TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-519c-3p
miRNA Sequence: AAAGUGCAUCUUUUUAGAGGAU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr521961 1407 ------
NM_000070chr15----1502 --
NM_000081chr12225 33 --11253 11452
NM_000090chr21736 --1697 --
NM_000092chr253996 3689 1508 1019 965 14543 44351 3150 1093 711 11575
NM_000104chr232152 846 721 --22932 2058 --
NM_000109chrX1358 --32597 2375 2129 --
NM_000115chr1342085 2065 1963 252 1232 1536 --
NM_000125chr664053 3956 3772 3760 1030 385 --44224 3675 890 45 21001 328
NM_000129chr621408 33 --11449 --
NM_000165chr611384 --2627 503 --
NM_000168chr723234 561 --22661 1315 --
NM_000170chr9153 ----1518
NM_000176chr51430 22921 703 12593 --
NM_000188chr104590 293 82 38 ------
NM_000194chrX2185 164 --1142 --
NM_000210chr232040 546 491 --22024 1721 --
NM_000213chr17------1241
NM_000214chr20------11221
NM_000216chrX33118 2789 1572 --23637 828 11018
NM_000217chr1284173 3686 2092 1495 998 983 783 153 ----13271
NM_000222chr441832 1821 1655 667 ----11329
NM_000227chr181344 ------
NM_000248chr333075 2848 22 ----11088
NM_000255chr6----1106 --
NM_000259chr15115872 5300 4833 4014 2546 1283 1193 1077 626 608 412 1316 25646 5030 --
NM_000267chr1731223 980 582 --23472 102 11192
NM_000276chrX42121 1846 734 454 --3570 562 419 --
NM_000282chr131262 --1211 --
NM_000297chr442052 1973 1845 1679 --1137 --
NM_000301chr6------1218
NM_000304chr1711115 --11078 --
NM_000314chr1063156 2966 2544 2259 660 277 --1419 11155
NM_000315chr11----1271 --
NM_000321chr1321274 1258 ------
NM_000332chr696465 5551 5467 2450 2131 1390 901 682 62 11122 46930 6445 6044 4635 --
NM_000335chr312193 ------
NM_000337chr565059 2621 1670 1422 1184 493 --22592 2263 --
NM_000362chr221118 ------
NM_000376chr12--13164 12602 --
NM_000378chr11----11245 --
NM_000389chr631455 473 230 --21309 1153 --
NM_000393chr221693 644 --11426 --
NM_000396chr11234 --2531 67 --
NM_000399chr10--1771 1463 --
NM_000408chr273251 3005 2254 1329 1295 1138 1013 1827 1177 13147
NM_000430chr1763465 2797 2476 1073 906 46 13237 12875 --
NM_000441chr752009 1887 1668 411 60 ----1468
NM_000442chr1731191 1050 848 ----189
NM_000444chrX2332 59 --1113 --
NM_000461chr374296 3868 3774 3523 3173 2884 172 --23040 187 13997
NM_000462chr1531642 1336 1231 ------
NM_000474chr73632 265 188 ------
NM_000484chr212715 247 ------
NM_000489chrX1904 --21088 1013 1451
NM_000509chr4----1177 --
NM_000525chr112179 140 ------
NM_000527chr1961976 1848 1634 1512 877 859 --22168 820 --
NM_000538chr13--11238 2160 137 --
NM_000555chrX77469 7110 2677 2325 1785 1205 63 1374 36665 5650 2518 --
NM_000578chr22253 233 --11264 --
NM_000584chr4----11118 --
NM_000599chr274640 4487 3870 3825 1143 1043 666 14621 11436 14495
NM_000609chr1023155 881 --1252 23129 2195
NM_000610chr111469 13023 1682 12786
NM_000615chr1123004 64 --22887 1955 --
NM_000618chr1285916 4080 2630 2122 1587 1402 599 339 14198 31618 625 426 --
NM_000621chr1321210 202 ------
NM_000625chr17162 --1467 --
NM_000633chr1855183 1760 1724 750 66 --44864 3698 2032 495 --
NM_000668chr4----21194 309 --
NM_000686chrX1431 --1528 --
NM_000701chr1----174 --
NM_000702chr142253 2095 2015 1860 --12232 1889
NM_000706chr121209 --2600 146 --
NM_000719chr1255263 5092 2030 1544 1508 --36668 1378 1065 --
NM_000723chr1721342 400 --1305 --
NM_000739chr7----197 --
NM_000756chr8------134
NM_000794chr51660 ------
NM_000806chr52591 38 ------
NM_000807chr4----1159 --
NM_000813chr565222 4760 3602 3472 1903 1343 1640 ----
NM_000814chr1533851 3393 1588 ------
NM_000816chr5----1185 --
NM_000817chr21902 --1822 --
NM_000824chr41623 --1108 --
NM_000826chr432535 1755 1667 --32413 1886 1856 11950
NM_000828chrX41595 1442 579 516 --12063 --
NM_000829chr1132219 2064 1917 12190 1785 11513
NM_000833chr1641368 1056 482 307 ------
NM_000844chr31990 --2404 350 --
NM_000868chrX22053 348 12251 1143 11905
NM_000875chr1576496 5347 4278 2217 1816 1376 280 --36745 5663 4860 --
NM_000877chr263111 2960 2783 474 263 184 --11024 13081
NM_000885chr211514 --1850 --
NM_000891chr1743640 3246 1379 1046 --22822 492 --
NM_000899chr1254422 4011 3823 2820 1758 --24317 3012 --
NM_000901chr422006 1757 1230 ----
NM_000902chr31101 13092 11175 --
NM_000919chr51102 ------
NM_000924chr1221290 945 --21224 193 --
NM_000933chr202403 376 --1172 --
NM_000944chr421503 327 --52053 1938 1914 1477 847 --
NM_000945chr22564 198 ----1809
NM_000950chrX43334 2587 1319 64 ----23243 459
NM_000957chr1----1364 --
NM_000965chr3----11199 --
NM_001001323chr1232171 878 319 --12917 --
NM_001001330chr1031213 363 207 1946 --11274
NM_001001331chr332603 1668 335 ------
NM_001001395chr122692 564 12492 --1383
NM_001001396chr124482 3769 13787 24279 3236 --
NM_001001419chr5115045 4819 4164 4081 3687 2004 1540 1331 1189 834 537 11667 33609 853 417 --
NM_001001433chr2043115 2509 2316 716 --22488 722 --
NM_001001481chr842556 526 151 56 12484 22624 136 12436
NM_001001484chr1042399 1930 1724 316 --11632 --
NM_001001523chr1----1421 --
NM_001001549chr73915 659 402 --11786 12582
NM_001001556chr1521162 377 141 11452 --
NM_001001664chr263890 3616 1412 1244 442 303 --34108 844 143 --
NM_001001740chr1----127 --
NM_001001890chr2114127 --1532 1827
NM_001001924chr82510 37 1265 11400 --
NM_001001928chr2295765 5425 2725 2185 1974 834 625 421 176 --13004 --
NM_001001933chr11112 ------
NM_001001971chr101106 ------
NM_001001974chr101126 --12272 --
NM_001002032chr171201 --1706 --
NM_001002033chr173301 120 112 --1806 --
NM_001002233chr842042 1718 1610 822 ------
NM_001002257chr243418 1432 1395 545 --177 33063 2215 140
NM_001002258chr21203 ----1166
NM_001002259chr12------1251
NM_001002265chr101582 ------
NM_001002295chr10----164 --
NM_001002296chr81262 --11351 --
NM_001002838chrX----21853 1481 --
NM_001002857chr151307 --1292 --
NM_001002860chr1484701 4473 3463 2869 859 421 261 237 31649 1605 1458 44315 1815 392 300 --
NM_001002909chr1742129 1749 808 404 11396 ----
NM_001003398chr12----1544 --
NM_001003652chr18148339 7738 7679 6600 6255 5518 3097 2556 1902 1588 1129 807 392 118 16091 18037 --
NM_001003681chr2211415 ----12124
NM_001003688chr431166 1099 352 --150 --
NM_001003712chr1283167 2699 2663 2524 1031 862 749 299 --12501 13652
NM_001003792chr31861 --1103 --
NM_001003800chr943505 3361 2466 1170 --31474 827 485 --
NM_001003936chr9----190 --
NM_001004308chrX2221 64 --11479 --
NM_001004329chr1231309 1252 361 --21139 1003 --
NM_001004346chr411209 --1163 --
NM_001004360chr22255 150 --11498 --
NM_001004419chr1234483 3085 3078 1929 24444 3281 --
NM_001004439chr1531087 831 302 --1118 --
NM_001004720chr21269 --1947 --
NM_001005360chr191810 --1231 --
NM_001005366chr122654 41 ----2842 690
NM_001005404chr1754474 4368 3580 3208 537 --33367 3247 3042 --
NM_001005463chr1052510 2096 1991 793 413 ------
NM_001005473chr545695 4215 4200 741 11870 11556 --
NM_001005476chr2----1625 --
NM_001005743chr1421313 245 ------
NM_001005753chr25903 612 358 262 69 ----12182
NM_001005781chr21118 --1244 --
NM_001005782chr2----2693 271 --
NM_001005845chr821290 654 ------
NM_001005849chr17----1196 --
NM_001005920chr16----1771 --
NM_001006600chr552292 2285 1779 1716 872 --31747 1535 819 1695
NM_001006635chr2------1248
NM_001006636chr21371 ----1706
NM_001006684chrX155 --1434 --
NM_001007024chr1754024 3293 2944 1492 506 13211 24376 4290 14348
NM_001007097chr964882 3857 1747 1395 957 156 --25077 319 --
NM_001007102chr61335 --51647 1507 1329 1285 1223 --
NM_001007226chr1731096 298 127 1579 ----
NM_001007237chr122853 345 ----12624
NM_001007246chr2131819 1437 179 --11308 1127
NM_001007257chr121098 422 1499 11517 --
NM_001007466chr6125092 4894 4780 4726 4444 3994 1959 1087 633 577 463 328 --24711 1691 14015
NM_001007553chr11427 --1359 1271
NM_001007559chr1811301 --22043 1791 --
NM_001008220chr523679 1057 --1907 --
NM_001008222chrX21191 149 --1872 --
NM_001008225chr72686 550 --2598 590 --
NM_001008239chr1873309 2952 1263 887 716 110 28 --23562 2386 1491
NM_001008408chr766340 5050 4812 4590 4392 1621 24478 2480 --1411
NM_001008493chr121097 554 ------
NM_001008495chr832275 2194 1956 12040 1243 --
NM_001008541chr1042206 2130 889 676 ------
NM_001008564chr1342091 1908 751 544 --12145 --
NM_001008660chr1131273 1155 431 --11396 --
NM_001008701chr1922295 511 ----13014
NM_001008707chr1431859 1787 546 ------
NM_001008738chr522139 247 --12105 172
NM_001008895chr1311078 2450 220 1389 --
NM_001008925chr452556 1089 295 274 214 ----22536 549
NM_001009552chr81588 1173 ----
NM_001009554chr453359 1481 749 359 74 14278 --14537
NM_001009569chr103537 231 94 ----11290
NM_001009571chr72546 321 ----41688 1293 1230 493
NM_001009880chr2243661 3051 1957 408 --24045 1346 --
NM_001009899chr376554 6403 5076 4145 1502 913 305 34425 2614 1041 46547 5230 765 214 --
NM_001009960chr721920 87 --12834 --
NM_001009993chr274392 4334 3416 3008 1794 1332 413 12926 13754 --
NM_001010000chr1823326 3105 --13528 --
NM_001010844chr6----126 --
NM_001010888chrX54673 4526 3637 3189 293 1132 21749 97 --
NM_001010891chr556099 5611 2455 797 344 --35794 5013 187 --
NM_001010926chr11642 ----1261
NM_001010935chr11880 --1303 --
NM_001010984chr121700 485 1974 ----
NM_001011513chr484148 3835 2989 2922 1381 1173 770 559 33395 3022 195 33061 2700 1307 11643
NM_001011515chr41878 --21056 1003 --
NM_001011537chr331974 1469 820 --12304 --
NM_001011553chr7----1957 3935 807 196
NM_001011657chrX----11083 --
NM_001011666chr766322 4481 2498 1252 1057 70 26414 2601 26558 4682 --
NM_001011713chr1411089 --1156 --
NM_001011885chr1531731 735 159 ------
NM_001012337chr3----149 --
NM_001012393chr1184755 4720 4547 4221 3961 1650 1622 716 --23239 1316 14076
NM_001012398chr163421 296 182 --130 --
NM_001012418chr664201 3933 3664 2922 331 174 --11555 1409
NM_001012506chr3----1154 --
NM_001012514chr21889 --194 --
NM_001012755chrX25054 1508 --11627 14173
NM_001012761chr51270 ------
NM_001012989chrX------171
NM_001013406chr721511 123 --11119 1450
NM_001013438chr31260 ------
NM_001013622chr42413 166 --11180 --
NM_001013699chr12124 --198 2513 105
NM_001013746chr722263 1583 --22340 1670 --
NM_001013843chr152762 376 --1746 --
NM_001014446chr4----172 --
NM_001015045chr431004 490 206 1970 11825 1803
NM_001015048chr1432694 2647 676 --2580 38 --
NM_001015877chrX42978 2746 2005 1117 32543 2219 334 22826 1169 --
NM_001015887chr311354 21829 283 21839 1228 --
NM_001017369chr41916 --11091 --
NM_001017371chr21209 ----11054
NM_001017395chr353648 2949 2919 714 331 12589 13193 --
NM_001017396chr231873 785 414 1487 1298 --
NM_001017405chr41243 --1179 --
NM_001017424chr131780 174 79 ------
NM_001017523chr1221720 751 ------
NM_001017923chr141463 --11569 --
NM_001017926chr821496 527 --11147 --
NM_001017977chr1--124 ----
NM_001018009chr321052 880 --11193 --
NM_001018053chr121619 1513 1304 31898 695 369 --
NM_001018056chr91391 --1146 --
NM_001018057chr113973 574 513 11036 1152 11329
NM_001018064chr931559 1485 333 --1163 --
NM_001018067chr175172 4697 4211 2031 1698 635 259 --1301 --
NM_001018111chr713004 --13981 --
NM_001020658chr121058 202 1528 11445 --
NM_001024226chr1----1408 --
NM_001024596chr1963449 2660 1304 863 490 306 ------
NM_001024649chr532866 2857 737 1746 21865 927 --
NM_001024680chr231801 1590 1335 --21276 164 --
NM_001024808chr1222296 817 12600 --11821
NM_001024847chr362447 2366 1591 608 473 224 12430 2573 273 1918
NM_001024948chr142643 1209 954 181 1790 23351 2552 --
NM_001024948chr142643 1209 954 181 1790 23351 2552 --
NM_001025068chr31719 11484 1183 2541 247
NM_001025076chr1045778 4622 1104 262 15532 36021 2469 2382 --
NM_001025077chr1067136 5980 2462 1620 1315 856 26890 530 37379 4806 4722 14799
NM_001025079chr373912 3523 3062 2608 1549 1225 676 ------
NM_001025105chr52441 50 --21375 254 --
NM_001025266chr364511 3118 1483 867 514 469 ----13080
NM_001025356chr1253014 2786 1885 794 25 --32986 2944 2158 --
NM_001025366chr621895 182 11233 ----
NM_001025579chr171426 --1327 1994
NM_001025580chrX64170 3804 3046 2867 1264 182 --12608 --
NM_001025616chr421814 1521 ----1358
NM_001029858chr662977 2964 2554 1132 355 243 --12256 --
NM_001029860chr8----2294 259 --
NM_001029875chr522993 533 --1998 --
NM_001029884chr652613 2210 949 924 181 --22578 2153 --
NM_001029998chr42910 520 --177 --
NM_001030006chr1721807 1642 --1400 --
NM_001030007chr16103991 3971 3161 3010 2619 1471 593 472 253 227 --43654 2703 2697 1196 --
NM_001030019chr7----1151 --
NM_001030055chr1434668 4184 1131 13674 24300 1507 --
NM_001031679chr1243162 1097 919 709 ----23318 34
NM_001031684chr2----21459 1279 --
NM_001031690chr711113 --12689 --
NM_001031695chr2254392 4141 3724 1559 1183 13523 54840 3930 1190 284 234 --
NM_001031711chr51525 --21696 1523 --
