TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-520h
miRNA Sequence: ACAAAGUGCUUCCCUUUAGAGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr561353 629 517 182 161 98 --31981 1409 63 --
NM_000052chrX63420 3057 2877 708 691 72 --23309 1337 --
NM_000068chr1941425 1107 1063 1051 ------
NM_000070chr152470 148 ----1505
NM_000084chrX226960 6588 6343 6005 5949 5919 5871 5556 5483 5278 5114 2726 2443 2352 2091 2022 1845 1423 782 621 445 84 14779 15842 --
NM_000088chr1741329 1115 872 128 11368 ----
NM_000090chr23901 704 698 ------
NM_000091chr252586 2274 1819 1080 873 ------
NM_000092chr2144352 3908 3823 3263 3111 2987 2815 1611 1561 1552 1509 736 712 507 13717 44061 1259 1035 95 --
NM_000109chrX92598 2376 2281 2206 2130 1791 1730 918 759 1501 21946 360 --
NM_000110chr141230 1161 430 112 ----1381
NM_000117chrX1287 --1218 --
NM_000125chr6104183 3768 3618 3374 3360 3247 2593 386 67 46 --1369 14227
NM_000129chr6--189 21451 542 --
NM_000138chr1592554 2486 2413 2389 2287 1897 930 370 189 12246 12594 12192
NM_000141chr1031342 579 318 11107 11361 --
NM_000158chr31579 --1567 --
NM_000163chr552282 2092 1890 1498 332 21912 524 22275 1465 --
NM_000165chr631545 1272 682 21374 85 --1506
NM_000167chrX61682 1427 1125 713 674 359 1101 11667 --
NM_000170chr92341 200 --1410 --
NM_000177chr9------1233
NM_000210chr252343 2034 1750 1722 950 11869 1863 --
NM_000214chr2041569 1414 1137 584 21486 523 ----
NM_000217chr12135370 5332 4744 4530 4339 4182 4174 4112 3944 342 332 163 103 --32094 2013 93 --
NM_000244chr11----1808 --
NM_000248chr3102698 2308 1112 1101 818 516 460 309 284 160 22225 756 ----
NM_000259chr1595647 5458 4015 1630 1513 1448 627 154 87 36058 6039 1390 21079 164 --
NM_000264chr982730 2563 2417 2311 2293 2239 423 157 ------
NM_000280chr112769 385 --3856 248 224 --
NM_000291chrX5750 602 333 264 54 ------
NM_000321chr1341462 1227 614 343 21506 1494 11400 --
NM_000332chr6175736 5543 5225 4840 4725 4370 2786 2529 2132 1844 1671 1481 1391 1190 1141 1044 603 35754 5101 1089 22180 1703 25115 1400
NM_000337chr5106219 5788 5060 2605 2337 1714 1704 1471 1085 270 24214 670 36011 2594 2265 15495
NM_000340chr381491 1436 604 532 516 322 230 80 --1948 --
NM_000345chr441019 948 901 234 ------
NM_000346chr1771882 1863 760 713 694 376 115 ----1481
NM_000368chr974530 4481 4425 3124 1774 366 281 --14455 --
NM_000378chr1151246 808 430 372 196 --11254 --
NM_000386chr173803 492 262 ------
NM_000387chr3--1565 --1192
NM_000389chr631186 514 231 ----21156 476
NM_000393chr292140 1931 1641 1546 1505 1407 1349 808 417 21954 67 1646 --
NM_000408chr2153118 3077 3006 2775 2713 2148 2118 1356 1296 813 744 570 340 235 178 23280 964 32256 1286 371 13254
NM_000430chr1793250 3171 3011 2876 2651 2644 1368 712 321 11397 1698 --
NM_000435chr191860 --1363 --
NM_000448chr11123235 3022 2973 2966 2136 1194 1052 816 462 444 409 383 22181 622 23090 946 12251
NM_000449chr141538 1311 532 45 ------
NM_000461chr374297 4196 3842 3041 2818 813 595 ------
NM_000480chr1171641 1141 1060 353 153 136 23 1466 ----
NM_000484chr214925 828 716 369 --1211 --
NM_000489chrX173426 3336 3264 3062 3035 2938 2370 2160 1384 1314 1255 1135 1014 905 713 443 139 12670 12262 --
NM_000503chr861869 1762 1292 1241 436 324 21598 638 ----
NM_000523chr251166 1064 372 183 119 ------
NM_000527chr1962430 2370 873 821 182 106 --22170 1636 --
NM_000533chrX11518 --1203 --
NM_000555chrX197883 7812 6889 6751 6660 6041 5921 5825 5707 5651 2937 2534 2519 2415 2180 2001 1869 325 112 21557 130 45948 4859 2454 2062 --
NM_000565chr121543 735 11908 22279 675 --
NM_000575chr23412 220 202 1981 1771 --
NM_000599chr294530 3925 3883 1852 1626 1437 1313 1144 785 --14489 --
NM_000609chr1032970 2899 120 13096 1134 --
NM_000610chr1182701 2483 2400 2173 2159 1203 1012 632 12922 1408 --
NM_000615chr11112787 2761 2526 2216 1956 1103 1015 750 712 473 420 12995 22406 531 --
NM_000618chr12146275 6031 5903 5897 5817 4867 4425 2555 1947 1565 913 712 626 78 46554 6358 1607 699 --11805
NM_000621chr133559 269 134 1476 11212 --
NM_000624chr14----2870 734 --
NM_000627chr24882 807 600 372 ------
NM_000633chr18115127 5068 5034 3888 3699 2009 1751 1399 812 751 374 --25185 1324 14178
NM_000668chr441131 586 441 310 11103 --11197
NM_000678chr202831 773 ----1740
NM_000719chr12106669 5295 5093 4914 2579 1696 1379 857 783 724 --21720 1510 --
NM_000726chr241286 555 499 124 11160 1243 --
NM_000788chr491417 1360 1337 1205 1071 1040 1034 985 50 11408 ----
NM_000793chr1485056 4708 4516 4057 3218 1627 1386 974 25146 320 23432 1377 --
NM_000801chr204765 258 252 164 --2269 119 --
NM_000806chr531842 712 597 --1532 --
NM_000813chr5115399 5235 5223 5165 4619 2126 1978 1738 1657 1231 1147 22018 1753 22145 633 --
NM_000814chr1594087 3673 3514 3424 2727 2691 1642 1115 1049 23588 3364 23709 262 --
NM_000816chr52640 454 1188 ----
NM_000824chr42865 624 1153 1110 --
NM_000828chrX2768 229 1718 22182 657 --
NM_000829chr111556 ------
NM_000844chr351113 991 838 180 50 --1406 --
NM_000859chr541718 1639 1380 431 1535 11704 --
NM_000861chr362595 2429 2392 1976 1945 1723 1203 ----
NM_000866chr341868 1445 412 233 11883 ----
NM_000868chrX51035 993 453 144 130 2926 220 --12449
NM_000870chr581606 1571 1345 1286 1159 995 553 214 11469 ----
NM_000876chr631403 368 94 1397 ----
NM_000880chr81897 1844 ----
NM_000891chr1783529 3224 3164 2823 2469 2439 913 32 23106 810 1845 --
NM_000899chr12104393 4318 4117 3830 3824 3615 3511 2833 2821 28 33681 1747 1378 23389 3014 --
NM_000901chr452575 2318 1919 841 25 21773 290 --12118
NM_000908chr54801 744 714 130 ----1778
NM_000917chr103754 741 160 ------
NM_000921chr12----2140 123 --
NM_000935chr351229 1038 811 252 35 --1126 --
NM_000944chr492361 2194 1915 1504 848 624 454 388 192 --12055 --
NM_000945chr281654 1368 786 598 452 199 126 30 --11358 --
NM_000965chr341200 848 330 74 ------
NM_001001132chr2141059 967 400 174 1988 1499 --
NM_001001323chr1272822 2783 2550 2515 2460 962 756 ----12920
NM_001001331chr341833 640 344 56 11727 11670 11785
NM_001001396chr193336 3237 2926 2907 2785 2710 633 553 329 24081 1601 11640 24282 774
NM_001001419chr5215235 5203 4992 4641 4082 3814 3802 3688 3661 3518 2005 1845 1761 1656 1020 854 848 745 418 282 148 45136 4918 1776 63 21968 1333 --
NM_001001481chr8123011 2986 2919 1274 1165 1123 1025 970 786 486 256 137 ----159
NM_001001521chr22257 86 ----1297
NM_001001549chr772758 2453 2368 1787 670 394 376 ------
NM_001001664chr2133933 3886 3674 3617 3326 3089 2780 2588 2568 845 370 249 103 --11067 1280
NM_001001890chr2193740 3694 3652 3422 2850 857 729 720 427 21679 602 ----
NM_001001933chr15617 474 229 184 167 1436 1126 --
NM_001001971chr1061090 1061 880 422 107 26 --11022 --
NM_001001974chr10142273 2206 2077 2016 1987 1891 1870 1633 1575 1568 865 561 529 355 32249 514 302 11954 --
NM_001001994chrX3451 426 92 ----1208
NM_001001995chrX81741 1655 1207 758 709 498 254 216 ----1233
NM_001002257chr2123463 3431 2219 1271 1247 1142 825 295 146 134 78 41 12606 1774 32937 673 548
NM_001002265chr103605 583 21 --1715 --
NM_001002295chr10165 --2913 146 --
NM_001002296chr861373 1352 1324 467 268 146 --1195 --
NM_001002811chr131615 1512 1471 --1444 11274
NM_001002838chrX61879 1854 1482 583 319 118 ------
