TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-520c-5p
miRNA Sequence: CUCUAGAGGGAAGCACUUUCUG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr51358 21490 139 11446 --
NM_000052chrX43322 2136 2123 592 43061 2236 884 489 ----
NM_000055chr3----140 --
NM_000084chrX146388 5611 5048 4759 4425 2366 2346 2016 1367 987 944 647 500 181 21872 954 --1164
NM_000109chrX22308 803 1836 12323 --
NM_000112chr5125542 4818 4674 4485 4190 3537 1949 1558 1340 831 462 437 65486 3982 2231 1652 1639 1002 13418 --
NM_000125chr693889 3552 2955 1633 1576 1395 691 126 69 ------
NM_000142chr421356 1130 ------
NM_000176chr523054 384 11240 --13463
NM_000194chrX274 35 ----1147
NM_000202chrX43947 2582 1377 878 --12800 --
NM_000210chr231970 1882 1838 --146 --
NM_000217chr1253846 3624 1857 1413 292 24629 3612 ----
NM_000232chr442801 1017 450 325 ----1946
NM_000248chr32511 262 21192 155 ----
NM_000252chrX1266 1150 ----
NM_000259chr1596170 4894 4439 4145 3909 1954 1703 1610 1347 26022 2112 16152 16160
NM_000266chrX5856 210 176 132 27 ----1756
NM_000276chrX71901 1727 1558 1416 401 361 185 129 11912 --
NM_000291chrX1243 ------
NM_000332chr677076 6434 6373 6190 6173 1000 292 12278 24365 1664 --
NM_000337chr545972 4163 514 385 16597 22291 55 14366
NM_000346chr1731870 788 504 11741 ----
NM_000408chr283424 3034 2661 1048 619 580 505 437 ------
NM_000430chr1783289 2878 2830 2627 1299 776 483 118 1209 23019 40 11251
NM_000441chr71138 ------
NM_000444chrX2148 84 ------
NM_000447chr12351 74 ----1434
NM_000461chr363148 3053 1660 1624 994 432 ------
NM_000462chr152674 570 ----11733
NM_000474chr72703 83 --192 1460
NM_000489chrX52175 1174 992 899 698 ------
NM_000492chr721334 964 1495 --11123
NM_000554chr1943303 2586 1068 75 21093 969 12241 --
NM_000555chrX97713 7409 5887 5671 2988 2955 2359 2182 180 47423 5268 2026 1094 1449 1788
NM_000615chr1172838 2039 2020 847 568 359 137 2957 338 ----
NM_000633chr1854583 4452 3721 3477 3299 21678 1089 14200 1874
NM_000719chr1276112 5522 5428 4623 2012 1803 517 16592 35025 4752 2367 --
NM_000724chr104753 735 646 460 ------
NM_000726chr22262 175 ------
NM_000806chr531590 1560 166 ------
NM_000809chr496785 6661 3727 3588 1884 1797 1196 877 858 --11521 39243 1555 761
NM_000813chr555486 5322 1779 660 642 ------
NM_000814chr1554037 3731 1461 877 562 21128 945 ----
NM_000816chr5----1593 --
NM_000828chrX--1525 --1621
NM_000829chr11----1699 --
NM_000875chr15117043 6670 5968 5467 5054 4587 4574 2386 1526 1499 520 16517 16955 15383
NM_000891chr1763550 3543 2703 1294 639 326 13022 --122
NM_000933chr2021617 1506 11303 ----
NM_000935chr3--31276 836 826 ----
NM_000944chr462250 2046 1605 655 339 123 ------
NM_000945chr2----11710 12062
NM_001001323chr1222281 589 12501 --11948
NM_001001396chr163751 3524 3393 2764 1436 628 11286 13506 13450
NM_001001419chr545109 3643 583 53 13964 11702 14859
NM_001001438chr21------1140
NM_001001890chr2154100 3808 3751 3664 1033 ------
NM_001001995chrX1655 11625 --2185 151
NM_001002814chr852996 933 655 581 205 13654 23135 2827 --
NM_001002838chrX21421 429 --1121 11451
NM_001002857chr151396 164 --1297
NM_001002919chr21454 ------
NM_001003406chr2273171 3031 2380 1316 1139 786 381 ----1705
NM_001003652chr1878023 7309 7193 5903 5711 5641 407 56076 3221 2944 516 196 --28310 7085
NM_001003681chr2232070 753 90 21804 1319 ----
NM_001003688chr42781 419 ----126
NM_001003805chr14--1209 --171
NM_001004065chr973940 3281 3106 2791 908 718 340 13310 22717 190 --
NM_001004317chr674441 4404 4275 3832 3803 3440 3357 13406 21456 607 --
NM_001005353chr14514 427 355 114 11261 ----
NM_001005463chr1022232 851 1980 ----
NM_001005474chr31227 ----11152
NM_001005611chrX3521 334 59 ------
NM_001005845chr831769 1757 169 11332 ----
NM_001005861chr32318 187 ----2794 142
NM_001005910chr31246 ------
NM_001006623chr222107 509 ------
NM_001006938chrX1790 --1165 --
NM_001007067chr81377 1426 ----
NM_001007094chr1053372 3152 3120 1788 1743 1167 ----
NM_001007466chr644464 4095 446 21 25073 1081 1172 --
NM_001007559chr181178 --1218 --
NM_001008239chr1853720 3663 2358 1515 390 1307 ----
NM_001008392chr393032 2822 2765 2739 2668 2304 1396 730 46 32892 2336 519 --139
NM_001008541chr1021597 333 ----11869
NM_001008660chr11------11000
NM_001008701chr1962206 2148 1148 810 360 64 --12806 11952
NM_001008708chr2------1245
NM_001008777chr17--1143 125 1214
NM_001008925chr463161 2421 2213 998 528 417 --22569 658 1636
NM_001009554chr474569 4337 3652 2974 1831 1766 1271 43783 3635 3414 3261 13150 13225
NM_001009899chr385512 5251 5192 5134 4787 4048 3952 566 25714 448 15259 --
NM_001010888chrX44027 3018 770 340 24207 935 --21868 1635
NM_001011553chr74821 678 631 182 ----1348
NM_001011718chr206967 955 887 840 814 640 1877 ----
NM_001012393chr1165006 3621 2050 1584 894 114 --14850 --
NM_001012755chrX95081 4733 4366 4341 3502 3316 1023 350 104 --1362 12000
NM_001012758chr1------192
NM_001012761chr512102 12379 12630 --
NM_001012980chrX----172 --
NM_001012989chrX1494 1646 --1460
NM_001013031chr1042564 2210 887 185 --22600 344 11073
NM_001013843chr152862 792 --1352 --
NM_001014283chr131553 --1589 11863
NM_001014380chr1365320 4187 3612 1179 742 661 1314 13979 1496
NM_001014797chr10147953 7158 6882 6789 6470 6156 6109 5744 2609 2261 1394 950 764 369 67541 7397 5876 5380 3070 2371 11544 --
NM_001015877chrX62878 2536 1196 1121 327 303 42731 2281 1096 946 12582 --
NM_001015882chr9--169 ----
NM_001017415chr1181 1176 1122 --
NM_001017420chr821105 35 --11199 1338
NM_001018050chr2243472 3238 2579 165 --1402 21388 356
NM_001018056chr91241 ------
NM_001024649chr542729 2678 1926 783 ------
NM_001024660chr341312 636 432 361 11433 ----
