TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-520d-3p
miRNA Sequence: AAAGUGCUUCUCUUUGGUGGGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000055chr3----1167 --
NM_000081chr121290 1253 11452 133 --
NM_000084chrX65888 5161 1514 1065 758 555 14562 22021 1757 --
NM_000089chr72603 164 --1675 --
NM_000092chr284351 4302 3150 1508 1179 1093 965 711 24543 1575 ----
NM_000110chr121160 392 --21229 378 --
NM_000115chr132640 536 --1252 1232
NM_000125chr674224 3759 3675 3326 890 884 45 21001 328 21030 385 --
NM_000158chr3----1660 --
NM_000165chr631190 627 503 ------
NM_000173chr171346 --1407 --
NM_000176chr512593 22921 703 1430 --
NM_000188chr101473 --138 --
NM_000217chr1254172 1872 1251 1113 1037 13271 12092 --
NM_000222chr441831 1821 1336 634 11329 1667 --
NM_000227chr18144 --1344 --
NM_000248chr333002 2126 800 11088 13075 --
NM_000259chr1585646 5030 4724 4014 1192 677 334 102 --21077 626 1316
NM_000267chr1753472 2663 2248 582 102 11192 ----
NM_000282chr132211 80 --1262 --
NM_000297chr421399 137 --12052 --
NM_000314chr103660 419 276 11155 ----
NM_000315chr111271 ------
NM_000318chr82900 573 1356 --12153
NM_000332chr6126930 6755 6445 6044 5107 5034 4635 2449 1389 1372 1178 1004 --35551 5467 2131 11122
NM_000337chr585059 2592 2263 2015 1935 1670 1161 493 ------
NM_000338chr1511184 --167 --
NM_000345chr4----1171 --
NM_000346chr1711768 11851 1797 --
NM_000362chr2213529 --1118 --
NM_000386chr17----1261 --
NM_000388chr331281 229 218 --11251 --
NM_000389chr661309 1291 1268 1153 472 230 ------
NM_000396chr12531 67 ------
NM_000397chrX22367 1808 --1200 22336 2322
NM_000399chr102463 138 ----1771
NM_000401chr11168 ----11132
NM_000408chr263004 1329 1295 1013 695 177 13147 23251 2254 1827
NM_000430chr1742939 2875 1451 294 13237 ----
NM_000442chr17--189 1848 --
NM_000444chrX1113 --1332 --
NM_000449chr12516 71 ------
NM_000461chr374296 3173 3040 510 187 172 36 13997 13523 --
NM_000480chr1121059 22 --21140 234 11290
NM_000489chrX62536 2454 1088 1031 1013 645 1451 1904 --
NM_000503chr831240 583 202 --2635 323 --
NM_000527chr1952168 1512 859 820 90 --11634 --
NM_000565chr11704 --22277 673 --
NM_000578chr241645 1594 1264 252 --1233 --
NM_000584chr411118 ------
NM_000599chr232971 1436 1208 14495 24487 1143 14621
NM_000609chr1052531 2499 1145 1125 252 23129 2195 ----
NM_000610chr114868 733 682 190 12786 --13023
NM_000615chr1162980 2887 2879 2700 1955 428 --164 --
NM_000618chr1292629 2199 1727 1618 1402 831 625 599 426 14198 11587 --
NM_000621chr13----21210 202 --
NM_000624chr14----1868 --
NM_000627chr2--1336 1599 --
NM_000633chr1875182 4864 3698 2032 1933 1429 495 --1750 --
NM_000678chr20----1765 --
NM_000684chr101391 --11227 --
NM_000686chrX31213 528 463 --1431 --
NM_000723chr173400 381 305 ------
NM_000726chr2--1290 11285 --
NM_000739chr7197 ------
NM_000793chr14----14707 13821
NM_000794chr51978 --1660 --
NM_000806chr531730 1410 1324 ------
NM_000809chr4109113 8950 6641 6539 2907 2061 1042 1034 384 218 --38074 2926 1939 26960 606
NM_000813chr574856 4528 4156 3669 1889 1590 330 1640 25222 3602 --
NM_000814chr1533392 2746 736 --11588 --
NM_000817chr22822 51 --1902 --
NM_000826chr462413 2209 1886 1856 394 60 11950 21755 1667 --
NM_000829chr1142000 1917 1486 785 22190 1513 ----
NM_000844chr33404 350 213 --1990 --
NM_000856chr4----172 1253
NM_000866chr321867 1706 --1710 --
NM_000868chrX32178 348 143 11905 --12251
NM_000875chr1597052 6745 5663 5347 4937 4860 1816 1602 1106 --22217 280 --
NM_000876chr621077 1071 --1367 --
NM_000885chr241801 1514 850 252 ------
NM_000899chr1284317 3906 3823 3196 3012 1132 690 198 --24011 2820 --
NM_000901chr431679 1643 861 ----1230
NM_000909chr42899 476 1284 ----
NM_000919chr51402 ------
NM_000924chr1241290 1224 1007 193 ------
NM_000935chr3--1879 1909 --
NM_000944chr482053 1938 1914 1896 1808 1477 847 429 --11503 --
NM_000945chr2--1809 2564 198 --
NM_000950chrX33333 3071 372 23243 459 22587 64 --
NM_001001323chr1222917 2692 --12171 --
NM_001001330chr10--11274 --1946
NM_001001331chr3----11668 --
NM_001001395chr1222507 36 1383 2692 564 12492
NM_001001419chr574164 3609 3406 3291 853 740 417 --44081 3687 2004 1331 11667
NM_001001433chr2042488 2379 722 316 --23115 2509 --
NM_001001481chr832638 2624 136 22484 2436 156 --
NM_001001549chr731786 915 659 12582 ----
NM_001001556chr1511452 141 11162 --
NM_001001664chr234108 844 143 --23616 442 --
NM_001001685chr1742439 1858 919 733 --11993 12822
NM_001001890chr2154183 4122 1610 850 532 1827 ----
NM_001001924chr821400 1284 --137 1265
NM_001001928chr2257058 5871 3004 1814 52 --52725 1974 625 421 176 --
NM_001001933chr1----1112 --
NM_001001971chr10----1106 --
NM_001002033chr172806 246 --1112 --
NM_001002233chr822135 1717 --32042 1610 822 --
NM_001002257chr242729 2186 415 77 33063 2215 140 1545 --
NM_001002265chr10----1582 --
NM_001002296chr821351 1134 --1262 --
NM_001002838chrX31853 1481 300 ------
NM_001002860chr14114701 4577 4315 2869 1815 1674 858 392 300 260 237 11458 14473 21649 1605
NM_001002909chr1752129 1971 1931 1749 621 --1404 11396
NM_001003652chr1888699 8037 6789 6600 2268 2025 1588 60 --37738 6255 118 16091
NM_001003674chr1875763 4904 4518 4469 1647 1367 402 25952 941 1868 16732
NM_001003688chr43383 351 50 --11166 --
NM_001003712chr1233829 2501 521 13652 43167 2663 862 749 --
NM_001003800chr963487 2465 1474 827 485 419 --23361 1170 --
NM_001003940chr1543733 3626 1541 910 11270 23694 3258 --
NM_001004065chr953759 2498 2416 1361 903 --175 12765
NM_001004317chr684548 4418 4008 3103 3073 2881 1538 400 ----11172
NM_001004360chr211498 --1150 --
NM_001004419chr1254444 3281 2810 532 26 ----1929
NM_001004439chr1531060 302 118 ------
NM_001005158chr32435 131 ------
NM_001005386chr242408 928 472 453 22106 265 1666 11958
NM_001005404chr1744368 3367 3247 3042 --23580 3208 --
NM_001005463chr1031991 1981 778 --12510 --
NM_001005473chr536102 1556 741 --35695 4215 4200 11870
NM_001005474chr31408 ----11485
NM_001005753chr222193 702 12182 3903 358 262 --
NM_001005845chr811541 --11290 --
NM_001006600chr562292 1859 1747 1535 872 819 1695 11716 --
NM_001006612chrX----160 --
NM_001006636chr2--1706 ----
NM_001006684chrX1434 --155 --
NM_001007024chr1734376 4290 2944 24348 3211 14024 --
NM_001007102chr671647 1507 1329 1285 1223 335 30 ------
NM_001007226chr172298 154 ----1579
NM_001007246chr2131437 1308 64 1127 11819 --
NM_001007257chr151517 1421 1355 242 70 1499 11098 --
NM_001007277chr11----1382 --
NM_001007553chr12417 359 1271 ----
NM_001007565chr3164 --1112 --
NM_001008222chrX51094 872 521 250 149 --11191 --
NM_001008225chr73598 590 268 ------
NM_001008239chr1883562 2386 1495 1162 886 716 422 110 1491 ----
NM_001008405chr731808 1457 697 --11498 --
NM_001008408chr712325 34478 2480 411 34812 4392 1621 --
NM_001008491chr222073 361 --21845 184 --
NM_001008493chr131442 554 515 --11097 --
NM_001008495chr81243 12040 22194 1956 --
NM_001008541chr1021705 685 --22206 889 --
NM_001008738chr532105 2065 141 172 22139 247 --
NM_001008895chr131389 1220 11078 1450
NM_001008925chr453313 2377 2150 214 198 22536 549 ----
NM_001009554chr453957 3304 1806 1322 74 14537 33359 1481 749 14278
NM_001009569chr10--11290 194 --
NM_001009571chr721431 389 41688 1293 1230 493 2546 321 --
NM_001009881chr1----1622 --
NM_001009899chr366547 5230 2238 1502 765 214 24425 2614 14145 11041
NM_001009993chr284355 4334 3754 3007 1720 1691 1331 575 --11794 12926
NM_001010888chrX114165 3920 3331 3243 3189 2996 2857 2829 1749 471 97 ----1132
NM_001010942chr122969 69 --1518 --
NM_001010971chr111013 --1896 --
NM_001010984chr112236 1974 21700 485 --
NM_001010986chrX12075 1911 --1136
NM_001011513chr463835 3746 3698 3061 2700 1307 21643 195 42989 2922 1173 559 23395 3022
NM_001011546chr201564 ----1336
NM_001011666chr796602 6558 6225 5576 4682 1279 1251 689 70 --16322 26414 2601
NM_001011713chr141156 ------
NM_001011885chr152212 158 --1735 --
NM_001011885chr152212 158 --1735 --
NM_001012393chr1163442 3239 1621 1316 1296 716 14076 44755 4547 4221 1650 --
NM_001012398chr163331 226 30 --1421 --
NM_001012761chr5----1270 --
NM_001012977chrX1929 --1311 --
NM_001013438chr31260 ------
NM_001013622chr411180 ------
NM_001013746chr732340 1670 1653 ------
NM_001013843chr151746 --1376 --
NM_001014797chr10127939 7721 7520 6152 5889 5443 5146 3182 2632 2417 1759 1302 16738 1374 --
NM_001015045chr442398 1825 884 206 1803 --1970
NM_001015048chr1452241 2197 580 311 38 ------
NM_001015508chr8----191 --
NM_001015877chrX42907 2826 1169 1117 --22746 2005 32543 2219 334
NM_001015887chr331839 1690 1228 ----21829 283
NM_001017369chr431091 916 909 ------
NM_001017371chr22559 209 11054 ----
NM_001017395chr363193 2949 2919 2351 1376 714 12589 13648 --
NM_001017396chr261844 578 423 354 298 146 --2785 414 1487
NM_001017405chr42818 179 --1243 --
NM_001017424chr11708 --31780 174 79 --
NM_001017440chr766342 5604 3172 1433 671 167 --47098 5697 2312 710 --
NM_001017923chr1411569 ------
NM_001017977chr1------124
NM_001018009chr321193 1019 --11052 --
NM_001018025chrX------1222
NM_001018056chr91146 --1391 --
NM_001018067chr134206 1141 301 --1635 --
NM_001023567chr1531582 717 528 --31768 893 218 --
NM_001024660chr331339 1241 1163 --1642 --
NM_001024680chr221276 164 --11590 --
NM_001024808chr123924 816 718 22600 1821 ----
NM_001024847chr35642 573 466 273 181 1918 3608 473 224 12430
NM_001024948chr173351 3051 2643 2552 1208 954 180 ----1790
NM_001024948chr173351 3051 2643 2552 1208 954 180 ----1790
NM_001025068chr32709 183 31484 541 247 1719 --
NM_001025076chr1066076 6021 2469 2382 1104 986 ----15532
NM_001025077chr1097434 7379 5101 5011 4806 4722 2462 2344 420 14799 1856 26890 530
NM_001025079chr363912 3623 1241 849 676 372 --33523 2608 1225 --
NM_001025105chr551375 1215 1136 254 166 --150 --
NM_001025108chr253381 921 873 742 125 ----195
NM_001025201chr2----2628 540 --
NM_001025252chr832097 930 522 12746 ----
NM_001025356chr1242986 2944 2158 696 --33014 794 25 --
NM_001025366chr61216 11233 21895 182 --
NM_001025579chr171327 1994 ----
NM_001025580chrX64170 3710 3046 2608 655 182 ------
NM_001025780chr92428 254 ------
NM_001029863chr652927 2871 1184 482 82 --12675 --
NM_001029875chr532992 998 630 ------
NM_001030006chr1731641 463 400 --11807 --
NM_001030007chr1693654 3127 2703 2697 1196 1151 471 253 163 --12619 --
NM_001031677chr52536 160 ------
NM_001031681chr1742246 920 597 28 --12175 --
NM_001031684chr221459 1279 ------
NM_001031695chr22115442 5410 4840 4392 3930 1806 1190 1182 808 284 234 --11559 13523
NM_001031716chr2164 1218 ----
NM_001031738chr2----1499 --
NM_001031740chr131283 120 71 --21446 313 --
NM_001032221chr931763 123 45 --11811 --
NM_001032279chr11----1396 --