NM_001031716chr2--1218 164 --
NM_001031740chr131657 1446 313 ------
NM_001031812chr522123 504 1725 32247 1604 1563 11544
NM_001032221chr961811 1802 1471 1429 190 137 ------
NM_001032280chr621656 1283 --1429 --
NM_001032282chr8----11313 --
NM_001032283chr1221019 899 ------
NM_001032363chr132248 2039 1784 --1144 --
NM_001032380chr1031355 815 220 11579 11547 1146
NM_001033025chr151501 968 355 299 43 ----11353
NM_001033044chr131733 1606 238 11491 ----
NM_001033057chr341828 1819 1378 659 --21407 141 --
NM_001033087chr20--13190 22873 147 1856
NM_001033503chr5----1362 --
NM_001033507chr12716 159 ----1530
NM_001033551chr1763575 3515 1387 843 538 478 ----13862
NM_001033557chr2173 ------
NM_001033602chr1332522 2217 339 1175 1492 --
NM_001033723chr842494 1941 1707 431 --22566 1103 --
NM_001034841chr1663787 2152 2059 1891 1745 678 --25489 1564 --
NM_001034852chr143842 749 548 --1132 --
NM_001034915chr821297 1201 21420 273 ----
NM_001034954chr1042366 2169 958 599 --12830 1829
NM_001035003chr41574 ----1411
NM_001035254chr951863 1748 1609 1600 127 --1683 --
NM_001035260chr1021401 656 1235 11309 --
NM_001037132chr741617 871 748 55 --1740 --
NM_001037164chr721555 785 --21906 1402 --
NM_001037172chr331081 305 229 --11390 --
NM_001037535chrX----11386 --
NM_001037582chr411602 --11318 --
NM_001037738chr5----1251 --
NM_001038493chr21588 --1966 --
NM_001039111chr3----1320 --
NM_001039141chr2232641 1974 1762 --2989 116 --
NM_001039199chr2064464 3710 1706 1502 1293 597 --44980 4939 3340 1698 11865
NM_001039538chr243610 3045 1477 609 --2663 290 --
NM_001039574chr11655 --1816 --
NM_001039577chr174325 4143 3884 1506 1115 625 31 11524 --13464
NM_001039577chr174325 4143 3884 1506 1115 625 31 11524 --13464
NM_001039580chr454415 3359 1033 637 167 --34444 600 489 13858
NM_001039590chrX33832 1077 354 --13962 12497
NM_001039618chr1165648 5094 4530 3911 3785 2249 --11700 --
NM_001039711chr12953 340 --1966 --
NM_001039840chrX35887 2197 200 14417 24796 504 1944
NM_001039844chr1011977 1134 1173 --
NM_001039888chr1----1320 --
NM_001039937chr1384055 3474 3432 3305 688 494 97 79 --33986 3975 2578 23687 1472
NM_001040101chr42485 435 --2330 190 --
NM_001040110chr72428 209 --1161 --
NM_001040142chr221680 1664 ------
NM_001040152chr765115 4636 4576 3869 3697 3147 14740 13367 --
NM_001040153chr132916 127 --1866 2760 170
NM_001040159chr4--11182 21485 443 --
NM_001040214chr62945 423 --32386 2324 70 --
NM_001040272chr922337 816 --11566 --
NM_001040284chr1665053 4882 4489 2319 2186 811 --35890 4411 819 --
NM_001040402chr473098 2247 915 799 411 353 103 12494 ----
NM_001040409chr2----1330 --
NM_001040429chr132774 30 ------
NM_001040450chr1532680 2341 2152 --1251 1941
NM_001040455chr1111357 --21331 359 --
NM_001040665chr754130 1508 1167 949 433 --11626 14605
NM_001040712chr963028 3021 2694 2321 2199 79 --13005 11403
NM_001040876chr431628 688 501 ----21451 371
NM_001042371chr1611766 --1206 1707
NM_001042404chr12777 632 ----11984
NM_001042413chr973985 3468 3303 3290 2874 2830 1281 --23769 621 --
NM_001042459chr31102 --1233 --
NM_001042473chr1022045 162 ------
NM_001042481chr1422625 2030 --52451 2062 743 257 166 --
NM_001042537chrX52336 752 533 201 64 12252 1908 --
NM_001042555chr1294040 3999 3785 3681 3187 1258 1220 819 614 14482 24059 971 --
NM_001042599chr267437 7142 7015 6785 6620 2147 12575 17248 11088
NM_001042601chr333104 2629 629 --2601 351 --
NM_001042604chr374724 4048 1909 382 264 148 90 --34169 3274 188 --
NM_001042616chr41166 --1432 1483
NM_001042632chr2042253 2167 1650 293 ------
NM_001042663chr141223 1060 943 486 --21043 154 --
NM_001042678chr12273 133 --1373 --
NM_001042683chr6--1158 21295 298 --
NM_001043318chr1453297 3038 3009 1321 881 --32581 1466 673 11641
NM_001044385chr253746 3302 2541 901 624 --13159 --
NM_001048183chr193756 2486 1414 948 760 538 150 136 83 --23704 1103 --
NM_001079874chr121694 774 --21900 104 --
NM_001095chr1221893 1776 ------
NM_001099678chr3115818 5301 4980 4769 4342 3897 1319 1194 1050 1006 863 14587 26104 5833 24459 2584
NM_001100108chr1118100 7705 7003 6291 6086 5656 5446 5110 3239 1952 246 --17867 16768
NM_001106chr359669 9273 8484 7455 6974 11693 37758 7327 3213 --
NM_001116chr1653083 910 661 611 514 --23022 2914 1876
NM_001146chr811554 ----1887
NM_001148chr471977 1850 1758 1535 721 305 135 --21441 1433 --
NM_001149chr1021283 1183 ------
NM_001153chr21880 --3918 200 194 --
NM_001156chr10----1425 --
NM_001167chrX105421 5397 4464 4263 2682 2477 2246 616 536 101 --26539 1757 --
NM_001174chrX22126 635 ----12054
NM_001177chr1242314 1971 1686 586 --22376 72 --
NM_001186chr2132145 769 514 --22069 1109 --
NM_001187chr211127 --1116 --
NM_001187chr211127 --1116 --
NM_001189chr431069 827 405 ------
NM_001201chr421079 90 --2858 102 --
NM_001204chr267379 6300 5948 5070 4858 1528 35542 4777 1633 22141 211 --
NM_001206chr91158 12296 2795 775 --
NM_001241chr222368 713 22359 1805 --1936
NM_001257chr16----21391 164 --
NM_001259chr7165148 5087 5047 4776 4574 4496 2275 1984 1868 1855 1824 1134 720 612 543 393 --34587 4179 1078 --
NM_001260chr133336 96 27 --1280 --
NM_001270chr52219 197 ------
NM_001271chr1553285 2453 1078 256 142 --43248 2190 1102 202 --
NM_001283chr71705 ------
NM_001290chr4----1733 --
NM_001299chr191480 ------
NM_001304chr1743704 3499 461 73 --62997 2637 2563 2335 1303 571 --
NM_001310chr1222332 799 --177 --
NM_001343chr511576 --11695 --
NM_001351chr31276 11731 1480 1430
NM_001356chrX52289 1897 1569 508 308 ----1269
NM_001364chr1163412 3016 2998 1295 1180 850 140 11021 198
NM_001386chr822339 1654 --11872 11927
NM_001389chr21----1581 --
NM_001390chr1853324 3255 3072 1239 406 --11109 --
NM_001396chr2122484 759 ------
NM_001400chr141007 927 265 196 --1418 --
NM_001401chr911372 ----21336 118
NM_001406chr1721145 529 11433 ----
NM_001419chr1921334 262 31018 944 852 13206 11178
NM_001420chr1922597 1271 --23167 2086 --
NM_001421chrX3690 353 51 --3414 404 92 --
NM_001427chr712083 --21980 393 --
NM_001431chr6------1200
NM_001432chr463936 3922 3639 1553 1277 738 --23653 125 --
NM_001438chr133402 2781 117 ----13203
NM_001447chr53890 375 234 ------
NM_001448chrX1191 --2657 269 --
NM_001451chr1631242 1204 928 ------
NM_001452chr6------1671
NM_001455chr643861 3602 3127 428 24869 198 14511 --
NM_001489chr91108 --1254 --
NM_001518chr72295 219 --1208 --
NM_001520chr161165 ----1705
NM_001527chr613072 14718 44741 1449 1347 338 24777 783
NM_001530chr142902 239 --1963 --
NM_001564chr4----1142 --
NM_001614chr17126 ----1551
NM_001616chr253406 3389 2859 759 170 --22973 439 --
NM_001620chr112769 271 ------
NM_001625chr11127 ------
NM_001635chr71736 --1263 --
NM_001656chr532037 625 153 1452 ----
NM_001663chr1422717 447 --12087 --
NM_001668chr1----2744 653 --
NM_001676chr13----1168 --
NM_001677chr1------1142
NM_001681chr12------1642
NM_001690chr33464 412 353 --12486 --
NM_001695chr843808 304 223 78 1893 14274 13848
NM_001701chr911613 --21586 1463 --
NM_001706chr321021 387 ------
NM_001718chr611027 ----11092
NM_001731chr122952 370 ----1755
NM_001743chr22461 410 ----1399
NM_001744chr5288 39 --148 --
NM_001753chr711175 ----11566
NM_001755chr164849 574 549 211 --31564 450 232 21903 1544
NM_001759chr1285058 3851 1695 1401 1330 973 882 190 --13995 --
NM_001760chr61162 --1191 --
NM_001781chr121188 --2380 284 --
NM_001792chr18----1396 --
NM_001797chr161759 ------
NM_001798chr1211053 ----1211
NM_001830chrX72600 1437 868 845 812 187 94 --11144 1487
NM_001839chr11554 --5726 653 537 304 115 --
NM_001845chr132271 228 --1896 --
NM_001854chr11353 ------
NM_001858chr631750 468 181 --13506 23868 3654
NM_001859chr963808 2653 1271 973 756 544 13185 13873 --
NM_001873chr41679 --1512 --
NM_001889chr11262 --1764 164
NM_001894chr22----11199 --
NM_001895chr20------1346
NM_001938chr111728 --31628 356 350 --
NM_001939chrX43290 2811 1030 763 --13871 --
NM_001944chr1852343 2154 2101 752 456 1106 12299 --
NM_001946chr121125 --11073 --
NM_001949chr642383 2042 1266 411 ------
NM_001955chr6164 ----1940
NM_001957chr421609 190 --22172 2125 --
NM_001964chr5----21163 1110 --
NM_001967chr32443 65 --1453 --
NM_001968chr42654 349 --2713 166 1100
NM_001977chr451639 1382 1171 411 58 1196 1227 --
NM_001981chr141787 1556 953 348 --2912 493 --
NM_001982chr1221082 828 133 1194 --
NM_001991chr172733 87 127 12212 --
NM_001993chr1141 1995 2902 736 --
NM_001995chr431328 1003 422 11041 11523 --
NM_001999chr5159 ----1981
NM_002009chr1531099 487 178 --32623 2275 734 1155
NM_002010chr13----1405 1177
NM_002015chr1362604 2159 2152 1012 472 33 --13140 13220
NM_002024chrX52014 761 661 313 236 1364 12095 --
NM_002025chrX139288 7938 7761 7623 7398 7147 3375 1880 1814 1701 1514 331 224 --39110 7036 235 --
NM_002031chr6----3650 544 162 --
NM_002039chr4----1285 --
NM_002048chr91180 --21239 970 --
NM_002063chrX31280 1100 829 ------
NM_002069chr71389 148 2665 28 --
NM_002076chr1252322 650 447 433 356 --23262 1011 --
NM_002077chr931882 1434 788 1312 21987 704 --
NM_002078chr3--1454 --1573
NM_002086chr1732244 871 667 ----12218
NM_002112chr15----1100 --
NM_002126chr1733372 710 96 --1842 --
NM_002128chr13--145 ----
NM_002129chr4----1337 --
NM_002140chr911178 --1154 --
NM_002141chr7------2621 548
NM_002146chr1711236 11275 11160 1953
NM_002163chr16----2489 295 1124
NM_002166chr21541 ----1563
NM_002182chr322190 857 12291 12202 --
NM_002192chr72554 447 ------
NM_002193chr231464 1253 1219 ------
NM_002198chr51594 ----1671
NM_002199chr41278 ------
NM_002203chr553013 2628 1078 439 290 11349 11448 --
NM_002205chr123907 192 82 --1285 --
NM_002214chr785159 4107 3845 2215 2069 1014 399 236 15677 22239 2095 --
NM_002226chr142649 324 --1897 --
NM_002227chr13897 495 319 1252 11294 --
NM_002239chr2------1255
NM_002241chr111966 --12226 --
NM_002245chr11440 ------
NM_002247chr1042112 1796 550 312 ------
NM_002264chr374853 3387 1341 941 535 470 120 1268 24962 2000 --
NM_002267chr1332346 1601 363 --22312 2226 --
NM_002268chr321293 139 ------
NM_002270chr575622 5471 2283 2032 1937 879 773 --25094 4512 11019
NM_002293chr132741 1019 756 11999 12273 --
NM_002296chr141597 1312 295 93 --31417 235 109 --
NM_002309chr2262872 2775 2283 2074 2032 944 ------
NM_002334chr1141841 1788 374 246 --11877 --
NM_002349chr2129 11397 31413 1218 1036 --
NM_002351chrX21470 1393 11419 2100 24 --
NM_002355chr1231001 905 259 ------
NM_002375chr322205 254 --22239 1422 --
NM_002380chr82810 390 ------
NM_002397chr562240 1984 736 206 144 87 ------
NM_002401chr1732045 858 827 --11523 --
NM_002408chr141540 ----1284
NM_002429chr1231496 1021 530 --1207 --
NM_002442chr12----11505 --
NM_002444chrX41792 1630 1402 285 1129 11952 --
NM_002480chr1211207 ------
NM_002487chr15----1592 --
NM_002499chr1532042 631 98 1371 2865 300 11937
NM_002500chr241234 936 905 404 ------
NM_002501chr1913953 --24090 2878 11114
NM_002505chr611260 2416 301 ----
NM_002515chr14165 --171 --
NM_002516chr19----1310 --
NM_002519chr1151513 1320 1228 1022 113 --1103 --
NM_002522chr1763878 2740 2646 1442 901 489 --11406 --
NM_002546chr83666 576 75 ------
NM_002547chrX63880 3341 1680 1653 1558 1117 --1128 --
NM_002572chr11296 90 ------
NM_002576chr11----1449 --
NM_002577chr321605 689 12915 1291 --
NM_002595chr121297 --21613 437 --
NM_002605chr15--1374 1848 --
NM_002609chr541690 1465 680 446 --11875 --
NM_002613chr1654607 4498 4362 3697 134 --33917 3714 1347 --
NM_002616chr171539 ------
NM_002627chr10178 ------
NM_002628chr33911 478 355 1365 11150 11198
NM_002641chrX91861 1414 1378 1270 1259 776 757 625 336 ----1198
NM_002645chr1193132 2718 2477 2433 2150 2019 740 646 327 --1155 --
NM_002655chr864939 3632 1940 1591 1273 682 --14625 35032 4973 4247
NM_002657chr2043747 3090 2734 143 --1863 --
NM_002670chr321601 396 ------
NM_002687chr1411100 11138 1162 --
NM_002702chr122682 32 ------
NM_002717chr81224 ------
NM_002721chr9194 ------
NM_002725chr163597 3564 3043 1606 1391 37 ------
NM_002731chr143107 1114 791 44 ------
NM_002734chr1721480 1414 --11729 11833
NM_002737chr1736593 6368 1854 --26120 5434 --
NM_002745chr2294556 3823 3587 3334 1824 1792 1270 590 450 1788 31624 480 248 --
NM_002747chr18--1685 ----
NM_002748chr151256 1832 ----
NM_002752chr51366 ------
NM_002755chr151317 --199 --
NM_002790chr1----1108 --
NM_002806chr142300 253 ------
NM_002822chr1221457 126 --41832 1693 1385 109 --
NM_002825chr71601 ----164
NM_002828chr182931 32 --2687 359 --
NM_002829chr931104 503 133 --11136 --
NM_002830chr2188 --1146 --
NM_002833chr151403 ----1532
NM_002841chr32226 175 123 ----
NM_002843chr1153479 2165 1018 577 213 ----13154
NM_002848chr123937 865 282 ------
NM_002849chr121282 --1187 --
NM_002855chr1133709 3569 2426 --23728 3060 --
NM_002865chr8----1211 --
NM_002868chr1222396 150 --2969 906 --
