --14571
NM_198353chr41408 1171 ----
NM_198391chr2031522 1192 1056 --1605 --
NM_198392chr662348 2277 1934 1839 679 355 21730 625 11697 --
NM_198399chr321422 36 --11203 --
NM_198400chr1532670 1018 598 22649 2528 31907 266 220 --
NM_198439chr113654 311 26 --1328 11290
NM_198468chr643392 3259 1411 826 34551 771 115 --14111
NM_198484chr375690 4559 4484 4434 1571 1416 910 35673 4858 234 16212 15035
NM_198506chr41225 21287 1094 --1591
NM_198512chrX4583 536 387 152 ------
NM_198513chr821454 56 11928 1815 --
NM_198549chr152872 2700 2306 2105 367 22740 2628 ----
NM_198560chr343400 3010 425 361 --2678 285 --
NM_198567chr51145 ------
NM_198569chr642675 918 757 378 12376 --12094
NM_198581chr297067 7044 5555 2833 2440 2110 918 679 319 26116 2366 11641 --
NM_198584chr822539 2286 22339 2048 --1613
NM_198700chr111458 1335 ----
NM_198793chr374082 3442 3131 2776 1448 1226 318 --1326 --
NM_198794chr143314 246 135 ------
NM_198829chr721168 1113 ------
NM_198834chr1711407 --136 11994
NM_198836chr1711407 --136 11994
NM_198837chr1711407 --136 11994
NM_198838chr1711407 --136 11994
NM_198839chr1711407 --136 11994
NM_198844chr172897 190 ------
NM_198880chr33709 551 215 ------
NM_198900chr12137023 7000 6937 4806 2190 2129 1403 1045 1015 566 411 401 395 --16621 11517
NM_198903chr5----1593 --
NM_198935chr2062208 1227 817 790 286 75 ------
NM_198956chr761931 1574 1517 1300 657 352 --11921 --
NM_198965chr12----1300 --
NM_198966chr12----1300 --
NM_198968chr1341387 1071 288 82 13011 --22964 2910
NM_199003chr821460 339 11467 ----
NM_199040chr1221023 219 ----13385
NM_199078chr251048 1010 273 199 115 ----1961
NM_199131chr1043548 2233 259 220 43577 3465 3136 2742 --12393
NM_199132chr1921985 718 ------
NM_199144chr202426 84 ------
NM_199167chr181349 ------
NM_199168chr101172 ----11250
NM_199169chr2052961 2522 2399 587 291 13304 12785 12730
NM_199170chr2052961 2522 2399 587 291 13304 12785 12730
NM_199171chr2052961 2522 2399 587 291 13304 12785 12730
NM_199188chr1243570 3373 3277 624 21409 1040 12654 --
NM_199190chr1243570 3373 3277 624 21409 1040 12654 --
NM_199203chr202426 84 ------
NM_199321chr172897 190 ------
NM_199324chr453109 3056 1075 1064 938 23338 2988 --12276
NM_199359chr201632 ------
NM_199360chr201632 ------
NM_199361chr201632 ------
NM_199362chr201632 ------
NM_199363chr201632 ------
NM_199421chr1445078 1275 683 151 11265 ----
NM_199436chr272603 2293 1118 1112 1076 658 110 ------
NM_199454chr113562 14246 ----
NM_199461chr1062905 2724 2630 1047 322 219 1396 ----
NM_199462chr184935 4152 1625 1494 1083 398 223 30 ------
NM_199478chrX11303 11957 ----
NM_199482chr23746 408 66 11349 11748 --
NM_201266chr222165 805 ------
NM_201269chr11535 21054 946 ----
NM_201279chr222165 805 ------
NM_201435chr122679 121 ------
NM_201567chr341392 1353 1242 528 ------
NM_201570chr104753 735 646 460 ------
NM_201571chr104753 735 646 460 ------
NM_201572chr104753 735 646 460 ------
NM_201590chr104753 735 646 460 ------
NM_201593chr104753 735 646 460 ------
NM_201596chr104753 735 646 460 ------