NM_001032282chr821313 374 ------
NM_001032293chr17----1442 --
NM_001032296chr1322055 851 --22790 2219 --
NM_001033044chr111733 ----11491
NM_001033047chr422571 1857 --11618 --
NM_001033057chr331407 1396 141 --11819 --
NM_001033087chr2032873 1138 147 23190 856 ----
NM_001033503chr51362 ------
NM_001033507chr11220 1530 1159 --
NM_001033551chr1763545 2999 2763 1529 1014 65 13862 23515 538 --
NM_001033723chr862788 2566 1941 1879 1103 538 --22494 431 --
NM_001034841chr1645489 3787 1564 727 --22152 678 --
NM_001034845chr4----1297 --
NM_001034852chr1441688 782 438 132 ------
NM_001034915chr811154 21420 273 ----
NM_001035003chr42890 574 1411 ----
NM_001035254chr931747 683 423 --21609 1600 --
NM_001035260chr1041400 1309 655 357 ----1235
NM_001035chr11415 ----1425
NM_001037132chr73854 748 740 --155 --
NM_001037164chr731906 1622 1402 --1785 --
NM_001037165chr768552 6519 2909 1874 1607 1246 --28937 7827 --
NM_001037172chr331390 1080 229 ------
NM_001037582chr411318 --11602 --
NM_001037738chr51251 ------
NM_001037954chr1133252 3092 948 1181 32695 963 928 13207
NM_001038640chr1521042 784 --1286 1961
NM_001039141chr2232161 989 116 --22641 1762 --
NM_001039538chr253610 3342 3310 663 290 --1609 --
NM_001039577chr122965 2781 13464 131 11524
NM_001039590chrX43962 3152 2742 1077 12497 13832 --
NM_001039618chr1135648 4832 1700 --24530 3911 --
NM_001039840chrX55455 4796 4308 504 487 24417 944 12197 --
NM_001039916chr12----11052 --
NM_001039937chr1384055 3986 3975 3603 3372 2578 1447 618 23687 1472 1494 --
NM_001040142chr231969 1739 736 --21680 1664 --
NM_001040152chr743869 3367 1979 401 14740 24636 3147 --
NM_001040153chr132866 649 2760 170 ----
NM_001040159chr421485 443 ----11182
NM_001040202chr432182 889 520 ----12155
NM_001040272chr932336 1566 811 ------
NM_001040402chr431091 915 353 --1411 12494
NM_001040429chr1333066 1274 30 --1774 --
NM_001040440chr5----1447 --
NM_001040441chr144254 3770 1988 1144 --55041 4887 4488 3318 1667 --
NM_001040450chr151251 1941 12680 --
NM_001040619chr131423 1404 90 --1329 --
NM_001040709chr132382 938 772 --12578 --
NM_001040712chr943005 2490 2185 78 11403 12199 --
NM_001040876chr4--21451 371 11628 --
NM_001042355chr1675194 5056 4846 3958 3899 1327 956 --24962 190 11903
NM_001042371chr1631695 1399 206 1707 ----
NM_001042388chr18----1306 --
NM_001042404chr141746 776 498 467 11984 ----
NM_001042413chr933769 3382 621 --43468 3303 3290 1281 --
NM_001042424chr432155 1243 1105 --1715 13219
NM_001042459chr32233 102 ------
NM_001042473chr1011533 --12045 --
NM_001042476chr162659 233 ----1244
NM_001042481chr1452451 2062 743 257 166 ------
NM_001042506chrX1929 --1311 --
NM_001042510chr8----1304 --
NM_001042537chrX3908 751 533 12252 12336 --
NM_001042555chr1264713 4059 1206 971 819 219 --34040 3187 1220 14482
NM_001042599chr277411 7248 6785 6620 6527 5501 1606 11088 --12575
NM_001042604chr384169 3679 3274 1769 728 680 188 147 --1382 --
NM_001042632chr2022167 319 --11650 --
NM_001042678chr11373 --1273 --
NM_001042749chrX31488 480 327 --11736 --
NM_001044385chr253745 3159 2536 304 195 ------
NM_001048183chr143704 1103 579 533 --4760 150 136 83 --
NM_001083621chr154287 4071 3383 1824 372 ----11165
NM_001099678chr346171 6104 5833 4768 34587 4459 2584 34342 1319 1194 --
NM_001100108chr1108091 7867 6916 5915 3339 2713 1952 1659 861 852 16768 36086 5446 3239 --
NM_001106chr3129174 8695 8484 8172 7758 7454 7327 7119 3760 3213 2131 775 11693 ----
NM_001148chr461757 1441 1433 305 135 87 --41977 1850 1535 721 --
NM_001167chrX86630 6539 5416 5148 2643 2477 1757 536 --22682 101 --
NM_001172chr142700 221 ----1254
NM_001177chr1242476 2376 1686 72 --21971 586 --
NM_001186chr2172393 2244 2183 2069 1109 835 769 --12145 --
NM_001187chr211116 --1127 --
NM_001204chr267379 6585 3002 2218 2141 211 25542 4777 35948 4858 1528 11633
NM_001206chr952942 2499 795 775 53 ----12296
NM_001241chr23821 712 409 21805 936 12368 12359
NM_001259chr7115087 5046 4587 4179 2407 2151 2117 1133 1078 543 393 --55148 4776 4574 4496 612 --
NM_001260chr131280 --1336 --
NM_001263chr42438 370 --1463 --
NM_001270chr5----1219 --
NM_001271chr1563248 2190 1102 780 255 202 --33285 2453 142 --
NM_001280chr19------1247
NM_001283chr7----1705 --
NM_001293chr11----1506 --
NM_001304chr1782997 2637 2563 2335 1303 827 571 184 --1461 --
NM_001310chr1242764 1158 799 77 --12332 --
NM_001326chr11----1355 --
NM_001338chr213489 374 183 --1289 --
NM_001343chr511695 --11576 --
NM_001351chr331536 480 276 1430 --11731
NM_001356chrX32435 1896 716 1269 22289 1569 --
NM_001364chr1153629 1578 1021 688 372 198 11180 140
NM_001386chr811872 11927 12339 --
NM_001390chr1873324 3153 2838 2580 2329 1109 837 --1406 --
NM_001391chr182939 373 --1151 --
NM_001400chr151132 926 418 284 31 --11007 --
NM_001402chr611584 --1224 --
NM_001406chr1711144 11433 1529 --
NM_001419chr1933206 1278 912 11178 11334 31018 944 852
NM_001421chrX61702 542 414 404 208 92 --151 --
NM_001432chr443653 3069 738 125 ------
NM_001438chr122885 1281 13203 12781 --
NM_001447chr54889 551 234 211 ------
NM_001449chrX135 ----1184
NM_001451chr162927 169 --11204 --
NM_001452chr6--1671 ----
NM_001455chr654511 4111 3427 1502 1025 --13602 24869 198
NM_001530chr1421025 963 ------
NM_001609chr1064173 4074 3856 3733 1129 107 --21498 735 --
NM_001614chr171154 1551 126 --
NM_001616chr253406 2973 2158 564 439 --1759 --
NM_001618chr12681 654 1486 159 --
NM_001625chr1----1127 --
NM_001656chr521393 1325 --2625 153 1452
NM_001661chr171621 --1565 1727
NM_001663chr1422757 2087 --12717 --
NM_001676chr131168 ------
NM_001677chr11343 1142 ----
NM_001695chr844274 2603 493 78 23848 893 13808 --
NM_001718chr61414 11092 ----
NM_001721chrX----152 --
NM_001731chr121952 1755 ----
NM_001753chr7--11566 11175 --
NM_001755chr1671746 1564 789 682 491 450 232 21903 1544 1549 --
NM_001759chr1253995 1401 1330 943 882 --2973 190 --
NM_001781chr122380 284 ------
NM_001798chr12--1211 11053 --
NM_001821chr154464 3201 3151 1229 152 1800 --13077
NM_001830chrX61205 1178 1144 812 725 187 1487 22600 868 --
NM_001839chr16726 653 537 304 264 115 ------
NM_001844chr12----156 --
NM_001845chr132896 227 ------
NM_001858chr644362 3506 1298 718 23868 3654 21750 181 --
NM_001901chr6----1975 --
NM_001944chr1832299 359 200 1106 32101 752 456 --
NM_001949chr652460 2434 1989 1266 838 --1411 --
NM_001967chr31453 --1443 --
NM_001977chr441170 1090 227 123 --31639 411 58 1196
NM_001982chr1231064 277 194 --1828 133
NM_001991chr1752212 852 830 358 40 ----127
NM_001992chr532083 570 346 12189 31727 1642 1535 --
NM_001993chr14902 736 177 157 1995 ----
NM_002009chr1542623 2275 907 734 1155 21099 487 --
NM_002010chr131405 1177 ----
NM_002015chr1333140 923 886 13220 32152 1012 33 --
NM_002024chrX22095 270 --2661 236 1364
NM_002025chrX39110 7036 235 --57761 7398 1880 331 224 --
NM_002031chr63650 544 162 ------
NM_002039chr41285 ------
NM_002040chr21--1721 1949 --
NM_002063chrX1250 --11280 --
NM_002069chr731424 665 28 ----148
NM_002076chr1223262 1011 --3447 433 356 --
NM_002077chr951987 1434 704 364 225 ----1312
NM_002078chr3--1573 --1454
NM_002086chr1721633 1546 12218 22244 667 --
NM_002107chr1----2389 328 --
NM_002126chr1753698 2569 842 679 512 --196 --
NM_002128chr13------145
NM_002146chr1731160 1020 268 21275 953 ----
NM_002148chr21429 --1447 --
NM_002154chr5----1155 --
NM_002160chr91107 --1619 --
NM_002182chr322202 857 12291 ----
NM_002192chr72554 446 ------
NM_002193chr2----21253 1219 --
NM_002198chr51593 1671 ----
NM_002199chr42384 155 ------
NM_002202chr52696 261 --1324 --
NM_002203chr542899 2535 1448 1291 --33013 2628 439 11349
NM_002214chr784106 2275 2239 2095 2082 639 366 294 15677 55159 2215 2069 1014 236 --
NM_002227chr151294 1007 848 483 258 ----1252
NM_002234chr121247 --1717 --
NM_002241chr122791 2226 ------
NM_002242chr221901 1754 --1606 --
NM_002247chr1012214 --31796 550 312 --
NM_002264chr364962 3570 2000 1349 1341 1246 1268 1470 --
NM_002267chr1322312 2226 ------
NM_002270chr565316 5094 4657 4512 4204 1080 11019 12283 --
NM_002293chr142741 2273 433 390 ----11999
NM_002296chr131417 235 109 --11312 --
NM_002309chr2242774 2709 2032 944 --22872 2074 --
NM_002310chr565181 2094 1966 1908 518 70 12601 36346 1414 278 14171
NM_002334chr1131931 1877 1841 --11788 --
NM_002355chr122905 526 ------
NM_002375chr322239 1422 --1254 --
NM_002397chr52851 539 --3736 206 144 --
NM_002398chr2------11202
NM_002401chr1721523 484 ------
NM_002429chr1241148 1020 514 207 --11496 --
NM_002444chrX21952 285 --11630 1129
NM_002449chr5187 --11279 --
NM_002487chr151592 ------
NM_002494chr4----1125 --
NM_002499chr1542042 1968 865 300 21937 371 198 --
NM_002500chr2----1404 --
NM_002501chr1944090 3850 3162 2878 11114 ----
NM_002505chr621154 1105 --11260 2416 301
NM_002515chr1462015 737 531 419 282 71 ------
NM_002519chr112477 103 --11228 --
NM_002522chr1742799 2645 1406 489 ------
NM_002539chr2----1260 --
NM_002546chr8174 --1576 --
NM_002547chrX43907 1692 548 128 --33341 1558 1117 --
NM_002569chr1541504 1250 1212 46 ------
NM_002577chr353682 1605 1467 689 291 ----12915
NM_002588chr51627 --11678 --
NM_002595chr1231866 1613 437 ------
NM_002597chr1----1151 --
NM_002605chr152848 91 ----1374
NM_002613chr1664497 4362 3917 3714 2076 1347 --34607 3697 134 --
NM_002616chr171539 ------
NM_002618chr2----145 --
NM_002627chr10----178 --
NM_002628chr331150 1042 478 11198 1355 1365
NM_002641chrX21258 336 1198 1757 --
NM_002645chr113645 299 155 --12477 --
NM_002655chr875241 4880 4625 4220 1940 1706 682 35032 4973 4247 23632 1591 --
NM_002657chr2033621 3090 863 --23747 143 --
NM_002663chr171179 --1543 --
NM_002670chr321600 1196 ------
NM_002674chr12------147
NM_002687chr141162 --11100 11138
NM_002709chr232574 2245 1439 --1764 --
NM_002717chr84667 460 223 62 ------
NM_002721chr9----194 --
NM_002725chr122831 37 --11391 --
NM_002731chr131142 217 195 --1791 --
NM_002734chr1731729 1413 169 11833 11480 --
NM_002736chr72705 392 --190 --
NM_002740chr311798 11760 22382 626 --
NM_002742chr141130 --1173 --
NM_002745chr22134569 3823 3548 1824 1780 1624 1201 1152 1134 698 480 449 248 --44556 3334 1792 590 1788
NM_002747chr18------1685
NM_002752chr5130 --1366 --
NM_002806chr14----2300 253 --
NM_002822chr1261832 1693 1385 1188 567 109 --1126 --
NM_002827chr2031590 584 538 --31663 1464 446 --
NM_002828chr182687 359 --1931 --
NM_002830chr23146 137 88 ------
NM_002833chr1511386 1532 1403 --
NM_002841chr32494 448 123 1175 --
NM_002843chr1122165 1018 13154 ----
NM_002848chr121937 --1282 --
NM_002868chr1241611 969 906 149 --12396 --
NM_002869chr1152175 2082 1653 575 304 --11816 1695
NM_002874chr921957 865 --21603 838 11524
NM_002892chr1451651 1635 1541 393 82 1281 1483 --
NM_002893chrX----1138 --