NM_002869chr1111816 1695 22082 304 --
NM_002871chr131561 511 392 12010 --11866
NM_002874chr972486 2319 1957 1603 838 309 40 11524 ----
NM_002892chr141483 1281 21651 393 --
NM_002893chrX1138 ------
NM_002895chr202961 31 ------
NM_002906chr1112064 1105 ----
NM_002912chr63903 801 346 --1158 --
NM_002941chr31348 --1323 --
NM_002946chr1----2577 464 --
NM_002956chr122512 362 --2452 384 --
NM_002959chr144403 3739 1752 188 --33820 3790 410 --
NM_002968chr161403 --11005 --
NM_002971chr31166 ------
NM_002998chr831706 1698 116 ----1876
NM_003011chr91568 1447 ----
NM_003012chr832386 1093 1018 --23084 2750 --
NM_003016chr1741596 553 457 417 11948 21768 272 --
NM_003017chr61474 --1105 --
NM_003026chr9----1379 --
NM_003030chr31610 --11543 --
NM_003036chr1----1976 --
NM_003042chr32451 330 --12186 --
NM_003048chr242712 2623 1129 1097 --12785 12705
NM_003051chr111943 --31255 752 638 11446
NM_003060chr511031 --1903 --
NM_003068chr8180 --137 1792
NM_003069chrX1744 ------
NM_003070chr9------1759
NM_003075chr12----1334 --
NM_003081chr201281 ------
NM_003105chr11----184 --
NM_003107chr612181 --12104 --
NM_003108chr256965 2069 1501 1288 1032 --26609 5720 14542
NM_003110chr1711061 1791 1310 --
NM_003112chr752744 2225 2152 367 194 --137 --
NM_003128chr232641 2073 142 1803 22234 905 --
NM_003136chr141116 1298 1336 --
NM_003137chr62822 64 --1836 --
NM_003149chr31613 ----11170
NM_003150chr1762285 1488 841 628 163 53 --22304 453 --
NM_003155chr842578 1976 759 76 --12548 --
NM_003173chrX2885 498 ----1218
NM_003174chr10----1742 2623 254
NM_003178chr322181 1633 --21724 893 --
NM_003185chr2021078 326 --1338 --
NM_003188chr61234 --1137 --
NM_003189chr173229 3212 3187 3123 2237 920 224 --23261 1028 --
NM_003204chr17----21182 612 --
NM_003221chr623091 1479 --43689 3421 1500 1131 21615 1326
NM_003222chr20----1917 --
NM_003223chr161301 --1860 --
NM_003234chr3--12230 22288 179 --
NM_003246chr151363 1617 ----
NM_003247chr6--11321 21669 1606 11976
NM_003253chr2121390 1240 11736 11665 --
NM_003255chr1722001 485 1330 21966 375 --
NM_003257chr151123 --2918 334 11188
NM_003262chr354976 3974 3697 664 86 13338 21993 271 14820
NM_003269chr631303 1228 226 1447 11175 --
NM_003272chr12650 82 --1244 --
NM_003295chr13------1203
NM_003298chr396122 5838 5591 4618 1845 1344 971 952 420 26048 432 46173 4869 3974 1301 11454
NM_003304chr321213 1023 1450 21479 1373 --
NM_003305chr41285 --1175 --
NM_003314chr51439 --1174 --
NM_003337chr551580 1485 1366 1060 695 1367 2303 171 --
NM_003339chr531380 1342 1087 --41174 994 531 188 --
NM_003341chr3----1667 --
NM_003348chr1231718 1198 431 ----171
NM_003350chr81999 --1862 --
NM_003358chr91145 ------
NM_003367chr19----1152 --
NM_003369chr113872 447 380 1943 --166
NM_003372chrX----1939 --
NM_003373chr10--11396 21981 653 --
NM_003379chr621087 804 ------
NM_003390chr112711 290 --11092 --
NM_003392chr333257 3206 1320 --34349 1354 547 11369
NM_003406chr841818 1305 415 272 1433 11536 --
NM_003409chr182442 112 --11100 --
NM_003410chrX22737 1011 --22986 785 --
NM_003413chrX2216 207 ------
NM_003418chr3----1713 1169
NM_003439chr753577 2901 2487 2276 784 23224 2589 1766 11325
NM_003442chr11----1844 --
NM_003455chr1111480 --1562 --
NM_003458chr383989 3746 3588 3269 3118 2507 1182 366 --12490 --
NM_003463chr632618 2120 723 12865 11340 11276
NM_003468chr244359 3255 3177 1752 --1284 --
NM_003472chr6----1183 1315
NM_003478chr1142918 1103 398 234 --1365 --
NM_003483chr122754 378 1851 12846 --
NM_003489chr2143478 973 954 354 --23013 332 --
NM_003506chr861244 1189 484 315 112 62 ----1102
NM_003507chr21633 --11555 --
NM_003566chr121532 13407 12872 161
NM_003574chr1865432 4037 2274 2261 1369 700 15443 13839 23546 1221
NM_003580chr8----149 --
NM_003583chr1243706 3204 3184 1268 53272 2453 1573 313 130 12853 1838
NM_003590chr283587 3085 2673 1575 992 758 392 38 ----23837 563
NM_003592chr72343 325 ------
NM_003597chr21772 11443 12152 --
NM_003603chr4--11682 3678 525 438 --
NM_003607chr133379 3057 1408 --23891 3822 1245
NM_003613chr152654 94 --1268 --
NM_003615chr3--13012 22647 2484 --
NM_003618chr2----1301 --
NM_003620chr1711103 --1155 --
NM_003622chr12----1972 1266
NM_003626chr1141395 470 330 51 ----1387
NM_003629chr12207 36 ------
NM_003633chr552190 1865 1770 1723 352 --12515 --
NM_003656chr3----1134 --
NM_003658chr111168 ------
NM_003679chr1----42972 2453 408 177 --
NM_003705chr21715 ----1278
NM_003716chr32329 318 --1902 --
NM_003718chr7----1512 --
NM_003722chr322671 2215 ----22014 430
NM_003768chr131149 654 507 --1364 --
NM_003772chr111332 ------
NM_003774chr1262992 2201 801 768 660 575 22494 1076 1781 12288
NM_003783chr12908 803 --11209 --
NM_003787chr1841307 1237 1197 193 --11449 --
NM_003795chr6----1626 --
NM_003796chr192559 442 ------
NM_003800chr63628 535 173 --12018 --
NM_003850chr13------1153
NM_003884chr331838 1704 125 ------
NM_003885chr1752700 2677 2207 2027 166 --141 --
NM_003887chr232043 343 320 --31436 700 546 21672 210
NM_003895chr2141526 1489 104 29 1256 1499 11496
NM_003902chr12700 652 --1295 --
NM_003916chrX2413 35 11104 11435 --
NM_003921chr121587 246 --31493 346 203 --
NM_003922chr15----1283 --
NM_003934chr911139 --21102 507 --
NM_003939chr1063950 3626 3208 3139 1369 1164 --21092 1049 --
NM_003941chr752526 2264 1018 994 914 --1927 12348
NM_003947chr311310 --21272 301 --
NM_003948chr452652 2637 2025 1040 406 --2129 40 --
NM_003953chr122729 121 1421 1261 --
NM_003954chr1731039 1019 1013 ------
NM_003956chr10----1151 --
NM_003958chr673943 2873 2608 2567 757 235 22 11409 23067 2674 --
NM_003966chr5107598 7420 7358 5710 5406 5349 3007 2474 1282 385 26717 1370 36677 4800 116 17794
NM_003980chr61277 --11100 --
NM_003998chr4----1594 --
NM_004050chr1421924 769 --1777 --
NM_004060chr5----1471 --
NM_004061chr5----1238 --
NM_004064chr121247 --11177 --
NM_004074chr11----173 --
NM_004079chr192448 2415 2190 1089 513 387 176 117 44 ------
NM_004093chr1342991 2388 2112 830 11170 1412 --
NM_004094chr1472995 2925 1967 638 460 208 46 11909 23001 805 --
NM_004097chr2----1301 --
NM_004098chr102888 357 --1505 --
NM_004114chrX31125 495 217 ------
NM_004117chr61867 --32207 1437 498 --
NM_004124chr1453574 2719 970 249 90 --11389 12880
NM_004161chr231332 96 81 ----1605
NM_004170chr92610 163 --21395 758 11439
NM_004171chr1138304 2013 1930 --18063 --
NM_004226chr2----1108 --
NM_004227chr752701 2290 800 647 296 12818 ----
NM_004229chrX42082 2037 1934 1887 --21871 149 --
NM_004232chr1843757 2880 861 331 --22847 28 --
NM_004236chr15----1459 1168
NM_004239chr14132 ------
NM_004261chr1----2817 220 --
NM_004267chr3----1169 --
NM_004272chr521447 487 --11259 --
NM_004277chr671637 1457 1390 1223 363 243 140 --1574 --
NM_004279chr72329 321 ------
NM_004281chr10----168 --
NM_004293chr922353 170 --32972 781 592 1577
NM_004302chr1252797 2291 2101 472 331 21797 648 ----
NM_004308chr1121853 528 --11926 --
NM_004316chr121258 --1934 --
NM_004321chr233539 3237 3004 --13551 --
NM_004330chr153970 170 63 11150 1283 176
NM_004331chr862634 2610 2017 1706 1032 175 ------
NM_004342chr71536 --21941 415 --
NM_004354chr43823 227 212 ----1739
NM_004360chr1611511 --12008 --
NM_004370chr622196 734 --1222 --
NM_004379chr251757 1545 1198 640 161 ------
NM_004386chr191354 --22288 592 --
NM_004396chr171198 ------
NM_004397chr1193410 3383 1708 1676 1233 1158 903 234 207 --33696 1486 390 --
NM_004418chr21595 ------
NM_004419chr101800 --1238 --
NM_004420chr1111795 --1348 --
NM_004431chr1--1230 1589 --
NM_004432chr932047 1781 243 12278 12413 12070
NM_004437chr11838 --23203 939 --
NM_004438chr272813 2487 1289 1183 1084 1072 235 --33308 75 56 --
NM_004439chr4----143 --
NM_004440chr621653 781 --11429 --
NM_004441chr3183 --1117 --
NM_004449chr2121083 35 --21402 1396 11202
NM_004457chr2----2531 235 --
NM_004458chrX22659 1857 --32569 2200 1040 --
NM_004464chr443694 3433 447 191 11279 1583 21517 1496
NM_004472chr51638 --1469 1583
NM_004481chr111759 --22594 559 --
NM_004482chr21707 1649 1123 --
NM_004491chr1953905 2899 1235 1089 57 --34306 1521 1130 --
NM_004499chr5----1423 --
NM_004501chr164142 3769 3380 674 465 452 --1735 --
NM_004504chr252995 2387 1023 129 68 22256 814 ----
NM_004505chr1741912 1852 1474 1421 ------
NM_004566chr101946 --1813 --
NM_004571chr2143234 2615 2493 2463 13304 33095 873 103 --
NM_004575chr411313 --11142 1528
NM_004580chr1521824 1212 11168 31734 1546 1176 --
NM_004586chrX74449 3347 1790 1728 1516 841 492 1395 25040 874 25030 3604
NM_004593chr3----1172 --
NM_004598chr51825 --33322 479 64 --
NM_004612chr983507 3358 1774 1404 993 636 464 199 --24039 930 --
NM_004622chr242447 1759 1543 313 --1109 --
NM_004637chr321281 1258 ------
NM_004642chr121492 --1192 --
NM_004660chrY31828 638 511 --11423 1267
NM_004661chr52309 211 ------
NM_004663chr151599 11265 --11135
NM_004687chr1751768 1496 1318 773 525 11287 21835 1594 11525
NM_004690chr6--2267 258 --2661 602
NM_004709chrX21705 1216 1313 11140 --
NM_004725chr103952 343 209 ------
NM_004730chr582117 2023 1619 1437 685 672 643 575 --21417 445 --
NM_004731chr1231529 1422 1248 ------
NM_004734chr1342625 2344 816 424 ------
NM_004736chr152244 2106 1740 1502 489 --12154 --
NM_004737chr221202 ----11320
NM_004742chr341743 1341 1182 246 ----11602
NM_004745chr845463 2071 1963 1547 --11572 11508
NM_004748chr1531583 1348 23 14209 23460 526 --
NM_004755chr1441138 1003 810 797 --1753 11219
NM_004768chr11394 --1906 --
NM_004770chr8----1192 --
NM_004772chr551546 1499 1394 1341 465 11477 11347 --
NM_004774chr1732389 2071 1066 12916 22319 438 --
NM_004775chr181918 --11997 --
NM_004779chr51120 --11220 166
NM_004781chr131701 550 164 ----11736
NM_004787chr4----1155 --
NM_004798chr2083388 2975 2665 2483 2281 971 525 37 ------
NM_004799chr11424 --170 --
NM_004800chr131192 --1263 --
NM_004801chr221101 415 --1530 --
NM_004805chr211077 --11220 --
NM_004808chr1053150 2701 957 749 564 --32939 631 388 --
NM_004815chr113214 13093 3927 853 607 23409 663
NM_004821chr5----1555 --
NM_004831chr194870 163 98 26 --1434 --
NM_004834chr233293 1368 984 --2913 801 --
NM_004836chr21792 --1609 --
NM_004842chr631548 1347 364 --11773 --
NM_004845chrX63899 3399 1134 1067 1043 294 24061 3733 22542 693 --
NM_004849chr621155 653 --11108 --
NM_004850chr221753 1543 11275 21170 583 --
NM_004852chr181214213 14147 13333 10536 10234 9649 9605 4573 4348 2852 979 758 28965 2861 413363 8924 2604 1401 19958
NM_004856chr15----1462 --
NM_004857chr1464790 3498 1431 879 668 69 1311 21833 539 14102
NM_004859chr1741198 1072 1057 312 --12322 22288 409
NM_004867chrX------1104
NM_004869chr1821447 640 1331 21543 153 --
NM_004884chr154656 619 532 113 ------
NM_004887chr521068 164 ------
NM_004898chr421074 918 22891 2074 ----
NM_004902chr20----1622 --
NM_004906chr61669 --1556 --
NM_004921chr172378 2292 2248 969 424 364 147 166 22238 215 --
NM_004938chr921269 1159 --11002 --
NM_004946chr5----1422 --
NM_004956chr764236 1753 1194 932 437 145 --41517 562 175 35 11046
NM_004958chr11339 --149 --
NM_004961chrX11095 --1375 --
NM_004965chr212762 620 ------
NM_004973chr641737 1440 97 69 --11596 1178
NM_004982chr121146 --1485 --
NM_004984chr122173 130 --132 --
NM_004985chr1264508 4375 3895 3248 1085 78 --14198 --
NM_004992chrX67832 5764 2933 2288 1534 982 --58202 6196 3306 1121 247 --
NM_004998chr153827 807 245 1872 --1707
NM_005028chr1032218 1538 681 --21472 268 --
NM_005055chr11----1176 --
NM_005065chr1484369 4001 1830 1505 1381 1100 912 738 --34669 941 66 --
NM_005066chr1----2761 75 --
NM_005086chr121156 ------
NM_005095chr1--11520 11566 --
NM_005097chr10----1291 --
NM_005121chr1753113 2506 1137 908 803 --11405 12834
NM_005124chr62344 21 --2687 70 --
NM_005126chr322259 1645 1226 12174 --
NM_005128chr212168 41 --1506 --
NM_005156chr985407 4866 4719 4153 3781 3732 1868 1135 --24726 368 --
NM_005157chr94767 591 518 468 --21903 1556 --
NM_005168chr241481 1353 1232 1171 21266 466 21680 326 --
NM_005171chr1221270 1171 --1360 --
NM_005188chr1111296 13024 37224 2085 214 --
NM_005202chr111488 --22237 2092 --
NM_005204chr101799 --1291 --
NM_005206chr1721219 1102 ------
NM_005215chr18----1237 --
NM_005225chr201317 --2985 392 --
NM_005230chr121155 1399 1118 --
NM_005243chr22126 --1126 --
NM_005249chr14148 ----1742
NM_005254chr1521331 898 ------
NM_005259chr211472 1174 --21422 949
NM_005277chr441559 1391 349 37 1162 31952 1433 634 11962
NM_005284chr62355 176 ------
NM_005296chrX1268 --1885 --
NM_005302chr7----1417 --
NM_005316chr111385 --2859 154 --
NM_005324chr17--1677 31975 644 101 2514 108
NM_005328chr81503 --1242 --
NM_005329chr1632230 2049 1850 11985 --12359
NM_005334chrX2237 99 --1703 --
NM_005339chr433577 3019 504 --21028 458 --
NM_005342chrX42816 2106 509 324 1306 1281 1764