NM_001024847chr312114 32130 764 740 21981 981 --
NM_001024948chr143000 947 773 361 22824 433 ----
NM_001025076chr1065069 5049 3807 3784 1987 1019 31825 1460 855 1505 --
NM_001025077chr1076427 6407 5165 5142 4872 2377 698 65096 4619 2818 2213 997 672 21863 982 --
NM_001025266chr384903 3489 3104 3013 1547 1053 804 523 24602 3377 --13094
NM_001025580chrX72822 1470 1229 644 638 456 209 33396 3083 928 11091 --
NM_001025596chr111458 1335 ----
NM_001025777chr231192 257 158 ------
NM_001029884chr642534 2388 2134 269 12687 ----
NM_001030055chr1484662 4429 3609 3515 1835 1496 816 50 1965 13484 --
NM_001031685chr1------1137
NM_001031710chr72806 728 --1343 --
NM_001032282chr81476 1820 ----
NM_001032283chr122821 687 1846 --1238
NM_001032288chr202426 84 ------
NM_001032380chr1031562 1483 271 ------
NM_001032393chrX2738 566 1303 --1663
NM_001033564chr6----21884 99 --
NM_001033566chr172357 310 1297 ----
NM_001033578chr812277 --22173 2007 --
NM_001033723chr852048 1912 1123 542 282 1735 11022 --
NM_001034850chr531655 1411 667 --2580 116 --
NM_001034915chr8189 ------
NM_001034954chr1022672 962 2888 796 22215 751 --
NM_001035521chr21120 --1798 --
NM_001037132chr7------2451 37
NM_001037164chr72582 43 2697 550 ----
NM_001037334chr1832001 1943 707 22189 723 177 --
NM_001037954chr1152914 1017 721 218 99 22437 337 1739 --
NM_001038707chr142232 2156 596 176 1876 21449 534 1297
NM_001039348chr2------11101
NM_001039538chr273585 3477 2812 2725 2719 2694 891 12667 12917 --
NM_001039577chr121526 411 43438 1736 745 366 197 --
NM_001039590chrX43916 3575 860 580 13261 ----
NM_001039618chr1145081 5017 4166 4009 22334 2170 14110 --
NM_001039960chr1221511 449 ----1275
NM_001040101chr441358 1229 623 394 --192 --
NM_001040151chr1164156 4143 3096 1681 731 552 --1602 34513 3348 3275
NM_001040214chr632249 1489 623 --21581 950 --
NM_001040272chr932092 552 477 --11945 --
NM_001040429chr1353523 2910 2727 2193 458 23591 3030 12959 --
NM_001040441chr155181 5071 4568 3533 1422 --14816 --
NM_001040450chr1522657 615 1884 --12351
NM_001040712chr941305 1236 102 21 12264 12992 --
NM_001042355chr16145351 4997 4537 4222 4085 3639 3580 3510 2084 1932 1608 1529 1094 914 35076 4104 929 14312 1202
NM_001042388chr181912 ------
NM_001042406chr621151 1143 21243 966 1439 --
NM_001042413chr953046 936 762 254 203 --13593 --
NM_001042494chr1543107 1080 1061 516 12954 ----
NM_001042555chr1284641 4278 1599 1271 1223 1129 812 295 ------
NM_001042599chr2107317 6478 6176 5662 2447 2296 1879 1771 1389 70 22261 2051 15454 25370 2551
NM_001042604chr384777 3662 3475 3298 3162 1840 1191 740 11132 1555 1635
NM_001042683chr631747 421 30 --11307 --
NM_001043351chr122331 2133 ----1885
NM_001050chr1731463 928 245 1107 11167 1279
NM_001100108chr187629 7340 7215 5195 3185 3000 2935 376 47102 6980 2838 2441 15910 11799
NM_001106chr3199366 9153 8530 8146 7928 7538 7320 7274 6961 6613 3389 2806 2665 2512 2206 1603 1261 1135 712 39758 9607 3058 23808 1735 19080
NM_001121chr1021562 711 1646 11214 --
NM_001148chr421513 313 ----1644
NM_001149chr1021236 1011 --11070 --
NM_001150chr151450 ------
NM_001167chrX76466 5235 2510 2305 972 476 325 22606 903 14393 --
NM_001174chrX22129 1674 31745 1734 1517 1381 --
NM_001174chrX22129 1674 31745 1734 1517 1381 --
NM_001204chr257739 6775 6294 2839 1928 --26574 6268 --
NM_001230chr253336 3145 2574 2487 1288 1104 1943 --
NM_001259chr7145843 5433 5352 5052 4000 2475 2329 2037 1683 1533 1460 694 128 103 ----12415
NM_001270chr531083 329 27 1764 --1929
NM_001271chr1543053 2026 767 83 13291 ----
NM_001332chr51243 1160 21537 427 --
NM_001356chrX32425 2400 1764 21677 646 1325 --
NM_001358chr4--1359 --1280
NM_001364chr1194695 4269 3828 3676 3436 3268 3079 1637 1092 143 11557 --
NM_001385chr8------1117
NM_001390chr1811014 --11323 22512 1458
NM_001412chrX23695 3289 --11457 13584
NM_001423chr1241971 1958 1674 759 --12054 --
NM_001438chr152959 2496 1360 807 410 ------
NM_001448chrX21358 528 --11554 --
NM_001483chr72797 398 ----1746
NM_001498chr63892 519 164 --1277 --
NM_001530chr14--21020 89 ----
NM_001546chr611373 ----1351
NM_001621chr772878 2783 2465 2452 1095 1032 780 1162 11879 1580
NM_001627chr3--11533 12145 11863
NM_001659chr1242516 2234 694 287 --31885 916 786 12634
NM_001663chr1411972 --1117 11989
NM_001681chr12----1694 --
NM_001699chr1981816 1577 1513 1434 1271 1249 305 291 --21320 268 21463 1132
NM_001709chr1142188 1764 874 410 11013 ----
NM_001718chr6--21200 993 --11316
NM_001742chr721677 624 1189 1390 --
NM_001755chr163483 454 99 ------
NM_001760chr64882 393 365 251 ------
NM_001769chr12----1310 --
NM_001796chr16294 50 1232 ----
NM_001829chr41397 ------
NM_001858chr623760 1342 23912 1491 --11310
NM_001859chr983923 3569 3450 3295 2762 2607 1410 1192 --1858 --
NM_001880chr2129 ------
NM_001938chr12251 122 21690 546 ----
NM_001939chrX93762 3504 1498 973 926 715 617 447 131 ----21162 797
NM_001955chr6------11102
NM_001957chr432071 1549 1421 --1394 --
NM_001967chr3--1436 1197 --
NM_001969chr1453676 2508 2417 1023 173 --11281 --
NM_001982chr12--11275 154 1787
NM_001987chr1263572 3437 2718 1481 1457 370 ----14146
NM_001999chr541189 499 173 167 11087 1471 --
NM_002009chr1532484 2342 501 42417 2366 2325 2265 --12358
NM_002017chr1131288 1217 1164 ------
NM_002024chrX22237 1536 ------
NM_002035chr1853783 3505 3447 3123 226 23576 831 1744 13961
NM_002040chr2142151 2065 100 47 1187 1411 1352
NM_002095chr8----1319 --
NM_002128chr1332178 1974 1874 12219 1172 --
NM_002135chr12161 ----1441
NM_002146chr1741043 582 561 60 ----11242
NM_002199chr42208 94 ------
NM_002202chr52372 345 ------
NM_002210chr233205 1377 1139 11307 ----
NM_002240chr211648 ----1663