NM_002902chr153610 265 27 --1435 --
NM_002906chr11------1105
NM_002912chr62320 158 --1346 --
NM_002923chr11483 ------
NM_002926chr4----1386 --
NM_002946chr12577 464 ------
NM_002968chr1621005 27 ------
NM_002977chr232498 1154 159 --12256 --
NM_002998chr821698 115 1876 ----
NM_003011chr91568 ----1447
NM_003013chr4----2680 160 --
NM_003014chr7--21313 1130 21089 143 --
NM_003016chr1731768 1405 272 ----11948
NM_003022chrX----11308 --
NM_003036chr14976 914 898 763 ------
NM_003048chr222785 408 12705 11097 --
NM_003060chr51903 --11031 --
NM_003105chr11184 ------
NM_003108chr2107109 6990 6609 5720 4434 2652 2068 2059 1652 1031 14542 ----
NM_003110chr1731075 1061 310 ----1791
NM_003112chr722744 37 --22225 367 --
NM_003113chr2------142
NM_003115chr1----2326 186 --
NM_003118chr531675 1504 1329 --21921 1539 --
NM_003128chr232640 2234 905 --1142 1803
NM_003133chr11981 133 21027 83 --
NM_003136chr142336 330 ----1298
NM_003137chr63836 821 605 --164 --
NM_003150chr1752304 1487 932 453 162 --1628 --
NM_003155chr842623 2548 1976 188 ------
NM_003161chr1742774 2322 2223 802 --23344 1423 --
NM_003184chr8----1146 1931
NM_003185chr201338 --11078 --
NM_003188chr62562 137 --1234 --
NM_003189chr163261 3123 2590 1072 1028 224 --23212 2237 --
NM_003205chr151511 --32096 812 633 --
NM_003221chr663689 3421 1668 1500 1479 1131 21615 1326 ----
NM_003222chr203917 232 185 ------
NM_003223chr162860 564 --1301 --
NM_003240chr1------1178
NM_003246chr1531675 460 193 1617 1363 --
NM_003247chr621669 1606 11976 --11321
NM_003253chr2131665 1390 301 11736 11240 --
NM_003255chr1742532 1966 375 224 --12001 1330
NM_003269chr631206 1175 149 --11228 1447
NM_003290chr191960 ----1248
NM_003298chr396173 5647 5151 4869 4646 4008 3974 1301 952 26048 1454 41845 1344 971 420 1432
NM_003304chr341479 1373 1104 1023 --11213 1450
NM_003337chr531484 303 171 --11366 1367
NM_003338chr10278 34 11934 --21584 195
NM_003339chr551174 1111 994 531 188 --11087 --
NM_003340chr421268 410 ----11378
NM_003369chr11--166 1380 1943
NM_003390chr1121092 334 ------
NM_003392chr374349 3574 2784 1534 1354 969 547 11369 13257 --
NM_003400chr21233 ------
NM_003406chr841536 1358 1305 415 --21818 272 1433
NM_003409chr1811100 --1442 --
NM_003410chrX33060 2986 785 --11011 --
NM_003411chrY2579 512 ------
NM_003412chr333113 2786 2606 22809 2372 1692 --
NM_003413chrX51604 1370 734 463 207 --1216 --
NM_003420chr32669 30 --1159 --
NM_003425chr191238 --1612 --
NM_003430chr19------11576
NM_003439chr783453 1428 1112 938 920 766 745 309 11325 33577 2276 784 23224 2589
NM_003455chr1121149 562 ------
NM_003471chr321589 311 --11842 --
NM_003472chr61183 1315 ----
NM_003477chr11----1136 --
NM_003483chr1222846 2160 --1754 1851
NM_003498chr1652553 2350 2145 2107 212 --1255 --
NM_003506chr811218 1102 21189 484 --
NM_003507chr211555 --1633 --
NM_003566chr1212872 161 --13407
NM_003574chr1865075 3839 3562 2261 1467 1067 35443 3546 1221 14037 --
NM_003583chr1293524 3407 3360 3184 2983 2853 2377 1233 603 33272 838 313 --32453 1573 130
NM_003590chr253587 3456 2737 2660 1384 23837 563 1392 --
NM_003592chr7----2343 325 --
NM_003597chr222152 269 --1772 11443
NM_003603chr43678 525 438 ----11682
NM_003607chr183929 3891 3822 3773 3057 2649 1408 559 1245 ----
NM_003613chr151268 --194 --
NM_003615chr332647 2484 1199 13012 ----
NM_003618chr22879 301 ------
NM_003620chr171155 --11103 --
NM_003626chr1111386 1387 21395 51 --
NM_003629chr13846 704 36 ------
NM_003633chr522515 2190 --31865 1770 352 --
NM_003658chr11----1168 --
NM_003659chr2----11199 --
NM_003705chr2--1278 1715 --
NM_003722chr352671 2236 2178 2030 58 22014 430 ----
NM_003728chr42694 105 ------
NM_003743chr211921 --1120 --
NM_003750chr10----2758 675 --
NM_003760chr13780 688 210 ------
NM_003772chr11----1332 --
NM_003774chr1262992 781 768 660 575 124 22288 1076 --12494
NM_003783chr111209 ------
NM_003787chr1811449 --21237 193 --
NM_003794chr31784 --21045 806 --
NM_003799chr1863340 3126 3014 2868 1557 561 1975 43985 907 431 390 --
NM_003822chr142533 2247 2032 88 12879 ----
NM_003829chr91203 --11204 --
NM_003861chr1432607 835 406 1347 --32098 684 629
NM_003872chr252396 2102 2095 1159 960 ----1612
NM_003884chr3----21704 125 --
NM_003885chr172165 41 --12207 --
NM_003887chr282043 1879 1576 1436 700 546 540 22 21672 210 ----
NM_003888chr151187 ----11759
NM_003895chr214859 845 499 29 11496 11526 1256
NM_003899chr133742 695 611 --12329 --
NM_003909chr862347 2083 1091 595 144 82 12451 --22310 99
NM_003916chrX41435 1208 964 35 --1413 11104
NM_003927chr1831094 862 133 ----1302
NM_003930chr71717 --32487 661 421 --
NM_003954chr1721252 1012 --11039 --
NM_003958chr653067 2674 757 235 22 --12873 11409
NM_003966chr5127839 7666 7644 7196 6677 5709 4800 2271 1081 384 289 116 17794 11282 26717 1370
NM_003968chr3----1189 --
NM_003971chr17----1120 --
NM_003972chr1021356 980 --1345 11298
NM_003980chr611100 ------
NM_004004chr1331319 323 293 --21331 91 --
NM_004050chr1422066 777 ------
NM_004079chr112448 --32415 176 44 --
NM_004093chr133907 412 177 --22112 830 11170
NM_004094chr1433001 2428 805 11909 52995 2925 460 208 46 --
NM_004098chr1021127 505 ------
NM_004100chr611998 --1674 12132
NM_004114chrX1309 --1217 --
NM_004117chr652207 1437 879 498 370 --1867 --
NM_004124chr1411389 12880 12719 --
NM_004162chr3------172
NM_004171chr1168788 8063 7377 6927 6602 6310 ------
NM_004226chr21108 ------
NM_004227chr722290 799 --1296 12818
NM_004229chrX32037 1871 149 --12082 --
NM_004232chr1822847 28 --22880 861 --
NM_004235chr91104 --1636 --
NM_004239chr14----132 --
NM_004274chr1412775 --2615 418 --
NM_004277chr631223 687 574 --3363 243 140 --
NM_004279chr732154 581 476 --1329 --
NM_004293chr973701 2972 2786 2352 1085 781 592 1577 ----
NM_004296chr1442861 2459 725 548 --1438 --
NM_004302chr1242797 1889 472 331 21797 648 ----
NM_004308chr1111926 ------
NM_004321chr233551 2396 2194 --13004 --
NM_004330chr152969 283 176 --11150
NM_004331chr81175 --32634 1706 1032 --
NM_004342chr741941 1864 415 196 ------
NM_004349chr82862 475 --1128 --
NM_004379chr21633 --11545 --
NM_004385chr5----1223 --
NM_004397chr1173696 3383 2777 1486 902 615 390 --11158 --
NM_004411chr72713 532 --1201 --
NM_004430chr811984 --22654 807 12468
NM_004432chr922413 447 12070 12047 12278
NM_004437chr133203 939 837 ------
NM_004438chr243308 2975 75 56 --1235 --
NM_004439chr4256 43 ------
NM_004440chr641429 780 239 51 ------
NM_004449chr2131402 1396 1083 11202 ----
NM_004454chr331788 1698 1623 ------
NM_004458chrX42569 2200 1040 899 ------
NM_004464chr433985 3416 583 31517 1496 1279 ----
NM_004482chr22150 123 --1707 1649
NM_004491chr1984306 3905 2663 1521 1234 1130 1089 57 ------
NM_004504chr222587 282 --12995 22256 814
NM_004505chr17----21474 1421 --
NM_004515chr1----1351 --
NM_004525chr2----189 1476
NM_004529chr9----21390 471 --
NM_004566chr101813 --1946 --
NM_004571chr2173233 3095 2561 2541 873 312 103 13304 ----
NM_004583chr172570 559 179 ----
NM_004586chrX95040 4748 4448 3746 3571 1191 874 423 317 25030 3604 21516 841 1395
NM_004612chr944039 3930 974 930 --1993 --
NM_004627chr21----1667 1695
NM_004637chr311039 --11281 --
NM_004642chr122237 192 --1492 --
NM_004660chrY52306 1827 1423 637 563 1267 ----
NM_004661chr51408 --2309 211 --
NM_004663chr151598 11135 --11265
NM_004687chr1751835 1594 615 531 510 21525 1287 21768 1496 --
NM_004690chr61701 3661 602 258 --1267
NM_004709chrX31720 1140 1124 --11705 1313
NM_004730chr551437 1417 574 445 131 --1672 --
NM_004731chr1221340 748 --31529 1422 1248 --
NM_004734chr1322179 208 --1424 --
NM_004736chr142244 2154 489 479 --21740 1502 --
NM_004744chr451312 1253 1182 638 79 --21262 577 11001
NM_004745chr855463 2071 1963 1572 1212 11508 11547 --
NM_004748chr1543460 3434 1348 526 --123 14209
NM_004755chr1431180 753 166 11219 21138 810 --
NM_004762chr1711619 --11272 --
NM_004766chr3------1180
NM_004768chr11906 ------
NM_004772chr521347 1108 11477 ----
NM_004774chr1732319 2313 438 --11066 12916
NM_004775chr1822156 1997 --1918 --
NM_004781chr121358 498 11736 ----
NM_004798chr203970 525 179 --22975 37 --
NM_004799chr1170 ------
NM_004800chr131263 --1192 --
NM_004801chr22530 322 --21101 415 --
NM_004815chr154517 3119 927 853 607 23409 663 --13093
NM_004817chr92597 300 ------
NM_004821chr51555 ------
NM_004842chr621773 364 --11347 --
NM_004845chrX63899 3851 2542 1133 1043 693 --13399 24061 3733
NM_004846chr2----1119 --
NM_004849chr611108 --1653 --
NM_004850chr231170 583 489 11275 11543 --
NM_004852chr18813363 12312 11339 8924 4572 3263 2604 1401 19958 313333 2852 979 28965 2861
NM_004856chr152610 462 ------
NM_004857chr1484750 4712 3858 3470 1833 625 539 69 14102 33498 1431 668 1311
NM_004859chr1712322 22288 409 11198 --
NM_004884chr15----3656 619 113 --
NM_004887chr521110 911 --1164 --
NM_004898chr452812 2451 2265 1073 328 12074 --12891
NM_004899chr2----160 --
NM_004915chr21----2669 574 --
NM_004921chr172378 2238 1901 968 363 215 147 --22248 424 166
NM_004947chr342318 1945 989 637 ------
NM_004956chr783426 1517 1411 715 562 437 175 35 11046 34236 1753 1194 --
NM_004961chrX31075 1026 375 --11095 --
NM_004973chr631660 1596 151 1178 169 --
NM_004979chrX21131 226 ----1757
NM_004982chr122485 58 --1146 --
NM_004985chr1254229 4198 3248 1180 89 --178 --
NM_004992chrX138402 8202 8122 7257 6327 6196 5819 3306 2670 1534 1121 247 175 --22933 2288 --
NM_004995chr143960 429 315 ------
NM_005028chr1041472 648 268 91 --12218 --
NM_005063chr1011021 --13513 13226
NM_005065chr1454669 4592 941 125 66 --21830 912 --
NM_005068chr631115 167 161 ----176
NM_005069chr2111693 --11218 --
NM_005086chr12----1156 --
NM_005095chr111566 11520 ----
NM_005110chr51831 --1719 --
NM_005114chr41192 --1120 185
NM_005116chr2054154 3827 2798 1739 459 24178 772 22933 1028 --
NM_005121chr1733076 1405 1137 12834 1803 --
NM_005126chr342174 1901 1737 617 1226 12259 --
NM_005156chr975369 4874 4866 4726 4435 4271 368 --34719 3781 1135 --
NM_005157chr941903 1660 1556 518 ------
NM_005168chr271680 1573 1353 1171 653 450 326 --21481 1232 21266 466
NM_005178chr19----1389 --
NM_005181chr8----1250 --
NM_005202chr132237 2092 881 ------
NM_005204chr102291 35 --1799 --
NM_005206chr171244 --11219 --
NM_005207chr2242712 2466 1209 1149 --172 --
NM_005222chr71357 ------
NM_005225chr202985 392 ------
NM_005230chr121118 1399 1155 --
NM_005242chr5----21266 599 --
NM_005249chr14--1742 ----
NM_005256chr113610 379 150 --1792 --
NM_005257chr182328 204 --21426 994 --
NM_005277chr431952 1433 634 11962 --1162
NM_005318chr2211196 1223 --11114
NM_005328chr81242 ------
NM_005329chr1662230 1912 1850 1612 633 294 12359 --11985
NM_005339chr432660 1028 458 --1504 --
NM_005342chrX72105 1797 1763 591 324 281 254 2764 306 ----