NM_005358chr13--11322 31722 708 411 1733
NM_005359chr1856223 5173 4520 4359 1851 --21362 1038 --
NM_005370chr19------11293
NM_005374chr171169 --22358 1687 --
NM_005375chr61757 --3984 898 846 21151 146
NM_005378chr22864 567 ------
NM_005385chr352589 2323 2100 1763 662 ------
NM_005386chr203801 782 123 --1567 --
NM_005399chr144165 3884 3572 3440 --3986 153 52 --
NM_005400chr243044 2826 1203 140 11030 ----
NM_005402chr7------11680
NM_005414chr3----2303 209 --
NM_005433chr1832300 851 757 --1964 1466
NM_005435chr72567 207 ------
NM_005436chr1073791 3653 3532 3255 2520 874 107 --11239 --
NM_005458chr922341 2154 --1895 --
NM_005461chr2061624 1464 1373 1354 1289 633 --11699 --
NM_005465chr131997 1845 567 ------
NM_005494chr71658 --1240 --
NM_005502chr943117 3084 2709 125 --22097 1037 --
NM_005504chr1266214 2452 2269 1752 1184 580 11776 55955 5882 600 296 71 16071
NM_005506chr4----1689 11795
NM_005517chr1----31186 1050 30 --
NM_005521chr10------1794
NM_005537chr131212 --1703 --
NM_005544chr21235 --1357 --
NM_005552chr141491 1432 --1237
NM_005574chr112545 83 ------
NM_005584chr131581 --1764 --
NM_005587chr151272 1191 125 --
NM_005595chr1------1658
NM_005596chr996270 6044 5297 5085 4603 4319 2016 1624 1187 21081 257 14928 11577
NM_005598chr1----21288 1155 --
NM_005599chr121557 1126 --11021 --
NM_005602chr321210 139 --11294 --
NM_005604chr621830 527 ------
NM_005605chr8------1113
NM_005611chr161469 11341 ----
NM_005618chr62527 226 ------
NM_005632chr162962 58 ------
NM_005639chr1251673 1562 452 126 103 --21206 26 --
NM_005644chr1----1373 --
NM_005647chrX83370 3313 3248 2725 2349 903 801 112 --13102 --
NM_005668chr554110 1742 1325 1300 278 --33266 1755 30 11544
NM_005669chr531649 345 185 11613 1320 --
NM_005708chr13----132 --
NM_005715chr682465 2347 2323 1947 1054 717 586 101 --12525 --
NM_005721chr2----11080 --
NM_005737chr242289 1013 1006 531 --1463 1905
NM_005746chr732731 2239 740 12357 --2975 179
NM_005748chr1253049 2708 2350 796 494 22635 1228 11159 --
NM_005751chr7----1344 --
NM_005759chr294782 4095 3596 2926 1806 1761 728 568 556 23947 1695 14604 --
NM_005766chr13----1401 --
NM_005776chr141307 --1271 1684
NM_005786chr1861187 1133 847 468 56 36 --1414 --
NM_005789chr1721707 1649 --21454 330 --
NM_005802chr9--1809 1204 --
NM_005819chr183449 3411 3339 2289 724 483 209 119 --11369 --
NM_005841chr421101 781 ------
NM_005859chr511425 --21063 978 --
NM_005862chr311042 --2810 784 11027
NM_005871chr101863 1260 3944 316 157 --
NM_005880chr1621129 223 ------
NM_005898chr1143002 2150 1250 686 --1469 21257 742
NM_005904chr18----11371 --
NM_005906chr62493 126 --1176 --
NM_005909chr554078 3774 821 309 272 --23912 520 1982
NM_005911chr22388 334 ------
NM_005916chr7------1117
NM_005923chr62604 274 --1103 --
NM_005924chr74439 375 286 125 ----1780
NM_005933chr1132693 2588 2492 --12565 --
NM_005935chr434467 4325 1304 ----13682
NM_005937chr1754154 2619 1422 700 366 ------
NM_005955chr195352 4690 4646 3839 3585 2170 1611 366 248 13718 35469 1582 927 --
NM_005963chr17------174
NM_005966chr221601 1539 --12397 --
NM_005969chr11----1269 --
NM_005977chr1321014 280 1374 ----
NM_005986chr1341874 652 608 439 1473 ----
NM_005996chr122488 238 --154 --
NM_006011chr1544142 1153 1146 956 14168 14205 --
NM_006016chr611474 ----11544
NM_006017chr41813 --2424 328 --
NM_006033chr1842074 509 336 180 ----11613
NM_006037chr223955 3174 --23883 1427 11224
NM_006040chr1611290 --1466 --
NM_006047chr2012993 --12631 --
NM_006054chr1141363 1158 108 70 ------
NM_006076chr72590 86 --1991 --
NM_006080chr722832 2057 --42922 2214 1037 479 --
NM_006084chr141310 ------
NM_006089chrX143 1234 11732 --
NM_006094chr821967 1867 --32413 952 691 --
NM_006106chr1122602 1029 23400 389 1701 11041
NM_006108chr112248 29 --22350 1484 --
NM_006121chr12----1450 --
NM_006133chr1112340 ----12379
NM_006134chr2141301 1112 570 361 --21370 1154 --
NM_006135chr12410 401 --11370 --
NM_006136chr71513 ------
NM_006141chr1662515 1980 995 640 568 533 --12498 --
NM_006148chr1712060 --12667 --
NM_006154chr1552588 2008 995 893 138 --32722 2264 430 1194
NM_006157chr111350 ------
NM_006158chr8----11355 --
NM_006159chr12------1580
NM_006160chr1711619 ------
NM_006161chr53661 566 476 --1246 --
NM_006162chr1811541 --1630 --
NM_006164chr22396 43 --1361 --
NM_006166chr1262277 2068 1939 1772 499 272 ----12569
NM_006178chr1721274 292 ----1225
NM_006186chr221069 218 ------
NM_006195chr931204 211 47 --11046 --
NM_006206chr432043 902 542 --42762 2383 2272 445 --
NM_006216chr22648 206 --1664 --
NM_006218chr3148 ------
NM_006226chr221180 334 1405 ----
NM_006237chr1321498 51 --21862 115 --
NM_006251chr532781 2074 2059 --12485 --
NM_006252chr177477 7244 7171 6007 4895 4690 31 --46042 5462 2558 825 15374
NM_006255chr142750 694 --11135 --
NM_006256chr152477 2248 2206 1991 782 21074 718 32727 1088 188 --
NM_006267chr22446 231 11741 1218 --
NM_006283chr844634 1464 1267 1089 --54117 3667 1921 1199 35 11678
NM_006284chr11------123
NM_006292chr11----1173 --
NM_006298chr682724 2316 2261 2117 1243 1200 628 77 12957 1540 --
NM_006307chrX------1142
NM_006313chr1241084 510 424 155 11477 21670 1499 --
NM_006327chr101370 ------
NM_006334chr91289 --2220 97 --
NM_006335chr14863 784 732 137 11035 2434 213 --
NM_006336chr921273 1144 --11511 --
NM_006345chr41888 11051 1312 --
NM_006352chr142044 1477 839 313 11721 1133 11509
NM_006353chr61946 ----129
NM_006361chr172519 341 ------
NM_006364chr141846 1466 11167 1489
NM_006379chr7--2739 489 1157 --
NM_006380chr1783658 2856 1722 1619 693 643 356 98 --24375 3398 11687
NM_006389chr11----11356 --
NM_006390chr1251842 1732 605 404 140 --31141 480 40 --
NM_006403chr611369 --2370 309 --
NM_006413chr101447 --1218 11027
NM_006415chr91983 ----1269
NM_006416chr6146 --1702 --
NM_006420chr2042698 2199 1123 937 --22976 2118 13312
NM_006460chr17----2448 277 --
NM_006464chr263299 3254 1496 441 434 369 --1234 --
NM_006467chr54484 415 232 95 ------
NM_006469chr121117 346 --1208 --
NM_006471chr18----195 --
NM_006472chr131198 1171 801 --1515 --
NM_006486chr221511 --174 --
NM_006496chr121540 294 --11531 --
NM_006519chr61108 ------
NM_006526chr2041388 816 672 124 --21949 1654 --
NM_006530chr121152 --1350 --
NM_006534chr2052587 1301 1263 924 53 --1719 --
NM_006537chr15----2623 95 --
NM_006538chr264099 4062 3351 1034 884 638 --23579 1171 --
NM_006540chr821336 241 ----1995
NM_006546chr1756066 1186 693 529 247 --24055 1463 --
NM_006547chr722053 1996 --2551 272 11914
NM_006549chr1212227 --42858 2395 424 261 --
NM_006557chr911737 --21655 298 --
NM_006565chr1621178 793 --11162 11170
NM_006570chr9------1375
NM_006574chr3----1295 --
NM_006575chr14184 --1132 11210
NM_006578chr1531168 399 371 ------
NM_006595chr1111283 --11313 --
NM_006597chr11----1175 --
NM_006599chr1697753 7060 7043 6772 6578 5377 2856 2005 398 --25818 5489 --
NM_006602chr201271 --1339 --
NM_006609chr261896 1884 1873 1159 270 243 --170 --
NM_006618chr1----11605 --
NM_006621chr111351 11707 ----
NM_006624chr1022088 2079 --1250 --
NM_006626chr932335 2132 74 ------
NM_006628chr1564533 4504 3912 1144 688 185 --13607 --
NM_006651chr4------11023
NM_006662chr16----1264 --
NM_006667chrX1109 ------
NM_006675chr1253347 2280 2232 274 81 --23335 2403 --
NM_006677chr3------1251
NM_006690chr2032310 1764 142 ------
NM_006700chr122583 54 --1805 --
NM_006710chr21707 --1921 --
NM_006711chr162768 574 --1791 --
NM_006717chr973141 2952 2857 2795 2405 2112 177 --12415 13312
NM_006729chrX65155 4659 1319 657 635 76 --44119 146 105 54 --
NM_006732chr1932138 1637 508 --22050 1380 --
NM_006734chr671441 1167 1076 638 413 279 219 ----1632
NM_006738chr1523483 1235 --12949 --
NM_006741chr121138 ------
NM_006750chr1646946 6690 5980 5768 --12572 --
NM_006751chr2182 1901 ----
NM_006765chr8--2238 28 ----
NM_006765chr8--2238 28 ----
NM_006775chr672912 991 903 761 443 236 122 --13015 --
NM_006777chrX52685 1871 1859 494 371 ------
NM_006791chr152585 491 ------
NM_006793chr10----2769 690 --
NM_006805chr5------1633
NM_006806chr21----1172 --
NM_006807chr17----2382 241 --
NM_006823chr821215 114 --21170 68 --
NM_006826chr231152 837 514 --11204 --
NM_006827chr142751 295 ------
NM_006832chr143948 675 150 --21073 710 --
NM_006861chr122147 30 ------
NM_006874chr421068 862 --1394 --
NM_006885chr1633357 871 391 --23724 1446 11310
NM_006888chr1453094 2781 2685 632 239 --43404 2927 1101 555 --
NM_006892chr20----11155 --
NM_006902chr143325 3192 2930 432 --12214 --
NM_006910chr16------1116
NM_006912chr141698 1656 346 255 --22534 962 --
NM_006914chr92532 331 ----1119
NM_006920chr231742 1540 1291 --1362 1581
NM_006940chr1221481 730 ------
NM_006948chr2132393 1712 593 --1775 1309
NM_006951chr10----2779 265 --
NM_006955chr1082783 2592 2540 2320 2178 767 702 651 1302 23422 2280 --
NM_006981chr922257 289 ------
NM_006988chr21--1356 11099 --
NM_006991chr331005 386 175 --1721 --
NM_006996chr131818 1596 683 --21860 104 11190
NM_006997chr101110 --1399 --
NM_006999chr511791 --31881 607 296 --
NM_007005chr941536 1517 350 45 ------
NM_007011chr1575946 5626 5416 1951 1454 615 215 14324 11477 --
NM_007013chr81951 --1790 136
NM_007019chr20----1172 --
NM_007034chr1----21025 870 1723
NM_007038chr2186050 5946 5447 4619 4426 1296 1268 171 --25614 1036 --
NM_007039chr143855 264 63 1537 ----
NM_007040chr191184 ----11032
NM_007045chr6----1116 --
NM_007050chr2047589 2293 1610 1343 --37801 5043 2388 --
NM_007073chr642852 1541 1484 68 ------
NM_007084chr1331193 574 233 --1294 --
NM_007085chr311841 --11652 12607
NM_007106chr133688 563 363 ------
NM_007114chr352211 2090 2028 1232 980 23015 43 11139 --
NM_007125chrY1434 --1192 --
NM_007146chr1742393 862 486 135 --2521 505 --
NM_007170chr1----1270 --
NM_007174chr1211951 --22144 243 --
NM_007185chr1----21001 333 --
NM_007197chr12------1180
NM_007198chr821276 33 --11521 --
NM_007212chr121735 67 12107 22289 868 --
NM_007216chr1171203 1164 1021 998 218 210 76 --1957 --
NM_007217chr3----127 --
NM_007220chrX54660 4649 1094 884 554 --43158 771 116 92 --
NM_007231chrX22080 884 --2573 286 --
NM_007246chr4183 --1103 --
NM_007249chr13119387 9267 8375 7617 6931 5949 3473 2692 2185 1446 1105 18243 59343 7018 3761 3694 2553 18991
NM_007271chr611339 --1589 --
NM_007275chr32475 371 ------
NM_007285chr16----1109 1325
NM_007286chr522120 1325 --11938 --
NM_007331chr462606 2287 1746 956 190 168 --1479 12613
NM_007345chr18165 --21769 503 --
NM_007349chr7----3450 377 77 --
NM_007350chr1244201 934 491 281 11528 34638 2992 865 --
NM_007361chr14----2556 514 --
NM_007363chrX31000 223 123 --1981 --
NM_007373chr1021314 117 --11149 --
NM_007375chr172785 2460 2116 1077 979 574 90 12730 32452 2159 1725 --
NM_012064chr121181 --1103 --
NM_012069chrX32137 1762 549 ------
NM_012074chr1431075 1051 263 ------
NM_012081chr553480 3451 3294 3096 937 --22963 167 --
NM_012082chr84657 385 362 316 ------
NM_012095chr1073242 3031 2179 1280 1041 817 106 --1601 --
NM_012104chr1123025 3005 ------
NM_012120chr622955 703 --1884 12558
NM_012129chr722505 1689 --12511 --
NM_012137chr132963 2891 2216 --12787 --
NM_012158chr1331235 742 448 11817 --1358
NM_012160chr61193 1341 ----
NM_012161chr4----31104 1088 60 --
NM_012164chr966958 6381 6043 4923 2722 1908 16104 56813 6237 5351 5330 268 1237
NM_012166chr911038 --21523 1373 --
NM_012193chr11135380 4930 4463 3600 1812 1112 997 898 778 639 564 533 53 --24562 1528 --
NM_012197chr921382 516 ------
NM_012199chr174294 3993 3735 3234 1497 1487 1129 1721 44513 4503 1003 921 14383
NM_012215chr1031705 1507 764 --31605 621 600 --
NM_012218chr1932976 1908 1201 ----137
NM_012233chr23907 836 354 ------
NM_012234chr332652 2283 454 11355 32338 2316 767 --
NM_012238chr101518 11302 2694 178 --
NM_012242chr102764 273 1224 ----
NM_012249chr21694 ----1652
NM_012255chr201105 --1429 --
NM_012257chr7----1859 1837
NM_012259chr611400 --21286 1085 --
NM_012261chr20168 ------
NM_012262chr163551 3442 1800 1372 345 193 25191 1233 55038 4693 3198 879 458 25089 938
NM_012281chr732411 950 176 12002 1797 1580
NM_012286chrX1573 ------
NM_012293chr211622 --12268 --
NM_012294chr753742 3005 2735 899 37 11011 21422 920 --
NM_012297chr482647 1988 1879 1803 586 476 462 55 --11714 --
NM_012300chr522402 1719 1860 1375 --
NM_012302chr121009 374 ------
NM_012307chr1821095 253 ------
NM_012308chr1121751 330 --12218 1696
NM_012309chr1134328 3434 365 11156 33365 535 504 --
NM_012319chr182926 81 ------
NM_012322chr7------1402
NM_012325chr2011137 --1140 --
NM_012328chr711217 --1945 --
NM_012329chr172104 49 ------
NM_012330chr101412 --1484 --
NM_012338chr71300 --11189 --
NM_012342chr10171 ------
NM_012343chr5----2781 420 --
NM_012382chr544337 3290 1433 799 --21673 756 1411