NM_002264chr383337 1959 1870 1666 1581 647 522 444 44056 3561 1598 164 ----
NM_002267chr1312065 31775 300 219 1673 --
NM_002293chr142675 986 741 671 1550 ----
NM_002336chr1273774 3101 1805 1627 852 634 68 34431 4016 3987 21268 723 2687 551
NM_002373chr151527 --149 --
NM_002399chr151901 ----1546
NM_002469chr12----173 --
NM_002489chr71303 ----132
NM_002515chr1451862 1834 808 344 249 --11433 --
NM_002556chr11--22055 426 ----
NM_002577chr363631 3285 3269 2931 1335 199 1663 --33730 2838 828
NM_002581chr995030 4295 1982 1900 1698 607 390 316 271 35160 4450 3491 --1794
NM_002599chr111790 11157 11138 --
NM_002618chr2----139 --
NM_002639chr183941 822 85 --11131 11054
NM_002641chrX41832 1621 398 96 11453 ----
NM_002715chr51817 ----1189
NM_002720chr161261 ------
NM_002734chr172867 393 ----12175
NM_002745chr222401 278 1663 11697 --
NM_002752chr51216 ------
NM_002763chr12209 74 ------
NM_002833chr151444 ------
NM_002844chr611368 1557 ----
NM_002880chr33763 337 126 ------
NM_002892chr1411084 21110 494 11477 --
NM_002902chr15------1466
NM_002906chr111758 31464 929 847 ----
NM_002912chr61635 1853 ----
NM_002938chr42234 218 --11450 --
NM_002942chr3------11005
NM_002956chr1251084 1045 948 395 160 21183 127 ----
NM_002957chr973789 3577 3360 2894 1302 1133 427 23473 1582 13414 --
NM_002968chr16----2700 164 --
NM_002976chr2------1498
NM_002994chr451833 1361 792 668 60 ----1561
NM_002998chr811627 --11984 1166
NM_002999chr2051561 1484 539 287 32 --11377 --
NM_003010chr1752218 959 894 470 316 22463 908 11841 126
NM_003011chr921628 369 ------
NM_003034chr12117752 7227 6910 5970 5287 2629 2608 2285 1724 702 680 1280 27066 6478 23118 438
NM_003042chr322250 513 11673 11737 --
NM_003043chr354287 4241 3462 3161 2789 11461 ----
NM_003051chr11625 --1309 1302
NM_003071chr3187 275 50 --11997
NM_003095chr12138 --1248 --
NM_003107chr61427 ------
NM_003108chr256895 6744 4623 2208 317 25518 477 26305 522 --
NM_003112chr732521 1079 27 22969 63 --12645
NM_003133chr11281 --1153 --
NM_003137chr62381 110 ------
NM_003139chr11----174 --
NM_003144chr641997 782 747 620 --1771 1297
NM_003155chr8----12552 1359
NM_003198chr1------1198
NM_003205chr1532118 1971 899 --1838 --
NM_003253chr2121419 613 ----11634
NM_003257chr1531336 1216 90 ------
NM_003292chr121729 844 ------
NM_003337chr531197 630 480 1136 1342 --
NM_003344chr721487 1160 11629 1157 --
NM_003345chr161535 1432 --1422
NM_003348chr1241589 492 471 215 1636 --1461
NM_003369chr1132002 511 244 --1559 12597
NM_003375chr102172 147 ----1325
NM_003406chr8--11876 2571 544 --
NM_003411chrY51752 1590 1584 508 128 1636 ----
NM_003413chrX21232 730 21971 1872 11919 --
NM_003431chr1------1644
NM_003432chr51498 1582 ----
NM_003458chr393786 3375 3176 3083 3033 2743 2567 2474 587 --290 64 --
NM_003463chr612751 ----12587
NM_003487chr171185 ------
NM_003590chr263141 1532 701 575 475 121 33846 3558 301 --12818
NM_003603chr41528 1685 --11514
NM_003615chr33849 631 133 23375 2905 12492 --
NM_003617chr174969 4427 4147 4081 3520 1305 1052 24648 810 --24924 1019
NM_003632chr171605 --1838 --
NM_003655chr171298 --1489 1716
NM_003664chr5------2145 24
NM_003692chr91935 2400 134 ----
NM_003701chr13--1819 --1836
NM_003705chr22252 201 ------
NM_003743chr251882 1829 1764 520 313 1763 --11851
NM_003749chr1332241 1535 537 ----11617
NM_003760chr1----1712 --
NM_003768chr151473 1329 1198 252 160 --1659 11515
NM_003774chr1232124 548 476 13132 ----
NM_003787chr1851648 1490 1240 1060 205 11501 ----
NM_003825chr1521362 197 --11302 --
NM_003831chr1831729 1488 506 11555 ----
NM_003872chr222165 805 ------
NM_003877chr121243 --186 1839
NM_003895chr212841 544 ----1266
NM_003909chr83693 541 152 ------
NM_003924chr421474 1221 1440 11277 --
NM_003939chr1053869 3534 993 570 436 --14028 13637
NM_003941chr731961 1662 443 ------
NM_003945chr5161 1370 ----
NM_003948chr452584 2115 766 685 587 32202 1694 150 --11766
NM_003980chr631326 1142 103 ------
NM_003982chr14--1258 1334 --
NM_004050chr1452572 2316 2195 2081 913 22639 998 ----
NM_004085chrX3595 586 246 ------
NM_004093chr1333184 675 586 --1480 --
NM_004119chr13------1134
NM_004161chr21330 11149 ----
NM_004175chr22----1111 --
NM_004202chrY3678 575 259 --1621 --
NM_004232chr1863888 2601 1142 914 677 216 32952 744 528 ----
NM_004242chr61324 ------
NM_004252chr173492 163 137 ------
NM_004272chr561784 640 630 618 406 333 1174 ----
NM_004274chr1462481 2257 2157 443 220 100 1398 --13194
NM_004290chr51311 ------
NM_004311chr1043121 2169 1047 314 3985 752 141 12794 --
NM_004342chr761740 1734 1502 676 646 175 21986 359 ----
NM_004349chr811268 --1234 --
NM_004397chr1163667 3561 3483 3463 1532 496 23422 1151 12980 --
NM_004431chr11104 ----1853
NM_004437chr163170 2684 2427 1080 921 172 12216 23534 3104 --
NM_004438chr223217 3150 32929 2142 767 12649 --
NM_004447chr1231078 1065 161 ------
NM_004454chr33888 511 122 1542 1142 --
NM_004458chrX32603 223 190 11826 12313 21946 61
NM_004481chr112663 ------
NM_004505chr1721340 397 ----11862
NM_004516chr191276 11186 ----
NM_004537chr1231364 1070 1029 11526 ----
NM_004549chr113456 241 235 ----11617
NM_004555chr161500 1549 ----
NM_004571chr2163338 3169 2573 2397 2254 660 ------
NM_004586chrX45157 4377 4307 2088 ------
NM_004612chr934721 4076 299 33578 1850 1178 1979 14452
NM_004627chr211109 ----1714
NM_004637chr311309 11104 ----
NM_004654chrY1551 11210 ----
NM_004660chrY52296 1697 1476 246 215 --1323 --
NM_004687chr1731966 647 518 31528 1486 238 1504 --
NM_004705chr111276 1817 --1252
NM_004718chr22536 258 --1602 --
NM_004721chr31258 ------
NM_004742chr3----1670 --
NM_004744chr473900 3518 3345 2690 1441 1047 116 --11580 --
NM_004745chr835200 2745 2075 35021 4765 2120 24795 315 14874