NM_001002857chr153308 293 138 ------
NM_001002860chr14134474 3835 3814 2870 1609 1345 582 393 383 262 238 118 48 44057 3664 3283 3092 --11818
NM_001003674chr18176979 6865 6613 6345 6085 5575 5516 5377 5320 5306 5127 4495 1270 741 471 442 343 46183 2738 885 281 ----
NM_001003679chr172133 2068 1846 1468 583 569 496 ----184
NM_001003681chr2272145 2118 2051 2008 858 226 175 ------
NM_001003683chr2--167 1265 --
NM_001003688chr461167 796 776 761 353 266 11235 ----
NM_001003712chr12103762 3468 3427 3149 3077 3039 2890 2814 2664 2502 21340 1223 11009 --
NM_001003760chr6103639 3557 3341 2807 2798 2446 1352 1269 1232 803 21425 555 ----
NM_001003792chr37992 821 777 436 349 221 104 ------
NM_001003927chr172604 181 ------
NM_001003940chr1553773 3325 2714 1093 111 --13696 --
NM_001004308chrX71487 1480 1248 276 222 103 23 11513 1131 --
NM_001004317chr673963 3615 3540 3514 3340 1437 312 11261 23178 2933 14296
NM_001004329chr1241528 1457 1045 107 --11311 11211
NM_001004419chr1274613 4445 4273 3421 3282 675 133 33464 859 819 ----
NM_001005158chr32383 132 --1518 --
NM_001005266chr153569 481 55 1243 ----
NM_001005386chr252070 473 297 244 154 1669 11752 12485
NM_001005404chr17114369 4120 3763 3618 3581 3368 3327 3209 3140 3043 192 23347 830 14382 --
NM_001005463chr10172606 2572 2367 2361 2290 2106 1992 1959 1044 911 759 607 405 348 285 210 138 1639 22340 2131 1365
NM_001005473chr5186523 6289 5328 5322 5033 4904 4853 4774 4659 4582 4431 4216 4201 2626 2597 2298 742 257 16281 1437 14135
NM_001005476chr22705 626 ------
NM_001005526chr2----1105 --
NM_001005743chr1461267 1261 1161 1114 526 79 1163 ----
NM_001005753chr272041 1840 1726 904 305 195 53 --198 --
NM_001005781chr22245 119 1459 ----
NM_001005861chr34943 264 197 74 ------
NM_001005910chr32687 478 ------
NM_001006634chr16----1494 --
NM_001006658chr13664 563 517 1477 ----
NM_001006684chrX6435 165 149 107 81 56 1157 ----
NM_001007024chr1794400 4377 4214 4138 3193 3126 1618 202 37 --34292 4026 1483 --
NM_001007075chr441034 836 389 80 --11117 --
NM_001007097chr9105095 5021 4997 4651 4550 3817 3256 1904 1889 1248 14600 21397 580 --
NM_001007102chr691330 1310 1224 1193 1056 653 529 487 388 1500 1337 --
NM_001007156chr1571967 1880 1746 782 612 605 396 ------
NM_001007237chr1102863 2390 2150 1908 1860 984 811 643 530 470 --1616 --
NM_001007245chr72640 632 1647 ----
NM_001007246chr2111552 11338 21821 280 --
NM_001007257chr141518 1231 1184 1021 --11048 --
NM_001007277chr11----1418 11040
NM_001007278chr13155181 5014 4740 4621 4589 4411 4340 4028 3881 3702 3575 3191 894 873 357 --35114 3922 2118 15192
NM_001007466chr6135216 5042 4965 4781 4732 4519 4508 4497 3918 3320 1800 1692 1070 ------
NM_001007553chr141181 1058 360 189 --1301 --
NM_001007559chr18102044 1792 796 773 684 417 398 355 321 270 ------
NM_001007565chr31113 ------
NM_001007794chr12646 631 ------
NM_001008222chrX1150 --1874 --
NM_001008391chr111462 --1451 --
NM_001008393chr4122360 2169 2056 2046 1821 1112 1019 945 908 898 212 62 32105 666 358 ----
NM_001008495chr862119 1470 1390 427 244 162 21932 1603 32029 1992 804 --
NM_001008529chr173958 429 411 21344 484 1300 --
NM_001008541chr1052231 1696 1478 1470 890 22333 905 12170 --
NM_001008701chr1942999 2811 1925 802 ------
NM_001008710chr841687 1305 370 154 --11566 --
NM_001008738chr552737 2461 2268 2106 773 22691 240 ----
NM_001008777chr172516 63 ------
NM_001008801chr1941974 1944 1855 1437 --12117 21907 1365
NM_001008895chr1371482 1199 1079 1055 955 933 390 41436 1135 579 255 --11110
NM_001008925chr4113565 3424 3282 2829 2406 2333 2299 1228 1095 493 215 31416 1313 679 ----
NM_001009554chr4164655 4171 4123 3970 3490 3458 1482 1433 1259 1033 750 733 559 518 446 129 24743 4101 ----
NM_001009566chr141138 904 501 394 --11199 11254
NM_001009571chr731446 322 171 1549 ----
NM_001009881chr11604 ------
NM_001009899chr3206548 6542 6478 6021 5872 5825 5709 5634 5231 5014 4815 4805 4772 4592 4331 4146 1760 1503 980 215 26383 4358 36070 2004 767 --
NM_001009909chr11113842 3679 3327 2883 1545 663 572 535 440 218 143 31539 1532 516 --13152
NM_001009959chr23865 457 443 11843 ----
NM_001009960chr762229 2199 1017 861 812 755 1828 22405 2373 --
NM_001010853chr672910 2257 1223 1042 987 893 317 13178 13142 12855
NM_001010861chr172655 991 973 526 472 378 297 21925 449 ----
NM_001010888chrX164532 4011 3959 3821 3810 3507 3469 3400 3386 3165 3056 1726 1573 1219 867 98 --24002 3206 23912 3525
NM_001010895chr972080 2027 1856 1760 1529 706 135 11689 ----
NM_001010908chr101615 --1763 --
NM_001010927chr63454 125 38 ----1232
NM_001010942chr1261213 1072 339 322 175 78 11165 --1521
NM_001010986chrX82537 2412 2377 2288 1648 349 336 274 12155 ----
NM_001011515chr461051 781 419 386 123 51 ----11006
NM_001011663chr102705 283 --196 --
NM_001011666chr7186551 6429 6275 4817 4683 4335 4178 2552 2272 2067 1989 1505 1253 1172 948 623 128 71 1979 1222 1655
NM_001011713chr1471621 1465 1153 1100 565 303 79 --1158 --
NM_001012393chr1175115 4994 4756 4263 1733 1255 683 13932 14119 24550 719
NM_001012398chr1641051 924 422 31 ------
NM_001012418chr6134202 4069 3941 3925 3678 3302 3079 2882 2856 2704 1556 1333 285 23257 795 11674 1531
NM_001012423chr1572724 2663 2515 1807 579 503 211 --1612 --
NM_001012478chr192647 414 1408 1633 --
NM_001012754chr1392124 2048 1951 1924 1854 1670 1604 864 155 21828 749 ----
NM_001012989chrX1582 --1630 --
NM_001013031chr1073027 2971 2169 1410 1175 496 463 23547 3061 12342 --
NM_001013399chr621086 1008 ----1724
NM_001013406chr761512 1178 1085 645 385 83 --2125 36 --
NM_001013659chr19105161 4891 4132 1693 1551 1134 1035 945 793 377 24185 425 54569 4272 3558 2162 69 --
NM_001013699chr122549 49 --126 --
NM_001013746chr772341 2327 2284 2134 1683 1566 749 2828 711 11579 --
NM_001013843chr153747 377 151 ------
NM_001014797chr10137309 5517 5444 5266 5137 3183 2549 2133 1368 1113 988 375 309 22091 687 48225 5596 2634 1894 --
NM_001015045chr431826 1558 675 --1208 --
NM_001015877chrX83022 2666 2613 2006 1955 1019 985 927 32437 1251 498 ----
NM_001015881chrX31277 1197 1190 21241 1122 ----
NM_001015887chr391758 1725 1684 1561 1506 1325 1319 1253 1229 ------
NM_001017369chr431065 1017 167 ----11094
NM_001017371chr241069 403 210 151 ----1512
NM_001017395chr383649 3288 2920 2657 1309 715 576 219 13388 11365 12365
NM_001017415chr11184 --1512 --
NM_001017420chr861351 1255 1124 1100 938 270 --11414 --
NM_001017423chr105778 725 315 277 238 ------
NM_001017424chr171781 1610 1282 1225 208 175 80 21363 339 ----
NM_001017440chr7147984 7825 7673 6616 6270 3173 2781 2144 1457 1434 1275 1199 1082 743 25385 5182 1712 15742
NM_001017923chr1471688 1570 1128 1108 610 323 69 ------
NM_001017926chr861428 1338 1183 1148 1134 264 1428 ----
NM_001017979chr43559 190 114 ----1206
NM_001018004chr152738 90 --1226 --
NM_001018037chr931010 474 269 1525 21324 392 --
NM_001018056chr94576 505 202 166 ----1394
NM_001018067chr1175393 5326 5167 4943 4322 3680 3324 1617 1571 1435 1119 759 735 719 554 444 274 24423 484 12074 --
NM_001018100chr154857 699 318 21 1811 ----
NM_001018111chr734001 3982 3595 23026 2924 ----
NM_001020658chr151698 1440 1317 455 296 11682 11447 --