NM_005370chr19--11293 ----
NM_005375chr651123 984 898 846 436 21151 146 ----
NM_005386chr201567 --1123 --
NM_005399chr14986 776 153 52 --34165 3884 3572 --
NM_005400chr221047 879 11030 ----
NM_005406chr1811359 ------
NM_005414chr32303 209 ------
NM_005433chr1831828 1111 964 1466 1851 --
NM_005436chr1093922 3532 2828 2721 2519 1239 1049 874 459 --13255 --
NM_005455chr1----2374 282 --
NM_005458chr982341 1893 988 895 754 602 343 140 ------
NM_005465chr111997 --1567 --
NM_005494chr71240 ------
NM_005502chr932287 2097 1037 --13084 --
NM_005504chr1285955 5882 5382 2578 1120 600 296 71 26071 1776 12269 --
NM_005509chr511650 --11363 11823
NM_005537chr131703 --1212 --
NM_005545chr151245 --1718 --
NM_005552chr14--2432 237 1491 --
NM_005561chr131793 --1686 1142
NM_005562chr131407 1261 219 --11136 --
NM_005574chr112545 82 ------
NM_005584chr132764 581 ------
NM_005587chr153705 271 25 1191 ----
NM_005593chr12----1551 --
NM_005595chr13372 241 100 1658 ----
NM_005596chr956270 6044 4928 4425 581 11577 25297 4319 21081 257
NM_005598chr121288 1155 ------
NM_005599chr111021 --11126 --
NM_005604chr631825 895 324 ------
NM_005611chr16------11341
NM_005639chr1271887 1684 1508 1206 481 126 26 --11673 --
NM_005647chrX43313 3102 1352 902 --12725 --
NM_005669chr531649 345 320 --1185 11613
NM_005730chr12----12976 --
NM_005737chr22672 463 1905 12289 --
NM_005739chr1522003 166 --1109 --
NM_005742chr2--1766 2830 126 --
NM_005748chr1232580 1159 494 --22708 796 22635 1228
NM_005751chr73482 344 179 ------
NM_005759chr224604 1677 --21806 568 23947 1695
NM_005776chr141271 1684 ----
NM_005802chr91204 ----1809
NM_005819chr143449 1369 939 171 --1483 --
NM_005822chr662288 2227 1812 1600 1579 1567 --12254 1493
NM_005832chr32987 491 --1249 --
NM_005859chr531102 1063 978 --11425 --
NM_005862chr32810 784 11027 ----
NM_005871chr103944 316 157 ----1260
NM_005880chr16----1223 --
NM_005898chr1163026 2392 685 577 498 469 21257 742 11250 --
NM_005904chr1831371 1190 1170 ------
NM_005909chr554041 3912 3149 520 309 1982 34078 3774 821 --
NM_005911chr221220 922 --1388 --
NM_005923chr61103 --1274 --
NM_005933chr1162565 2395 2327 2191 860 387 ------
NM_005935chr454556 4320 4179 2006 666 13682 ----
NM_005937chr1733242 2619 983 --24154 366 --
NM_005941chr833912 3060 1397 21514 760 11561 --
NM_005955chr145469 4646 1582 927 --25352 3585 13718
NM_005966chr252397 1834 928 609 287 --11601 --
NM_005977chr13155 --1280 1374
NM_005986chr131439 --1608 1473
NM_005999chr11123 --1577 31227 1199 1155
NM_006011chr1544283 4205 3711 207 14168 14142 --
NM_006016chr631972 1474 467 11544 ----
NM_006037chr274284 3883 3478 3148 2960 1572 1427 11224 23955 3174 --
NM_006040chr1631062 930 466 --11290 --
NM_006076chr742475 991 331 86 --1590 --
NM_006084chr14----1310 --
NM_006088chr9----1143 --
NM_006089chrX11732 ----1234
NM_006106chr1142903 2733 2557 701 23400 1041 11029 1389
NM_006134chr2141521 1370 1290 1154 --21112 361 --
NM_006135chr121370 410 --1401 --
NM_006136chr711369 --1513 --
NM_006141chr1632515 2498 2227 --21980 568 --
NM_006148chr1722667 2581 ------
NM_006154chr1542722 2264 995 430 1194 32008 893 138 --
NM_006159chr12--1580 ----
NM_006161chr51246 --1566 --
NM_006166chr121831 12569 42068 1939 1772 499 --
NM_006186chr21218 --11069 --
NM_006195chr921225 1046 --1211 --
NM_006206chr462762 2383 2272 2217 445 348 --22043 542 --
NM_006218chr31111 ------
NM_006226chr221254 879 --11180 1405
NM_006241chr321646 527 --1203 --
NM_006243chr11848 ----11065
NM_006251chr533029 2485 914 --12059 --
NM_006256chr162727 2091 1974 1088 207 188 --32477 2206 1991 21074 718
NM_006264chr4126 ------
NM_006283chr8104634 4117 4055 3667 3478 3403 1921 1416 1199 35 11678 ----
NM_006292chr111173 ------
NM_006298chr671268 882 619 540 259 38 28 --22724 628 12957
NM_006307chrX--1142 ----
NM_006310chr17----1380 --
NM_006313chr1251670 1499 1084 510 493 --1155 11477
NM_006315chr474526 4278 3696 3147 1810 1132 638 22836 66 24328 2799 12870
NM_006325chr121848 --1657 --
NM_006327chr101321 ------
NM_006335chr13738 434 213 11035 2863 137 --
NM_006345chr431224 912 312 11051 1888 --
NM_006352chr131769 167 133 21721 1509 11477 --
NM_006361chr171287 --2519 341 --
NM_006379chr73789 181 157 ----2739 489
NM_006380chr1764375 4357 4073 3398 2819 490 11687 43658 1619 693 643 --
NM_006390chr1231141 480 40 --1140 --
NM_006401chr9----1332 --
NM_006424chr431793 787 179 --11557 --
NM_006464chr254134 3995 3572 234 145 --13299 --
NM_006467chr51867 --2415 95 --
NM_006472chr121224 515 --31198 1171 801 --
NM_006486chr223631 118 74 --1511 --
NM_006496chr121531 130 --11540 --
NM_006504chr101401 --32682 1008 439 --
NM_006517chrX----1115 166
NM_006526chr2031949 1654 330 --2816 672 --
NM_006534chr2042425 1263 842 719 --11301 --
NM_006537chr153623 591 95 ------
NM_006538chr254000 3843 3579 1171 229 --24062 884 --
NM_006544chr1441429 1313 578 348 --35370 1530 1070 --
NM_006546chr17106065 4141 4055 1463 1298 1093 1078 936 693 246 --11186 --
NM_006547chr741750 838 551 272 11914 11996 --
NM_006557chr931655 1546 298 --11737 --
NM_006565chr1611162 11170 1793 --
NM_006578chr151200 --1371 --
NM_006595chr1151313 1283 536 81 71 ------
NM_006597chr112175 25 ------
NM_006599chr16118124 7453 7060 6578 6497 5818 5763 5489 1343 992 576 --26772 5377 --
NM_006602chr201339 --1271 --
NM_006609chr232083 1159 70 --41896 1884 1873 270 --
NM_006614chr322690 1440 1254 2184 156 13298
NM_006618chr121605 318 ------
NM_006621chr1--11707 11351 --
NM_006624chr1022088 250 ------
NM_006626chr932217 1959 446 --32335 2132 74 --
NM_006628chr1544055 3607 3253 266 --24504 3912 --
NM_006648chr9----1117 --
NM_006667chrX----1109 --
NM_006682chr731826 921 168 --52252 792 361 141 63 11144
NM_006690chr2022259 388 --22310 1764 --
NM_006691chr11------11236
NM_006698chr2031222 167 72 1504 ----
NM_006711chr162791 728 --1768 --
NM_006717chr922415 2095 13312 22857 177 --
NM_006729chrX84288 4119 3747 2070 532 146 105 54 --2657 635 --
NM_006734chr621167 219 1632 21441 279 --
NM_006738chr1574193 4015 3888 2949 1716 733 561 ------
NM_006750chr16108027 7574 6946 2613 2572 2372 1549 469 353 198 --26690 5768 --
NM_006751chr2181 ----1901
NM_006765chr8--128 --1238
NM_006771chr172314 308 --2813 272 --
NM_006775chr643057 3015 279 121 --22912 991 --
NM_006777chrX32844 2793 2685 --2494 371 --
NM_006791chr151491 ------
NM_006806chr211172 ------
NM_006823chr851170 522 454 442 68 ------
NM_006826chr221204 200 --2837 514 --
NM_006827chr1412543 --1295 --
NM_006885chr1663724 3272 3172 1446 724 447 11310 ----
NM_006902chr143192 2214 827 90 --12930 --
NM_006910chr16--1116 ----
NM_006912chr152534 2357 962 194 70 --21698 1656 --
NM_006914chr92459 331 1119 ----
NM_006920chr221462 362 1581 21540 1291 --
NM_006939chr141202 --191 --
NM_006940chr121277 --11481 --
NM_006948chr211775 1309 ----
NM_006981chr922930 1175 --1289 --
NM_006991chr32833 721 --21005 175 --
NM_006999chr531881 607 296 ------
NM_007005chr911578 --21536 45 --
NM_007007chr1244216 3342 3072 548 14074 11715 14743
NM_007010chr1711526 --11190 --
NM_007011chr15136699 6146 5907 5327 4988 2438 1950 1861 1477 1454 1429 1206 614 14324 15416 --
NM_007013chr81790 136 1951 --
NM_007034chr131025 870 38 1723 ----
NM_007038chr2165924 5614 5208 5190 1036 48 --26050 1296 --
NM_007039chr1431687 761 112 1537 3855 264 63 --
NM_007040chr191184 11032 ----
NM_007050chr2087882 7801 7000 6032 5043 2388 1342 645 --27589 1610 --
NM_007073chr654041 3557 1540 1484 975 --22852 68 --
NM_007084chr133294 233 64 --11193 --
NM_007114chr331139 980 235 13015 22211 1232 143
NM_007146chr1782859 1976 911 700 555 521 505 323 --2862 135 --
NM_007157chrX42791 1894 1114 436 --32647 1971 837 --
NM_007159chr311100 ------
NM_007170chr11270 ------
NM_007174chr1252144 1951 880 263 243 ------
NM_007212chr122289 868 12107 ----
NM_007216chr112957 76 --31164 1021 218 --
NM_007246chr41103 --183 --
NM_007249chr13139343 8058 7322 7018 3761 3694 2999 2659 2553 2321 1589 1133 546 18991 69387 7617 6931 3473 2692 1105 18243
NM_007271chr62589 444 ------
NM_007275chr331097 960 416 --2475 371 --
NM_007331chr442287 955 479 93 12613 21746 190 --
NM_007345chr1831902 1769 503 --165 --
NM_007375chr132452 2159 1725 --22460 574 12730
NM_012069chrX12136 --11762 --
NM_012081chr553518 2963 2439 1395 167 --23480 937 --
NM_012082chr8----3657 385 362 --
NM_012095chr1042188 601 571 530 --43031 2179 817 106 --
NM_012098chr911332 1370 21473 498 --
NM_012104chr1162774 1281 1275 920 359 217 --13025 --
NM_012115chr6180 ------
NM_012158chr1341293 750 741 320 1358 1448 11817
NM_012160chr6--1341 1193 --
NM_012161chr431104 1088 60 ------
NM_012166chr951523 1510 1488 1453 1373 --11038 --
NM_012193chr1134562 1528 634 --34463 1812 53 --
NM_012197chr921323 659 --1516 --
NM_012199chr1104513 4503 3992 3710 3451 3234 1003 921 711 276 24383 721 11129 --
NM_012214chr2126267 5942 5840 5824 5595 5535 5487 5296 2324 2148 1687 348 --45610 1293 1235 649 --
NM_012215chr1061605 1457 763 621 600 307 --11705 --
NM_012218chr1912209 137 ----
NM_012233chr2----1836 --
NM_012234chr372652 2338 2316 1168 910 767 693 11355 ----
NM_012238chr106694 605 518 457 178 41 ----11302
NM_012242chr101117 1224 ----
NM_012255chr201429 --1105 --
NM_012257chr74859 693 182 125 1837 ----
NM_012259chr631286 1085 1030 ------
NM_012262chr1125159 5038 4693 4016 3551 3198 1390 1185 931 879 458 193 35191 5089 938 31800 1372 345 11233
NM_012281chr72797 176 22002 580 ----
NM_012290chr2----2466 69 --
NM_012293chr232268 1858 1441 --11622 --
NM_012294chr752804 2734 1422 920 237 --137 11011
NM_012296chr1133483 2972 1503 --1132 --
NM_012297chr442535 2324 1714 586 --22647 1988 --
NM_012300chr542277 474 400 375 1860 ----
NM_012306chr121797 --13199 --
NM_012307chr18----1253 --
NM_012308chr1132218 1751 614 1696 ----
NM_012309chr1154328 3365 3154 535 504 11156 ----
NM_012319chr18----1926 --
NM_012325chr201140 ------
NM_012329chr1721106 48 ------
NM_012330chr102493 484 --1412 --
NM_012342chr10----171 --
NM_012343chr53781 766 420 ------
NM_012384chr2032457 2258 830 --1752 --
NM_012395chr773277 3238 3051 2659 2452 1324 205 --1659 --
NM_012396chr1----1700 --
NM_012405chr143875 3690 3552 1251 22391 432 ----
NM_012406chr12--1285 --1148
NM_012464chr442874 2487 513 180 1634 12416 --
NM_012465chr1041228 1139 908 861 ------
NM_012479chr732168 642 409 --11981 --
NM_013230chrY------1508
NM_013231chr1464116 2757 1289 259 120 112 24050 1269 13617 --
NM_013246chr11----1801 --
NM_013277chr123910 102 30 --1200 --
NM_013283chr5156 --2583 94 --
NM_013290chr171154 --1412 --
NM_013313chr2243117 2781 1380 1044 --1393 --
NM_013316chr72862 849 --1212 --
NM_013354chr83431 340 141 ------
NM_013381chr12----21734 580 --