NM_012395chr733225 659 205 --23238 3051 --
NM_012405chr123691 1479 12391 23875 3552 1432
NM_012406chr12--1148 --1285
NM_012419chr61637 --1443 --
NM_012428chr152736 357 --1963 --
NM_012464chr442874 2416 2132 144 --1513 1634
NM_012465chr1031228 1140 862 --1908 --
NM_012479chr731981 974 409 --22168 642 --
NM_013230chrY21790 1301 1508 ----
NM_013231chr1454116 3617 3146 2757 148 24050 1269 2120 112 --
NM_013233chr21567 --11288 --
NM_013237chr5----169 --
NM_013262chr621135 46 --11304 --
NM_013275chr162799 628 --2734 130 --
NM_013277chr123200 83 61 --1910 --
NM_013281chr2041288 370 252 119 ------
NM_013283chr55776 583 140 94 57 ------
NM_013296chr1----1421 --
NM_013300chr121245 --1212 --
NM_013309chr1522321 2118 ----1340
NM_013313chr2272795 2782 2256 2200 1044 767 393 --23117 1380 --
NM_013354chr8----1431 --
NM_013381chr1231734 580 80 ------
NM_013382chr1432261 2041 869 --11685 --
NM_013386chr151342 1311 1151 602 286 --21515 105 --
NM_013436chr22162 33 ------
NM_013437chr831431 1297 870 ------
NM_013438chr941729 1589 1525 374 --3509 422 131 1227
NM_013438chr941729 1589 1525 374 --3509 422 131 1227
NM_013444chrX21161 1080 --31025 440 142 1358
NM_013446chr731439 1044 1011 --1522 1301
NM_013449chr1221931 427 ------
NM_013995chrX52499 2024 1036 817 752 --1404 1973
NM_014011chr222257 294 ----12616
NM_014021chr141350 1325 627 305 12991 22380 2311 --
NM_014023chr102968 731 ----12707
NM_014028chr653146 2777 2319 2112 289 --22423 413 --
NM_014034chr621294 587 1283 11256 --
NM_014048chr16105177 4680 4598 3588 1670 886 623 455 230 91 14567 35298 4011 448 --
NM_014106chr1592901 2452 2343 2287 2072 480 232 117 92 12443 173 12618
NM_014109chr81341 1299 1862 --
NM_014112chr8124897 4882 4375 2007 1993 1833 1703 1590 1423 1352 973 270 11817 23947 2204 --
NM_014117chr1652684 2171 795 761 463 ------
NM_014154chr31492 --21443 1433 --
NM_014155chr1187317 6789 6605 5890 2355 1541 798 138 --12991 --
NM_014166chr131381 ------
NM_014231chr1231560 255 157 --12155 --
NM_014240chr383918 3708 2865 1588 1460 1440 795 536 12821 23216 1361 --
NM_014249chr15----1518 --
NM_014253chrX12178 --32450 2369 1590 --
NM_014263chr1021059 522 --21194 1143 --
NM_014264chr4----1501 --
NM_014268chr181389 --1152 --
NM_014278chr41350 --1158 --
NM_014280chr11717 --3706 647 295 --
NM_014282chr9135 1872 1133 1466
NM_014283chr111227 ------
NM_014289chrX31136 1017 457 11338 11178 --
NM_014290chr9----1196 --
NM_014294chr831108 925 151 --1136 --
NM_014319chr1231737 633 271 --1762 1561
NM_014322chr11412 --1329 --
NM_014326chr1521050 109 11256 ----
NM_014331chr4127717 7097 6678 6575 5247 4754 2491 1981 1589 1380 562 495 16944 57354 2816 2810 1038 868 14879
NM_014342chr112287 91 11241 21441 948 --
NM_014344chr111675 --1776 --
NM_014363chr1321112 517 --2267 64 --
NM_014368chr912067 11527 ----
NM_014382chr321771 368 --11711 1295
NM_014409chr111001 --1832 --
NM_014410chr18------1365
NM_014415chr331444 478 305 1596 21458 337 1368
NM_014423chr5105316 4032 3954 3462 2265 1170 793 755 680 652 --15358 1748
NM_014426chr201489 ----2216 62
NM_014445chr342418 1816 933 426 --11575 12045
NM_014452chr611203 --2857 340 --
NM_014456chr1041466 298 118 98 ------
NM_014458chr121028 147 --11116 11252
NM_014488chr112524 233 ------
NM_014494chr1641984 886 489 398 --22380 697 --
NM_014515chr122879 384 ------
NM_014554chr1222095 142 ------
NM_014572chr1321605 223 2369 269 11195 --
NM_014577chr222853 682 --3920 716 634 --
NM_014585chr241171 1113 347 63 --11137 --
NM_014586chr2174738 4670 3882 3268 3257 1844 1303 --34546 4446 4030 --
NM_014587chr1631245 556 415 --11356 --
NM_014588chr203708 216 56 --1597 --
NM_014591chr10----11312 --
NM_014600chr221459 1140 --11647 --
NM_014612chr941080 416 379 237 1251 11295 11004
NM_014613chr543007 2538 2516 2441 --23055 2060 --
NM_014615chr1641121 977 784 488 --13550 --
NM_014629chr821227 207 1410 ----
NM_014630chr1521084 795 ----13521
NM_014636chr964119 4055 2972 2778 1223 1028 --23750 539 --
NM_014660chr71307 ----21093 283
NM_014666chr521138 189 ------
NM_014667chr382339 2190 2019 1710 960 739 484 320 168 1165 12447
NM_014671chr721051 488 ------
NM_014674chr332957 2883 597 --33747 1572 843 --
NM_014678chr221121 ------
NM_014679chr112545 255 21090 183 21040 267 --
NM_014682chr872147 1897 1685 502 258 127 76 --42232 2125 1872 353 1108
NM_014686chr1951893 1684 899 887 518 --12400 --
NM_014701chr15183 --12925 1826
NM_014702chr663078 2669 2520 2455 801 494 --1168 13369
NM_014705chr7285 29 --21712 762 --
NM_014709chr2------1613
NM_014713chr21364 1126 1340 --
NM_014727chr19----1257 --
NM_014729chr842114 1810 708 275 1119 ----
NM_014730chr1215105 23279 1787 14669 --
NM_014732chr1675305 5218 5135 3616 2201 2035 2012 11104 35717 5180 1587 --
NM_014737chr2044240 1133 845 74 --11044 --
NM_014741chr11----12184 --
NM_014746chr264279 3103 2754 1339 680 621 1470 31515 712 568 --
NM_014755chr253363 1701 1379 939 438 --31060 689 683 1512
NM_014757chr531867 1652 1555 ------
NM_014764chr1251324 820 201 148 52 --1870 11248
NM_014774chr122611 2238 --1388 --
NM_014779chr311111 --1258 --
NM_014786chr111900 1428 ----
NM_014790chr5------1194
NM_014795chr23945 306 191 21125 268 2878 478 --
NM_014798chr1731772 1330 348 ------
NM_014803chr1041085 1024 901 188 12728 12374 --
NM_014807chr111274 --1647 --
NM_014810chr143466 3082 988 643 --1757 1111
NM_014813chr1193 ----2614 54
NM_014819chr5--12199 11918 --
NM_014822chr4--1138 2256 31 --
NM_014827chr111624 ----1385
NM_014829chr522218 140 --2609 361 --
NM_014830chr1212897 --12758 12378
NM_014835chr2041577 1513 1421 645 ----11940
NM_014839chr142312 2010 1949 724 ------
NM_014847chr11496 ------
NM_014848chr1552272 1008 918 764 305 --12159 1477
NM_014864chr173470 3356 3015 2803 990 762 490 --14320 --
NM_014869chr32385 283 ------
NM_014872chr911614 22149 348 3705 568 166 1409
NM_014873chr144845 3864 1936 63 --44780 4493 951 729 13087
NM_014874chr121780 1405 ------
NM_014876chr2221971 1638 --11991 1215
NM_014877chr1757083 5612 5294 2442 551 1373 47226 5709 5328 187 --
NM_014897chr1763257 3190 2850 951 372 77 --1238 --
NM_014901chr5--22135 1715 32201 177 119 --
NM_014905chr221737 225 ----2463 339
NM_014906chr1753740 3026 948 904 749 --23239 2954 13127
NM_014912chr1043143 2967 1156 100 --1228 1397
NM_014918chr15----11582 --
NM_014924chr1452692 2597 2516 1138 786 ------
NM_014926chr311018 --1947 --
NM_014935chr131508 474 120 13177 13881 --
NM_014942chr622588 1738 --12437 --
NM_014943chr8----11052 --
NM_014945chr51128 ----130
NM_014946chr212850 --13057 --
NM_014947chr142963 2928 2742 712 13137 12303 --
NM_014949chr1----160 --
NM_014950chr1431730 1663 1614 ----1462
NM_014952chr1532058 1311 78 --11957 --
NM_014953chr1333324 1599 332 1977 1135 --
NM_014961chr421653 377 1544 12159 --
NM_014962chr2042845 2686 2051 632 --12382 --
NM_014982chr1454248 1349 579 558 296 11423 54949 3641 1983 1757 727 15275
NM_014988chr4--1101 2470 207 --
NM_014989chr631343 787 758 --31932 1534 1262 --
NM_014990chr14----1859 --
NM_014991chr412585 13275 12795 --
NM_014994chr1552381 2321 1831 1616 485 --21928 463 --
NM_014996chr31956 --1742 --
NM_014999chr1241386 1140 286 196 ------
NM_015000chr1262276 2105 1051 751 695 274 ----12667
NM_015002chr1232114 2078 1859 --2401 357 --
NM_015009chr3----1246 --
NM_015017chr131148 1026 821 ------
NM_015020chr1693594 3328 3115 3064 2776 1468 918 880 534 --13698 --
NM_015025chr242577 1929 761 648 --12194 11718
NM_015026chr1253781 3316 1711 1688 1582 11163 24705 329 31877 1746 540
NM_015032chr1332610 2525 777 ------
NM_015040chr243400 2427 1316 401 23302 529 1178 1742
NM_015045chr1042124 2028 167 159 --32018 1985 1815 --
NM_015054chr12------1491
NM_015063chr1911123 --11167 --
NM_015071chr576245 5877 4434 4195 4002 478 231 16232 ----
NM_015072chr142250 76 --1386 --
NM_015074chr184884 4202 4086 3282 1316 1108 176 137 --33711 596 347 --
NM_015075chrX1648 --21797 1521 --
NM_015076chr6114196 4068 3528 3147 1651 1225 862 536 288 270 63 13508 21550 1326 14518
NM_015091chr141281 --190 --
NM_015092chr16104647 3510 3351 1759 1547 1224 898 459 176 146 --44003 1847 1394 964 --
NM_015093chr61592 --11624 11434
NM_015094chr2234509 1586 900 ------
NM_015097chr322346 1876 --21849 284 --
NM_015125chr19----2484 421 --
NM_015130chr4----11125 --
NM_015137chr81183 --12377 11901
NM_015138chr15----22659 706 --
NM_015139chr1----1121 --
NM_015143chr431016 257 134 --21205 50 --
NM_015144chr1664008 3727 3196 2898 672 498 23051 2554 ----
NM_015149chr121748 1417 ------
NM_015151chr214865 655 316 158 11015 1330 --
NM_015155chr1042825 2446 1082 646 2561 276 22080 1062 --
NM_015170chr82623 150 --1342 --
NM_015172chr11454 ------
NM_015180chr142920 289 ------
NM_015185chrX32383 859 814 --12909 --
NM_015192chr2032799 2769 761 --32792 2064 2006 --
NM_015194chr1741909 1895 1491 1315 ------
NM_015196chr41107 ------
NM_015199chr331112 294 67 --11864 --
NM_015215chr152896 2710 2362 1165 799 --42691 2108 204 198 --
NM_015230chr431343 1259 328 2149 138 1392 --
NM_015231chr112129 76 ------
NM_015251chr162764 673 --21476 147 --
NM_015265chr232657 2365 2246 --21969 884 1328
NM_015267chr1221746 1583 22021 57 --12058
NM_015271chr474085 3831 2918 1663 799 696 39 13043 11484 12616
NM_015272chr1612010 --2566 291 --
NM_015275chr121527 11430 11536 --
NM_015277chr1841337 1279 587 447 --3431 60 52 --
NM_015278chr623099 316 1238 33212 2740 2161 --
NM_015291chr132773 2421 2145 --13388 --
NM_015293chr61574 ----1730
NM_015294chr17----21148 944 --
NM_015296chr132893 477 --11102 --
NM_015308chr111880 --1765 --
NM_015310chr896809 6716 6490 5750 3259 3068 1671 559 115 25101 1679 26867 3081 18327
NM_015313chr1184501 4469 3679 1477 1158 920 769 187 --14678 1310
NM_015317chr221017 758 1964 ----
NM_015318chr1921487 1471 ------
NM_015326chr1--11034 ----
NM_015331chr1----1579 --
NM_015332chr742996 2577 2489 78 13464 13199 --
NM_015335chr1242457 2171 862 124 --12128 --
NM_015336chr122683 334 1962 22011 1789 12528
NM_015339chr20----1898 --
NM_015344chr852133 2031 1959 1912 347 ----1551
NM_015346chr1461664 1650 1211 358 318 297 ------
NM_015347chr1292677 2288 2247 1909 1853 850 776 341 256 1953 52345 2095 1902 1153 689 --
NM_015349chr662702 2678 2604 2005 1041 284 --1926 --
NM_015355chr1741921 727 610 493 --1222 1334
NM_015361chr21746 --2784 173 1872
NM_015397chr921922 1847 1140 ----
NM_015409chr1242710 772 664 205 --12716 11923
NM_015443chr172279 211 --1618 --
NM_015444chr3----1169 1621
NM_015446chr1----21568 434 21660 1177
NM_015455chr573541 3487 3175 3048 650 622 496 --13088 14041
NM_015458chr864940 4908 4149 3939 906 879 --13375 --
NM_015459chr11----1267 --
NM_015483chr71979 ----1446
NM_015488chr2--11646 11620 --
NM_015508chr341321 217 111 49 11358 ----
NM_015509chr1211220 ------
NM_015523chr11----1235 --
NM_015530chr22264 209 --1399 1842
NM_015541chr3----21073 476 --
NM_015542chr10----11125 --
NM_015548chr63956 769 243 138 --1989
NM_015553chr674408 3513 3248 1859 1793 1219 1167 ------
NM_015554chr152164 97 2346 201 52264 2181 545 451 23 11137
NM_015557chr153631 2223 1413 1116 863 --1330 --
NM_015565chr21----12302 --
NM_015567chr1321155 852 --31136 930 821 134
NM_015569chr164723 4194 3238 597 224 134 --11809 13301
NM_015576chr372953 1911 1087 824 655 496 316 ------
NM_015577chr531612 380 101 ------
NM_015578chr1931529 1411 276 ------
NM_015607chr1------1147
NM_015626chr1721197 128 --1134 --
NM_015627chr13665 613 366 ------
NM_015630chr221114 862 --1259 --
NM_015641chr731239 328 197 --31220 1057 53 --
NM_015652chr10160 ------
NM_015675chr19----1564 --
NM_015678chr1351430 1369 1162 1108 570 --1679 --
NM_015686chrX52485 2465 2326 1848 812 ------
NM_015691chrX52925 1970 1088 426 357 ----1524
NM_015714chr12299 243 --1367 --
NM_015726chr141826 1492 1247 98 --1619 21739 601
NM_015878chr811793 --1698 11486
NM_015879chr18148012 7401 7300 6944 6865 6436 5963 2757 1947 1416 1259 923 185 142 27551 2031 88558 8219 8004 6674 1520 597 591 231 --
NM_015885chr11----2356 165 --
NM_015888chr153000 2724 2637 2115 1096 ------
NM_015891chr632079 1417 1336 ------
NM_015892chr1052354 2291 2177 1987 295 --12403 1802
NM_015898chr1932076 917 180 2774 559 ----
NM_015902chr83798 761 631 --1737 --
NM_015955chr2------1425
NM_015994chr14----2717 453 --
NM_015995chr1565094 4846 4498 2113 949 323 ------
NM_016018chr832432 391 51 --32728 2671 2005 --
NM_016019chr74946 878 730 364 ------
NM_016021chr672968 2567 2037 1997 623 490 56 --12940 12893
NM_016022chr1------1227
NM_016041chr172276 127 ------
NM_016045chr20--1531 21183 668 --
NM_016061chr221092 1025 --31659 1515 1142 --
NM_016078chr17----2885 341 --
NM_016081chr431976 1684 106 11968 ----
NM_016083chr673835 3539 3334 3055 1520 1410 1179 --52827 2810 2415 748 556 --