NM_001023567chr15122464 2380 2196 2111 2045 1828 1760 1535 911 582 506 219 ------
NM_001023587chr341158 1142 953 142 --1168 1794
NM_001024226chr12988 409 11005 2823 375 --
NM_001024380chr862367 2343 2026 1649 1615 155 --11753 --
NM_001024455chrX52520 2108 2094 1694 1024 --11891 --
NM_001024649chr582886 2867 2676 2228 2202 1919 928 311 42610 2132 2046 1101 ----
NM_001024688chr831451 217 194 21832 151 11668 --
NM_001024808chr1251960 1830 409 368 70 11754 ----
NM_001024912chr1931823 1343 383 148 11365 --
NM_001024934chr62696 585 ------
NM_001024948chr1132553 2533 2443 2382 1210 1136 771 728 647 534 514 508 182 23380 670 2956 173 --
NM_001024948chr1132553 2533 2443 2382 1210 1136 771 728 647 534 514 508 182 23380 670 2956 173 --
NM_001025076chr10196255 4402 4178 3940 2470 2464 2116 1858 1674 1657 1648 1568 1334 997 608 578 564 529 32 --15406 --
NM_001025077chr10257613 5760 5536 5298 5111 5050 5020 4973 4730 3032 3015 3006 2926 2692 2355 1966 1936 1922 1887 1348 1079 646 300 200 32 --36764 4808 4612 --
NM_001025079chr3143994 3983 3939 3913 3782 3370 2791 2609 1469 1356 1226 862 677 454 33885 3452 3404 13603 --
NM_001025201chr26738 629 583 541 494 189 ------
NM_001025252chr883217 3159 3082 2963 2041 1047 547 511 11110 ----
NM_001025366chr621464 267 --21897 184 --
NM_001025580chrX164171 3880 3857 3784 3047 3002 2642 2609 1489 1273 1125 824 746 280 244 99 33945 2755 1030 1563 --
NM_001025616chr431203 536 505 21191 674 11178 --
NM_001029858chr6103330 2301 2257 2164 2105 651 575 441 425 407 --21134 1093 --
NM_001029863chr6133212 3096 3073 2783 2764 1975 1168 1006 786 633 483 342 244 ----12812
NM_001029875chr5112994 2803 2674 1941 1147 1103 1083 960 914 639 125 11990 22736 812 --
NM_001030007chr16123782 3516 3412 3400 3339 3295 3092 2847 2620 1197 473 222 22680 1412 23656 366 --
NM_001030055chr14164707 4610 4301 4258 4185 4025 3968 3835 3587 1321 1160 1057 883 737 397 121 24157 3503 11235 --
NM_001030chr1----151 --
NM_001031695chr22105178 4620 3794 3670 2177 2031 1047 594 235 150 13555 34677 1328 1185 --
NM_001031710chr731034 293 57 1854 ----
NM_001031723chr42457 309 --1348 --
NM_001031804chr1684000 3564 1159 1082 906 527 499 474 34028 3086 1182 24278 1319 23860 3512
NM_001031812chr5112248 2156 1605 1564 1523 810 674 491 296 232 128 11830 21851 142 --
NM_001032282chr841314 1073 319 34 1295 ----
NM_001032283chr123924 285 185 --21021 206 --
NM_001032296chr1372834 2294 1019 623 450 245 227 --32792 1832 1121 1591
NM_001032380chr1061458 398 370 283 136 58 ------
NM_001032394chr6142823 2730 2717 2662 2223 2148 1973 1067 935 625 596 523 486 256 1565 11786 --
NM_001033025chr121502 163 ------
NM_001033045chr284401 4043 3774 3402 2951 1780 1386 382 14135 23094 1228 14263
NM_001033049chr2162194 2153 1973 1528 434 352 ------
NM_001033057chr381429 1408 797 704 361 271 224 133 ------
NM_001033059chr621780 462 21740 1513 1592 1151
NM_001033081chr121865 553 11841 188 --
NM_001033085chr2----196 --
NM_001033087chr2052917 2297 2290 2105 280 12923 1149 --
NM_001033518chr792511 2279 1774 743 553 536 337 179 59 182 1290 --
NM_001033659chr1721558 1302 1365 41368 1038 491 80 --
NM_001033925chr1051743 1733 512 325 144 1272 2706 523 1303
NM_001034841chr1695533 4816 4709 4362 3906 1391 982 958 679 14856 22154 703 15492
NM_001034850chr551564 1359 1314 1076 113 21459 472 11229 --
NM_001034954chr1032990 2831 2740 12288 --12608
NM_001035003chr44575 481 127 75 1379 11428 11041
NM_001035260chr1071340 1264 1076 511 420 310 277 21608 346 --11404
NM_001035chr141178 1091 825 94 1184 21259 85 11189
NM_001037132chr7102027 2004 1986 1899 1879 1780 1531 680 371 199 ------
NM_001037164chr781907 1666 1428 786 691 544 389 118 32069 1645 54 11404 --
NM_001037172chr361213 1154 1143 1082 381 230 ------
NM_001037174chr292252 2134 1776 1534 599 592 445 230 29 11578 --1300
NM_001037334chr1891865 1778 1771 1651 670 659 447 311 229 21753 1529 ----
NM_001037339chr191792 1784 1419 1304 702 621 582 568 420 11487 ----
NM_001037535chrX81387 1246 1227 1182 1025 975 249 73 ----11140
NM_001038493chr261544 1523 1421 1398 967 485 ------
NM_001038633chr111397 ------
NM_001038640chr152978 287 --1683 --
NM_001039479chr1482435 2220 1924 1903 1823 918 625 140 --1203 --
NM_001039570chr2244672 4641 735 569 24522 4470 11389 --
NM_001039577chr193900 3477 1591 1569 1465 1203 396 232 186 21517 452 133 --
NM_001039590chrX103885 3833 3481 3470 2835 2639 1513 1434 1407 503 22804 2593 --1627
NM_001039618chr11195671 5447 5330 5036 4908 4877 4313 4178 4127 2343 2240 2187 2002 1677 1558 843 753 340 332 45592 4458 3935 2310 25975 1976 14533
NM_001039711chr14967 777 386 326 1453 122 --
NM_001039762chr1051807 787 679 437 64 --1451 --
NM_001039840chrX175917 5584 5204 4823 4452 4103 3936 3924 3697 3685 2431 2407 2358 1962 1663 1451 360 35631 4682 1001 45054 4410 873 506 --
NM_001039937chr13233987 3976 3559 3314 3256 3050 2721 2569 1598 1576 1392 1380 1083 823 794 769 495 437 371 348 218 151 85 1472 21092 174 --
NM_001039938chr1341213 1180 1161 172 --136 --
NM_001040001chr681964 1714 1686 1449 1405 1359 1307 179 1701 123 --
NM_001040057chr781397 1353 1346 1340 1278 949 461 284 ------
NM_001040101chr43222 140 89 155 1332 --
NM_001040110chr73162 150 97 ------
NM_001040142chr282484 2402 2214 2065 1665 1567 903 420 --126 --
NM_001040152chr794637 4481 3870 3818 3352 1436 1389 1346 705 23387 1932 ----
NM_001040159chr461486 1272 1209 600 291 117 1186 11257 --
NM_001040179chr62878 864 --2955 812 --
NM_001040181chr341023 189 109 33 --1422 --
NM_001040202chr492493 2398 2058 1810 1723 1641 750 657 296 32198 1613 1577 11731 --
NM_001040429chr1362869 2391 2275 775 83 31 12221 23118 697 --
NM_001040441chr1125371 5069 4888 4327 3433 1553 1395 814 346 275 255 173 --35043 4490 1669 --
NM_001040446chr562506 2184 987 895 515 343 --1622 --
NM_001040450chr1572681 831 738 710 576 283 112 32558 2521 729 11069 --
NM_001040613chr84425 327 173 67 11156 ----
NM_001040633chr7--1682 11082 --
NM_001040665chr7154829 4800 4282 3995 3756 3409 3367 3269 1509 1015 950 701 445 382 266 --11628 --
NM_001040708chr851071 301 226 157 112 1463 1270 --
NM_001040709chr152308 1880 1720 799 774 1124 ----
NM_001040712chr993335 3006 3000 2855 2200 836 719 623 455 1416 ----
NM_001042355chr16195419 5337 5202 5183 4980 4963 4847 4180 3959 3853 3842 3520 3293 1449 1423 1329 1315 660 395 --31996 1357 192 --
NM_001042383chr373449 3149 2940 2838 2630 165 152 --1227 12953
NM_001042404chr171996 1973 1915 788 778 755 579 11677 ----
NM_001042413chr9163991 3712 3645 3421 3304 3291 3278 3229 3088 2724 2602 1449 1317 683 622 168 13146 23470 729 --
NM_001042414chr13160 --1296 1204
NM_001042437chr21159 194 1208 --
NM_001042459chr34311 277 263 103 ------
NM_001042473chr1062107 1658 1382 778 181 158 1823 22047 532 --
NM_001042481chr1482686 2631 1867 1802 780 346 258 167 --2960 745 12368
NM_001042510chr861904 1506 1486 1391 1369 132 21653 307 ----
NM_001042537chrX51972 1860 928 909 234 22112 1617 ----
NM_001042543chr461540 1378 1010 394 150 143 2542 342 ----
NM_001042555chr12204770 4616 4609 4530 4060 4049 4041 3830 3720 3703 3558 1772 1221 1157 1067 972 881 729 601 70 1396 14194 --