NM_013396chr2121400 367 ------
NM_013437chr821431 913 --11297 --
NM_013446chr731044 1010 522 1301 11439 --
NM_013450chr211219 --21177 790 --
NM_013943chr121258 1215 --1724 33041 2893 634
NM_013995chrX42223 850 752 404 1973 32499 1036 817 --
NM_014011chr222067 294 12616 12257 --
NM_014021chr163386 3268 3249 2380 2311 266 --1305 12991
NM_014023chr10--12707 2968 731 --
NM_014028chr652423 2386 815 413 289 --12112 --
NM_014034chr641544 1294 1256 964 --1587 1283
NM_014048chr16105298 5017 4679 4011 1687 1669 623 455 448 230 --34598 3588 886 14567
NM_014071chr201345 ------
NM_014109chr81862 1299 1341 --
NM_014112chr874395 3947 2204 2007 1139 973 386 --44897 4882 4375 1833 11817
NM_014117chr162761 722 --22684 2171 --
NM_014155chr1166789 6782 6763 2991 2392 798 --26605 138 --
NM_014157chr1663966 2898 759 408 401 215 --13757 1247
NM_014166chr1311020 --1381 --
NM_014240chr343216 2864 1361 654 12821 13708 --
NM_014243chr421783 1503 ------
NM_014249chr152518 31 ------
NM_014253chrX32450 2369 1590 ------
NM_014282chr91133 1466 --1872
NM_014283chr1----11227 --
NM_014289chrX21361 1178 --21136 457 11338
NM_014294chr841390 151 136 65 --11108 --
NM_014319chr1221737 762 1561 1271 --
NM_014326chr152997 207 11256 1109 --
NM_014331chr4117471 7354 7256 5977 5329 5247 4872 2816 2810 1038 868 14879 31981 1380 562 16944
NM_014338chr22----11095 --
NM_014344chr111776 ------
NM_014363chr132267 64 ------
NM_014368chr932170 1697 725 11527 12067 --
NM_014372chr132042 2015 418 --11577 --
NM_014382chr321711 1427 1295 ----
NM_014399chr73774 368 251 --1277 --
NM_014409chr11832 ------
NM_014410chr181134 1365 ----
NM_014415chr321458 337 1368 1478 1596
NM_014423chr555358 5316 4840 4830 4518 1748 33954 2265 793 --
NM_014426chr20--2216 62 ----
NM_014445chr321575 425 12045 1933 --
NM_014452chr62857 340 ------
NM_014454chr6----11023 --
NM_014456chr1021780 118 --21466 98 --
NM_014458chr121116 1028 11252 1147 --
NM_014488chr113523 240 169 ------
NM_014494chr1632380 697 55 --1886 --
NM_014504chr72823 489 --1111 --
NM_014517chr311729 1368 1746 --
NM_014554chr1221436 851 --12095 --
NM_014572chr1331711 1195 653 ----2369 269
NM_014577chr224920 881 716 634 --1853 --
NM_014585chr221137 1113 --11171 --
NM_014588chr203597 215 56 --1708 --
NM_014607chr222057 1563 --1405 --
NM_014612chr911295 21004 251 2379 237 --
NM_014613chr533055 2282 2060 --22516 2441 --
NM_014629chr8--1410 21227 207 --
NM_014634chr2232588 2509 2433 ----1800
NM_014647chr1662057 1567 1543 830 318 237 --1790 --
NM_014660chr7--21093 283 ----
NM_014666chr511006 --1189 --
NM_014671chr721050 488 ------
NM_014679chr1131040 545 267 ----21090 183
NM_014682chr842232 2125 1872 353 1108 11897 --
NM_014705chr731712 762 84 ------
NM_014709chr2--1613 ----
NM_014713chr21340 --1364 1126
NM_014727chr191257 ------
NM_014729chr812053 ----1119
NM_014732chr16105717 5180 5162 4919 3616 2172 1911 1587 1035 1028 11104 12201 --
NM_014737chr2052976 1477 1044 845 73 --14240 --
NM_014752chr1121938 585 --31541 334 302 --
NM_014755chr283105 1701 1060 894 864 689 683 438 1512 13363 --
NM_014764chr122870 147 11248 2201 52 --
NM_014772chr1833370 2711 778 --12401 --
NM_014774chr142577 786 466 388 ------
NM_014784chr12943 379 ------
NM_014786chr111149 ----1428
NM_014795chr22878 478 ----21125 268
NM_014798chr17----1348 --
NM_014803chr1042374 2318 1909 1085 --21024 901 12728
NM_014810chr153435 3110 2697 1279 757 1111 ----
NM_014813chr1--2614 54 193 --
NM_014819chr521918 1674 ----12199
NM_014820chr321765 801 1577 11567 --
NM_014827chr1--1385 11624 --
NM_014832chr131769 --21415 1369 --
NM_014835chr2021512 870 11940 21577 1421 --
NM_014839chr122426 1904 --42312 2010 1949 724 --
NM_014847chr11441 ------
NM_014848chr1562496 2159 1953 1008 917 526 1477 2764 305 --
NM_014862chr1533922 2976 919 --13533 14067
NM_014869chr32520 385 --1283 --
NM_014872chr961614 705 599 568 523 166 1409 --22149 348
NM_014873chr164780 4493 1715 951 941 729 13087 14845 --
NM_014874chr12327 155 --11780 --
NM_014876chr2231991 1970 1892 1215 11638 --
NM_014877chr1787226 5816 5709 5328 5159 2562 1676 187 --25294 2442 1373
NM_014891chr721051 1045 --21271 232 --
NM_014899chr522119 855 1390 13039 12242
NM_014901chr552201 431 301 177 119 ----22135 1715
NM_014903chr12----22341 210 --
NM_014904chr1053977 3879 3680 2720 1470 --13638 --
NM_014906chr1733239 2954 467 13127 33740 904 749 --
NM_014912chr103228 63 28 1397 11156 --
NM_014920chr622934 501 --33237 286 258 --
NM_014924chr1423073 2596 --32516 1138 786 --
NM_014926chr31947 --11018 --
NM_014943chr841052 848 467 355 ------
NM_014947chr132742 2303 190 13137 ----
NM_014952chr1541957 1420 541 60 --32058 1311 78 --
NM_014953chr1344305 3984 1095 135 --1332 1977
NM_014961chr422237 2159 --11653 1544
NM_014969chr11814 --11134 --
NM_014982chr1495241 4949 3676 3641 1983 1757 1564 727 531 15275 11349 11423
NM_014989chr651932 1923 1534 1262 83 --1758 --
NM_014990chr141859 ------
NM_014991chr422795 868 13275 ----
NM_014994chr1542321 1928 651 463 --11616 --
NM_014999chr1221644 196 --21386 1140 --
NM_015000chr1232708 2172 671 12667 32276 2105 1051 --
NM_015002chr1242077 401 357 226 ------
NM_015017chr121238 1025 ------
NM_015020chr1633698 3328 1365 --33594 2776 880 --
NM_015025chr232254 2194 1928 11718 1761 --
NM_015026chr1274705 3781 3733 1811 1688 826 329 31877 1746 540 23316 1711 11163
NM_015040chr222210 178 2742 529 1401 13302
NM_015045chr1062028 2018 1985 1915 1815 167 --12124 --
NM_015071chr5126244 6113 5876 4805 4759 4710 4574 4433 1420 453 292 195 --2478 231 16232
NM_015074chr143711 3244 596 347 --21108 137 --
NM_015075chrX41797 1719 1521 1405 --1648 --
NM_015076chr663147 1550 1326 740 464 143 14518 44196 536 288 270 13508
NM_015091chr142814 90 ------
NM_015092chr1694003 3590 1847 1401 1394 1388 1224 964 498 --23510 1547 --
NM_015110chr93926 613 229 1270 22294 822 --
NM_015125chr192484 421 ------
NM_015130chr421125 341 ------
NM_015132chr721997 296 --21976 461 --
NM_015137chr822377 593 11901 1183 --
NM_015139chr11121 ------
NM_015143chr421205 50 --2257 134 --
NM_015144chr1673448 3195 2898 2874 2616 470 295 --1672 23051 2554
NM_015149chr11145 --21748 1417 --
NM_015151chr211330 --2655 158 11015
NM_015155chr1073378 2825 2346 2080 1062 858 33 1561 --1276
NM_015157chr1111119 --11173 --
NM_015170chr81342 ------
NM_015176chr1----11101 --
NM_015180chr141321 --1289 --
NM_015187chr4------1695
NM_015192chr2072792 2122 2064 2006 517 435 401 ------
NM_015199chr362735 2614 1864 1112 828 66 ------
NM_015215chr152691 2108 1244 204 198 --22710 799 --
NM_015216chr51179 172 1977 --
NM_015221chr101589 --11566 --
NM_015226chr1622142 1275 ----23233 2744
NM_015230chr431577 694 392 1138 21343 1259 1149
NM_015239chr93217 206 179 ------
NM_015263chr151444 --2821 748 1247
NM_015265chr242365 2246 1969 884 1328 ----
NM_015267chr12--22058 57 11583 12021
NM_015271chr463254 2918 2834 1484 1220 1053 23043 2616 23831 696 --
NM_015277chr184514 431 60 52 --2587 447 --
NM_015278chr643212 2897 2740 2161 ----1238
NM_015291chr143492 3388 770 730 ------
NM_015293chr62573 247 1730 ----
NM_015294chr1721148 944 ------
NM_015310chr896867 6730 6715 5750 5319 3081 3068 2274 478 18327 36809 3259 559 25101 1679
NM_015313chr1144678 4501 919 768 1310 14469 --
NM_015317chr2------1964
NM_015318chr19----11487 --
NM_015326chr112757 11034 ----
NM_015335chr1222548 2128 --22457 862 --
NM_015336chr1252427 2011 1834 1789 435 22528 962 1683 --
NM_015346chr141357 --21664 318 --
NM_015347chr1282677 2463 2345 2095 1902 1153 941 689 --21853 776 1953
NM_015349chr632005 926 284 --32702 2678 1041 --
NM_015355chr1741737 222 177 106 1334 21921 610 --
NM_015359chr812025 --12412 --
NM_015361chr22784 173 1872 ----
NM_015397chr9--1140 11922 --
NM_015409chr1252716 2162 1964 298 104 11923 12710 --
NM_015423chr1121588 1173 ----21687 1410
NM_015443chr1721317 618 --1211 --
NM_015446chr121568 434 21660 1177 ----
NM_015455chr583805 3688 3088 1620 1159 1092 968 345 14041 13048 --
NM_015459chr111267 ------
NM_015477chr151879 1388 1963 --
NM_015483chr731127 1009 863 1446 ----
NM_015488chr211620 11646 ----
NM_015508chr35535 434 296 110 92 --149 11358
NM_015509chr1211220 ------
NM_015530chr22716 399 1842 1209 --
NM_015531chr111146 ------
NM_015541chr331073 542 476 ------
NM_015548chr61321 1989 --138
NM_015553chr654937 4408 3897 1859 1756 --13248 --
NM_015554chr1572264 2193 2181 2064 545 451 23 21137 201 --1346
NM_015557chr14451 404 330 32 --1863 --
NM_015564chr533381 3348 799 1776 ----
NM_015569chr134722 4525 1809 13301 ----
NM_015576chr32655 316 --22953 1087 --
NM_015577chr531749 606 473 --11612 --
NM_015578chr192211 117 --21529 276 --
NM_015627chr141739 622 612 113 --1366 --
NM_015630chr21259 ------
NM_015649chr19------1344
NM_015675chr191564 ------
NM_015678chr1341446 1368 1108 679 ------
NM_015691chrX--1524 31970 426 357 --
NM_015726chr141491 1247 619 98 21739 601 ----
NM_015850chr822387 285 --12235 --
NM_015872chr111752 --11628 --
NM_015878chr81698 11486 ----
NM_015879chr18198609 8558 8426 8219 8004 7929 7621 6944 6674 6367 5866 3413 1520 1204 857 815 597 591 231 --68012 7401 7300 5963 1416 1259 27551 2031
NM_015888chr132999 2546 2115 --32724 2637 1096 --
NM_015891chr621581 574 --22079 1417 --
NM_015898chr1911881 2774 559 2917 180 --
NM_015902chr84797 737 630 176 ------
NM_015906chr164536 3903 3831 3432 3030 758 --14014 --
NM_015912chr831984 827 108 --2894 411 --
NM_015955chr2--1425 ----
NM_015980chr52621 354 --11564 --
NM_015994chr142717 453 ------
NM_015995chr1585076 4498 3885 3681 948 756 719 621 ------
NM_015999chr1----1267 --
NM_016018chr842728 2671 2625 2005 --2391 51 --
NM_016019chr73946 878 364 --1730 --
NM_016021chr642940 1158 1149 388 12893 22567 623 --
NM_016041chr17----2276 127 --
NM_016045chr2031183 668 607 1531 ----
NM_016076chr143184 2728 2053 798 1431 22686 2081 12302
NM_016081chr452161 2119 1684 611 214 11968 1106 --
NM_016083chr6103776 3167 3054 2827 2810 2506 2415 748 556 409 --23835 1410 --
NM_016084chr172553 132 ------
NM_016087chr741382 560 532 84 ----11752
NM_016090chr11----11067 --
NM_016097chr182174 104 ----1834
NM_016098chr62344 40 1404 --1338
NM_016120chrX--190 ----
NM_016121chr111031 ----11039
NM_016123chr121927 --21098 474 --
NM_016129chr4----2376 76 --
NM_016131chr262157 1866 1510 871 258 239 --11692 --
NM_016151chr16136 --144 --
NM_016206chr3138477 8459 7876 7144 6931 6888 6433 5492 3533 1835 1055 517 430 1943 26416 193 16910
NM_016217chr633560 1175 222 ------
NM_016224chr61751 1138 21744 1688 1247
NM_016231chr17----11574 --
NM_016248chr1333440 2431 1490 33355 1565 976 2734 142 13475
NM_016255chr653311 2781 1130 1053 276 --22680 308 --
NM_016258chr12690 581 ------
NM_016269chr431070 403 341 --21167 981 --