NM_004747chr1061621 1485 1424 1293 271 68 ------
NM_004757chr41114 ------
NM_004762chr1731864 1614 1492 ----11513
NM_004772chr521266 400 --1132 --
NM_004775chr181829 --1573 --
NM_004798chr2052884 2725 2565 350 191 23626 1443 13549 --
NM_004804chr232748 2617 1119 21686 974 ----
NM_004831chr191813 1797 1929 --
NM_004841chr11749 --1808 --
NM_004852chr182313164 12867 11061 9822 9712 9519 8967 8886 8863 5370 5331 5145 4774 4650 3767 3351 1527 1327 1259 1144 992 822 151 913916 13285 12614 12535 9368 5553 3950 1355 657 413611 12185 8763 4581 112893
NM_004856chr151580 ----1467
NM_004857chr1434138 4129 194 ----23984 108
NM_004866chr574982 4924 4714 4672 3872 3701 3560 34749 3914 559 23596 359 --
NM_004869chr1811412 ----11325
NM_004898chr432139 572 125 ------
NM_004902chr20175 ----1272
NM_004948chr1831049 155 98 ----1395
NM_004958chr14891 759 168 52 ----1293
NM_004965chr21--1714 --1109
NM_004985chr1254046 3742 3506 1530 481 33820 3545 3343 11324 --
NM_004992chrX97229 6943 6686 6471 5879 2435 2304 958 650 38037 2792 2373 21575 509 18305
NM_004999chr654275 3667 1759 1733 1255 43444 1201 586 578 --1317
NM_005109chr342437 1972 1900 503 12234 --1125
NM_005112chr4--1703 2185 23 --
NM_005121chr1733513 602 197 --11132 --
NM_005153chr16178 2794 231 190 --
NM_005168chr241304 1175 500 475 --11111 --
NM_005180chr10176 ------
NM_005230chr123638 481 140 ------
NM_005254chr1511335 1511 11287 1174
NM_005316chr111960 --11113 2923 64
NM_005324chr172720 615 21809 1705 --21726 770
NM_005342chrX62519 2173 2047 1915 1064 192 22055 808 --1152
NM_005358chr1321172 317 11244 1136 --
NM_005402chr721308 336 2608 467 11525 --
NM_005406chr1811058 ----11381
NM_005433chr1812571 --1824 --
NM_005436chr1074047 3716 3686 3416 3139 120 80 23539 2846 12833 --
NM_005440chr1763139 2230 1195 794 603 563 12613 1435 --
NM_005465chr11390 1413 ----
NM_005471chr531247 1087 954 155 --168
NM_005502chr9--22019 994 ----
NM_005539chr10------11194
NM_005578chr344350 4043 1665 1653 23914 858 1956 --
NM_005596chr996192 6177 6139 4779 4368 4113 1664 630 422 --15954 15247
NM_005627chr6--1687 --1119
NM_005639chr123354 305 46 11314 ----
NM_005647chrX62523 2290 2137 1337 1179 133 1538 ----
NM_005665chr153962 3622 1500 1437 1195 33993 3421 285 ----
NM_005668chr5--1538 --34147 1721 1337
NM_005715chr62880 698 11033 12445 21777 434
NM_005725chr111816 41635 578 365 231 --1675
NM_005765chrX1158 1306 ----
NM_005780chr13----1747 --
NM_005822chr662284 1922 1771 869 558 218 1210 12058 --
NM_005839chr1----185 --
NM_005899chr17----1197 --
NM_005909chr523597 544 33681 3457 3046 ----
NM_005920chr143580 2757 2534 1223 13371 1452 1742
NM_005935chr424242 1142 55161 3364 3243 1472 289 --13829
NM_005941chr822700 246 ------
NM_005955chr195170 5107 4058 3588 3407 2141 1710 732 25 14405 11057 --
NM_005964chr1721468 1232 ------
NM_005966chr222064 341 1445 --128
NM_005999chr141506 1281 1149 418 11396 ----
NM_006010chr31250 ----1202
NM_006041chr171194 --1148 --
NM_006047chr2042858 991 296 209 23338 3110 --23429 2378
NM_006089chrX--31718 546 367 11736 --
NM_006094chr82812 744 150 ----
NM_006139chr221784 562 1569 165 --
NM_006194chr141208 ------
NM_006218chr3----134 1220
NM_006224chr1772316 1947 1863 1650 673 584 152 12031 ----
NM_006237chr1321798 876 ----1505
NM_006241chr322207 1724 22008 1704 12180 1306
NM_006275chr2032137 1594 825 1842 1409 --
NM_006300chr1922288 140 1295 --1198
NM_006306chrX64006 2251 1565 814 171 30 34940 1098 409 55839 5088 4797 732 61 --
NM_006313chr121660 ------
NM_006329chr141514 ----1754
NM_006350chr51337 ------
NM_006352chr141843 1796 1777 464 --1187 1138
NM_006363chr20188 2252 57 1135 --
NM_006379chr71766 12180 --1364
NM_006380chr1753738 2887 2695 820 780 23880 1175 1767 13384
NM_006387chr1911146 ------
NM_006390chr1241572 525 438 288 ----11412
NM_006393chr1063256 984 941 873 219 163 33635 1189 546 13724 33643 2923 1717
NM_006407chr321345 1028 11385 1953 --
NM_006420chr2022772 297 23118 2753 22673 2535 --
NM_006460chr172626 404 1229 ----
NM_006464chr243904 3656 1554 1544 ----44048 3246 173 23
NM_006496chr151777 1271 684 494 136 21227 300 ----
NM_006593chr2------1714
NM_006599chr1688154 7378 6021 5014 1876 1411 954 673 46052 6036 5893 2987 1893 16291
NM_006609chr22471 273 22248 1914 22450 531 --
NM_006621chr141431 821 288 217 --1186 1678
NM_006651chr4----11156 1569
NM_006704chr13------1134
NM_006729chrX94790 4695 4566 4398 2244 2222 2101 2043 859 2962 559 11346 --
NM_006788chr1861679 1393 438 429 206 22 12099 ----
NM_006806chr212311 175 ------
NM_006828chr6162 1252 ----
NM_006888chr1432651 639 406 ----22272 36
NM_006940chr1211476 1349 1674 --
NM_007005chr921597 629 ------
NM_007011chr1566538 4705 4326 4223 906 824 22026 1504 11418 142
NM_007026chr171238 --1376 --
NM_007034chr11793 2664 417 1337 --
NM_007036chr5178 --1998 --
NM_007039chr1461638 1611 1474 689 423 293 ----12037
NM_007050chr20107918 7659 6723 6352 5995 5892 1785 1256 516 494 15782 32649 2593 2283 15423
NM_007073chr674199 3077 1296 1163 893 266 98 13704 --13261
NM_007084chr1321474 1258 11303 11004 --
NM_007106chr1352743 2586 2316 2176 722 1423 ----
NM_007172chr2252737 2650 2487 2165 1168 33004 1333 1082 11003 --
NM_007236chr1562021 1906 798 769 615 467 --12349 --
NM_007238chr2093893 3860 3801 3402 1113 1051 1032 505 449 11924 44635 3704 3178 271 --
NM_007246chr41781 --1263 --
NM_007249chr13108708 8687 8470 7958 7629 6467 2910 2121 2102 1832 27000 2472 16157 17643
NM_007286chr562096 1898 1490 495 165 127 11636 2698 653 --
NM_007361chr141649 ------
NM_007372chr172899 285 146 2305 233 --
NM_007373chr1021416 550 2661 156 ----
NM_007375chr112199 12011 12324 1160