NM_001042599chr2217769 7570 6976 6786 6462 6141 5953 5394 5240 5208 2903 2073 1569 1186 991 886 876 793 638 491 312 67487 7273 6703 6623 6025 1136 66286 5604 5284 2727 1128 656 27383 1635
NM_001042603chr12155369 5310 4703 4016 3730 3512 3454 3396 3338 1970 1692 1149 1119 771 456 1742 11400 24448 2002
NM_001042604chr3184104 3719 3657 3559 3404 3341 3275 3159 1726 1240 876 845 616 534 383 189 149 131 --34663 4507 3710 --
NM_001042646chr321829 170 11617 ----
NM_001042683chr661775 1296 1274 528 487 299 ------
NM_001042724chr191717 1844 ----
NM_001042749chrX51764 778 633 520 37 --11288 11273
NM_001042762chr721125 913 --2795 711 --
NM_001043318chr1444125 3796 3765 3621 13892 33721 1468 870 --
NM_001043351chr141850 907 696 381 22057 1967 1286 --
NM_001044305chr631365 212 194 --11140 --
NM_001045556chr821137 483 --11738 --
NM_001046chr553003 2487 2023 435 399 32930 1844 1219 ----
NM_001048183chr173618 2617 2598 1509 1110 1104 38 --43565 1202 762 199 1139
NM_001049chr1462294 2218 1911 1763 258 207 ------
NM_001068chr3124 ------
NM_001071775chr1381834 1743 1677 1412 643 236 214 119 31509 671 418 11949 11518
NM_001079874chr172134 2066 1987 1777 760 548 365 11407 12124 --
NM_001100108chr1127977 7868 7338 6590 3348 3329 3240 3081 3011 1953 1338 1289 26801 879 26088 5448 17480
NM_001106chr3229251 9220 8570 7588 7161 7069 7017 6790 6033 5909 3299 3214 2757 2546 2376 1742 1619 1499 1005 891 529 337 36436 3148 1405 39535 7760 6603 17828
NM_001109977chr43768 678 97 ------
NM_001121chr1051824 734 677 581 176 1198 ----
NM_001123chr105834 571 287 277 98 ------
NM_001140chr171160 1584 ----
NM_001146chr882282 2015 1989 1896 1802 925 620 306 1495 ----
NM_001148chr441851 1675 1536 396 12050 1307 11585
NM_001153chr27853 838 593 373 282 275 61 --1943 142
NM_001167chrX196540 6534 6460 6406 4930 4731 4622 1810 1758 1233 1139 1055 912 883 838 831 571 511 202 16358 1848 --
NM_001187chr212523 235 --2129 118 --
NM_001187chr212523 235 --2129 118 --
NM_001198chr682347 2143 1828 1779 1650 1595 977 24 1277 11958 --
NM_001199chr8------1211
NM_001201chr4123937 3919 3788 3385 3068 2408 1498 1352 1080 700 671 664 --21395 104 --
NM_001204chr2267575 7487 6253 6098 6075 5830 5811 5798 5565 4798 3022 2501 2329 2142 2100 1610 1600 1529 954 896 678 645 615 593 212 192 27664 2179 36659 5644 4860 --
NM_001218chr1552199 608 344 330 44 --1759 --
NM_001219chr751902 1520 812 669 393 --1231 --
NM_001225chr11----185 --
NM_001235chr111672 --1705 --
NM_001241chr292403 2146 1963 1902 1777 830 714 590 132 11949 ----
NM_001248chr33958 911 419 11111 ----
NM_001259chr7165781 5347 5048 4588 4497 4299 4180 2235 2082 1415 1401 1328 1079 963 480 394 14048 --15273
NM_001262chr13354 307 35 1224 ----
NM_001270chr561080 980 936 729 444 220 ------
NM_001271chr1533286 3249 712 12587 22823 204 1247
NM_001274chr112338 154 --1353 --
NM_001278chr1031054 968 425 --11208 --
NM_001280chr192251 109 ----1237
NM_001304chr17103232 2723 2715 2460 1304 676 462 315 238 110 13383 12639 13429
NM_001315chr652045 1580 1508 1495 1396 --21662 378 --
NM_001326chr112366 356 --181 --
NM_001332chr531528 1275 1098 11057 21321 397 --
NM_001338chr2131100 767 383 11216 --1292
NM_001356chrX42169 1771 1641 277 1341 11545 11810
NM_001364chr11154798 4791 4194 4059 3786 3753 3653 3434 3095 1554 1135 1022 776 662 219 11417 11182 1423
NM_001380chr103969 938 905 ------
NM_001389chr21----1583 --
NM_001396chr2182310 2144 1825 1811 1795 1115 889 246 11074 11012 --
NM_001400chr181137 1049 1008 990 928 506 499 388 2367 256 11335 --
NM_001402chr61225 2486 268 1169 1755
NM_001407chr341150 1109 1075 1065 11171 11184 --
NM_001408chr11325 --1223 --
NM_001419chr19144883 4707 4610 4536 4235 4228 4221 4094 1215 1199 1170 985 972 467 34522 4485 3989 21110 84 --
NM_001421chrX51537 1266 524 310 52 ----1662
NM_001424chr16----160 --
NM_001427chr752084 1981 1489 1456 323 --1451 --
NM_001429chr2241052 970 421 402 ------
NM_001430chr271846 767 569 441 387 236 175 12005 11507 --
NM_001431chr661212 1130 917 298 213 36 ----1333
NM_001432chr493654 3635 2897 2756 2655 1354 1229 889 65 13809 23676 3394 --
NM_001438chr183685 3328 3197 3091 2357 1073 953 191 1965 ----
NM_001448chrX41496 151 80 59 1702 ----
NM_001451chr1651184 1034 969 929 426 ------
NM_001452chr63703 681 458 --1637 --
NM_001453chr641775 1593 1469 461 --21439 225 --
NM_001455chr694761 4220 3561 3397 3325 3078 1952 996 147 14696 24513 1292 --
NM_001485chr21225 ------
NM_001491chr652620 2410 2279 805 543 11788 22172 209 --
NM_001527chr6144569 3681 3374 3367 3073 1684 1591 1450 1348 1282 1037 895 100 90 14890 ----
NM_001530chr144436 416 255 208 2867 132 2965 754 --
NM_001546chr641233 1117 1023 360 ------
NM_001554chr11214 --1253 --
NM_001584chr1121146 52 --11038 --
NM_001620chr113770 663 327 ------
NM_001622chr3--1305 155 --
NM_001627chr351868 1696 1511 837 347 ------
NM_001650chr18103908 3564 3444 2954 2870 1552 1334 1271 940 928 --1888 --
NM_001655chr1132094 1745 1496 --22125 385 --
NM_001656chr592083 1774 1678 1668 590 520 171 154 48 --1627 --
NM_001656chr592083 1774 1678 1668 590 520 171 154 48 --1627 --
NM_001663chr14112255 2088 1970 1863 1047 990 826 443 378 221 91 1882 21766 855 --
NM_001678chr1731593 1306 492 1529 11169 --
NM_001679chr31667 --153 --
NM_001681chr121526 --1137 --
NM_001690chr33787 482 413 22489 110 1466 --
NM_001701chr971614 1464 1267 471 459 425 219 11052 21104 105 --
NM_001718chr6--1106 --11238
NM_001723chr6156 --1857 --
NM_001731chr126953 900 804 795 233 57 ------
NM_001743chr22516 486 ------
NM_001744chr53444 49 40 ------
NM_001748chr151065 919 294 284 277 --178 --
NM_001753chr7111700 1642 1599 1527 1303 1228 714 678 390 263 137 11553 ----
NM_001759chr1274716 3316 2038 1786 1660 1650 650 23777 3566 11332 1976
NM_001792chr1861180 1108 381 336 122 88 ------
NM_001798chr1231054 858 782 ----1843
NM_001801chr54652 457 427 30 ------
NM_001806chr1942985 1182 964 523 1838 22772 998 --
NM_001826chr12414 153 ----1103
NM_001830chrX73740 3618 3076 2777 921 491 188 43914 3549 3473 769 ----
NM_001854chr141291 1241 1100 387 1178 163 --
NM_001859chr933496 1307 1079 34006 3514 2734 43596 2979 2445 546 1990
NM_001882chr52519 174 169 ----
NM_001893chr17----1384 --
NM_001894chr2241200 1194 1182 1141 ------
NM_001895chr2031197 980 398 ----1867
NM_001901chr62901 63 2988 699 ----
NM_001918chr1129198 8705 8382 8236 8195 7165 6114 1272 1224 1025 965 210 26141 3470 52395 1895 1650 1257 331 25656 2196
NM_001924chr11170 1432 ----
NM_001938chr161746 1573 1497 1308 628 87 1222 --21892 685
NM_001939chrX53502 3230 3076 1101 611 23852 3803 12484 1766
NM_001941chr18133679 3235 3011 2921 2861 1630 1501 1483 1232 999 854 506 349 53442 3360 3308 1450 113 13163 --
NM_001945chr561424 1300 1097 924 532 154 ------
NM_001946chr1241185 982 885 410 ------
NM_001949chr6173245 3165 3086 3025 2825 2782 2758 2746 2703 2685 2453 2375 2139 2016 990 226 149 1881 ----
NM_001957chr4102260 2173 2126 2098 1586 1416 868 474 419 303 --12065 11778
NM_001964chr551164 1104 1087 879 282 ------
NM_001966chr311099 --11009 1357
NM_001967chr31625 1135 1455 --
NM_001968chr45870 695 648 358 179 --1851 --
NM_001969chr14113743 3613 2990 1448 1164 1028 800 779 357 297 116 --33035 2694 758 --
NM_001995chr431212 351 220 181 ----
NM_001999chr561541 1519 1128 1077 357 237 21385 135 1348 --