NM_016097chr181802 1834 2174 104 --
NM_016098chr6--2404 338 ----
NM_016123chr1231309 1098 474 ------
NM_016131chr211692 --42157 1510 258 239 --
NM_016192chr2----1107 --
NM_016201chr341997 1961 1860 1546 --11467 --
NM_016205chr431338 504 139 --1965 --
NM_016206chr397876 7144 6416 6056 2735 1835 1818 1055 193 16910 38477 6433 5492 1943
NM_016217chr632263 807 458 --23560 222 --
NM_016224chr621744 1688 1247 1751 1138
NM_016230chr61404 ------
NM_016248chr1373888 3812 3078 2432 734 341 142 23475 1565 13440 23355 976
NM_016258chr1----1690 --
NM_016269chr421167 981 --2403 341 --
NM_016271chr1842136 1686 675 327 --1263 --
NM_016277chr661558 1521 1502 1223 478 45 ------
NM_016281chr1221021 465 --11102 --
NM_016284chr16----2360 188 --
NM_016287chr141812 1627 661 156 --167 --
NM_016289chr232283 1720 40 --22118 740 --
NM_016297chr253541 2655 2444 2359 478 --23151 317 1187
NM_016308chr121796 500 11286 ----
NM_016315chr211205 --11632 --
NM_016322chr993069 2971 2117 2031 1044 1032 944 518 61 --11194 --
NM_016339chr1721585 57 ------
NM_016356chr642743 2051 405 257 ------
NM_016357chr1211162 --1421 11169
NM_016374chr141394 1222 1129 23 1143 21268 152 131
NM_016376chr1753483 3391 3056 1455 813 13768 33832 797 781 13878
NM_016396chr1552222 2154 2120 542 523 --196 1693
NM_016422chr1153079 2898 2080 1186 979 12733 --22743 603
NM_016441chr262325 1703 1676 832 631 428 --181 --
NM_016484chrX2281 136 --1156 --
NM_016485chr631919 901 299 --1911 --
NM_016486chr11420 --1197 --
NM_016506chr11----1483 --
NM_016525chr91238 --1244 --
NM_016530chr1514055 31143 488 408 33725 2603 692 11659
NM_016531chr494124 3704 3555 3460 3353 3310 3049 3035 1068 ----13373
NM_016544chr263776 3554 2818 2787 2523 801 2961 948 2219 185 --
NM_016559chr341130 1113 582 49 ------
NM_016577chr311210 --2864 236 --
NM_016578chr111494 ------
NM_016584chr12----1277 --
NM_016591chr51291 ----1792
NM_016605chr51350 --22285 438 --
NM_016620chr111340 --1484 --
NM_016623chr81244 --1521 --
NM_016628chr101664 ----181
NM_016631chr21----1770 --
NM_016644chr54349 178 112 69 ------
NM_016829chr3----153 --
NM_017409chr121571 ------
NM_017423chr431901 1776 1467 --12078 --
NM_017426chr41264 1502 1427 --
NM_017440chr12----1486 --
NM_017508chr1112381 --184 11759
NM_017519chr61264 --1327 --
NM_017548chr341996 815 351 137 --21909 1898 --
NM_017553chr153844 830 159 ------
NM_017567chr2----1119 --
NM_017580chr1032338 2290 1884 21921 370 ----
NM_017590chr2221012 508 --22715 2505 --
NM_017593chr41134 --175 --
NM_017594chr922607 672 --12917 21103 115
NM_017610chr1521895 1476 --2425 263 1713
NM_017617chr941405 1374 204 60 --1163 --
NM_017633chr663565 2813 2752 2477 1555 1426 12773 11563 --
NM_017634chr821805 1662 --1354 --
NM_017635chr1141283 523 190 94 --11470 --
NM_017637chr989338 7338 6099 3632 3486 1805 1460 795 21445 1211 59135 8455 2438 820 85 31941 121 78
NM_017640chr6----1248 --
NM_017643chr1742442 2048 551 273 --11242 --
NM_017644chr331927 888 440 14876 11902 --
NM_017645chr913096 --12651 135
NM_017650chr765301 5157 3910 3762 825 170 23930 457 65894 4300 4244 2247 1047 152 14998
NM_017658chr14114440 4016 3963 1502 1246 1217 515 279 146 92 44 --31483 1020 255 --
NM_017694chr221760 1600 --21580 1473 --
NM_017709chr173282 3144 1260 1242 1033 650 87 --11352 --
NM_017714chr202123 37 1158 --1667
NM_017742chr1861914 1839 1300 1254 1214 495 11536 11804 --
NM_017744chr132192 301 122 12272 1444 11726
NM_017748chr17----135 --
NM_017752chrX32115 1812 179 ------
NM_017754chr645028 3061 1847 282 24635 3581 13611 --
NM_017758chr1711506 --1449 --
NM_017778chr851327 1102 1066 463 129 --11248 --
NM_017798chr20----1166 1157
NM_017799chr141279 ----1660
NM_017811chr94763 528 221 25 --12594 --
NM_017824chr1032355 885 209 22292 139 179 --
NM_017831chr1844026 3557 1690 568 --24636 1286 1149
NM_017848chrX64173 1391 1265 1214 723 660 1373 24021 1802 --
NM_017849chr232634 1272 208 --22964 520 --
NM_017851chr151813 ----1306
NM_017869chr16----1627 --
NM_017893chr1041167 1020 982 547 ------
NM_017902chr1064852 4841 3577 2048 1696 255 15755 --1105
NM_017910chr2191 --1369 --
NM_017913chr9----191 --
NM_017921chr1742323 1835 1684 616 --11958 --
NM_017922chr141240 --1271 --
NM_017925chr941826 1304 453 156 --11367 --
NM_017944chr1152992 2723 2557 209 194 --12236 1694
NM_017964chr2174 ------
NM_017969chr2----1171 --
NM_017974chr2----11041 --
NM_017983chr17------1337
NM_017987chr101509 --21379 363 --
NM_017988chr122699 92 --1868 --
NM_017994chr732531 1899 1142 --22605 442 --
NM_018013chr621215 466 12594 21168 568 11941
NM_018027chr1053318 2714 1249 540 219 ------
NM_018030chr181839 --2881 133 2908 216
NM_018036chr1464174 3164 1628 771 236 120 --44016 1307 596 505 11760
NM_018046chr551874 1719 1458 1383 601 1617 ----
NM_018061chr131469 384 171 --2228 119 --
NM_018063chr101351 1136 ----
NM_018078chr43839 795 178 11074 ----
NM_018084chr252075 1180 1032 487 263 --41284 1053 936 855 23080 2994
NM_018085chr167593 6134 5043 1837 1416 1203 32917 2614 1627 77168 5382 5349 2634 1746 1280 81 --
NM_018092chr161513 --21088 608 --
NM_018098chr3290 77 --11036 --
NM_018103chr1----188 --
NM_018117chr101492 --1695 --
NM_018120chr81458 --1135 --
NM_018121chr1042597 2571 2452 2341 --73052 2775 2658 2130 984 962 561 --
NM_018128chr1711419 --11019 --
NM_018133chr321981 1633 ----1873
NM_018137chr12515 273 1244 ----
NM_018154chr192938 216 ------
NM_018157chr1253269 2827 2244 1097 751 --22235 2050 --
NM_018176chr431549 1189 1118 2342 258 --1173
NM_018181chr1851760 1421 562 510 304 --21778 1265 --
NM_018184chr351899 1858 1524 617 138 11397 32025 1977 1411 --
NM_018211chr111857 --21832 394 1426
NM_018227chr431280 1188 149 ----156
NM_018243chr453315 3205 2817 2606 1268 --31448 912 410 --
NM_018254chr142056 947 658 490 11829 ----
NM_018263chr21651 1843 --22465 237
NM_018275chr71496 ------
NM_018287chr1021044 421 --4954 354 242 113 --
NM_018293chr332970 2557 2308 --22889 2796 --
NM_018327chr2021529 1395 ----11772
NM_018330chr1011675 --31489 1277 1267 --
NM_018351chr1242950 1518 1307 917 ----34661 3297 1130
NM_018361chr853786 3447 2977 1169 766 --21176 321 --
NM_018362chr1153559 3083 3065 2849 1394 23592 3538 41301 528 521 316 --
NM_018364chr153760 3728 3027 582 403 13006 --13392
NM_018368chr6----154 --
NM_018370chr1221799 1594 1469 ----
NM_018371chr821534 1519 --21320 634 --
NM_018387chr91451 ------
NM_018398chr3----1324 --
NM_018416chr1222567 1759 11836 --1937
NM_018440chr8137946 7856 7332 6385 6171 5880 5317 3087 2502 1286 827 715 333 28682 5562 38043 2572 2121 --
NM_018464chr101145 --1360 --
NM_018469chr1751499 1419 1309 1114 73 --21024 555 11462
NM_018471chr2----1440 --
NM_018482chr832091 1914 600 1247 --1805
NM_018489chr151786 776 585 303 293 1142 ----
NM_018490chr1131871 1536 89 ------
NM_018527chr131108 ------
NM_018557chr241492 1289 662 212 --1365 1340
NM_018566chr1115085 4994 4412 4260 4073 3500 1606 1544 1143 990 886 ----14695
NM_018584chr12960 84 --1484 --
NM_018638chr1254953 4904 4675 4126 455 --11398 14394
NM_018646chr71170 ------
NM_018650chr131750 1539 66 1633 ----
NM_018657chr31651 --3845 797 290 --
NM_018682chr72715 76 --1545 --
NM_018685chr71822 --185 --
NM_018689chr1532443 920 811 --22691 659 --
NM_018700chr531508 1284 1066 11242 1458 --
NM_018704chr1--11548 1677 --
NM_018710chr83988 924 160 --1440 --
NM_018715chr132086 861 61 --1118 --
NM_018717chr432736 2383 503 --12354 --
NM_018834chr52234 106 --1825 --
NM_018837chr20----1250 --
NM_018841chr123915 3397 13317 33852 3720 2960 --
NM_018898chr512264 1158 ----
NM_018945chr653018 2809 1417 1127 543 --21441 911 --
NM_018951chr711159 --1811 --
NM_018963chr2121026 460 --11307 --
NM_018970chr722856 2500 11133 ----
NM_018976chr1232810 2271 1020 --12480 --
NM_018979chr1222551 149 --32587 2570 862 1105
NM_018993chr2011326 --11432 --
NM_018999chr1064638 4512 4290 3942 1490 665 --24353 3989 --
NM_019004chr71934 1644 12305 31680 766 196
NM_019006chr15----1618 --
NM_019022chr1853158 2986 2080 597 454 ------
NM_019035chr421940 1277 --11560 1104
NM_019044chr294462 4314 3542 3319 3292 1560 960 881 245 1519 --1291
NM_019050chr452020 649 532 498 197 ------
NM_019067chrX84855 4491 3127 1925 1094 999 437 195 ------
NM_019071chr72272 198 --196 --
NM_019072chr544308 2905 789 606 --24195 448 --
NM_019084chr1022433 730 ----12599
NM_019091chr231165 1100 992 --1103 --
NM_019098chr811195 ----11254
NM_019114chr921853 554 --1830 --
NM_019116chr1643709 2476 1084 428 --33212 3009 161 --
NM_019117chrX12655 --11362 --
NM_019555chr351409 1373 579 88 58 ------
NM_019558chr2--1318 1361 --
NM_019593chr2033061 2709 298 1375 22497 441 --
NM_019600chr151203 --2785 516 --
NM_019606chr7----1397 --
NM_019845chr2----1710 --
NM_019885chr242811 2518 1123 675 --12924 --
NM_020116chr4------21399 52
NM_020117chr53991 781 659 --1325 1701
NM_020122chr2105974 5928 5421 4940 4735 3738 2349 1963 1824 932 --12002 --
NM_020123chr1031006 334 114 1404 1978 --
NM_020130chr821198 86 ------
NM_020134chr22394 190 --1809 --
NM_020137chrX----1352 --
NM_020144chr772079 1686 1413 1311 727 604 546 --21640 733 --
NM_020154chr15124 ------
NM_020168chr151917 --11357 --
NM_020177chr512291 ------
NM_020193chr1121229 89 1101 2193 23 --
NM_020194chr23589 534 84 --1611 --
NM_020198chr1721128 322 11077 11099 --
NM_020205chr133130 2275 205 --1803 23447 3250
NM_020210chr15----1977 --
NM_020211chr1521431 359 ------
NM_020228chr1152427 1613 1037 438 424 ------
NM_020309chr191835 --1709 --
NM_020310chr1732819 2781 185 ------
NM_020317chr11100 --142 1109
NM_020336chr2022951 327 --23366 1486 --
NM_020337chr42440 243 --21173 1139 --
NM_020340chr612281 12067 2879 74 --
NM_020341chr203482 399 96 --12045 --
NM_020345chr3--1715 2265 146 --
NM_020346chr1131535 1262 517 --1219 1372
NM_020353chr31512 --21350 1320 1792
NM_020357chr32546 509 11413 ----
NM_020363chrY1469 --2578 378 1528
NM_020374chr1231946 1813 331 --1636 --
NM_020382chr12----1243 --
NM_020390chr354944 4653 3782 3272 398 13707 74597 4397 4184 3221 1525 1415 451 --
NM_020403chr1311671 --2305 260 1569
NM_020432chr731638 1588 401 --1719 1222
NM_020440chr122460 205 --12593 --
NM_020447chr1532558 1927 407 --12585 --
NM_020463chr211210 --11451 --
NM_020466chr6104804 3983 3688 3246 1957 1537 1216 784 448 331 23851 1358 33454 544 178 23109 54
NM_020474chr1821977 1871 --11292 --
NM_020546chr543176 2101 1236 193 --21174 658 --
NM_020640chr352307 1862 792 490 461 ----21526 696
NM_020647chr812156 --1380 22196 929
NM_020673chr2067144 5515 1877 1703 549 346 11068 12386 26727 2379
NM_020689chr2031699 1073 437 ------
NM_020699chr165332 5235 4023 1713 1590 91 11916 --1581
NM_020704chr742530 2295 659 324 --1459 --
NM_020713chr2022305 2179 --32949 2686 2098 --
NM_020717chrX54927 4717 965 314 270 --13279 --
NM_020718chr1676129 5824 1874 1862 1616 1431 859 --76498 4175 1263 1113 962 515 96 --
NM_020726chr51208 ----1539
NM_020734chr1243364 2464 2155 731 1964 11067 12065
NM_020740chr17------134
NM_020752chr1052200 2001 1943 1078 1036 12773 22254 857 --
NM_020760chr221848 378 --11391 11990
NM_020768chr553178 3128 3040 1061 814 12525 ----
NM_020772chr1767940 7826 7779 7101 5332 1296 22889 1483 37120 5721 5639 27809 1953
NM_020774chr1845754 4310 2343 2138 46022 5581 4353 1268 54935 4122 842 612 297 --
NM_020783chr1822207 2146 --31783 1506 897 --
NM_020796chr5--12283 --12749
NM_020801chr532089 891 805 ----11619
NM_020803chr412214 11779 1587 1968
NM_020809chr1111614 1305 22213 1512 --
NM_020810chr141908 --32892 2877 109 --
NM_020820chr2021549 470 --21415 374 --
NM_020825chr1683365 3154 3092 2340 925 665 380 331 --23073 2553 --
NM_020843chr15----1134 --
NM_020850chr1643136 3121 3108 2371 --13289 --
NM_020854chr184540 144 109 73 1360 164 --
NM_020856chr1971170 1128 413 406 396 363 288 1313 ----
NM_020858chr1532329 517 401 --22386 191 --
NM_020860chr43936 736 457 ----11189
NM_020871chrX32408 622 560 ----12535
NM_020872chr3----11726 --
NM_020886chr11----1169 --
NM_020888chr14784 447 399 189 ------
NM_020899chr1732514 1865 718 --11717 --
NM_020918chr1063403 2723 2523 2374 1002 984 11108 43432 3050 2832 1434 --
NM_020921chr1452978 2875 2709 1370 643 12527 22343 34 12738
NM_020935chr284555 4096 3802 3742 1617 1084 235 31 11112 ----
NM_020940chr1082718 2255 2230 2171 1125 801 365 274 --11146 --
NM_020960chr954856 3757 3525 3062 162 13679 44764 3902 3564 1622 --
NM_020980chr1521139 343 --1695 --
NM_021005chr151199 1996 1430 1324
NM_021009chr12163 ------
NM_021012chr171638 --33214 2934 2476 --
NM_021013chr17----1303 --
NM_021035chr2051223 489 476 348 139 --31329 1303 984 --
NM_021038chr353136 2763 1346 931 295 --12452 13194
NM_021090chr2244202 1868 1145 793 --21762 88 --