NM_012074chr142449 22 1924 1101 --
NM_012081chr543232 2665 2486 326 3743 591 479 23000 73 --
NM_012096chr332710 2351 795 22825 954 --13603
NM_012104chr1133485 1532 678 --21038 483 --
NM_012105chr211142 ----1354
NM_012199chr154429 4417 4146 1752 1111 --24484 405 --
NM_012234chr333233 3041 2609 22706 987 13501 12519
NM_012238chr1041363 1256 404 52 ------
NM_012247chr10----1269 --
NM_012249chr222498 1290 --12999 --
NM_012255chr202455 306 ------
NM_012281chr741967 1738 636 180 21784 1772 ----
NM_012287chr364304 3825 1482 1099 436 255 11589 2666 272 13383
NM_012290chr211177 11239 ----
NM_012297chr432481 873 208 ------
NM_012300chr52117 35 --22213 555 --
NM_012301chr731935 504 293 ------
NM_012302chr131025 271 121 1949 ----
NM_012304chr531710 1600 655 12565 ----
NM_012307chr181926 ------
NM_012309chr11104947 4053 3983 3883 3841 3326 3106 1365 1180 1053 21630 1190 1370 24640 1641
NM_012316chr1135616 4422 4204 4185 4026 3748 3588 1764 1623 1332 1004 730 65 --25244 174 11364
NM_012328chr721330 935 --11095 --
NM_012329chr1721567 487 21434 160 11295 --
NM_012330chr1021832 407 --11818 --
NM_012338chr731265 1081 846 ------
NM_012430chr31731 ----1557
NM_012443chr102354 94 --1121 --
NM_012461chr142646 608 1227 --1495
NM_012464chr452610 859 689 642 626 22681 2448 ----
NM_012465chr1063243 2815 2730 2175 1147 364 12720 --12340
NM_013231chr1453271 3118 1587 1037 967 2868 855 --13660
NM_013233chr231363 522 211 2902 473 ----
NM_013261chr413191 33118 2947 1260 13388 --
NM_013275chr161748 ------
NM_013290chr171241 1635 ----
NM_013348chr1971001 940 478 410 353 285 254 21253 870 --11263
NM_013354chr82964 66 --1435 --
NM_013995chrX4999 875 655 294 21622 323 22584 777 1109
NM_014021chr142901 2302 2233 901 --1701 11070
NM_014048chr1663992 3733 973 879 364 71 13254 1289 --
NM_014055chr121213 ----1370
NM_014079chr32751 373 2852 828 ----
NM_014112chr854703 4062 3951 1491 726 34486 961 347 1687 --
NM_014141chr785079 1618 999 951 587 443 307 249 12065 11094 --
NM_014154chr32563 238 21501 119 ----
NM_014181chr232484 2295 85 22691 62 12507 --
NM_014214chr18------1346
NM_014251chr71634 ------
NM_014253chrX42408 2373 951 79 ------
NM_014271chrX--1321 1715 1114
NM_014289chrX2261 228 --11155 191
NM_014323chr222833 395 ----1176
NM_014331chr4117767 7540 7252 5701 4980 2049 1423 1201 612 520 82 37091 6786 1179 14850 --
NM_014372chr121897 244 1169 ----
NM_014393chr812227 32135 1493 491 --1829
NM_014415chr311222 --1521 --
NM_014423chr575471 4599 3469 2230 2172 1903 1554 22007 784 34224 4216 3693 14694
NM_014437chr12985 125 ----1927
NM_014445chr34843 538 346 176 11486 ----
NM_014458chr121399 386 ------
NM_014569chr751448 233 205 143 125 1472 ----
NM_014571chr122555 730 12353 12389 --
NM_014588chr202711 583 1191 ----
NM_014602chr3170 ------
NM_014634chr2233283 1396 1186 21062 1009 --1815
NM_014660chr7--11062 1767 --
NM_014665chr831164 353 46 --23209 2948 --
NM_014666chr521165 954 ------
NM_014701chr1511154 11105 12270 11217
NM_014711chr1632101 827 112 --11872 --
NM_014720chr1021535 115 11457 1269 1699
NM_014729chr822221 279 12040 --1154
NM_014730chr1274200 3766 3438 1153 598 571 436 21642 560 13683 24138 3360
NM_014746chr274366 3098 1755 1051 1003 915 347 31661 608 488 --14285
NM_014751chr832060 829 513 2570 358 2782 145 --
NM_014754chr8------1910
NM_014755chr253115 2753 1704 479 412 1527 13371 --
NM_014764chr122101 73 --1278 --
NM_014783chr1521429 674 21241 718 11349 11195
NM_014819chr552356 2071 1783 1753 221 1128 ----
NM_014827chr121098 95 1102 ----
NM_014832chr132829 285 21923 1686 11513 --
NM_014877chr1756588 6312 5310 1922 573 15698 27585 5490 --
NM_014897chr1742810 2804 2280 577 23063 1181 ----
NM_014900chr211023 ----1228
NM_014904chr1022514 731 43840 1137 553 544 ----
NM_014906chr1732944 1611 974 --23888 1420 1145
NM_014912chr101554 23172 89 13051 --
NM_014913chr1841295 1238 1077 560 ------
NM_014945chr51362 21723 660 --11902
NM_014947chr132671 2599 2247 22127 546 ----
NM_014974chr1031404 1161 32 ------
NM_014982chr1444085 4055 1325 1014 25161 4413 --15216
NM_014991chr432758 2378 704 22909 378 32778 2506 2098 --
NM_014999chr1211391 ----11202
NM_015000chr1221989 438 22190 983 --12325
NM_015020chr1622825 288 --1486 11419
NM_015032chr131171 1872 ----
NM_015033chr942643 2606 2266 550 --13257 --
NM_015039chr1153552 3499 3346 3222 3123 1645 1381 1300 425 411 386 347 333 308 199 12771 33407 373 295 --
NM_015045chr101441 --1863 --
NM_015069chr163441 263 237 ------
NM_015079chr1572976 2951 2779 2677 1990 532 194 1696 ----
NM_015138chr15----1259 --
NM_015149chr131984 1628 1481 --1731 --
NM_015156chr1423706 271 22693 448 1100 11626
NM_015172chr131462 1051 299 21548 1175 ----
NM_015173chr41199 --1250 --
NM_015191chr1112005 ------
NM_015199chr3--32002 538 188 --12866
NM_015236chr421259 413 31533 1137 567 ----
NM_015245chr652044 1975 1963 1957 723 --2351 331 --
NM_015252chr22887 37 --1741 --
NM_015260chr1911498 11228 ----
NM_015271chr444235 4018 3063 188 13785 1577 --
NM_015272chr1631801 1695 84 ----21686 1491
NM_015278chr652584 2410 1141 690 575 12869 3542 85 26 --
NM_015291chr172739 2502 1114 983 481 216 107 2495 121 ----
NM_015293chr62583 121 1453 --1546
NM_015310chr8127585 7470 7232 6469 5086 2852 2465 2320 2230 1535 844 414 37999 7983 3328 26073 1766 18413
NM_015315chr573430 3419 2773 2713 491 479 323 11304 21038 1000 --
NM_015326chr152307 2280 525 518 24 12627 ----
NM_015347chr1212183 12979 1820 1407
NM_015349chr642516 2424 1097 207 12593 ----
NM_015355chr1711548 2413 297 11572 --
NM_015375chr184935 4152 1625 1494 1083 398 223 30 ------
NM_015440chr6--1387 --1277
NM_015465chr5189 --1187 1634
NM_015488chr281690 1400 1390 1377 1312 1129 713 500 ------