NM_016271chr182675 263 --11686 --
NM_016275chr332781 949 570 --12233 --
NM_016277chr621438 371 --11223 --
NM_016281chr1211102 ------
NM_016284chr162360 188 ------
NM_016287chr161867 1811 1763 426 156 67 --11627 --
NM_016289chr252118 1720 740 317 67 --22283 40 --
NM_016297chr253151 1242 1158 903 317 1187 33541 2444 478 --
NM_016308chr151796 1653 1491 835 630 --1500 11286
NM_016322chr972971 2616 2189 1194 842 518 292 --23069 61 --
NM_016338chr51951 --11075 1846
NM_016356chr61594 ------
NM_016357chr121421 11169 ----
NM_016374chr151268 1205 1128 152 97 2143 31 31394 1222 23 --
NM_016376chr1773939 3832 3776 1613 797 781 356 23878 3768 13391 --
NM_016395chr1511291 --1175 --
NM_016396chr1543013 2221 542 96 1693 ----
NM_016422chr11178 22743 603 1979 12733
NM_016436chr2012089 --22182 752 --
NM_016441chr272324 832 767 631 174 123 81 --11676 --
NM_016448chr1----21805 255 --
NM_016526chr1132183 963 534 --153 --
NM_016530chr1543725 3362 2603 692 11659 --31143 488 408
NM_016531chr421068 809 13373 34124 3460 3353 --
NM_016544chr293554 2910 2787 2488 1489 757 576 219 185 2961 948 22818 801 --
NM_016559chr32383 21 ------
NM_016563chr1511442 --21534 976 --
NM_016592chr2021416 956 --2925 439 --
NM_016605chr542285 1065 438 349 ------
NM_016628chr103787 663 649 181 ----
NM_016630chr15----1227 --
NM_016644chr5----169 --
NM_017412chr811003 --1265 --
NM_017420chr1433008 1043 912 12953 1509 --
NM_017426chr41427 ----1502
NM_017436chr22145 --1693 --
NM_017508chr1132406 84 29 11759 ----
NM_017548chr321909 1898 ------
NM_017551chr1011901 --12697 --
NM_017567chr21119 ------
NM_017580chr1042338 2034 1970 1721 1370 --11921
NM_017590chr2242715 2505 1677 886 ------
NM_017629chr151787 1279 749 523 153 ----11193
NM_017633chr632404 1563 1363 --23565 2477 12773
NM_017635chr1131470 1156 190 --21283 94 --
NM_017637chr989135 8455 7934 2438 2061 820 673 85 51941 1445 1211 121 78 37338 6099 1460 --
NM_017645chr943028 2982 2651 284 135 ----
NM_017650chr7105894 5484 5301 4300 4244 3762 2247 1236 1047 152 14998 1825 23930 457
NM_017658chr1494428 3086 1502 1483 1231 1020 515 255 146 --13963 --
NM_017672chr15--1973 ----
NM_017694chr231580 1473 106 ------
NM_017709chr163324 3144 2710 1352 1259 87 --11033 --
NM_017734chr1----2242 52 --
NM_017736chr1621952 459 --21932 1165 --
NM_017742chr1811804 ----11536
NM_017752chrX31812 1757 823 --1179 --
NM_017754chr654271 3611 3061 125 75 --11847 24635 3581
NM_017758chr171449 --11506 --
NM_017761chr141464 504 471 180 ----11512
NM_017762chr151962 --21778 622 --
NM_017778chr841448 1248 526 129 --21327 463 --
NM_017799chr1431912 1768 143 1660 ----
NM_017811chr912594 --1763 --
NM_017813chr865610 5040 3643 1155 877 827 15268 2708 344 25570 4058
NM_017824chr102934 79 ----22292 139
NM_017848chrX54021 1868 1802 1391 689 --24173 1265 1373
NM_017849chr242964 2634 1052 520 ------
NM_017893chr1011166 --11020 --
NM_017902chr1064852 3593 2012 1055 170 85 1105 24841 3577 15755
NM_017913chr92129 91 ------
NM_017921chr1721958 1906 --11835 --
NM_017974chr231041 461 133 ------
NM_017987chr1052137 1432 1379 861 363 ------
NM_017998chr911177 --1410 --
NM_018013chr652846 2101 1221 1168 568 22594 1941 ----
NM_018027chr10----53318 2714 1249 540 219 --
NM_018036chr1464016 3332 1307 1071 596 505 11760 31628 236 120 --
NM_018046chr511777 --11874 1617
NM_018047chr52817 760 144 ----
NM_018061chr14659 496 228 119 --11469 --
NM_018078chr41321 --1178 11074
NM_018084chr2102690 2118 1284 1053 1032 936 855 709 339 206 23080 2994 ----
NM_018085chr1117168 6986 5485 5382 5349 3279 2634 2313 1746 1280 81 12614 26134 1203 22917 1627
NM_018092chr1651088 608 513 268 251 ------
NM_018098chr321036 77 --190 --
NM_018117chr101695 --1492 --
NM_018121chr1083052 2775 2658 2452 2130 984 962 561 --12597 --
NM_018133chr3--1873 11981 --
NM_018137chr11515 1244 1273 --
NM_018154chr191216 --1938 --
NM_018157chr1242696 2251 2235 2050 --23269 2827 --
NM_018164chr12----169 --
NM_018181chr1831778 1265 94 --21760 510 --
NM_018184chr362025 1977 1858 1429 1411 832 ----11397
NM_018200chr1542365 1997 1988 752 --1831 --
NM_018208chr1----139 --
NM_018227chr423027 1280 156 ----
NM_018241chr4--1142 ----
NM_018254chr1----2947 490 11829
NM_018263chr2--32465 843 237 ----
NM_018275chr7----1496 --
NM_018287chr105954 421 354 242 113 ------
NM_018293chr372889 2796 2557 1184 772 625 53 --12308 --
NM_018330chr1041489 1277 1267 175 ------
NM_018351chr1224722 815 34661 3297 1130 22950 1307 --
NM_018362chr11113082 2849 2786 1516 1394 1301 735 707 528 521 316 --13559 23592 3538
NM_018364chr133027 1242 1048 13392 33728 582 403 13006
NM_018370chr1211965 --11594 1469
NM_018371chr821320 634 ------
NM_018388chrX21009 170 ----11344
NM_018403chr331297 669 650 --43133 2735 1053 599 --
NM_018416chr1212342 21836 937 11759 --
NM_018424chr921620 1360 --21462 747 --
NM_018433chr2----1574 --
NM_018440chr8178164 8043 7504 7211 6914 5396 5267 3464 2695 2572 2260 2149 2121 1656 1286 827 368 28682 5562 87946 7856 7332 6171 5880 5317 3087 715 --
NM_018444chr852044 1752 900 374 218 ----1109
NM_018448chr12------1173
NM_018451chr13----1225 --
NM_018469chr1731024 555 81 11462 ----
NM_018482chr822554 600 1805 12091 1247
NM_018489chr142155 1785 1649 293 1142 2585 303 --
NM_018492chr8----3615 231 178 --
NM_018527chr131169 --1108 --
NM_018534chr22139 70 ------
NM_018557chr231452 365 95 1340 11289 --
NM_018566chr154452 3717 1826 1293 886 14695 84994 4412 4073 3500 1606 1544 1143 990 --
NM_018584chr12960 484 --184 --
NM_018590chr10143 ------
NM_018638chr1235251 3631 1398 14394 ----
NM_018650chr11674 1633 11750 --
NM_018652chr1521044 784 --1286 1961
NM_018657chr34845 797 290 226 --1651 --
NM_018689chr1542691 2443 920 659 ------
NM_018700chr531415 458 438 --21508 1066 11242
NM_018717chr432459 2354 2110 ------
NM_018834chr51825 --1234 --
NM_018898chr512013 1158 12264 --
NM_018945chr641441 911 872 197 --22809 1417 --
NM_018963chr2121307 460 ------
NM_018970chr782645 2500 1999 858 664 560 482 348 ----11133
NM_018994chr1----165 --
NM_018999chr1054353 4341 4150 3989 1626 --34638 3942 1490 --
NM_019004chr712305 41680 766 644 196 ----
NM_019022chr1832831 453 212 ------
NM_019024chr2----1473 --
NM_019050chr441990 498 435 197 --2649 532 --
NM_019067chrX51925 1398 1043 999 921 --44855 4491 1094 195 --
NM_019072chr554195 3597 2777 448 256 --1606 --
NM_019091chr21103 --21100 992 --
NM_019096chr62399 360 ------
NM_019098chr81386 11254 11195 --
NM_019114chr941853 830 554 187 ------
NM_019116chr1633212 3009 161 ------
NM_019555chr321289 156 --188 --
NM_019558chr21361 ----1318
NM_019593chr2073166 3061 2801 2709 2497 441 73 --1298 1375
NM_019885chr232924 2658 2410 --22811 2518 --
NM_020066chr1--1921 --1402
NM_020116chr41330 21399 52 ----
NM_020122chr222002 608 --45928 5421 4735 1824 --
NM_020123chr1031240 978 114 1404 21006 334 --
NM_020130chr811198 --186 --
NM_020134chr241161 1047 809 189 --1394 --
NM_020144chr752098 1640 1311 733 603 --11413 --
NM_020150chr1031703 1617 1384 --12252 --
NM_020168chr1511357 ------
NM_020177chr583306 3131 903 649 132 86 66 23 --12291 --
NM_020193chr1131302 193 23 1101 21229 89 --
NM_020194chr22611 534 ------
NM_020198chr1721583 1099 --21128 322 11077
NM_020205chr132314 953 803 23447 3250 ----
NM_020210chr151977 ------
NM_020211chr15----11431 --
NM_020228chr1121037 424 --12427 --
NM_020309chr193835 709 118 ------
NM_020317chr13100 68 42 1109 ----
NM_020337chr431173 1139 531 --1243 --
NM_020338chr101496 --13171 --
NM_020340chr651907 923 879 166 74 ----12067
NM_020341chr2042045 2022 1720 1512 --2482 399 --
NM_020345chr32265 146 1715 ----
NM_020346chr1121262 219 1372 ----
NM_020348chr1031944 1055 1004 12484 --12756
NM_020353chr331350 1320 74 1792 ----
NM_020357chr31509 ----11413
NM_020374chr1252006 1988 636 435 331 --11946 --
NM_020390chr3154652 4633 4597 4512 4397 4184 4139 3550 3221 1800 1525 1415 1363 637 451 13707 ----
NM_020403chr133464 305 260 1569 ----
NM_020422chr16299 36 ------
NM_020432chr73719 212 48 1222 11588 --
NM_020440chr142593 2540 675 204 ------
NM_020447chr1522585 87 --21927 407 --
NM_020453chr421979 143 --2271 109 --
NM_020463chr211451 ------
NM_020466chr694286 4244 3454 3382 1728 1536 816 544 178 33851 3109 54 31957 784 331 11358
NM_020525chr121408 --1366 --
NM_020640chr311485 21526 696 1461 --
NM_020651chr21720 ------
NM_020673chr20117381 7015 6937 6699 5796 5485 4919 2440 2386 1877 1417 26727 2379 57144 5515 1703 549 346 11068
NM_020689chr2031596 1474 1073 --1437 --
NM_020699chr175001 3913 3855 2165 1712 1384 503 1581 15332 11916
NM_020704chr732128 459 324 --12530 --
NM_020713chr2062949 2686 2179 2098 2076 840 --12305 --
NM_020717chrX64470 3432 3279 1835 1139 338 --34717 965 270 --
NM_020718chr16106498 5764 5306 4175 2248 1263 1113 962 515 96 --11431 --
NM_020738chr221214 1167 --11506 --
NM_020742chrX1977 --12745 --
NM_020752chr1052254 1135 857 551 448 --32200 1943 1036 12773
NM_020760chr221604 1391 11990 1378 --
NM_020771chr61961 --1528 --
NM_020772chr17118288 7673 7120 6824 5721 5639 3309 3037 2069 1258 38 37809 1953 1483 17940 12889
NM_020774chr1864935 4310 4122 842 612 297 --35754 2343 2138 46022 5581 4353 1268
NM_020782chr12104817 4606 4436 4403 4246 4074 4013 3462 3195 437 14179 --33303 1799 1016
NM_020783chr1831783 1506 897 ------
NM_020791chr1711431 --31324 1003 183 --
NM_020801chr532259 2185 2089 11619 1805 --
NM_020804chr622323 2134 --2783 168 --
NM_020805chr1831784 1647 545 ----11818
NM_020814chr211223 --11358 --
NM_020825chr1673481 3073 2960 2553 2340 924 331 --23154 3092 --
NM_020830chr282597 2364 1151 1133 960 892 160 79 1591 12844 --
NM_020854chr183964 487 64 1360 173 --
NM_020856chr1921581 363 --2406 396 1313
NM_020858chr1552386 1920 1474 301 191 --22329 517 --
NM_020871chrX41997 1769 1005 939 12535 1622 --
NM_020872chr351726 1421 505 388 270 ------
NM_020886chr111169 ------
NM_020899chr1732514 1864 1717 --1718 --
NM_020909chr251428 877 719 439 35 1792 --14059
NM_020921chr1483337 3291 2546 2490 2343 1369 779 34 22738 2527 ----
NM_020935chr244554 2855 871 234 11112 24096 1084 --
NM_020940chr1032462 1146 365 --22230 274 --
NM_020946chr931696 1677 537 11529 11257 --
NM_020962chr1562171 2017 1975 1826 1819 502 1581 12366 --
NM_020967chr202346 192 --11204 --
NM_021005chr151430 2996 324 ----
NM_021035chr2041329 1303 1030 984 --2489 139 --
NM_021038chr373135 3106 2763 2598 2452 1161 751 13194 ----
NM_021079chr1712618 ----12908
NM_021083chrX43272 2951 2936 1405 --33492 3309 2557 13551
NM_021090chr2264646 3468 1762 1144 512 88 --21868 793 --
NM_021111chr91410 11282 ----
NM_021117chr1122242 1753 ------
NM_021136chr141727 2720 513 2583 468 --
NM_021137chr1732135 1622 1586 11969 3591 502 191 --
NM_021151chr7--1337 1394 2986 25