NM_002015chr1382542 2187 858 832 780 692 658 177 22733 1279 42061 1074 958 902 11297
NM_002024chrX91752 1429 1418 1390 662 517 465 305 69 12098 ----
NM_002025chrX289181 9147 9105 8495 8451 8169 8092 8066 7906 7762 7206 7047 6166 5991 5726 3367 3190 2973 2955 2069 1881 1457 1423 1125 1095 984 659 208 47503 3030 1332 700 --16032
NM_002031chr62562 163 --1619 --
NM_002039chr46873 626 616 370 286 168 ------
NM_002040chr21123047 2836 2537 2418 2295 2164 2141 2061 1172 1115 1043 950 2709 172 ----
NM_002045chr31344 --1279 --
NM_002048chr92971 832 ------
NM_002061chr141871 1653 1567 317 1681 11263 --
NM_002076chr1293263 3152 2905 2605 1082 1012 720 554 357 12399 ----
NM_002077chr962134 1888 734 627 108 41 ----11990
NM_002099chr421386 532 11539 ----
NM_002112chr152101 77 ------
NM_002126chr17123577 2941 1491 1201 1120 1086 1017 556 350 227 97 26 24173 3990 33892 2718 131 13218
NM_002128chr1362441 2280 2001 1744 1648 873 ----2773 538
NM_002137chr732224 1883 957 --1178 11460
NM_002139chrX1107 --1561 --
NM_002140chr931013 780 350 1259 ----
NM_002148chr23448 160 136 ----1432
NM_002154chr52156 58 ------
NM_002158chr2133839 3376 3015 2964 2789 1521 1009 750 628 479 408 362 126 43283 2678 1212 682 --2944 850
NM_002167chr1----1485 --
NM_002205chr12----1287 --
NM_002207chr33681 482 225 ------
NM_002210chr2103105 2482 2185 1300 992 872 667 594 465 291 12459 --23376 2317
NM_002214chr7175531 5335 5160 5067 4833 4689 4638 4488 4355 4192 4056 3913 2216 1015 766 305 237 35473 5092 992 15217 33763 2098 973
NM_002221chr172643 2574 2556 2108 1965 858 159 12745 22217 127 --
NM_002223chr1242816 2454 598 441 22660 2642 ----
NM_002227chr121171 71 --21296 828 --
NM_002232chr111107 ------
NM_002233chr11------1381
NM_002241chr142227 2211 2166 1160 --23139 449 --
NM_002245chr13622 107 73 ------
NM_002253chr441435 1361 525 445 --11377 --
NM_002264chr3174654 4296 3757 3556 3282 3158 3088 1986 1969 1953 1225 1062 1048 963 755 471 254 24738 3323 --1679
NM_002267chr1342424 2313 1640 1549 11872 2381 151 --
NM_002268chr351763 1705 1460 1445 1238 11437 ----
NM_002270chr5195634 5595 5520 5095 4853 4513 4285 4000 3813 3742 3511 2190 2183 1964 1857 1661 1485 847 769 14810 13600 --
NM_002271chr1362307 2273 2104 1668 913 840 --21797 525 --
NM_002291chr7152 --1116 --
NM_002293chr152742 2673 844 245 85 ----11988
NM_002310chr5146405 6155 5881 5203 5119 4920 4768 4405 2264 1967 1099 830 824 810 1644 11711 --
NM_002314chr7----21027 1019 11084
NM_002332chr121135 ------
NM_002333chr1921172 418 --138 --
NM_002335chr112195 162 ------
NM_002336chr12134897 4881 4523 4321 4124 4108 4066 3608 3169 1977 1139 1055 539 33578 3234 3208 24542 769 --
NM_002356chr671843 1136 877 539 317 156 136 32722 2551 1104 12577 --
NM_002359chr17104307 3784 3420 3282 3061 2988 2911 2741 1629 890 13695 ----
NM_002382chr142978 427 1451 ----
NM_002395chr681217 1119 454 384 358 282 181 114 --2370 191 --
NM_002397chr552061 1605 1429 881 145 --1693 --
NM_002399chr1541463 1366 453 444 1389 ----
NM_002402chr741083 1010 241 125 21186 211 1334 --
NM_002408chr146806 702 584 324 316 308 --1192 --
NM_002444chrX81953 1928 1497 1484 561 525 299 286 --11547 --
NM_002467chr81158 --1397 --
NM_002480chr1241265 420 369 106 11239 1155 --
NM_002481chr1188009 7812 7637 7543 6516 5846 5780 5531 4907 2960 2445 2405 1880 1311 1253 320 169 158 37842 4815 1621 17652 12609
NM_002486chr942187 875 438 155 22172 645 11688 --
NM_002499chr1562494 2241 2231 866 555 264 --1307 --
NM_002514chr84943 332 298 234 1893 21161 882 --
NM_002515chr1472039 1792 1700 273 218 72 50 1476 ----
NM_002516chr19----1312 --
NM_002518chr221221 1143 --1992 --
NM_002522chr17123919 3793 3761 3654 3099 3059 2774 1503 606 460 440 401 11112 33181 3119 2648 --
NM_002533chr13255 115 79 2287 277 ----
NM_002541chr721027 992 ------
NM_002547chrX74170 4127 3196 3139 2783 849 129 --194 --
NM_002556chr1141931 1761 812 126 11822 2704 395 --
NM_002563chr341062 832 252 68 ------
NM_002568chr81320 1133 ----
NM_002577chr3104048 3352 3017 2834 1333 873 865 307 292 37 14030 31607 786 539 --
NM_002581chr995662 5640 5525 3763 1655 1122 966 948 844 44840 4354 2260 1257 23809 1544 --
NM_002590chr131451 1231 ----
NM_002595chr1251386 724 526 489 438 21616 1215 11649 1656
NM_002613chr1695064 4608 4390 4363 3347 1303 1194 497 135 13381 1221 13405
NM_002628chr311047 --21152 261 1358
NM_002629chr105561 315 299 151 145 --1161 --
NM_002641chrX51637 1344 758 337 303 1295 --22047 562
NM_002645chr1183040 2903 2478 2359 1097 323 99 22 1290 22324 1237 --
NM_002649chr741525 1299 1208 382 31426 1164 300 ----
NM_002655chr8195154 4954 3795 3754 3633 3241 2131 1974 1342 1246 728 333 311 300 236 207 168 80 62 ------
NM_002657chr20123893 3680 3356 3319 3128 3091 2568 1365 1305 825 797 244 --13749 --
NM_002687chr146997 892 845 442 176 163 11188 11200 --
NM_002699chr151413 1274 526 476 90 --11214 --
NM_002709chr263267 2604 2335 1223 683 453 23424 382 11082 --
NM_002716chr1143140 996 601 502 ------
NM_002718chr382685 2285 1822 1721 1079 626 586 134 197 11961 11893
NM_002719chr1462421 2103 1874 1711 883 392 11815 11665 2911 587
NM_002721chr9281 29 --196 --
NM_002734chr1792253 1730 1645 1481 1415 672 544 223 155 ------
NM_002736chr7141948 1911 1769 1751 1597 1576 845 743 706 470 429 229 181 91 11832 11402 1590
NM_002737chr17176461 6121 6115 6073 5929 5735 5435 4995 4846 4394 4130 2044 1467 1249 795 694 321 26288 4692 36647 899 301 --
NM_002738chr1641148 794 432 67 1925 --11083
NM_002740chr382644 2619 2383 2077 1816 905 627 88 32822 2292 404 12670 22244 2168
NM_002742chr141181 ------
NM_002745chr22103824 3583 3572 3324 3219 3200 1075 677 451 419 12994 11767 1112
NM_002747chr1831817 665 230 --11794 --
NM_002748chr156938 891 853 381 179 80 --11069 --
NM_002752chr51224 --1368 --
NM_002767chr172522 417 ------
NM_002786chr111213 182 ----
NM_002806chr141316 --1255 --
NM_002827chr2071829 1465 712 555 447 232 191 --11474 1209
NM_002828chr186982 932 819 716 620 252 ------
NM_002829chr91134 ----11211
NM_002830chr23268 147 89 1124 ----
NM_002833chr15----11532 --
NM_002834chr1274112 4031 3549 3397 2848 2561 315 13571 --23817 513
NM_002843chr1173434 3337 2356 1019 785 730 242 21341 133 ----
NM_002844chr631187 362 348 --1902 --
NM_002848chr1291222 1141 1126 1102 1016 938 861 107 85 ----11281
NM_002849chr1241073 921 756 269 ------
NM_002850chr1941245 1173 811 486 ------
NM_002851chr71671 ----1723
NM_002858chr11430 --11207 --
NM_002859chr1221662 1277 21779 707 ----
NM_002868chr1252323 970 907 337 151 --1271 --
NM_002869chr1152222 373 274 263 44 11966 ----
NM_002874chr962315 2307 1839 839 709 434 --11605 --
NM_002880chr33829 674 61 ------
NM_002886chr3115163 5157 4656 4477 1849 1469 1443 1001 868 774 252 34046 1729 84 54345 3891 3493 1272 101 24501 4249
NM_002892chr14111652 1606 1571 1302 1269 1176 1116 611 394 242 121 ------
NM_002894chr182211 178 1238 1185 --
NM_002895chr204962 673 276 32 2689 184 ----
NM_002902chr153652 143 61 --1437 --
NM_002906chr11152379 2341 2168 2117 1985 1826 1751 1694 1682 1629 1560 424 361 339 247 ----12052
NM_002912chr62709 676 --1928 1597
NM_002923chr11648 1665 --1629
NM_002941chr381641 1605 1327 1170 1137 626 481 147 1268 1325 --