NM_015520chr322458 1842 --21800 433 --
NM_015525chr621027 905 21036 355 ----
NM_015534chr1----2426 171 --
NM_015542chr1031112 505 109 ------
NM_015550chr722374 1030 ----22295 98
NM_015554chr1522504 2294 51947 1798 793 204 185 ----
NM_015560chr352698 2590 2562 2353 724 1845 ----
NM_015565chr2121430 546 1379 2741 176 1124
NM_015569chr154093 4018 1007 316 206 --13586 1756
NM_015570chr721765 1451 ------
NM_015601chr10----1828 --
NM_015695chr61743 22036 1921 ----
NM_015726chr121321 1213 --1116 11832
NM_015878chr81194 1452 123 --
NM_015879chr18137729 7493 7441 7169 6508 2779 2518 2430 1776 1634 1560 371 203 36692 6360 1011 25589 2096 25692 5267
NM_015906chr131401 713 464 14170 --14766
NM_015941chr8163 ----1260
NM_015981chr532327 1280 943 --12811 --
NM_015995chr1585045 4971 4768 4392 2070 2045 1961 521 --24914 328 15246
NM_015999chr11476 1101 ----
NM_016059chr62896 56 --1836 --
NM_016076chr172982 2921 2173 2111 475 233 36 --183 12234
NM_016083chr683971 3593 3050 1316 1047 868 861 775 161 --1592
NM_016127chr8--1597 --166
NM_016131chr242328 1629 1517 1476 11986 ----
NM_016156chr1142195 1997 1668 470 3339 149 85 --1138
NM_016257chr173164 2650 2503 1166 215 111 69 --33468 3278 2209 1579
NM_016322chr932975 2095 230 13140 ----
NM_016396chr1521936 556 1680 12727 1221
NM_016426chr225856 760 638 520 70 ------
NM_016436chr201460 32129 735 702 --12488
NM_016442chr521768 778 42028 1819 1499 241 ----
NM_016472chr141332 ------
NM_016525chr93860 814 667 ----1682
NM_016575chr12105425 5103 3768 2188 1567 1427 1167 962 692 318 14149 12073 --
NM_016605chr522357 1728 12137 21809 1787 1603
NM_016620chr11535 21054 946 ----
NM_016630chr151561 ------
NM_017420chr1443569 3284 1515 100 --1133 --
NM_017488chr211228 --122 --
NM_017508chr1162530 1698 1658 1581 709 357 1437 ----
NM_017551chr1032635 2165 1786 22488 867 --12543
NM_017580chr1062317 1795 1487 703 603 194 1477 12270 --
NM_017590chr2242387 1826 1016 525 12698 ----
NM_017594chr933333 2742 872 33353 2047 782 1183 23105 1179
NM_017610chr1552049 692 428 321 204 1736 --1453
NM_017634chr851787 1423 770 488 126 185 1705 --
NM_017635chr111417 11106 11367 --
NM_017643chr171951 22210 434 1643 --
NM_017644chr384967 4497 3518 3279 1912 1501 1344 1121 21680 446 14310 --
NM_017650chr752302 1541 1200 1099 522 1467 35901 732 117 --
NM_017658chr1443709 3653 1644 398 1383 ----
NM_017709chr162926 1443 1413 1036 1027 75 11727 --21357 1167
NM_017712chr1965249 5133 4943 2165 1754 66 56124 5559 4924 1658 116 12232 16317
NM_017752chrX21892 566 ----11735
NM_017778chr81458 ------
NM_017784chr31920 ----1801
NM_017798chr2021173 401 1939 --11243
NM_017813chr874570 3770 3705 2246 1495 1471 1176 11290 --15395
NM_017824chr1021984 774 32490 2259 801 --12361
NM_017847chr141737 753 517 226 ----1773
NM_017848chrX73222 3017 1683 543 351 283 194 24273 1482 11674 --
NM_017849chr272804 2768 2681 1276 827 443 149 32693 2495 2109 ----
NM_017859chr20------1140
NM_017919chr964312 2302 1833 1825 1182 1047 14639 24591 866 --
NM_017943chr14------1100
NM_017944chr1122833 1038 32931 1009 611 23027 2067 --
NM_017955chr14--21007 215 2419 326 --
NM_017987chr1011648 ------
NM_017998chr91296 2307 262 --11312
NM_018030chr182400 324 1423 --11122
NM_018045chr183008 2831 2773 2756 2615 2228 2050 667 22655 1053 12802 --
NM_018061chr1--21754 1523 1585 --
NM_018086chr221834 574 --1141 --
NM_018121chr1052083 1233 850 727 334 ----12011
NM_018126chr411580 11566 ----
NM_018133chr32750 656 ------
NM_018159chrX41522 633 446 176 21213 1092 ----
NM_018184chr33827 470 440 1461 ----
NM_018227chr432587 2476 1236 --1286 1858
NM_018254chr142081 1608 219 96 ------
NM_018266chr31350 --1709 1260
NM_018287chr1031350 1302 959 ------
NM_018293chr342567 1099 776 105 2526 151 1937 --
NM_018312chr1142214 1970 1773 141 11412 161 11673
NM_018323chr411231 2490 35 11510 1298
NM_018327chr2011243 ------
NM_018351chr1254375 3212 3086 1758 1109 14647 23424 267 --
NM_018364chr143577 3401 3161 552 33265 1166 711 --1294
NM_018375chr1461181 622 527 459 396 173 ----11922
NM_018383chr241917 1779 1690 698 --2823 34 11955
NM_018388chrX11401 --11169 --
NM_018440chr8147761 7584 7508 7103 6816 6677 2221 2134 831 751 730 612 104 44 27953 3081 11638 17159
NM_018490chr11--21901 1423 11226 --
NM_018566chr153282 1920 1751 742 55 --13545 14882
NM_018650chr122159 306 --12108 --
NM_018664chr1------1293
NM_018700chr51485 ------
NM_018718chr731740 1500 226 ----11558
NM_018898chr531745 634 217 21940 150 --1603
NM_018945chr623695 1447 ------
NM_018975chr161516 --2672 77 --
NM_018979chr1212559 11616 --1508
NM_019071chr71315 --1580 --
NM_019083chr121150 1052 1466 --1204
NM_019117chrX63061 2968 2852 2554 1284 254 1413 13010 11222
NM_019594chr931481 1035 338 --11410 --
NM_020066chr12404 136 1978 ----
NM_020123chr1021434 1186 ----11252
NM_020150chr1021587 455 --140 --
NM_020159chr411403 11112 11364 1305
NM_020177chr543158 2720 1084 671 11093 ----
NM_020341chr2061516 1260 821 635 592 100 ----11375
NM_020342chr231855 1839 581 11949 --1843
NM_020363chrY1227 3710 542 274 --21520 60
NM_020381chr631425 1371 547 --21753 525 --
NM_020383chr10----2119 40 --
NM_020390chr333249 1572 1127 13494 14413 --
NM_020432chr721986 900 ------
NM_020443chr176332 5089 2673 2618 2399 1896 1695 26787 6129 26434 670 --
NM_020463chr211108 2930 356 11254 --
NM_020466chr674565 4256 4010 3861 1385 1303 334 14473 ----
NM_020651chr251758 1699 1384 1340 95 ------
NM_020666chr5------138
NM_020676chr32962 748 ------
NM_020718chr1694781 2566 2488 1790 1765 1730 908 303 280 56427 2393 2307 594 51 --25966 5578
NM_020768chr542698 2689 1093 195 12749 ----
NM_020774chr1875347 4925 4817 4245 2486 1524 626 35849 5693 1665 14204 11192
