TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-519e-5p
miRNA Sequence: UUCUCCAAAAGGGAGCACUUUC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000125chr662898 1329 1185 743 357 306 22799 2777 --43461 2840 1427 455
NM_000141chr10----21210 1138 21421 332
NM_000351chrX63518 3422 1576 1226 911 173 43263 2900 2860 81 23121 983 1878
NM_000611chr11127008 6693 6669 6206 5876 2614 2052 1911 1850 1658 863 457 76384 5725 4511 2231 1674 1207 546 25382 378 --
NM_000633chr1834125 471 464 24680 1604 44431 4015 1403 1005 24875 441
NM_000901chr432253 848 150 11875 --21737 1609
NM_000926chr11108278 7578 6626 6606 6393 6271 6142 5776 3017 1751 36776 6373 6316 26788 711 --
NM_001001664chr242984 2808 1445 957 11423 1452 33981 3095 2897
NM_001008801chr1961507 679 428 326 157 73 1596 --1834
NM_001009899chr355116 4847 4775 4291 284 14111 --25629 2526
NM_001013746chr74460 380 213 45 1297 --11646
NM_001014797chr1067121 2742 2141 2069 1192 959 37161 6533 1547 36976 6960 5141 13135
NM_001017440chr7197897 7872 7741 7599 7501 5958 5662 5627 5609 3072 2704 2448 1651 1212 1135 1073 998 911 525 36493 2359 1806 --37678 6961 1286
NM_001024647chr1257096 6682 5873 5773 1229 25236 839 32635 1125 696 25642 1642
NM_001037165chr7138003 6442 6233 6154 3107 3064 1998 1601 937 863 854 310 299 48913 8600 6760 3419 35595 2118 1363 16414
NM_001039618chr1173699 2271 2214 1738 1371 760 727 --1621 1914
NM_001042599chr267089 6429 4948 3108 2363 27 11999 12355 12732
NM_001100108chr188080 7112 6942 5585 5451 5134 3220 2637 --26522 1787 27223 2456
NM_001106chr3199646 6585 6547 6505 6395 6363 5980 3900 3840 3810 2915 2215 2111 1853 1799 1113 1020 766 720 28942 3278 --43588 3493 3439 800
NM_002481chr1117780 7076 6716 6159 5733 5704 5247 1063 805 450 268 25258 257 26312 3203 37500 7304 2620
NM_002657chr2073775 3683 3471 991 914 329 152 1811 1342 1323
NM_003034chr1246985 2631 2315 359 37843 7557 6953 --68121 7176 1988 1239 488 170
NM_004432chr91110 1590 --31652 686 546
NM_005197chr1446022 4305 4166 2250 35670 887 705 --34295 3919 1611
NM_005235chr267089 6429 4948 3108 2363 27 11999 12355 12732
NM_005399chr164135 3850 3401 1404 379 298 22896 1776 --23284 1040
NM_005596chr944997 2359 2287 1815 14253 35144 2491 1110 26251 82
NM_005840chrX87493 6400 6010 5904 1990 1224 906 313 37472 4946 1983 26641 75 15941
NM_005955chr144510 4503 3465 1687 --35121 4197 3474 35047 4625 819
NM_006546chr17136578 6548 6375 6211 6087 5483 4762 4407 4079 2607 1912 760 644 35299 1886 985 26043 1180 25041 4062
NM_007050chr20107443 6725 5535 3221 3083 2914 1553 1250 449 357 56515 4967 2029 1939 399 25758 916 --
NM_012193chr1195011 4757 4283 3465 1304 1199 910 289 281 24274 3529 11595 160
NM_012297chr422017 1928 12293 11898 2402 217
NM_013255chr748562 5992 1819 351 38855 8427 7917 11514 27671 2020
NM_014423chr545321 3887 2271 336 25008 4204 45534 5101 5089 3942 25624 1962
NM_014909chr14143606 3249 3119 3052 2979 2860 2836 2701 1571 1187 1021 455 216 39 32587 949 80 13312 1255
NM_015852chr7133619 2680 1133 1049 965 797 629 545 461 377 209 125 41 --1293 --
NM_015886chr865370 1794 1223 1138 604 68 11944 11931 15600
NM_016220chr74460 380 213 45 1297 --11646
NM_016260chr246690 5343 1376 147 --37279 6118 1667 37063 6667 2675
NM_017848chrX33699 1778 426 1197 11410 34551 2937 1468
NM_018416chr1222190 469 22442 59 41829 861 679 528 21875 397
NM_020443chr186623 5068 5044 2675 2181 1780 620 324 26112 4768 15321 46244 5752 992 259
NM_020699chr1125109 5101 5095 5043 4373 3704 1439 1432 1212 722 651 299 35130 3932 3672 11764 35373 4616 848
NM_020956chr19124611 4568 4485 3287 3150 2963 1411 1304 1241 1058 866 457 24300 4246 33690 3344 396 2471 330