NM_002942chr32917 433 ----11365
NM_002956chr1241423 453 349 220 2414 138 1447 --
NM_002959chr1124460 4399 3477 1490 1305 1233 1208 1164 1135 817 224 189 --11775 --
NM_002968chr1671108 1006 963 882 247 232 206 --1753 1442
NM_002973chr122535 95 ------
NM_002988chr171174 ------
NM_002993chr431042 756 112 2695 134 1992 --
NM_002994chr491959 1921 1712 1637 1212 712 557 462 99 21328 722 11871 1159
NM_002996chr1631935 1915 1866 --21979 1751 --
NM_002998chr8112160 1981 1915 1884 1814 1741 1699 615 581 376 117 --1549 11841
NM_003011chr941516 644 469 231 ----1571
NM_003016chr1732023 1938 273 --11273 --
NM_003017chr661260 1150 1091 373 222 106 1258 ----
NM_003026chr941097 962 136 62 --11132 --
NM_003029chr131127 1017 430 ------
NM_003030chr331804 1786 1544 21507 784 11983 --
NM_003036chr12347 288 --2978 879 --
NM_003042chr332187 399 289 --1453 --
NM_003048chr252786 2535 2454 2190 2047 1984 22819 1099 --
NM_003071chr342043 646 344 244 ------
NM_003081chr203263 256 161 --11185 --
NM_003100chr52426 174 1383 ----
NM_003105chr11------187
NM_003106chr321054 384 --1841 --
NM_003108chr2166807 6566 6463 6347 5721 5649 5596 5423 5277 5001 4554 1468 917 782 248 210 16425 26558 1425 15039
NM_003112chr7113074 2866 2632 2375 2240 2120 1071 989 914 646 368 32598 2017 960 ----
NM_003133chr191062 1028 836 401 200 150 125 84 22 --1383 --
NM_003146chr114415 363 259 64 --1370 --
NM_003150chr1742387 454 164 105 --1630 --
NM_003155chr852680 2558 2549 1977 44 1604 12162 --
NM_003161chr1733345 2262 1218 33204 3103 2846 13480 --
NM_003174chr102743 167 1354 1846 --
NM_003179chrX----11337 --
NM_003185chr2071287 1252 1237 1207 1079 930 865 --1340 --
NM_003188chr63690 641 138 1538 1236 124
NM_003204chr17--1695 --21185 615
NM_003205chr1582097 2014 1840 1669 829 813 753 649 ------
NM_003206chr62424 139 1359 ----
NM_003221chr693573 3536 3510 3422 3193 3042 1480 1004 94 31558 1192 396 ----
NM_003223chr163861 788 302 1753 ----
NM_003234chr341846 1749 822 255 1378 22290 1585 --
NM_003253chr2151666 1391 1241 167 160 ------
NM_003257chr1571173 1137 970 563 441 406 243 21088 929 ----
NM_003262chr3134360 4338 4158 1994 1676 1523 1422 1301 967 755 523 272 156 21143 922 14323 33977 989 251
NM_003263chr4175 1194 ----
NM_003269chr631176 1157 1102 ----11187
NM_003290chr192288 144 1161 2763 100 1341
NM_003292chr161905 910 394 313 217 81 ------
NM_003298chr3196174 5960 5775 5587 5477 5135 4870 4248 2414 2029 2005 1955 1927 1846 1567 1345 421 226 78 23870 2502 26030 1303 1955
NM_003304chr371457 1374 1024 634 614 512 238 ----11596
NM_003318chr62288 241 ------
NM_003319chr22631 264 --1619 --
NM_003320chr1174478 4401 4384 3988 3439 2952 114 13957 ----
NM_003336chrX51132 1097 989 295 89 ------
NM_003337chr541448 435 304 172 31674 1409 595 21368 290 --
NM_003338chr1081894 1602 1495 1232 651 478 410 126 11858 1203 --
NM_003339chr551337 995 603 532 460 ------
NM_003341chr32532 145 163 ----
NM_003342chr1763310 2375 2251 1325 1068 682 12074 13049 1212
NM_003348chr1241662 1109 1082 686 --1620 --
NM_003374chr52765 38 --3781 530 302 --
NM_003390chr1121071 87 2699 157 ----
NM_003403chr143703 694 578 --1607 --
NM_003406chr8101849 1819 1796 1389 1306 1292 651 563 416 273 11439 ----
NM_003410chrX72582 2342 605 568 393 233 57 22780 714 42918 1013 787 160 --
NM_003411chrY81492 1347 735 687 353 148 136 54 11288 1558 --
NM_003412chr392797 2787 2717 2363 955 827 693 591 195 ------
NM_003417chr19239124 9059 7663 7191 6866 6781 6693 6587 6280 3638 3569 3539 3437 2893 2745 2591 2518 2421 1990 1810 1799 1202 951 43605 2305 1878 1039 27069 273 13131
NM_003427chr6------1665
NM_003439chr772775 2691 2613 1418 1405 1225 414 --23579 2278 --
NM_003463chr682995 2908 2303 2243 1316 1205 874 499 --1618 1646
NM_003466chr231919 1736 1636 22527 1661 --12397
NM_003468chr2124222 4007 3717 3346 2739 1256 933 842 649 308 276 205 13393 21443 286 12963
NM_003470chr1631327 433 66 ------
NM_003471chr352163 1725 911 889 877 --11844 --
NM_003472chr651224 1103 341 250 195 1421 1259 --
NM_003473chr102988 834 --1762 1364
NM_003477chr111244 ------
NM_003478chr1192914 2865 2810 2200 2114 1173 988 150 39 43300 3214 2658 98 ----
NM_003482chr1272797 2750 2565 2432 2349 2235 1115 --11806 --
NM_003483chr1282551 2486 1879 1818 778 660 536 104 12849 ----
NM_003489chr21163345 3191 3162 3102 2802 2520 2272 2126 1260 728 710 522 515 393 361 355 13120 22478 334 1121
NM_003506chr861313 1283 1120 1092 994 330 11299 3961 931 486 --
NM_003507chr2102027 1987 1981 1948 1933 1736 1556 754 746 442 --11317 1704
NM_003557chr131588 1559 582 ------
NM_003559chr1733996 3858 567 ----11577
NM_003566chr12173308 3237 2753 2637 2346 2320 2214 2131 1235 1120 1032 992 915 486 277 205 135 12824 22874 2603 --
NM_003569chr63569 517 119 ------
NM_003583chr1293413 3344 3281 3087 2854 1294 1253 1019 204 --21120 159 --
NM_003590chr2113480 3472 3401 3081 2914 1614 1561 1256 1188 974 928 12491 33589 1266 394 --
NM_003592chr71412 ----1346
NM_003597chr272153 1972 1751 1420 887 674 601 22261 2192 1433 --
NM_003603chr4102092 1881 1608 1519 1402 1385 679 623 526 439 22036 239 ----
NM_003607chr1174374 4341 4202 4124 4060 3861 3837 3727 3241 3149 2996 1571 1556 945 344 267 60 --13491 --
NM_003615chr3153543 3310 2648 2485 1339 1269 1262 1235 1140 1000 976 954 400 342 289 21058 748 ----
NM_003618chr261181 1123 978 302 151 111 ------
NM_003626chr1151396 1335 1129 1070 252 11080 21096 75 --
NM_003629chr183359 3212 2856 2296 580 423 115 37 32924 2913 872 ----
NM_003630chr62728 41 1741 ----
NM_003631chr102783 423 --1946 --
NM_003633chr562310 1866 1771 939 784 580 --1763 22537 2239
NM_003651chr121524 --1428 --
NM_003685chr192890 719 --155 --
NM_003686chr11241 --1260 --
NM_003690chr24526 245 215 187 1631 ----
NM_003701chr133432 221 50 ------
NM_003711chr51246 ------
NM_003713chr11697 --11678 --
NM_003716chr33862 734 134 ----1905
NM_003718chr72513 30 ------
NM_003722chr392672 2640 2132 2060 1967 1773 1755 1676 441 11782 ----
NM_003743chr232165 556 423 --11867 --
NM_003749chr1372061 1838 1765 1687 1673 783 735 1684 12148 --
NM_003760chr1------1797
NM_003779chr12499 417 1475 ----
NM_003787chr1881604 1450 1281 1238 1138 537 531 203 ----161
NM_003796chr195591 443 432 181 114 ------
NM_003822chr12853 669 1603 1967 --
NM_003825chr1511006 11284 --11256
NM_003850chr131540 1527 ----
NM_003861chr1482454 2308 1939 1852 1097 920 407 125 12544 ----
NM_003872chr262356 774 665 430 291 66 32596 2060 1995 ----
NM_003873chr1042569 2360 2315 1775 ------
NM_003884chr391705 1581 746 591 409 381 354 193 126 1550 ----
NM_003885chr1742413 2115 167 42 --32563 2209 239 --
NM_003887chr262343 2199 1659 1504 1437 547 12163 12045 --
NM_003899chr1322330 1743 1306 --1359
NM_003913chr6114306 3616 3572 3402 3272 3126 2992 1575 1305 777 612 --2815 345 1957
NM_003922chr154398 305 284 72 ------
NM_003930chr782220 1871 718 706 662 422 232 46 --12489 --
NM_003932chr2251537 1512 766 238 166 1122 1312 1460
NM_003934chr941283 927 508 190 1990 ----
NM_003945chr52468 92 --1198 --
NM_003948chr442209 919 414 130 --11754 --
NM_003958chr683890 3356 3097 2986 2675 1582 1291 495 1407 12875 --
NM_003968chr35190 167 140 78 45 ------
NM_003971chr174568 527 515 121 ------
NM_003980chr651139 1101 1067 575 224 ----1124