NM_021183chrX41880 1737 762 717 ----1699
NM_021190chr1--31246 844 340 1530 --
NM_021202chr2032501 2074 1920 --22511 2206 --
NM_021204chr4----1959 --
NM_021218chr9----1779 1360
NM_021229chr1231126 896 29 ------
NM_021238chr1262053 2012 1614 1528 1491 628 ------
NM_021239chr14--1343 --11328
NM_021240chr92475 171 1493 ----
NM_021244chr6----1175 --
NM_021249chr1411255 ----180
NM_021572chr63370 353 328 --1992 --
NM_021614chr51257 ------
NM_021629chr354861 4784 4591 523 329 --34443 3937 3223 --
NM_021638chr454301 4014 1600 1543 443 ------
NM_021643chr2----11231 1382
NM_021813chr695721 5197 4813 4705 4468 2100 982 757 69 1650 14557 --
NM_021914chr1452263 974 433 404 277 --1511 --
NM_021945chr652282 1309 854 654 476 --22364 264 --
NM_021960chr132698 466 402 --12231 --
NM_021961chr1187081 6592 6057 5623 4928 2252 1499 659 26364 5430 34588 1381 362 --
NM_021964chr3106547 5925 5391 4037 1294 1155 395 175 156 33 22103 753 14629 22244 927
NM_021973chr43578 230 115 ------
NM_021994chr7--1178 1954 --
NM_021998chrX51532 1207 982 557 202 11136 --11524
NM_022048chr1555879 5415 4089 752 549 24451 1493 11396 --
NM_022051chr11109 --1567 --
NM_022058chr23581 507 30 --1557 --
NM_022068chr181178 --182 --
NM_022073chr1431672 333 151 ------
NM_022075chr1----1802 --
NM_022114chr134658 4056 3581 24467 1691 ----
NM_022123chr14158 --185 --
NM_022133chr831868 1251 1233 ------
NM_022138chr641087 382 107 100 1266 ----
NM_022340chr363451 2613 1368 552 216 155 --12697 --
NM_022373chr7----2964 360 --
NM_022465chr1252411 1932 663 411 182 --12991 --
NM_022473chr151773 13145 34470 2982 1311 --
NM_022474chr1452487 1829 1079 936 259 ----11857
NM_022484chr741391 1094 250 33 ------
NM_022497chr333106 2510 431 --33776 3752 997 13256
NM_022648chr222926 1456 13280 12819 --
NM_022658chr1221130 467 --11339 --
NM_022719chr2293691 3375 2940 2489 2385 1488 716 431 171 --43843 3723 2424 948 --
NM_022728chr71211 --1679 --
NM_022733chr11481 1274 ----
NM_022735chr141672 1601 172 85 ----11262
NM_022749chr831398 1390 68 ------
NM_022753chr142223 2081 1050 296 22580 1962 160 --
NM_022757chr3----11020 1259
NM_022763chr362873 2561 2207 2043 684 578 1426 22488 2386 --
NM_022771chr122385 308 --158 --
NM_022781chr93659 588 582 --22228 908 --
NM_022826chr2------1931
NM_022828chr531487 1405 1245 11611 --1167
NM_022832chr482128 1793 1021 827 618 407 168 49 ------
NM_022841chr1552513 2275 1708 857 763 --12728 --
NM_022843chr133525 396 204 11039 21408 185 --
NM_022893chr262602 2280 2018 796 583 292 12997 --12167
NM_022898chr14114630 4482 4095 3708 1531 1381 1279 856 694 270 132 11402 1663 --
NM_022900chr711110 ------
NM_022912chr212253 22226 488 1459 --
NM_023012chr12181 --2774 536 --
NM_023016chr232473 492 486 12017 12511 12062
NM_023071chr12----2993 730 --
NM_023076chr1672467 2415 2166 775 720 162 48 --31853 992 385 22966 566
NM_023940chr431022 956 380 ------
NM_024019chr43967 260 163 ------
NM_024052chr1742039 1998 991 262 --11045 --
NM_024081chr11----2785 81 --
NM_024312chr121410 --147 137
NM_024322chr22530 81 ------
NM_024345chr934594 769 218 24522 4104 21576 153 --
NM_024408chr143468 1083 1037 333 --13218 --
NM_024491chr31621 ------
NM_024496chr14------1281
NM_024524chr333177 2662 90 12957 12097 --
NM_024525chr1----1559 --
NM_024539chrX21075 972 --1474 --
NM_024546chr1311288 --2976 803 --
NM_024548chr341617 1386 1164 241 ------
NM_024554chr121244 1203 --21612 492 1241
NM_024607chr854447 1615 661 584 226 --33598 3511 984 --
NM_024612chr172371 82 1767 3979 801 106 --
NM_024615chr5------1230
NM_024617chr9----1715 --
NM_024665chr3134381 4251 3679 3602 3506 3414 3362 3344 1810 1779 1707 1341 1332 14213 11852 1251
NM_024692chr21293 ------
NM_024700chr161147 796 783 228 90 70 ------
NM_024704chr202914 908 ------
NM_024713chr151263 --21335 26 11357
NM_024721chr852079 1052 984 871 206 1898 1514 --
NM_024735chr1631657 1451 80 --2622 150 --
NM_024749chr151987 1623 700 625 52 --1459 --
NM_024757chr9----11170 --
NM_024761chr964048 3448 3437 3416 1977 286 --25252 617 11040
NM_024792chr172403 55 --2953 182 --
NM_024828chr91444 ------
NM_024830chr541911 541 404 109 --1560 --
NM_024900chr441726 1475 855 525 11702 ----
NM_024915chr812018 --12546 --
NM_024947chr3119173 9164 8820 7715 5825 3301 2827 2508 2123 1103 177 26793 2366 39315 8842 8587 29394 1332
NM_024948chr10----1310 --
NM_024949chr453725 3420 1248 932 669 --1453 --
NM_024953chr1221837 22 1606 12073 --
NM_024963chr765669 4552 4479 3989 2233 951 --25045 4627 --
NM_024993chr221462 236 --124 --
NM_025009chr4----2383 84 --
NM_025010chr322098 52 --22038 1953 --
NM_025076chr21198 ------
NM_025133chr22308 210 --1423 --
NM_025134chr1622140 1828 --11694 --
NM_025146chr33504 431 29 12459 11038 --
NM_025147chr211066 --196 --
NM_025154chr72287 281 11086 11273 --
NM_025160chr12624 590 24174 3671 23882 1343 --
NM_025182chr921044 818 --1986 --
NM_025187chr16----1447 --
NM_025195chr831538 331 45 ----1687
NM_025208chr1142211 2103 706 607 1216 22443 590 --
NM_025222chr322164 474 23016 2809 22287 1869 --
NM_025235chr1022194 1617 --22032 209 1372
NM_025248chr1721028 865 --1887 --
NM_030621chr1473385 3075 2905 2899 1389 1345 1312 11646 ----
NM_030625chr1012581 --1626 --
NM_030627chr543645 3191 1636 611 23079 797 33936 3271 882 --
NM_030637chr14----1141 --
NM_030647chr755502 5201 2297 875 147 --26016 1515 16254
NM_030648chr443592 2152 1045 696 13650 21198 232 25296 1127
NM_030650chr2103948 3751 3644 3340 1689 982 760 736 588 525 176 ----
NM_030661chr741575 553 453 418 1676 11365 --
NM_030758chr22175 1438 ----
NM_030762chr1241724 1572 1367 1268 ------
NM_030786chr1------11234
NM_030816chr1--33650 1170 609 23116 849 --
NM_030885chr331430 802 469 --185 --
NM_030891chr2111109 --11333 --
NM_030906chr111410 --153 --
NM_030911chr1331649 1639 50 ------
NM_030915chr2----32343 825 803 --
NM_030918chr155160 4653 4108 3820 2151 --24632 1379 --
NM_030920chr121572 336 --11889 --
NM_030923chr2------1577
NM_031283chr22318 293 1619 1138 --
NM_031435chr1242893 2749 2490 447 33096 2991 69 22982 649 --
NM_031439chr81493 --1755 --
NM_031442chrX32167 1108 923 --12143 --
NM_031445chr221358 692 ----12112
NM_031483chr2063416 2772 2625 1387 772 418 ------
NM_031886chr19--22568 917 22626 1902 --
NM_031890chr2222748 862 1205 1777 13022
NM_031942chr21454 11277 2929 359 --
NM_032021chr1131101 983 215 ------
NM_032047chr322118 2057 --1430 --
NM_032102chr1142960 2495 1092 749 --12050 1931
NM_032109chr521374 1227 --11322 --
NM_032124chr1831069 957 832 ------
NM_032144chr22424 154 --21672 1140 1547
NM_032153chr332762 926 331 ------
NM_032172chr7----1985 --
NM_032182chr10130 11053 ----
NM_032199chr1063869 3219 2406 1176 989 364 23796 996 --13465
NM_032208chr222967 2265 --22795 2415 --
NM_032217chr421200 303 --1213 --
NM_032221chr2031923 1323 818 --1270 --
NM_032229chr132998 445 ------
NM_032239chr421215 152 --2924 905 --
NM_032242chr342067 914 420 242 --23325 2455 --
NM_032291chr13622 386 104 --1290 --
NM_032299chr11192 ------
NM_032303chr92668 494 ----11386
NM_032312chr22851 253 --1135 --
NM_032320chr111322 --1193 --
NM_032352chr1421133 133 --21428 581 11403
NM_032361chr52304 142 ----1412
NM_032373chr1025298 1993 14790 45700 4940 4748 3925 14207
NM_032410chr8----11211 --
NM_032411chr2----1215 --
NM_032433chr1911257 11343 1617 11481
NM_032439chr10151 --1461 --
NM_032440chr1022867 44 --22614 2004 --
NM_032445chr1522411 419 --1938 --
NM_032457chr411265 --13678 --
NM_032458chrX23237 3156 --23076 2335 32873 2549 664
NM_032499chr151462 --1235 --
NM_032505chr352777 2707 2447 2343 446 --32467 819 216 1323
NM_032509chr82874 587 12473 ----
NM_032521chr2043040 2952 2387 1165 ------
NM_032539chrX2553 287 ------
NM_032557chr42775 353 ----1302
NM_032569chr162618 236 --11607 11420
NM_032582chr17----21497 1284 --
NM_032603chr2----1732 --
NM_032632chr1431463 371 189 --1150 --
NM_032682chr331110 451 253 12778 23379 2347 --
NM_032701chr19----1634 --
NM_032728chr91943 ------
NM_032780chr112361 164 --1799 --
NM_032790chr121346 ------
NM_032801chr1132535 1926 1626 --1567 --
NM_032833chr12982 310 --1675 --
NM_032844chr102356 251 ------
NM_032876chr14----21512 1467 --
NM_032905chr10----21169 308 --
NM_032932chr1775514 4930 1863 1537 1093 749 223 11231 14519 --
NM_032983chr783185 3147 1169 769 276 139 84 63 22905 695 ----
NM_033055chr1195 ------
NM_033117chr9169 --2375 120 --
NM_033141chr1441576 607 593 126 --21995 1708 --
NM_033211chr531987 379 177 --1388 11909
NM_033224chr757706 5628 5121 4881 2263 26968 389 32981 1390 478 --
NM_033254chr33497 488 126 ------
NM_033260chr6181 --1144 --
NM_033272chr21123 --1333 --
NM_033285chr874448 4394 3112 1315 867 697 480 12900 54372 3064 856 428 300 --
NM_033387chr922615 2272 22637 679 ----
NM_033389chr1784718 4342 4194 3834 3568 3136 1842 78 13597 ----
NM_033394chr221617 1483 --21125 646 --
NM_033396chr111158 --1314 --
NM_033495chrX----1276 --
NM_033505chr2126544 5448 5346 5008 4720 2512 2079 1532 1325 715 115 29 12346 45566 5044 4945 4892 --
NM_033515chr611038 --11214 --
NM_033631chr143249 2617 1259 1017 ------
NM_033656chr2175555 4981 3921 1086 314 187 166 25144 47 24821 739 --
NM_052832chr842886 1997 1871 66 12966 ----
NM_052865chr20------1916
NM_052879chr1212831 1697 1408 12518
NM_052905chr241605 745 718 663 --1752 --
NM_052932chr1162321 2143 2031 1650 638 376 --12001 --
NM_052937chr82951 392 --160 --
NM_052954chr2152039 1672 1638 1480 494 --11452 --
NM_053023chr1172889 2412 2306 1056 966 808 508 --12941 184
NM_053025chr32593 459 11177 ----
NM_053056chr1173105 3085 2408 1113 1048 560 335 --21019 93 --
NM_058191chr213901 780 562 --1133 1671
NM_058237chr141718 1320 1421 2799 368
NM_078469chr1031173 1135 919 --1413 --
NM_078470chr1012329 --1568 --
NM_080415chr171363 --1169 --
NM_080546chr921447 903 ------
NM_080626chr12------1325
NM_080723chr621326 545 ------
NM_080737chrX----1229 --
NM_080738chr11380 --11726 --
NM_080743chr642139 1664 320 258 --31819 963 365 12123
NM_080797chr2033031 2576 529 --33594 2857 1431 --
NM_080867chr1454528 4497 1867 1586 1206 1693 21668 1548 --
NM_080872chr823049 990 22991 524 22920 1585 12858
NM_080927chr353140 2723 1175 504 277 13228 ----
NM_130446chr32279 238 --34263 3616 1721 --
NM_130808chr3182 --1349 --
NM_133264chr1723632 2846 --33183 2559 458 --
NM_133334chr4106106 6069 5874 5305 4661 2236 1787 1750 1168 769 --15502 --
NM_133473chr192753 26 --21803 74 1653
NM_133478chr2148 --1761 --
NM_133493chr674623 3002 1719 1318 1025 792 349 --13802 --
NM_133496chr184350 4206 3879 3374 1651 1079 848 117 --21816 1498 --
NM_134428chr91381 ------
NM_138285chr22502 167 ------
NM_138335chr42229 172 --2635 42 --
NM_138340chr18123 ------
NM_138375chr184855 485 473 141 ----158