NM_020787chr172461 255 --1588 --
NM_020801chr511786 11652 12345 1159
NM_020807chr1631178 1111 558 ----11818
NM_020861chr62852 261 1441 ----
NM_020866chr13------1845
NM_020871chrX41024 433 391 363 1476 ----
NM_020899chr1722485 1652 12442 --11870
NM_020901chr11----1374 1282
NM_020927chr1611701 2510 277 12332 --
NM_021025chr5------1364
NM_021033chr1312685 ----1676
NM_021035chr2021332 461 ------
NM_021090chr2284949 4896 4131 4047 3809 3707 3241 1476 --11020 12009
NM_021097chr222168 763 32823 652 235 1770 --
NM_021127chr1821259 309 11018 11361 --
NM_021140chrX1970 ----1993
NM_021144chr9--1355 --1466
NM_021190chr111056 ----11331
NM_021202chr2082688 2542 2117 1134 1022 692 323 270 12135 ----
NM_021238chr121350 ------
NM_021240chr91210 ----1705
NM_021255chr1453261 3136 2915 2785 1303 23946 440 2640 66 --
NM_021260chr1421264 958 ----11388
NM_021643chr231864 1527 1345 ------
NM_021728chr1431023 269 226 --1795 --
NM_021815chr242788 1233 1042 59 ------
NM_021935chr31746 1841 ----
NM_021943chr642111 1836 764 129 --11712 --
NM_021961chr11117284 7198 6500 6346 5902 4992 2910 2903 2803 1356 1151 37461 2972 1940 1500 --
NM_021964chr366203 4303 4191 2383 1097 233 12222 --24451 39
NM_021998chrX--1403 ----
NM_022037chr22641 347 ------
NM_022041chr1632030 1729 156 ------
NM_022058chr21423 ----1777
NM_022073chr141500 --21534 1098 1537
NM_022130chr511352 --11412 --
NM_022133chr841697 1616 565 29 147 --1551
NM_022145chr53504 238 193 ------
NM_022150chr71539 ------
NM_022166chr16106207 5784 4887 4746 4348 4340 2353 612 453 406 14445 24123 1578 --
NM_022170chr721136 609 --1381 --
NM_022459chr1373888 2455 1427 1267 603 225 27 1351 11259 --
NM_022462chr19223077 3054 2736 2710 2679 2672 2649 2527 2491 2372 1490 1483 1426 1391 1385 1327 1237 791 637 554 215 189 73048 2744 2619 2499 2438 2356 1367 43681 3215 2558 823 --
NM_022465chr124804 579 532 350 12078 12028 22465 755
NM_022494chr102392 91 ------
NM_022552chr211200 ------
NM_022753chr162464 2367 2318 1088 837 829 --1939 11761
NM_022763chr333078 2389 975 ----13038
NM_022832chr422276 1692 ------
NM_022893chr253044 2839 2789 912 104 12242 ----
NM_022898chr1434193 3249 837 ----11710
NM_022913chr5------123
NM_023037chr131346 1335 11151 --
NM_023067chr331276 863 108 1887 1121 --
NM_023079chr1751226 1192 683 611 575 ------
NM_024090chr421516 1398 1500 --31406 396 266
NM_024345chr995950 5854 5198 5126 2210 1931 1321 728 63 75543 4413 4370 2176 1251 669 84 --12353
NM_024513chr333566 3381 3219 13713 1871 --
NM_024524chr343022 2537 2019 554 ----12836
NM_024529chr13817 314 196 126 --2417 279
NM_024556chr114454 446 346 29 ------
NM_024561chr1321344 1311 --1292 --
NM_024567chr8138 ------
NM_024665chr354630 4410 3952 1046 493 34012 3110 254 13176 --
NM_024686chr11392 2487 230 ----
NM_024798chr1552918 2083 1996 1036 926 32048 1136 959 --12230
NM_024831chr81578 2624 590 1184 --
NM_024837chr152614 513 ----1296
NM_024947chr3109533 9346 7859 6568 6402 6011 1013 655 543 506 57773 6283 6220 565 82 11804 --
NM_024989chr276918 6306 5446 2651 1643 1455 1283 27048 5620 25544 899 23285 2032
NM_025047chr31188 1160 ----
NM_025054chr843184 1529 982 622 24191 2614 --14006
NM_025133chr221071 912 ----1846
NM_025184chrX2841 62 ------
NM_030571chr531501 1347 1335 21309 495 ----
NM_030579chr1642956 2645 1363 919 23409 2376 12589 1881
NM_030627chr543049 1387 1124 1017 ------
NM_030648chr444445 1869 1372 649 33766 3396 1471 11954 14729
NM_030755chr1443040 486 350 114 --12097 12746
NM_030759chr101507 ------
NM_030762chr1231974 1711 1239 21665 546 ----
NM_030817chr1273293 2933 2689 2670 1074 1034 371 33169 2730 1521 11172 --
NM_030918chr1105389 5090 4975 4576 3457 1673 630 470 268 106 11499 159 1989
NM_030953chr521053 190 11393 2649 53 --
NM_030964chr542925 2915 2689 2423 23737 3664 1907 --
NM_031216chr1831698 1493 360 --11630 --
NM_031422chr18----1512 --
NM_031445chr263266 2854 2625 1188 1030 932 22906 2557 ----
NM_031469chr662837 2672 1405 1390 824 557 13614 ----
NM_031483chr2071357 1071 950 803 776 336 141 22604 2318 23292 101 11402
NM_032042chr53996 888 160 11823 ----
NM_032047chr331914 1718 1681 41641 651 214 151 1763 --
NM_032174chr141401 1141 967 582 21509 1155 --1108
NM_032199chr1063056 1270 1091 1007 811 179 ------
NM_032208chr231382 1257 21 22513 1443 --1245
NM_032228chr1133413 3206 1396 1321 --11198
NM_032246chr1531072 902 298 ------
NM_032315chr1--177 148 125
NM_032320chr111188 --1607 --
NM_032373chr1065878 4717 4548 4440 1569 962 35329 5086 468 13888 --
NM_032433chr1941230 1061 485 62 ----1330
NM_032436chr131643 ------
NM_032440chr1011964 1395 ----
NM_032449chr15653 474 449 264 75 42922 2013 1008 544 --12183
NM_032457chr453613 2991 2475 1423 152 11211 ----
NM_032458chrX53208 2866 2082 657 633 33061 2611 1276 12912 --
NM_032499chr1521666 705 --1145 --
NM_032509chr831904 939 166 1353 12026 11867
NM_032547chr431328 1175 933 11100 ----
NM_032582chr1721359 408 ----11874
NM_032682chr363080 2987 2731 2408 2215 107 ----1953
NM_032737chr19295 77 1283 21815 864 --
NM_032804chr1011897 ------
NM_032842chr731090 400 30 11582 1126 11331
NM_032873chr1163245 3046 1824 1624 1240 289 --3878 624 204 --
NM_032875chr172185 50 ------
NM_032927chr41526 --1611 --
NM_032961chr411247 1958 2304 216 --
NM_032983chr721173 143 --1118 --
NM_033121chr1221203 606 1516 1298 --
NM_033211chr531456 1428 198 1448 ----
NM_033215chrX1205 ------
NM_033224chr757363 7074 5125 4876 488 36937 6368 6045 36585 2744 429 --
NM_033225chr863226 3055 1260 1067 962 96 22600 484 1593 --
NM_033631chr1113866 3738 3707 2668 2586 2412 1255 920 586 490 358 1886 ----
NM_033656chr2175288 4887 4776 4723 4444 4214 1129 25810 888 --1717