NM_003996chr6168 ------
NM_003998chr44677 630 454 266 --1596 --
NM_004004chr1361383 1091 535 517 458 294 1556 11333 --
NM_004040chr221015 321 ------
NM_004050chr1452596 2498 2430 2394 709 12240 ----
NM_004075chr122427 56 1520 ----
NM_004079chr131946 460 45 1764 22705 876 12418
NM_004093chr1382939 2721 2667 2426 2113 2011 1147 1103 --22070 832 --
NM_004094chr1482596 2486 2348 2214 1059 806 461 209 ----22928 202
NM_004100chr651968 1915 695 216 28 --11789 --
NM_004113chr341727 734 451 351 11873 11651 --
NM_004114chrX31119 276 218 ------
NM_004124chr14133542 3145 2790 2720 1390 1357 1057 1004 871 733 578 228 185 --12516 --
NM_004136chr1593004 2879 2663 2556 2547 2388 1050 965 786 12517 23120 283 11011
NM_004157chr33762 716 562 --2873 198 --
NM_004161chr261636 1333 1219 403 302 195 --31432 1230 371 --
NM_004171chr11137830 7069 6880 6780 6688 6675 6139 6024 3297 2413 1829 995 892 17498 59494 8065 7386 6335 3097 16053
NM_004172chr542023 353 163 21 ------
NM_004177chr1141868 1555 1517 707 1630 1555 11543
NM_004229chrX51872 1496 1476 1369 387 ----1449
NM_004232chr18163848 3719 3623 3484 3298 2848 2462 1558 1421 1369 929 862 593 510 423 182 --130 --
NM_004235chr94846 794 637 58 1555 1830 --
NM_004236chr15----1461 --
NM_004240chr19178 --1256 --
NM_004241chr104796 765 590 558 --1626 --
NM_004277chr6101659 1536 1432 1412 1380 575 472 273 244 141 ----1544
NM_004293chr9133871 3788 3720 3507 3375 3161 2598 2380 2354 823 782 618 245 1366 --22975 2496
NM_004316chr123956 808 40 ------
NM_004329chr1041191 1045 994 398 ------
NM_004331chr8102387 1985 1724 918 873 596 586 296 212 176 --22690 2636 --
NM_004349chr83971 920 496 ------
NM_004370chr652197 1585 1551 576 339 ------
NM_004386chr1972300 2212 1649 1510 1502 593 456 11903 ----
NM_004392chr1392514 2324 1970 1031 581 343 316 113 43 --1633 --
NM_004393chr361608 1600 891 559 265 194 12075 --11565
NM_004397chr11123697 3594 3384 3239 1512 1345 1159 993 666 577 135 101 11330 23430 1704 11594
NM_004405chr211018 ----1680
NM_004411chr74714 274 138 115 ------
NM_004412chr10185079 4962 4950 4732 4573 4496 4435 4294 4164 3687 2353 1838 1829 1761 679 654 620 46 --25004 669 14744
NM_004414chr2121339 1271 11399 --11306
NM_004417chr5----1611 --
NM_004423chr332605 2034 82 --31737 1667 319 --
NM_004426chr1251975 1767 208 192 78 1186 11647 --
NM_004430chr8112655 2500 2290 2134 2097 2086 1878 1847 1831 1035 26 --1267 --
NM_004431chr14786 770 590 584 ------
NM_004432chr9112414 2255 2048 1622 1575 890 831 523 491 423 355 51900 964 732 718 479 11504 --
NM_004437chr173328 3256 3204 3004 2981 1206 866 --1840 11246
NM_004438chr293174 2217 1305 710 447 383 236 76 57 13138 ----
NM_004440chr651870 782 605 475 450 ------
NM_004441chr321233 382 ------
NM_004444chr72604 43 ----1105
NM_004456chr71231 1241 ----
NM_004458chrX82633 2608 2570 2201 2137 841 748 167 22126 697 11059 --
NM_004459chr17101851 1796 1784 1460 1439 1417 1324 418 256 164 ------
NM_004460chr21184 --1227 --
NM_004468chr11547 --1564 --
NM_004480chr143737 647 265 ------
NM_004481chr152659 2604 2595 2243 422 1940 1954 --
NM_004486chr921205 313 --11024 --
NM_004498chr15--1313 ----
NM_004501chr1124143 3705 3625 2522 1643 1541 1061 761 315 257 170 133 13819 13382 1738
NM_004504chr2113030 2996 2913 2821 2765 2754 2668 1163 873 432 386 --11994 --
NM_004514chr1732816 2710 848 22465 426 ----
NM_004516chr1931069 368 339 11160 ----
NM_004525chr251313 460 267 90 39 21492 1470 ----
NM_004535chr2051430 1397 1353 1179 1115 21414 1324 21484 1465 --
NM_004566chr1072553 2185 2036 1784 814 788 695 12338 11595 12258
NM_004569chr146715 670 643 625 284 215 1246 ----
NM_004575chr441444 1215 1124 77 1494 1400 --
NM_004586chrX135301 5041 5035 4869 4828 4463 4450 4145 4103 927 842 822 165 23947 3647 34044 1518 450 24547 4371
NM_004593chr34872 860 190 137 1254 ----
NM_004598chr5143348 3015 2938 2908 2813 2720 2498 2442 2339 2085 935 605 480 169 12366 --12458
NM_004603chr7----11161 --
NM_004612chr9104733 4338 4040 3216 1731 1084 994 955 931 574 43477 2969 1936 457 13449 11326
NM_004615chrX1743 --1208 --
NM_004627chr21------1670
NM_004635chr32799 112 --1765 --
NM_004654chrY61395 1300 1206 1085 988 558 31283 1039 378 ----
NM_004655chr171527 --11296 21011 88
NM_004660chrY41867 1703 1517 275 2823 339 --11740
NM_004663chr1561525 1468 600 551 259 87 1473 21447 378 --
NM_004685chr13112985 2761 2685 2535 1959 847 679 432 407 391 171 32806 1966 1076 22215 1195 --
NM_004709chrX41706 1340 1275 1141 ----1365
NM_004719chr12102708 2484 2169 2135 2124 2065 1833 1757 1079 705 62632 2385 2086 1792 1775 735 22515 807 --
NM_004721chr31296 --2305 93 --
NM_004730chr571878 1739 1447 1438 576 355 270 21351 418 2236 181 --
NM_004738chr202628 296 11852 22408 607 --
NM_004742chr321645 421 21154 404 ----
NM_004745chr8146832 6503 6165 6103 6065 5732 5690 5677 4315 2072 1964 1752 1573 39 --21549 338 --
NM_004747chr1061596 1276 1248 643 616 480 1517 1419 --
NM_004760chr772304 2096 1916 803 424 308 131 --1433 --
NM_004768chr131097 928 907 21176 844 ----
NM_004770chr8----1194 --
NM_004774chr1793091 3076 2838 1231 893 506 460 377 353 22977 129 21068 515 --
NM_004789chr93356 338 109 2442 88 ----
NM_004795chr1351892 1860 1844 1447 125 ----131
NM_004808chr1083370 3310 3226 2852 2387 2255 2070 1291 22801 634 22941 751 --
NM_004814chr1----1366 --
NM_004815chr1114811 4094 3818 3656 3560 1909 1885 1587 919 608 45 34305 3350 1768 11135 --
NM_004817chr9------1531
NM_004831chr1931043 435 326 ------
NM_004834chr243247 1176 822 698 --2803 650 --
NM_004845chrX82823 2800 1221 1196 1044 797 694 315 --22544 1136 --
NM_004849chr661535 1109 680 654 643 175 1566 11669 --
NM_004850chr231171 1106 526 --11545 --
NM_004852chr183413608 13453 13409 12849 12777 12659 11969 11940 11840 11828 11694 11253 11247 11059 10783 10652 10256 10055 9616 9211 8919 4890 4726 4371 4321 3047 2853 2565 2200 1849 1472 1350 1323 980 311448 8945 3234 211789 887 110265
NM_004859chr1732884 2336 191 22058 1913 12324 --
NM_004863chr1473723 2053 1359 1261 624 264 258 23419 1270 54693 3622 1551 230 157 --
NM_004865chr61368 ----1330
NM_004866chr5194974 4854 4774 4477 4093 4054 3803 3743 3673 3466 3278 1949 1889 1811 1470 1099 1058 869 166 33665 3135 574 34133 853 510 13459
NM_004867chrX2573 228 --1471 --
NM_004884chr1531362 411 288 ----11753
NM_004887chr53191 165 61 ------
NM_004898chr482736 1988 1963 1075 959 759 728 508 12029 1599 --
NM_004905chr12908 650 ------
NM_004906chr62557 76 1228 2250 202 --
NM_004926chr1481770 1375 1358 1299 1217 1130 389 282 ------
NM_004936chr992806 2438 2291 937 931 921 912 557 176 ----12888
NM_004961chrX41523 1096 1084 376 --11171 --
NM_004965chr214511 149 116 80 ------
NM_004972chr931046 336 222 1835 ----
NM_004973chr661724 1597 474 354 207 141 --11486 --
NM_004985chr12104199 4191 3697 3619 3594 3249 2810 1374 1254 1225 23287 1559 24307 759 --
NM_004992chrX118301 7403 7236 7145 5373 3297 2946 2738 943 248 242 --15518 --
NM_005028chr1082287 2219 1795 1473 785 269 210 163 ------
NM_005032chrX51005 854 757 392 247 ----1121
NM_005034chr83593 493 85 ------
NM_005044chrX114586 4015 3747 3637 2810 1826 1203 1106 577 465 119 13301 1828 --
NM_005063chr1063807 2907 2369 1450 771 245 2920 405 13515 --