NM_138423chr15--11441 11508 --
NM_138426chr762066 886 632 512 267 241 --1221 --
NM_138453chr5----156 --
NM_138468chr286240 5703 5506 5207 4369 4263 1332 579 26291 4542 22219 1392 --
NM_138473chr12113885 3414 3383 3162 2036 1622 1571 1565 785 301 103 --1246 --
NM_138571chr61571 ------
NM_138731chr1423757 438 1688 ----
NM_138782chr532046 175 145 --1878 --
NM_138797chr222271 99 ------
NM_138799chr241645 797 309 234 --31863 685 250 --
NM_138959chr1115598 5576 5564 5395 4484 2697 2600 2433 2324 792 152 ------
NM_138967chr1522251 201 ----1489
NM_138983chr2161283 1061 964 426 390 310 --1110 --
NM_139076chr41604 1157 1172 1316
NM_139207chr1221520 1396 --1167 --
NM_139283chr1211660 12423 ----
NM_139321chr2064182 3328 3308 3239 1506 1145 --21696 1155 --
NM_144571chr4126985 6013 5787 5498 5258 5118 5107 2756 2445 2059 1439 268 11658 --1505
NM_144574chr14------1188
NM_144579chr252130 831 607 226 30 ------
NM_144599chr1575203 4640 3703 3464 1717 1314 417 1883 --14463
NM_144632chr242053 1648 1525 917 1584 21854 784 --
NM_144642chr31364 --21329 543 --
NM_144664chr1132565 2534 1801 --3581 154 22 12386
NM_144720chr4--1196 ----
NM_144726chr54917 845 823 140 ------
NM_144775chr1764950 4807 4216 3739 918 379 ------
NM_144778chr1341788 1101 606 412 --12589 12778
NM_144973chr1264982 4206 1354 861 790 766 --35271 1666 1038 --
NM_144979chr43707 507 130 --1612 --
NM_145005chr9----1902 1401
NM_145011chr101531 --11972 11473
NM_145018chr112236 75 --1212 --
NM_145117chr1133082 1254 230 ------
NM_145166chr362358 2033 1132 789 550 293 ------
NM_145176chr623462 3071 --1688 --
NM_145203chr13--1254 149 --
NM_145239chr163759 366 272 ------
NM_145251chr141305 --11235 --
NM_145290chr4--1279 --172
NM_145291chr41362 --1388 --
NM_145307chr1083334 3086 2879 1850 1571 1197 468 313 --34333 4260 1772 --
NM_145313chr1021515 1371 1166 ----
NM_145315chr61105 ------
NM_145332chr63710 285 142 --1382 --
NM_145891chr1631571 1396 1130 --21071 615 --
NM_145909chr62891 54 11216 --11272
NM_147128chr721465 1430 --11129 --
NM_147156chr1021514 145 ------
NM_152263chr196046 5975 5173 4758 4649 2098 1659 1405 210 --34043 1343 993 --
NM_152265chr131216 177 170 --21338 147 --
NM_152275chr282231 2142 2099 1782 1582 844 366 342 ------
NM_152277chr511738 11455 22117 1854 --
NM_152278chrX169 ------
NM_152344chr1711355 --1129 --
NM_152345chr173775 370 333 ------
NM_152371chr131695 1328 322 ----11228
NM_152400chr421906 1320 ------
NM_152409chr51815 1511 23181 930 11293
NM_152414chr821208 493 ------
NM_152431chr11----1386 --
NM_152446chr141643 --1395 --
NM_152450chr151495 --11385 --
NM_152457chr16----198 --
NM_152463chr17--1207 1509 --
NM_152493chr1----1234 --
NM_152522chr21164 --1226 --
NM_152556chr762085 1799 1745 858 388 84 1453 11947 1239
NM_152570chr9----1303 --
NM_152588chr1221157 740 ----1249
NM_152594chr1522196 301 ----11695
NM_152606chr19----1505 --
NM_152614chr2------1137
NM_152622chr583480 3460 2843 2562 1326 1257 979 791 --2606 494 --
NM_152624chr597212 6867 5943 2457 2263 1751 490 483 457 1251 66397 6255 2800 1467 1039 603 14680
NM_152636chr1122341 2173 1399 2602 35 1596
NM_152660chr1------1838
NM_152665chr11490 1473 ----
NM_152682chr42380 31 --1694 --
NM_152694chrX1155 --1559 --
NM_152704chr13----1249 1838
NM_152707chr10----1132 --
NM_152735chr62766 623 ------
NM_152745chr71963 ----11069
NM_152753chr63784 244 142 ------
NM_152756chr553625 1612 885 853 273 14373 11578 --
NM_152758chr842582 2145 2015 717 --1220 12631
NM_152780chrX1924 --1268 --
NM_152787chrX83894 3484 2898 2682 1288 858 757 45 --23112 348 --
NM_152793chr744551 3424 431 420 --34524 92 79 --
NM_152835chr162249 1923 1109 1073 857 448 12290 --22826 818
NM_152890chr13341 169 107 11055 11073 --
NM_152996chr12236 175 --11801 --
NM_153000chr182243 96 ------
NM_153020chr621301 460 --11579 --
NM_153029chr1654145 3633 3436 1017 577 --24011 3990 --
NM_153042chr641711 1595 209 167 11327 --1194
NM_153184chr321627 1354 --11934 11882
NM_153207chr1253107 2914 1383 1209 416 --23668 2995 --
NM_153208chr16--1967 1791 --
NM_153211chr18148 ----1412
NM_153223chr531064 1010 371 1206 ----
NM_153235chr642454 1642 652 596 1471 ----
NM_153261chr1621309 186 --1227 --
NM_153262chr142755 2026 992 585 33188 2965 551 1775 --
NM_153331chr31501 ----1492
NM_153332chr873020 2868 2397 2119 1015 642 522 --1197 --
NM_153365chr442243 1955 759 465 188 1585 --
NM_153377chr12----1329 --
NM_153447chr19----1276 --
NM_153605chr311197 ------
NM_153607chr573203 2893 2676 2481 857 179 92 22868 1189 32655 465 367 --
NM_153634chr12----11182 --
NM_153646chr142906 813 12607 ----
NM_153686chr421858 127 ----166
NM_153689chr221824 794 --2530 49 11936
NM_153695chr9135 ------
NM_153707chr9----2137 37 --
NM_153810chr1093835 3779 1944 1100 905 881 617 515 390 --33620 821 362 11576
NM_153825chr411528 --1228 --
NM_170606chr7--11504 21473 241 --
NM_170662chr3------1661
NM_172037chr8173 --1165 --
NM_172070chr211987 --11970 --
NM_172071chr177228 6741 1884 1370 832 522 189 16029 --17482
NM_173075chr421500 444 --21295 414 --
NM_173354chr211807 --11911 --
NM_173355chr23384 281 85 ------
NM_173359chr3----11885 --
NM_173468chr455507 5381 3893 2079 1242 25729 472 11154 --
NM_173469chr152600 173 --11109 --
NM_173470chrX22764 2524 --1516 12182
NM_173473chr1052724 2618 2088 411 126 --22452 602 12472
NM_173475chr162711 167 --1619 --
NM_173495chrX52534 1826 1000 757 423 --22565 1615 --
NM_173505chr1841101 408 339 65 ----1992
NM_173508chr11151 ------
NM_173511chr243687 2432 217 79 23910 3568 23877 3741 --
NM_173582chr1176260 6240 5922 4454 1886 450 85 24700 752 55129 3991 1622 1271 537 --
NM_173595chr1275125 4077 1350 758 551 486 81 ------
NM_173642chr1109041 8840 7162 5700 3303 2314 1778 752 277 121 38505 5940 1732 79021 8548 7193 2740 573 559 129 124
NM_173683chr81498 --159 --
NM_173794chrX----1146 --
NM_173822chr22706 557 1642 11370 --
NM_173825chr312413 --1384 --
NM_173829chr555722 5125 2194 1114 923 11377 35329 4705 1191 --
NM_173833chr821418 115 11694 11655 --
NM_173854chr132278 856 37 ------
NM_174890chr101308 ------
NM_174907chr3----1125 --
NM_174911chr843746 3364 3249 2473 2849 292 ----
NM_174936chr11248 --11218 --
NM_175056chr332160 374 360 1385 ----
NM_175061chr73687 354 83 ------
NM_175607chr32550 75 --1158 --
NM_175630chr21797 --2733 703 --
NM_175709chr2232639 2544 329 --22855 2577 --
NM_175736chr12137454 7366 6722 6713 6317 5902 4895 4859 1263 979 200 194 163 --26904 25 15447
NM_175767chr531876 1195 225 --21371 1151 --
NM_175852chr152683 1071 426 174 128 1198 22620 345 --
NM_175854chr131131 --11111 --
NM_175884chr721133 124 ------
NM_175887chr73470 420 41 --1487 --
NM_176814chr731105 274 189 11207 2578 205 --
NM_177401chr1941734 1432 644 460 ------
NM_177424chr121941 515 11410 ----
NM_177966chr341875 1845 1771 1384 11631 21867 1272 --
NM_177968chr21191 --31932 1635 140 --
NM_177999chr983659 3215 3200 870 785 636 133 118 --13253 --
NM_178011chr1012723 --12746 --
NM_178126chr1742139 1840 1707 259 --11463 --
NM_178175chrX1740 1567 1730 --
NM_178313chr252132 2046 1945 1932 357 1135 11788 --
NM_178439chr21193 --164 --
NM_178587chr14----1115 --
NM_178815chr1072422 2073 1958 1910 822 440 360 --32791 1002 551 --
NM_178839chr2------1368
NM_180989chr1322293 2281 21831 141 22203 876 1715
NM_181077chr1521580 528 --31766 893 218 --
NM_181291chr14--1519 ----
NM_181354chr8157 --11337 11406
NM_181504chr583723 2926 2809 2707 2558 1538 1336 805 --11038 --
NM_181521chr16127173 6851 6837 6165 6158 5850 4576 2806 2693 2591 1053 373 --22737 820 11364
NM_181552chr71368 1302 ----
NM_181699chr11155 ------
NM_181782chr611772 11791 --1452
NM_181877chr1511565 ------
NM_182485chr4--1346 --12800
NM_182501chr223317 2554 --22254 455 --
NM_182503chr664016 1788 1378 1134 458 408 11569 1163 1556
NM_182509chr1481544 1385 1308 1248 489 343 249 196 --11682 --
NM_182509chr1481544 1385 1308 1248 489 343 249 196 --11682 --
NM_182511chr1821270 920 --1155 --
NM_182515chr1996665 5992 4891 4885 2332 2231 1427 743 653 24475 2570 54579 2650 1215 829 647 --
NM_182524chr4----1226 --
NM_182607chrX123 ----11774
NM_182691chr731166 367 253 ------
NM_182700chr731940 1656 1540 11647 11927 --
NM_182758chr1542949 1536 1187 84 --13140 --
NM_182760chr31601 ------
NM_182765chr1032201 373 39 --1259 --
NM_182767chr1281788 835 726 699 584 488 160 73 1820 11848 21517 828
NM_182830chr1442290 573 153 40 1463 11683 --
NM_182975chr1166 ------
NM_183238chr1273840 3674 3662 3110 967 936 861 ----12806
NM_194247chr231574 759 702 13459 23172 685 --
NM_194282chr432973 2399 2159 --12645 12131
NM_194285chr1162550 2217 2080 1042 602 395 --32737 2126 1292 --
NM_194298chr101614 --21595 1545 --
NM_194314chr175403 4787 4082 2098 1588 1255 804 35325 3539 1812 24508 1442 11572
NM_194317chr242695 2302 1833 134 1275 11846 11903
NM_198270chrX13132 --1899 --
NM_198273chr552461 2423 2261 1940 937 --1760 22225 251
NM_198401chr81122 --21680 479 --
NM_198467chr71402 ----1171
NM_198513chr81653 ----11247
NM_198563chr3------1571
NM_198568chr6----11213 --
NM_198581chr2--22813 1610 67434 6111 2211 1305 574 242 15820
NM_198584chr822498 534 --12670 --
NM_198859chr344666 3120 1815 1754 --54178 1544 1077 681 85 --
NM_198935chr2022838 320 --32401 993 189 --
NM_198965chr121296 ------
NM_198990chr723336 667 --32699 2148 1262 --
NM_199000chr71161 --12004 --
NM_199044chr113036 --1320 --
NM_199072chr731295 1092 454 --32577 2536 326 --
NM_199168chr1031204 1012 535 1183 2372 297 1170
NM_199334chr171532 ------
NM_199420chr31807 1313 1319 --
NM_199461chr1043557 1144 871 381 --22279 163 --
NM_201280chr61117 11061 ----
NM_201633chr5----1337 --
NM_203282chr1931276 1223 393 ----31709 458 292
NM_203301chr1421753 574 21309 616 1437 --
NM_203349chr15----2678 522 12070
NM_203364chr1121253 796 ----1293
NM_203394chr122854 346 31896 601 180 --1331
NM_203406chr522156 1935 --22934 81 --
NM_203459chr132531 284 47 --21850 581 --
NM_203463chr254224 4118 3938 1174 235 --31050 1009 128 --
NM_205848chr13694 550 175 12720 ----
NM_206853chr673966 2776 2707 2553 1253 434 117 13903 --11346
NM_206854chr695227 4037 3968 3814 1695 1378 787 713 201 15164 2670 475 --
NM_206914chr1241713 1496 1366 584 11671 1288 --
NM_207009chr1031020 968 682 --1658 --
NM_207111chr742423 2408 481 440 12613 ----
NM_207321chr101305 --1226 --
NM_207322chr1531443 615 526 --22163 401 1387
NM_207325chr1942086 1811 1594 1392 11842 41803 1291 602 467 --
NM_207371chr1021326 123 21454 584 ----
NM_207406chr485994 4899 4641 2596 2537 1614 1104 634 --35217 2141 1823 --
NM_212464chr1562066 1981 1907 1495 198 33 --1756 --
NM_212558chr922950 2645 --14082 --
NM_213589chr2105420 4908 4750 1996 1459 1091 1081 833 728 586 ----11553
NM_213609chr31108 ------