NM_052879chr1243570 3373 3277 624 21409 1040 12654 --
NM_052885chr1234479 4318 3988 44598 4018 3421 131 14087 --
NM_052886chr832011 1945 1810 1453 --11580
NM_052904chr611199 --1267 --
NM_052907chr1253398 1710 678 413 364 34232 3614 3565 --1517
NM_052917chr263367 3283 2911 1353 907 631 1147 ----
NM_052927chr512087 ----11865
NM_052978chr1431723 454 275 --3664 282 109 --
NM_052995chr31231 ----1592
NM_053001chr82276 26 ------
NM_053023chr1133278 1300 512 --2485 352 --
NM_053042chr443141 2971 925 236 22506 1944 --12557
NM_053064chr1462899 2853 2248 2212 1117 80 22585 120 1128 1393
NM_057175chr43983 446 302 ----1994
NM_058237chr142710 354 ----1277
NM_080616chr201127 ----1253
NM_080671chr21433 1788 ----
NM_080818chr133974 407 147 1747 1853 --
NM_133264chr1773594 3158 2654 2629 1380 884 745 1695 1176 --
NM_133265chrX32694 2313 332 --22390 689 --
NM_133468chr752258 948 938 764 458 1229 1438 --
NM_138286chr1964084 3895 3839 2791 1620 1450 14347 --13866
NM_138288chr1451849 1621 1584 560 92 ------
NM_138333chr932166 672 146 ------
NM_138468chr231979 271 76 21728 1151 1137 14963
NM_138701chr71217 ----1198
NM_138731chr1444187 2994 1601 1086 34171 3263 936 --13734
NM_138771chr741320 1304 1297 1176 ------
NM_138957chr22267 39 2163 146 ----
NM_139244chr6170 ------
NM_139321chr2043735 2850 1607 533 13538 --13938
NM_144571chr475294 5242 2644 2140 1451 1210 1110 25741 5123 25936 2172 --
NM_144598chr15------1116
NM_144633chr331478 177 77 21419 1318 1988 --
NM_144642chr32312 126 1396 ----
NM_144643chr4--1356 132 --
NM_144664chr1122573 2456 2846 406 ----
NM_144778chr133671 454 135 ------
NM_144963chr862025 1994 1937 1077 947 906 1977 --22316 652
NM_145115chr732074 892 502 11443 --22298 850
NM_145203chr131157 169 --1623
NM_145263chr422320 435 12186 1176 --
NM_145307chr1063660 3634 3474 3174 688 230 2565 474 13948 --
NM_145315chr6--1471 2116 30 --
NM_145808chr71454 --2752 662 --
NM_145891chr1631242 607 257 ------
NM_148957chr1322602 85 --12496 22193 925
NM_152263chr174470 4405 3888 1876 1346 695 27 22353 942 24580 77 --
NM_152280chr12878 525 11325 33326 1350 752 --
NM_152409chr5--22711 31 33298 822 253 --
NM_152424chrX54673 4655 3888 3831 470 --13093 --
NM_152443chr144578 491 451 380 ------
NM_152446chr14----1399 --
NM_152622chr563080 2344 2129 1015 1004 705 12796 ----
NM_152641chr1222365 718 32307 961 529 ----
NM_152740chr71121 --2706 671 --
NM_152753chr662072 1945 1771 537 252 162 --1559 --
NM_152756chr533328 3020 864 13620 ----
NM_152780chrX4423 404 379 214 ------
NM_152787chrX43838 3177 2997 1243 12796 --1428
NM_153020chr631334 1214 168 1564 11156 --
NM_153029chr1694068 4021 3694 3271 2848 2786 1218 1145 1078 ----1840
NM_153184chr311530 --11439 --
NM_153207chr1243024 1150 476 347 ------
NM_153262chr132049 1130 730 22691 2344 ----
NM_153371chr13143 11559 ----
NM_153605chr311519 ----11202
NM_153607chr543199 2403 1168 1131 32881 2002 399 --1838
NM_153634chr121517 ----11190
NM_153690chr31273 ----1659
NM_153836chr212118 22111 1721 --12074
NM_170665chr1263635 3040 1752 1356 942 607 --24529 129 --
NM_171998chrX11754 42294 2232 2016 791 --12349
NM_172037chr82959 388 31421 1078 308 ----
NM_173074chr21313 --1103 --
NM_173083chr111242 --11106 --
NM_173468chr446035 1718 1361 86 64350 1557 1460 1444 1407 963 23820 2244 14062
NM_173470chrX2326 119 21822 1107 --12223
NM_173508chr1------1768
NM_173511chr222603 516 33373 2437 138 ----
NM_173576chr1042348 2156 1458 730 ----1720
NM_173582chr1136057 4595 191 34376 3921 550 ----
NM_173658chr32652 59 1813 1727 --
NM_173794chrX----196 1510
NM_173808chr154230 3859 874 512 250 43992 3967 3228 1177 ----
NM_174911chr852610 2485 697 235 208 ----12916
NM_175061chr721841 501 12130 1249 --
NM_175736chr12137023 7000 6937 4806 2190 2129 1403 1045 1015 566 411 401 395 --16621 11517
NM_175854chr1331693 846 229 11914 ----
NM_175856chr5--1733 --1523
NM_176814chr72561 461 1997 1966 --
NM_177424chr11290 ------
NM_177968chr211366 --11476 11860
NM_178123chr24899 792 714 389 ----11076
NM_178148chr6------1550
NM_178175chrX----1682 1599
NM_178191chr12482 343 --21144 991 --
NM_178313chr242159 1813 1539 45 31724 804 547 12051 --
NM_178423chr71216 ----1990
NM_178554chr323320 116 ----1227
NM_181358chr123394 155 11220 13192 14019
NM_181504chr522718 1267 23546 1553 1384 155
NM_181869chr1232124 1867 1164 ----182
NM_182485chr431270 946 834 21254 722 ----
NM_182493chr16105308 5173 4536 4070 3883 3672 2162 2033 1081 279 24354 689 11289 --
NM_182503chr6115342 4997 4635 4609 4371 3996 3449 1792 1039 743 284 55605 1753 559 257 170 23937 1636 --
NM_182569chr171272 1215 ----
NM_182700chr761931 1574 1517 1300 657 352 --11921 --
NM_182920chr32561 468 --11371 --
NM_183416chr1----11754 --
NM_194291chr822421 780 12977 12796 22891 1985
NM_194317chr222681 870 ----1444
NM_198243chr153688 315 40 1278 ----
NM_198270chrX43382 1297 228 171 32797 1061 431 2915 384 --
NM_198281chr433182 1003 438 13015 12284 --
NM_198392chr662348 2277 1934 1839 679 355 21730 625 11697 --
NM_198401chr81145 --1453 11323
NM_198503chr1--11656 --1528
NM_198512chrX4583 536 387 152 ------
NM_198513chr821454 56 11928 1815 --
NM_198965chr12----1300 --
NM_198990chr722694 2198 22782 867 12732 --
NM_199168chr101172 ----11250
NM_199461chr1062905 2724 2630 1047 322 219 1396 ----
NM_201634chr531886 1848 1836 --1100 --
NM_203459chr121771 790 1969 12526 1493
NM_205848chr142561 2342 2297 802 32089 945 435 11961 --
NM_207406chr455526 4681 4117 2569 1829 36396 4337 2053 35805 1450 648 46525 6101 4144 1002
NM_207506chr82371 268 1915 21422 415 --
NM_212551chr11226 --1241 --
NM_213589chr274597 4515 3867 3761 975 815 718 34898 1695 376 13886 --