NM_021116chr7118736 8158 7499 7130 6883 3384 2033 1430 1185 609 246 27091 127 26944 6096 15799
NM_022091chr622507 263 1129 --2669 274
NM_022166chr16115654 4342 4227 4125 3855 2007 1867 1420 973 656 373 44836 2048 2019 1556 22463 1858 --
NM_022456chr1257096 6682 5873 5773 1229 25236 839 32635 1125 696 25642 1642
NM_022491chr12102952 2804 2616 1354 1212 1165 647 488 252 126 33373 981 375 --11137
NM_022497chr383119 2779 899 739 731 477 102 48 51486 812 705 586 396 11567 --
NM_022648chr293795 3729 3189 3074 1146 1138 368 137 50 31217 213 36 23968 1742 14168
NM_022970chr10----21210 1138 21421 332
NM_024408chr13760 719 607 23427 2779 22707 2586 22410 281
NM_024989chr256339 3124 1800 1720 780 --11061 1102
NM_025054chr823852 359 11523 24137 2965 23805 609
NM_025179chr194378 3178 3035 1257 1106 1036 283 129 85 21729 1024 21085 543 23371 342
NM_030806chr1128535 7953 7893 7678 7606 7582 6991 6473 2696 1967 1525 1469 26031 1187 47244 1763 1152 504 --
NM_031468chr7197897 7872 7741 7599 7501 5958 5662 5627 5609 3072 2704 2448 1651 1212 1135 1073 998 911 525 36493 2359 1806 --37678 6961 1286
NM_032105chr1117913 7209 6849 6292 5866 5837 5380 1196 938 583 401 25391 390 16445 37633 7437 2753
NM_032291chr111870 143 --21205 27
NM_033389chr1784214 1817 1648 1360 745 738 393 381 --23096 400 12950
NM_033430chr423327 2693 --21369 324 22988 1293
NM_033437chr423327 2693 --21369 324 22988 1293
NM_033631chr1113841 3663 3459 3346 2956 2656 2370 1428 803 725 516 42785 1213 1094 1005 12938 12987
NM_080669chr1774890 4152 3362 1497 1385 652 60 53756 3355 1913 958 516 53213 1881 1469 1440 1024 21137 545
NM_133170chr20107443 6725 5535 3221 3083 2914 1553 1250 449 357 56515 4967 2029 1939 399 25758 916 --
NM_139248chr34807 714 688 364 3871 706 697 ----
NM_144571chr455953 2605 2174 1072 651 46605 5944 1299 972 16919 25854 4381
NM_152424chrX44174 3119 1839 51 34489 3978 1481 --44247 4146 3017 548
NM_152734chr6164947 4882 4714 4686 4650 4321 3740 3469 3341 2103 1746 1488 965 872 593 367 55181 4840 3552 1808 1429 ----
NM_153456chr1356125 4785 4201 1675 162 ----2935 75
NM_153607chr5------32247 617 294
NM_173642chr1119010 8627 8368 8255 7347 6649 3476 3367 2898 1889 1317 68305 7856 7016 6437 6221 2336 32892 971 889 --
NM_174934chr1173336 3157 2894 1431 458 408 263 22580 469 31406 1156 441 1788
NM_175623chr1257096 6682 5873 5773 1229 25236 839 32635 1125 696 25642 1642
NM_175736chr12106503 5797 2871 2545 2358 1867 1724 1336 975 955 55748 1841 1218 1019 646 --1996
NM_175910chr1962195 859 696 612 528 108 1781 21654 192 --
NM_182503chr623451 1110 11396 22090 1595 31903 1728 786
NM_182515chr1932120 2108 240 1576 25599 999 15480
NM_182762chr753896 2514 1486 599 581 --1952 15543
NM_182970chr20144257 4202 3802 3529 3333 3291 3230 2771 1415 1223 981 829 636 39 2780 117 1844 1910
NM_198560chr3183414 3191 2838 2757 2646 2529 2376 2313 1275 1188 947 940 922 913 715 680 363 297 --13304 13520
NM_198900chr12106503 5797 2871 2545 2358 1867 1724 1336 975 955 55748 1841 1218 1019 646 --1996
NM_199132chr1961507 679 428 326 157 73 1596 --1834
NM_203329chr11127008 6693 6669 6206 5876 2614 2052 1911 1850 1658 863 457 76384 5725 4511 2231 1674 1207 546 25382 378 --
NM_203330chr11127008 6693 6669 6206 5876 2614 2052 1911 1850 1658 863 457 76384 5725 4511 2231 1674 1207 546 25382 378 --
NM_203331chr11127008 6693 6669 6206 5876 2614 2052 1911 1850 1658 863 457 76384 5725 4511 2231 1674 1207 546 25382 378 --
NM_203504chr422017 1928 12293 11898 2402 217
NM_203505chr422017 1928 12293 11898 2402 217
NM_207406chr4106493 6215 5380 4928 4572 4053 2100 1704 1574 378 16173 26546 1372 --