NM_021111chr92551 348 11282 1410 --
NM_021117chr1122061 1744 --12242 --
NM_021136chr143583 468 163 1513 1727 1720
NM_021137chr1751586 597 591 502 191 11969 12135 --
NM_021140chrX----1206 --
NM_021145chr72940 719 ------
NM_021151chr71394 3986 337 25 ----
NM_021180chr1----1774 --
NM_021183chrX12418 1699 21880 1737 --
NM_021189chr11165 --1242 --
NM_021190chr131075 974 530 ----31246 844 340
NM_021192chr2----1429 --
NM_021202chr2052511 2206 2074 1921 775 ------
NM_021205chr11413 11893 32877 2401 992 --
NM_021215chr2031746 439 367 --3874 743 325 1587
NM_021222chr111437 --21449 467 --
NM_021229chr12130 --21126 896 --
NM_021238chr1231994 771 628 --32053 2012 1614 --
NM_021239chr1431184 358 163 11328 --1343
NM_021240chr9----2475 171 1493
NM_021244chr62175 66 ------
NM_021252chr1031841 1315 696 --21786 1535 --
NM_021260chr14------1240
NM_021572chr63992 353 301 --2370 328 --
NM_021614chr5----1257 --
NM_021629chr374443 3937 3426 3223 1960 1425 261 --24784 329 --
NM_021633chr131070 311 274 ----1141
NM_021783chrX3560 377 194 --21730 327 --
NM_021813chr655871 5587 4557 3714 862 1650 35197 4813 4705 --
NM_021914chr1462263 1831 943 511 501 405 ------
NM_021938chr19----166 --
NM_021945chr632364 1309 264 --2654 476 --
NM_021947chr171955 --21145 484 --
NM_021950chr1121443 1386 --12229 --
NM_021960chr112231 --12698 --
NM_021961chr11137081 6943 6315 6207 6004 5623 4988 4588 2252 1381 1007 788 362 26364 5430 36592 4928 659 --
NM_021964chr3106384 4629 4138 4020 2311 1998 1155 560 221 34 32244 2103 927 56547 5925 1294 395 156 1753
NM_021973chr4----2578 115 --
NM_021979chr141363 ------
NM_021992chrX----1370 --
NM_021994chr73954 829 436 ----1178
NM_021998chrX--21524 1136 31532 1207 982 --
NM_021999chr131311 ------
NM_022006chr19----1372 --
NM_022041chr1612671 --2450 330 --
NM_022048chr1535712 1955 1396 24451 1493 35415 4089 752 --
NM_022051chr13567 179 109 ------
NM_022058chr221389 557 --1581 --
NM_022062chr1121433 358 --11761 --
NM_022073chr141151 --1333 --
NM_022114chr154628 4044 3849 3697 556 --24658 4056 24467 1691
NM_022118chr13----2187 69 --
NM_022123chr14285 58 ------
NM_022130chr5----188 --
NM_022133chr811251 --11868 --
NM_022138chr61315 --2107 100 1266
NM_022165chr19264 29 ------
NM_022166chr1666116 5764 4151 2259 1132 220 --15483 --
NM_022340chr353654 2909 2697 1018 155 --23451 552 --
NM_022346chr4----2346 125 --
NM_022459chr13106150 5730 4912 4638 4350 4265 1883 1439 1396 47 ----24692 1811
NM_022465chr1233057 2991 591 --12411 --
NM_022474chr1452787 2768 2066 1023 453 11857 22487 936 --
NM_022479chr711449 ------
NM_022484chr7----1250 --
NM_022497chr3123776 3752 3653 3285 3111 2636 1207 1199 997 826 677 123 13256 ----
NM_022574chr72172 126 ------
NM_022648chr244632 2819 1593 791 13280 11456 --
NM_022658chr1231339 1173 457 --21130 467 --
NM_022719chr22103843 3789 3723 3215 3127 2490 2424 2385 948 598 ------
NM_022728chr72679 562 ------
NM_022733chr11778 1274 ----
NM_022735chr111602 11262 ----
NM_022739chr17----2852 453 --
NM_022753chr121736 60 11962 --12580
NM_022757chr311020 1259 ----
NM_022763chr332873 2488 2386 --22207 578 1426
NM_022771chr123872 123 58 --1308 --
NM_022780chr221391 1161 --3588 493 53 1266
NM_022781chr962418 2274 2228 908 250 131 ------
NM_022832chr431833 1794 382 ------
NM_022843chr1331408 1335 185 --2525 396 11039
NM_022893chr213151 22997 2167 22018 292 --
NM_022894chr221268 550 11441 21135 260 --
NM_022898chr1454631 3849 1381 663 270 --24482 3708 11402
NM_022900chr71226 --11110 --
NM_022912chr21459 1488 --12226
NM_023004chr22----1241 --
NM_023009chr1----1673 --
NM_023011chr132796 335 ------
NM_023012chr124774 756 536 104 ------
NM_023016chr232511 1920 103 12062 2492 486 12017
NM_023018chr1----1193 --
NM_023067chr351293 1243 403 270 238 ------
NM_023076chr1641853 992 481 385 22966 566 32166 775 162 --
NM_023927chr5----11054 --
NM_023940chr431022 292 237 --1956 --
NM_024007chr532978 1989 1981 --1578 --
NM_024014chr7------1153
NM_024019chr41260 --1163 --
NM_024052chr1752222 1045 609 594 262 --11998 --
NM_024071chr141445 --1564 --
NM_024081chr114998 785 268 81 ------
NM_024090chr41759 ------
NM_024322chr2----2530 81 --
NM_024324chr22----1150 --
NM_024491chr3----1621 --
NM_024524chr312097 12957 12662 --
NM_024539chrX31190 1085 474 --21075 972 --
NM_024548chr321386 291 --21164 241 --
NM_024551chr12151 --22265 2015 --
NM_024554chr141612 1245 492 185 1241 ----
NM_024561chr1321070 444 --21087 73 --
NM_024574chr4----1107 --
NM_024607chr883598 3511 3230 1696 1195 984 661 226 --34447 1615 584 --
NM_024612chr175979 801 363 352 106 1767 ----
NM_024615chr5--1230 ----
NM_024617chr91715 ------
NM_024665chr384674 3679 1852 1341 1300 961 587 74 1251 44251 3506 3344 1332 14213
NM_024670chr1031760 1549 1364 --1462 1269
NM_024674chr173158 3150 2675 2465 777 667 84 --1699 11290
NM_024692chr221564 1234 --1293 --
NM_024700chr11228 --31147 796 783 --
NM_024704chr201741 --1914 --
NM_024713chr1531335 235 26 11357 1263 --
NM_024721chr842382 871 514 338 --2984 206 1898
NM_024735chr162622 150 --21451 80 --
NM_024749chr11459 --152 --
NM_024751chr43741 655 598 2535 355 1450 --
NM_024769chr1121115 151 --1407 --
NM_024786chr5----1913 --
NM_024792chr172953 182 ------
NM_024828chr9----1444 --
NM_024830chr52560 541 --21911 404 --
NM_024835chr17------1297
NM_024900chr431684 1475 855 --11726 11702
NM_024915chr852546 2010 1143 972 633 --12018 --
NM_024943chr42828 619 ----1530
NM_024947chr389315 9246 8842 8820 8587 6501 2852 1147 29394 1332 57715 3301 2827 2508 177 26793 2366
NM_024948chr102310 258 ------
NM_024949chr474302 1249 836 804 453 434 321 --23725 3420 --
NM_024979chr1341572 1501 1345 468 ------
NM_025010chr352593 2038 1953 919 52 --12098 --
NM_025075chr3----1200 --
NM_025076chr2----1198 --
NM_025126chr12------1527
NM_025133chr23947 772 423 ------
NM_025134chr1631694 502 200 --11828 --
NM_025138chr131912 --1159 --
NM_025141chr15--1226 1114 --
NM_025146chr321038 431 --129 12459
NM_025154chr721273 362 11086 2287 281 --
NM_025160chr153882 2794 1555 1343 418 --1624 24174 3671
NM_025191chr123457 3374 --1647 1518
NM_025195chr831501 635 45 1687 11538 --
NM_025201chr1531530 1434 323 --11313 --
NM_025208chr1122443 590 --32211 2103 706 1216
NM_025222chr342800 2497 2287 1869 12809 1474 13016
NM_025224chr2012170 --21975 755 --
NM_025235chr1062226 2032 421 294 249 209 1372 11617 --
NM_025244chr2------182
NM_025248chr1732382 887 865 ------
NM_030571chr5----11089 133
NM_030621chr1483953 3812 3574 3075 1509 1453 1312 749 --22905 1389 11646
NM_030625chr101626 ------
NM_030627chr573936 3870 3271 1584 1219 882 45 --13191 23079 797
NM_030629chr16----11473 --
NM_030637chr142678 141 ------
NM_030647chr766016 4878 1703 1515 718 568 16254 2875 147 --
NM_030650chr264252 3866 3282 3257 1689 982 176 33948 3340 736 --
NM_030661chr721365 453 1676 1418 --
NM_030758chr22163 1438 ----
NM_030759chr102536 176 --1662 --
NM_030762chr121682 --21572 1367 --
NM_030767chr91526 1841 1795 --
NM_030786chr12303 80 11234 ----
NM_030790chr161260 ------
NM_030791chr1421141 605 --1148 11360
NM_030806chr1108841 8752 8698 6591 6507 6427 5796 3253 2621 847 --28444 2489 --
NM_030815chr201310 --1560 --
NM_030816chr133116 940 849 ----33650 1170 609
NM_030906chr112416 53 --1410 --
NM_030911chr1311639 --150 --
NM_030920chr121889 754 --1336 --
NM_030939chr61238 --1124 --
NM_030949chr611379 --21101 58 --
NM_030962chr1131231 220 204 --21485 1110 --
NM_030963chr6----2616 93 --
NM_031283chr22294 138 1619 1318 --
NM_031407chrX1341 --1409 --
NM_031417chr191764 ----11940
NM_031438chr521312 782 --11692 --
NM_031439chr81755 --1493 --
NM_031461chr81725 12235 1548 22116 382
NM_031483chr2022953 418 --11387 --
NM_031890chr2252625 2411 2185 815 777 13022 1862 1205
NM_031935chr12389 148 --1970 --
NM_031942chr231051 929 359 ----11277
NM_032021chr11----11101 --
NM_032047chr322058 430 ------
NM_032102chr1133019 2260 2050 1931 42960 2495 1092 749 --
NM_032121chrX11728 --22758 2403 --
NM_032124chr182416 134 --31069 957 832 --
NM_032142chr181228 ----1191
NM_032144chr221672 1140 1547 1154 --
NM_032146chr3------1119
NM_032153chr341807 717 678 332 --12762 --
NM_032172chr71985 ------
NM_032182chr101375 ----11053
NM_032199chr1053722 2910 2735 2406 364 13465 13869 23796 996
NM_032226chr9----3833 816 776 --
NM_032229chr131999 --1445 --
NM_032233chr141670 --2760 331 --
NM_032239chr441215 924 905 345 --1152 --
NM_032242chr343325 2455 1189 1047 ------
NM_032246chr15----11154 1324
NM_032268chr162255 128 --12951 --
NM_032291chr131626 290 248 --2386 104 --
NM_032299chr11----192 --
NM_032320chr114322 193 69 53 ------
NM_032352chr1441428 1209 581 424 11403 11133 --
NM_032373chr10105845 5700 4940 4748 4135 3925 2199 878 154 39 14207 11993 14790
NM_032408chr71217 --11285 --
NM_032410chr811211 ------
NM_032433chr192617 557 11481 11257 11343
NM_032437chr1----2149 123 --
NM_032439chr102461 360 ------
NM_032445chr151938 --22411 419 --
NM_032449chr132723 828 432 ------
NM_032457chr453678 3113 2452 1307 1167 --11265 --
NM_032458chrX33308 3076 2335 32873 2549 664 13156 --
NM_032491chr1221049 469 --11025 --
NM_032505chr382467 1863 941 819 510 495 307 216 1323 32777 2447 2343 --
NM_032509chr81108 --2874 587 12473
NM_032511chr6----1444 --
NM_032521chr20----33040 2387 1165 --
NM_032532chr6----1656 --
NM_032539chrX1553 --1287 --
NM_032562chr10----1426 --
NM_032582chr1731864 1497 1284 ------
NM_032632chr1461981 1560 497 313 218 150 --21463 371 --
NM_032682chr363379 2347 864 253 232 223 ----12778
NM_032701chr191634 ------
NM_032727chr1011386 --149 --
NM_032728chr9----1943 --
NM_032737chr191468 --12166 --
NM_032780chr111799 --1164 --
NM_032784chr6----1229 --
NM_032796chrX2819 623 ------
NM_032810chr10----11395 --
NM_032815chr1642502 2448 1948 1797 --22495 638 --
NM_032829chr1211163 ----11090
NM_032833chr12675 543 --1310 --
NM_032838chr191277 ----11186
NM_032844chr10----1251 --
NM_032859chr1343976 2800 2775 25 --23452 420 --
NM_032867chr11----1125 1595
NM_032873chr1194456 4269 4218 3758 2977 2795 1116 712 694 --1835 23701 1238
NM_032875chr17----1797 --
NM_032876chr1431512 1467 89 ------
NM_032900chr1043889 3424 2745 2665 --1107 --
NM_032918chr1231150 228 84 1333 11258 --
NM_032983chr723185 1170 1695 23147 84 12905
NM_033055chr1----195 --
NM_033117chr92375 120 --169 --
NM_033132chr1332152 1803 557 --1442 --
NM_033133chr17----12782 13704
NM_033141chr1442208 1995 1708 114 --31576 607 126 --
NM_033222chr921144 1108 --31278 1016 174 --
NM_033224chr788020 7456 5319 2981 2140 2128 1390 478 16968 17706 1389
NM_033254chr3----1126 --
NM_033261chr101106 --1456 --
NM_033285chr8114454 4372 3412 3229 3064 2844 1316 856 698 428 300 --14448 12900
NM_033340chr1021356 22 --1474 --
NM_033360chr1264629 4496 4016 3369 1206 199 --24319 136 --
NM_033387chr922272 2135 1679 --12637
NM_033389chr1734718 4342 1394 13597 24194 78 --
NM_033394chr231125 1076 646 --21617 1483 --
NM_033396chr111314 --1158 --
NM_033505chr2116559 5566 5257 5044 4945 4892 4333 2512 2226 715 115 --36544 2079 1325 12346
NM_033546chr181161 ------
NM_033631chr133644 1034 1017 ------
NM_033656chr2165555 4821 2108 757 739 546 147 1166 15144
NM_052832chr852993 2886 1872 247 66 --11997 12966
NM_052845chr1212595 --23256 833 --
NM_052851chr1321523 275 --12015 22331 1534
NM_052879chr121408 12518 12831 1697
NM_052880chr2231394 1159 899 --11462 --
NM_052897chr12----1840 --
NM_052905chr22752 587 --11605 --
NM_052927chr541781 1578 146 92 ------
NM_052932chr1152265 2143 2066 2001 1917 --11650 --
NM_052937chr832117 272 60 --2951 392 --
NM_052971chr5----178 --
NM_053001chr8------1347
NM_053002chr33476 69 40 ------
NM_053023chr1153073 2987 2941 966 509 184 32412 2306 808 --
NM_053025chr321125 337 11177 ----
NM_053042chr412162 --22075 229 --
NM_053053chr1----11025 --
NM_053056chr1183105 2623 2409 2088 1963 1216 1019 93 --43085 1113 560 335 --
NM_053064chr1462935 2257 2169 986 346 92 --11873 12359
NM_053281chrX----1410 --
NM_054114chr63766 701 317 ------
NM_057175chr442302 1749 792 77 ------
NM_058172chr42704 417 --21383 88 --
NM_058237chr142807 421 2799 368 1718 1320
NM_078469chr102413 109 ------
NM_078471chr1721188 146 ------
NM_080283chr17----1103 1267
NM_080391chr11593 ------
NM_080723chr6----11326 --
NM_080737chrX1229 ------
NM_080743chr641819 963 365 258 12123 ----
NM_080832chrX21786 576 --1200 --
NM_080836chr2031654 1378 937 13942 14653 --
NM_080867chr1474924 4497 4227 1867 1668 1586 1548 ----1693
NM_080872chr843224 2920 1585 638 32991 2858 524 23049 990 --
NM_080927chr333247 2922 2729 --32723 1175 277 13228
NM_130446chr364263 3616 1721 1521 767 280 ------
NM_130468chr15----1743 1727
NM_130808chr31349 --182 --
NM_130809chr52790 653 --1326 --
NM_133264chr1753378 3183 2559 1099 458 ------