NM_201597chr104753 735 646 460 ------
NM_201629chr91501 ------
NM_201632chr531787 1749 1737 ------
NM_201634chr531886 1848 1836 --1100 --
NM_203282chr1921703 1484 ------
NM_203283chr41405 ------
NM_203284chr41405 ------
NM_203301chr14--1177 ----
NM_203305chr932404 2316 335 --143 --
NM_203327chr2043929 3459 3056 766 ------
NM_203342chr163170 2684 2427 1080 921 172 12216 23534 3104 --
NM_203343chr163170 2684 2427 1080 921 172 12216 23534 3104 --
NM_203349chr1551939 1761 1574 1417 668 ------
NM_203354chr142823 193 ------
NM_203355chr142823 193 ------
NM_203356chr142823 193 ------
NM_203364chr111440 1453 ----
NM_203370chr3141 ------
NM_203394chr1221898 748 1270 --1742
NM_203399chr11753 1103 ----
NM_203401chr11753 1103 ----
NM_203406chr5--22715 1169 --1246
NM_203446chr2121938 342 ----11076
NM_203459chr121771 790 1969 12526 1493
NM_203464chr14514 427 355 114 11261 ----
NM_203487chr132180 103 ------
NM_203499chr172899 285 146 2305 233 --
NM_203504chr432481 873 208 ------
NM_203505chr432481 873 208 ------
NM_203506chr171153 ------
NM_205768chr141843 1796 1777 464 --1187 1138
NM_205833chrX4692 605 580 40 ------
NM_205836chr51618 ------
NM_205848chr142561 2342 2297 802 32089 945 435 11961 --
NM_206594chr152959 2496 1360 807 410 ------
NM_206595chr152959 2496 1360 807 410 ------
NM_206814chr611440 ----11015
NM_206832chr171301 ------
NM_206854chr634218 4032 1235 ------
NM_206855chr645183 4997 2200 63 ------
NM_206866chr213859 267 110 12694 --1664
NM_206876chr253045 2672 967 835 583 11356 ----
NM_206907chr562998 2217 1247 1038 910 473 23359 2065 ----
NM_206909chr8127585 7470 7232 6469 5086 2852 2465 2320 2230 1535 844 414 37999 7983 3328 26073 1766 18413
NM_206963chr32174 66 ----1189
NM_207012chr1043547 3323 1053 95 22806 2639 ----
NM_207015chr321700 312 22021 1798 ----
NM_207032chr2011342 --1576 --
NM_207033chr2011250 --1484 --
NM_207034chr2011250 --1484 --
NM_207113chr71347 187 --11343
NM_207123chr43861 581 152 --189 --
NM_207174chr212615 200 159 ----
NM_207303chr1033762 1660 974 44137 2593 1457 1126 13754 1258
NM_207304chr133558 341 22 ------
NM_207311chr12--11270 ----
NM_207317chr51451 ------
NM_207325chr1931926 470 221 ------
NM_207396chr131364 1312 460 11863 ----
NM_207406chr455526 4681 4117 2569 1829 36396 4337 2053 35805 1450 648 46525 6101 4144 1002
NM_207422chrX11409 3335 257 82 ----
NM_207481chr221323 1236 --1996 --
NM_207627chr212615 200 159 ----
NM_207628chr212615 200 159 ----
NM_207629chr212615 200 159 ----
NM_207645chr113919 506 92 11140 ----
NM_207647chr941672 1603 736 615 ------
NM_212460chr72582 43 2697 550 ----
NM_212461chr121233 ------
NM_212467chr1562403 2335 2113 1059 888 297 --12454 21840 1806
NM_212471chr172867 393 ----12175
NM_212472chr172867 393 ----12175
NM_212551chr11226 --1241 --
NM_212554chr1031525 1245 276 159 ----
NM_212558chr93673 334 135 --12762 --
NM_213589chr274597 4515 3867 3761 975 815 718 34898 1695 376 13886 --
NM_213594chr123367 330 178 ------
NM_213648chr531787 1749 1737 ------
NM_213654chr32563 238 21501 119 ----