NM_133265chrX53284 3183 2764 1076 144 --22715 704 1879
NM_133334chr496205 6069 5658 5502 5305 1524 1168 1105 769 --15874 --
NM_133369chr51906 1916 ----
NM_133445chr933626 3335 338 --22401 1055 --
NM_133478chr232167 972 761 --148 --
NM_133493chr643802 3637 1720 1318 --24623 3002 --
NM_133496chr133880 1816 1498 --34206 1079 848 --
NM_133510chr14------1281
NM_134428chr9----1381 --
NM_138285chr21167 ------
NM_138286chr1954153 3386 1508 919 146 --21412 1109 14028
NM_138288chr141867 --3855 815 244 --
NM_138316chr101275 --11097 --
NM_138335chr42635 42 --1172 --
NM_138340chr181274 --123 --
NM_138357chr10--1466 11231 --
NM_138370chr2175 --1756 --
NM_138375chr181855 158 1485 --
NM_138409chr611338 --21393 389 --
NM_138423chr1531640 1508 681 ----11441
NM_138426chr782418 2396 1815 1745 791 677 512 221 --2632 241 --
NM_138468chr265979 3963 2219 1602 1392 579 14542 56240 5703 4369 4263 1332 16291
NM_138473chr1253886 786 699 456 246 --32036 1565 301 --
NM_138492chr521274 1080 --11140 --
NM_138731chr1434260 3325 2897 --1438 1688
NM_138773chr51684 ----1930
NM_138782chr541680 878 145 54 --12046 --
NM_138799chr252074 1863 1813 685 250 --11645 --
NM_138927chr211694 --1820 --
NM_138959chr165565 4485 4165 2109 1766 1409 --42697 2433 2324 152 --
NM_138967chr15--1489 12251 --
NM_138983chr2151284 1061 438 310 110 ------
NM_139076chr41172 1316 1604 1157
NM_139241chr121151 ------
NM_139321chr2053374 3328 1696 1155 857 --14182 --
NM_144571chr445799 5615 2493 2184 1505 46985 6013 5118 1439 11658
NM_144578chr1455057 4504 3990 3389 738 15289 34663 3561 154 --
NM_144579chr212017 --32130 831 226 --
NM_144582chr292414 2323 2170 1951 1916 1647 1609 986 706 --11055 --
NM_144599chr1565022 4776 4641 4163 842 455 14463 25203 1717 1883
NM_144611chr17--1493 1535 --
NM_144642chr321329 543 --1364 --
NM_144657chrX172 --157 --
NM_144664chr1142479 581 154 22 12386 22565 2534 --
NM_144710chr231179 486 150 --11268 --
NM_144720chr4------1196
NM_144721chr452592 2192 1806 654 128 --1417 --
NM_144726chr5----2917 845 --
NM_144775chr1711881 --24950 4807 --
NM_144778chr1322589 37 12778 21788 1101 --
NM_144963chr8--1443 22020 240 --
NM_144973chr1285271 1666 1354 1038 790 766 509 436 --24982 861 --
NM_144979chr41612 --1707 --
NM_144981chr11------177
NM_145005chr92902 312 1401 ----
NM_145011chr1062116 1972 1908 588 531 437 11473 ----
NM_145018chr111212 --1236 --
NM_145117chr1132604 915 214 --33082 1254 230 --
NM_145176chr643072 2629 688 438 ------
NM_145185chr19----1686 --
NM_145203chr13149 ----1254
NM_145239chr164328 291 226 206 --2366 272 --
NM_145251chr1411235 --1305 --
NM_145260chr23708 263 154 ------
NM_145266chr51144 --1252 --
NM_145291chr41388 --1362 --
NM_145305chrX31299 184 25 ----11289
NM_145307chr1054333 4260 3339 2879 1772 --13086 --
NM_145313chr1021167 40 1166 21515 1371 --
NM_145315chr6----1105 --
NM_145332chr62382 143 --1285 --
NM_145735chr1342749 2187 1943 874 --42856 2252 2066 139 --
NM_145753chr321575 428 --2585 342 --
NM_145808chr772609 2546 2501 2392 2040 1161 476 --13009 --
NM_145891chr1651571 1130 1071 615 416 --11396 --
NM_145909chr631243 185 54 11272 --11216
NM_147156chr101215 --11514 --
NM_147166chr7----1859 --
NM_152253chr2233884 3282 3175 --11223 --
NM_152261chr1222484 22 --12283 12493
NM_152263chr1104460 4043 3725 2098 1475 1415 1406 1343 1205 993 --36046 4758 210 --
NM_152265chr131338 1276 147 --2177 170 --
NM_152275chr2----42142 1782 1582 366 --
NM_152278chrX----169 --
NM_152280chr113417 --12539 --
NM_152284chr82294 222 --1723 --
NM_152292chr41431 --1640 1756
NM_152309chr1012211 22116 1859 1325 1353
NM_152326chr14166 ------
NM_152328chr14----1119 --
NM_152332chr1422784 2393 2962 393 --11998
NM_152345chr171370 ------
NM_152365chr1----1160 --
NM_152380chr121049 28 --11335 --
NM_152381chr211803 --11267 --
NM_152384chr221873 440 ----11996
NM_152409chr593308 3181 3158 2765 1285 1141 930 775 172 21293 511 ----
NM_152414chr81494 --11208 --
NM_152415chr83205 196 87 ------
NM_152424chrX84687 4240 4049 3951 3417 1277 531 229 --13487 --
NM_152446chr141395 ------
NM_152450chr1531385 320 85 --1495 --
NM_152457chr16198 ------
NM_152470chr1813993 --13891 --
NM_152493chr121533 234 ------
NM_152522chr23893 363 226 ------
NM_152523chr21621 --1696 --
NM_152536chr321094 464 ------
NM_152550chr5------147
NM_152556chr711947 1239 2858 388 1453
NM_152588chr1231892 1477 740 1249 ----
NM_152594chr1562277 2228 1828 380 318 301 11695 ----
NM_152622chr543418 791 606 494 --43480 2843 2562 1257 --
NM_152624chr5217443 7249 7242 6867 6397 6390 6255 5877 5687 4543 4508 2800 2588 2100 2083 1655 1467 1039 603 483 168 24680 251 57212 5943 2457 2263 490 --
NM_152665chr11323 ----1473
NM_152666chr11618 --1862 --
NM_152678chr352507 2066 809 231 170 12715 12483 --
NM_152704chr1321019 249 1838 ----
NM_152726chr132339 69 --1129 --
NM_152727chr16----1257 --
NM_152740chr71473 --1678 --
NM_152745chr71462 11069 1963 --
NM_152756chr543963 3489 1636 1578 --11612 14373
NM_152758chr832777 2582 220 12631 1717 --
NM_152774chr722082 2044 --31829 598 89 196
NM_152780chrX2447 268 ------
NM_152787chrX53894 3112 2978 1147 348 --32682 858 757 --
NM_152793chr754524 3310 92 85 79 --33424 431 420 --
NM_152835chr152580 1924 842 454 448 32826 2290 818 1857 --
NM_152896chr92625 614 ----1653
NM_152996chr131801 236 175 ------
NM_153000chr18----2243 96 --
NM_153029chr1654049 4011 3990 578 28 --24145 3436 --
NM_153042chr621711 1596 21327 194 1209 --
NM_153184chr321934 119 11882 11354 --
NM_153207chr1253668 2995 2914 1292 1135 --23107 1209 --
NM_153208chr163791 717 209 ----1967
NM_153211chr18148 1412 ----
NM_153223chr511473 --21064 371 1206
NM_153234chr542730 1974 920 844 --2900 195 --
NM_153235chr622454 560 --2652 596 1471
NM_153262chr152071 2026 775 742 709 12965 --23188 551
NM_153332chr842838 2004 522 197 --22868 1015 --
NM_153365chr451865 981 760 653 585 188 12243 --
NM_153453chr61720 --1413 --
NM_153605chr3----11197 --
NM_153607chr552655 2551 857 465 367 12868 42893 2676 2481 179 11189
NM_153634chr1211182 ------
NM_153646chr143935 807 660 --1906 12607
NM_153689chr25934 727 530 96 49 11936 ----
NM_153697chr21591 --1512 --
NM_153757chr4----1875 --
NM_153810chr10134662 4653 4518 4386 3620 3483 3203 3196 2024 905 821 390 362 11576 1617 --
NM_153812chr111578 --12027 11906
NM_170606chr741473 580 534 241 ----11504
NM_170672chr231848 1271 258 --21282 325 --
NM_172069chr211694 12167 1438 --
NM_172070chr242125 1970 1664 1425 --11987 --
NM_172071chr135381 2366 750 27482 6029 26741 189 --
NM_173039chr11190 --1190 --
NM_173075chr421295 414 --11500 --
NM_173079chr1751705 543 466 255 102 --21721 1693 --
NM_173354chr2131911 413 164 --1807 --
NM_173355chr22385 85 ------
NM_173468chr434839 1154 754 25729 472 25381 2079 --
NM_173469chr1521178 1109 --2600 173 --
NM_173473chr1042452 2089 2002 602 12472 1126 --
NM_173475chr1651718 619 566 464 168 --1711 --
NM_173491chr51195 --11158 --
NM_173495chrX52565 2534 2040 1615 984 --21826 1000 --
NM_173500chr15----172 --
NM_173505chr181409 1992 21101 65 --
NM_173508chr121139 424 --1151 --
NM_173511chr253877 3741 3050 2432 637 --23687 79 23910 3568
NM_173515chr6----1805 --
NM_173519chr81323 1241 1389 --
NM_173552chr362414 2396 1796 1769 335 123 21829 343 --2385 354
NM_173582chr1195339 5129 4907 3991 2174 1622 1271 537 450 --26260 4454 24700 752
NM_173589chr11----2535 495 --
NM_173595chr1264893 4247 1268 758 655 82 --25125 4077 --
NM_173602chr1212785 --1267 --
NM_173664chr551453 1117 478 103 49 ------
NM_173808chr153670 3022 2973 1132 775 --1440 --
NM_173822chr211370 1642 2706 557 --
NM_173829chr585329 5200 4705 3826 2194 1605 1191 456 --11114 11377
NM_173833chr821655 1602 ----11694
NM_173854chr11721 --22278 37 --
NM_174890chr10----1308 --
NM_174902chr1131458 410 140 --21467 1266 --
NM_174911chr822981 1257 2849 292 13746 --
NM_174916chr1511893 --12238 --
NM_174921chr421166 954 ----1357
NM_174937chr10----1203 --
NM_175056chr3--1385 22160 360 --
NM_175061chr722035 687 ------
NM_175607chr33686 213 158 --1550 --
NM_175611chr21137 --1225 --
NM_175630chr22733 703 --1797 --
NM_175736chr12127164 7142 6996 6904 6723 5902 5645 5474 4859 1754 1430 25 15447 1200 --
NM_175747chr61806 --1316 --
NM_175839chr20----1284 --
NM_175852chr172996 2684 2620 345 227 174 129 --1426 1198
NM_175854chr1331111 291 60 --1131 --
NM_175861chr1245195 3828 3665 3641 --34477 4256 3966 25629 771
NM_175866chr11101 ------
NM_175884chr721133 504 --1124 --
NM_175887chr73570 487 206 --1420 --
NM_176812chr201776 ------
NM_176814chr751486 1420 1328 578 205 --21105 274 11207
NM_176823chr133022 986 388 --13762 --
NM_177401chr19----2644 460 --
NM_177424chr111400 --11941 11410
NM_177538chr2177995 7271 7068 6936 6754 6544 5593 5379 2933 2723 2094 1760 1449 1044 826 690 553 12179 --35700 3486 122
NM_177999chr943253 2975 1365 870 --33215 133 118 --
NM_178123chr21236 --190 --
NM_178126chr1751878 1792 1707 1463 259 --22139 1840 --
NM_178313chr231993 1788 502 --11945 1135
NM_178439chr2164 --1193 --
NM_178554chr323565 2836 --22479 2386 --
NM_178558chr741136 448 442 190 --11198 --
NM_178565chr831743 1457 356 --1393 --
NM_178835chr4----1677 156
NM_180989chr1332293 2203 876 1715 12281 21831 141
NM_181291chr14------1519
NM_181354chr821337 219 11406 ----
NM_181358chr143333 3122 251 183 --13996 24071 1364
NM_181457chr211244 --1981 --
NM_181504chr544177 2707 2558 1038 --11336 --
NM_181656chr171228 --1207 --
NM_181699chr11----155 --
NM_181723chr832220 2092 408 1597 3577 309 253 --
NM_181782chr632334 1553 232 1452 --11791
NM_181783chr1221780 1567 ------
NM_181787chr853155 2912 2703 1431 1316 1505 33161 1279 656 --
NM_181844chr1741753 1411 1386 320 --1388 --
NM_181877chr1511565 ------
NM_182485chr483662 3112 2560 2404 885 772 670 95 12800 --1346
NM_182487chr933510 493 204 --14385 --
NM_182501chr253305 2554 2254 576 455 ------
NM_182503chr633683 408 163 1556 21378 1134 11569
NM_182509chr1431682 1455 196 --31544 1385 343 --
NM_182509chr1431682 1455 196 --31544 1385 343 --
NM_182515chr19104789 4579 4244 2650 2320 2177 1215 1030 829 647 --45992 4891 2231 653 24475 2570
NM_182557chr1162226 1889 1780 1694 205 141 --1595 --
NM_182569chr172707 496 --1262 --
NM_182691chr72164 22 --11166 --
NM_182700chr731927 1540 533 --21940 1656 11647
NM_182757chr6----13326 --
NM_182760chr32968 823 --1601 --
NM_182765chr102776 259 ------
NM_182767chr1211848 21517 828 1726 1820
NM_182970chr2034274 4036 825 --23762 3720 13838
NM_183416chr112077 --31716 1680 740 --
NM_194071chr763735 3637 3436 3399 2116 1583 24655 4537 --25414 1603
NM_194247chr243172 1661 685 97 --1759 13459
NM_194282chr432842 2645 2159 12131 12399 --
NM_194285chr1172950 2737 2551 2126 1292 1061 275 --32217 2080 1042 --
NM_194291chr83467 352 293 --12497 --
NM_194292chr121779 1353 1563 1178 11705
NM_194298chr1021595 1545 ------
NM_194314chr1105611 5204 5186 5092 4508 4300 3963 3897 1588 1442 45325 3539 1812 1572 45403 2098 1255 804 --
NM_194317chr221846 1034 11903 --1275
NM_197941chr532132 1146 103 11105 1473 --
NM_198042chr83328 45 22 ------
NM_198074chr1172 --21151 862 --
NM_198243chr151385 --1702 1275
NM_198270chrX32937 1255 899 --13132 --
NM_198273chr542985 2929 2904 760 22225 251 32461 2423 1940 --
NM_198279chrX----2797 272 --
NM_198402chr32336 277 ------
NM_198467chr71185 1171 ----
NM_198468chr684448 4214 3805 3698 3122 1336 852 221 --24532 4031 --
NM_198844chr171160 1175 1125 1928
NM_198935chr2032401 993 189 ------
NM_198965chr121105 --1296 --
NM_198990chr772699 2430 2148 2122 1262 742 667 ------
NM_199334chr17----1532 --
NM_199355chr162258 204 ------
NM_199420chr31319 --1807 1313
NM_199461chr1062483 2279 1418 871 382 163 --13557 --
NM_201280chr611325 ----11061
NM_203301chr1441518 437 425 412 ----21309 616
NM_203371chr11----21377 122 11756
NM_203394chr1232670 2551 2228 1331 1854 31896 601 180
NM_203406chr562934 2375 1935 985 948 81 ------
NM_203434chr92970 921 --1997 --
NM_203458chr143826 2673 1412 286 --33702 2658 1119 --
NM_203459chr121850 581 --147 --
NM_203463chr284613 4448 4197 3512 1050 1009 141 128 --23938 235 --
NM_206853chr653432 2577 1052 435 233 11346 33966 1253 117 13903
NM_207009chr102905 658 --1968 --
NM_207043chr1----12056 --
NM_207322chr1552163 1443 826 616 401 1387 ----
NM_207325chr1951811 1803 1291 602 467 11842 ----
NM_207336chr7------1324
NM_207366chr72395 184 2512 75 32326 1712 896 --
NM_207371chr1051568 1520 1327 394 123 ----21454 584
NM_207391chr1921162 832 1925 ----
NM_207411chr833398 3050 2690 --23571 612 --
NM_207422chrX21390 947 ----1297
NM_207506chr85971 273 265 181 132 1553 1981 --
NM_207578chr1----1615 --
NM_212464chr151756 --32066 1495 198 --
NM_213589chr231940 1048 587 11553 11081 --
NM_213609chr3----1108 --