NM_005065chr14125104 5027 4326 4188 3906 1996 1970 1831 1331 1191 935 893 35218 2054 1512 ----
NM_005066chr1176 --1753 --
NM_005095chr1112201 2123 1831 1604 1469 888 647 391 373 360 269 1537 ----
NM_005109chr352570 2543 1966 772 722 ------
NM_005110chr51635 --1721 --
NM_005113chr143505 435 419 ------
NM_005114chr41535 --1194 --
NM_005116chr2094337 3867 3475 3120 2831 2799 1596 934 140 24386 2781 ----
NM_005124chr67961 729 688 676 309 121 71 ------
NM_005126chr341689 1659 1637 1432 --22176 46 1304
NM_005156chr9165300 5116 5022 4867 4777 4727 4237 3782 3464 1697 1674 1611 1554 852 369 87 --24721 1137 --
NM_005157chr921557 363 --11905 --
NM_005168chr251751 1681 1581 1540 327 21560 571 11483 1374
NM_005178chr19----1391 --
NM_005180chr1051520 1490 1343 1133 653 11608 --1520
NM_005184chr1921520 369 11399 1337 --
NM_005194chr203570 535 103 ------
NM_005204chr106992 946 765 615 384 100 --1293 --
NM_005215chr183630 238 43 ------
NM_005229chrX1350 ----1821
NM_005238chr11103231 2857 2632 2594 2431 1197 950 587 307 112 175 23511 2968 --
NM_005239chr2152056 2018 796 616 593 ------
NM_005245chr41625 --1513 --
NM_005256chr114829 793 611 390 1738 ----
NM_005259chr251547 1452 1384 1171 1005 162 ----
NM_005271chr1061205 1017 993 837 489 240 --1232 --
NM_005277chr481953 1836 1788 1640 1357 635 505 389 --11595 --
NM_005296chrX21043 852 1290 1808 --
NM_005308chr101454 1401 1368 --
NM_005313chr1531080 932 476 --123 --
NM_005324chr1741698 1621 550 49 ------
NM_005329chr1652149 2141 1468 949 932 11907 12232 --
NM_005342chrX62822 2715 1030 850 325 237 --1283 --
NM_005359chr18176480 6423 6078 5075 4480 4360 2572 2395 1979 1631 1435 1363 1202 952 741 422 89 14633 --15923
NM_005378chr24690 682 597 96 --135 2867 45
NM_005384chr9----164 --
NM_005385chr352661 2324 749 238 205 --11059 22528 879
NM_005387chr111219 183 ----
NM_005388chr941503 1289 1167 398 21696 1427 ----
NM_005399chr1134124 3927 3885 3810 3764 3030 1731 1700 1423 1399 1214 987 810 64217 3795 3305 3145 648 100 53090 1453 1310 873 734 --
NM_005400chr292964 2775 2590 2584 2275 2191 723 596 23 ------
NM_005402chr761729 1194 438 370 162 92 11735 1101 --
NM_005431chr721432 641 --11906 --
NM_005433chr1892579 2472 2430 2047 1919 1103 965 852 151 ------
NM_005436chr1063533 3286 2664 1511 1240 567 23184 2975 11159 --
NM_005455chr191685 1416 1370 673 463 398 375 283 35 21485 614 ----
NM_005458chr952370 2342 2218 960 896 11717 ----
NM_005460chr54584 525 379 87 ------
NM_005461chr2091994 1811 1700 1585 1430 693 684 389 363 ------
NM_005465chr121998 399 ------
NM_005491chrX32116 1729 1362 --11354 --
NM_005494chr72199 70 --1242 --
NM_005499chr19----1142 --
NM_005502chr9113212 3182 3085 2725 2420 2318 2184 2098 1038 550 308 32301 1020 635 --12871
NM_005504chr12126552 6480 5613 5531 4649 4252 2399 2270 2174 2167 1656 1621 11801 1756 --
NM_005520chr51660 --1543 --
NM_005522chr74923 523 490 225 ------
NM_005573chr51517 --1190 --
NM_005575chr52836 66 1264 2871 24 --
NM_005578chr3124830 4413 3661 3430 1472 1422 1213 1180 1084 869 307 235 --31406 1023 752 --
NM_005584chr133787 582 535 --1627 --
NM_005585chr151318 ------
NM_005593chr124582 552 191 143 1500 ----
NM_005596chr9176271 6028 5742 5163 5020 4929 4923 4662 4280 4083 2521 2433 1761 1620 1603 1587 572 1978 36046 2093 1401 --
NM_005599chr121492 1308 1329 ----
NM_005604chr6102476 2335 1900 1710 1008 931 853 726 631 621 ------
NM_005607chr83795 733 185 21038 957 --1171
NM_005610chr1----1862 --
NM_005626chr12356 102 --1429 --
NM_005639chr1231798 593 89 --11675 --
NM_005647chrX63314 3126 1076 819 525 510 13487 23104 905 --
NM_005650chr2231383 1104 376 ------
NM_005665chr184953 4527 3958 3234 1620 1607 1202 1085 13698 34866 3747 1649 --
NM_005668chr5134203 4143 3362 3043 2822 1538 1314 1264 1210 1165 977 959 640 21758 191 11327 --
NM_005717chr131059 846 111 --11280 --
NM_005721chr231081 389 271 1400 --1969
NM_005730chr1253455 3200 3026 2802 2539 --12978 --
NM_005737chr242751 2446 2338 724 --12299 12292
NM_005739chr1562284 2167 1734 471 393 110 1888 11727 --
NM_005748chr1273104 2647 2397 1160 1154 278 79 12734 22710 200 --
NM_005754chr571175 1131 1107 1093 278 207 131 1438 1912 --
NM_005776chr142155 116 ------
NM_005780chr133998 898 682 --1973 --
NM_005785chr121266 ----11302
NM_005786chr1841014 945 814 140 --11238 11205
NM_005788chr111215 --1587 --
NM_005789chr1752041 1925 1455 1375 331 11652 --1541
NM_005828chr1785073 4545 4249 4235 1802 1640 478 113 14512 --13889
NM_005838chr112394 120 --1491 --
NM_005839chr13986 865 286 ------
NM_005859chr521426 221 --1529 --
NM_005862chr371049 936 811 785 750 721 89 --1423 --
NM_005880chr1631601 474 380 11055 --1197
NM_005881chr16------1296
NM_005897chr1----1179 2981 36
NM_005898chr1152977 2535 870 687 283 2677 568 --13174
NM_005902chr1544469 3633 1617 1484 13084 --33049 719 227
NM_005906chr661693 1468 1460 1382 1355 177 1544 2502 391 --
NM_005909chr5124007 3524 3348 3226 3052 2950 2708 2635 1658 570 521 37 ------
NM_005926chr153464 429 159 1149 ----
NM_005933chr1162280 2267 1911 1073 969 920 1628 ----
NM_005935chr495083 4970 4820 4512 4012 3815 3750 1584 560 11428 --11322
NM_005937chr1743856 3293 936 447 11020 23797 221 --
NM_005941chr8103614 3299 3134 2849 1604 1405 709 647 565 533 --22882 589 --
NM_005955chr1145470 4860 4835 4365 3653 3586 3501 2010 1583 1572 1062 1025 260 165 --35448 4551 929 --
NM_005963chr17----168 --
NM_005966chr292334 2130 1727 1602 1584 586 410 399 251 21890 818 22238 1899 --
NM_005968chr19166 1237 ----
NM_005985chr202717 162 2317 149 1753 --
NM_005986chr1382415 1946 1782 991 802 615 374 348 ----11938
NM_005996chr1241492 1232 1152 520 --156 --
NM_006017chr41264 --1426 --
NM_006022chr131674 1929 1844 --
NM_006037chr2144304 4258 4229 4070 3884 3737 3715 3574 3492 3175 1671 1593 1434 1428 --24371 3372 --
NM_006047chr20173349 3140 2989 2779 2612 2584 2368 2211 2197 2155 943 850 577 468 451 433 230 1681 ----
NM_006055chr282912 2803 988 659 605 562 173 117 ----1479
NM_006060chr773529 3390 3181 2706 1027 816 716 14348 11710 13764
NM_006080chr762626 2457 1038 783 450 236 1618 12216 --
NM_006085chr121177 384 1517 156 --
NM_006089chrX101733 1708 1599 1408 701 498 347 186 156 54 21611 1562 --11214
NM_006096chr841701 1374 1055 123 1630 11382 --
NM_006106chr11103280 3147 2971 1344 688 675 541 340 146 132 12581 31031 703 264 --
NM_006107chr171408 1353 ----
NM_006108chr1192351 2270 1936 1921 1791 1594 1485 934 107 1305 22096 952 --
NM_006128chr8------1298
NM_006135chr141371 377 306 96 1508 ----
NM_006136chr741256 918 514 28 11362 1176 --
NM_006139chr282564 2521 2294 2200 2146 795 734 372 --1862 2619 167
NM_006141chr16102516 2499 2489 2282 2212 2153 2061 1981 837 306 2831 611 ----
NM_006154chr15152923 2905 2618 2326 2222 2040 2009 996 787 637 573 523 468 315 174 --12266 22820 433
NM_006157chr112390 344 ------
NM_006160chr171556 ------
NM_006166chr1262656 1671 888 725 562 343 11737 12070 22098 420
NM_006186chr231114 974 817 --1220 11072
NM_006194chr1441077 881 840 403 --1936 --
NM_006195chr91212 ----11136
NM_006197chr852241 2227 2110 1771 240 12096 ----
NM_006202chr1961478 1239 697 629 346 268 ----11938
NM_006206chr4122763 2478 2267 2256 2014 1832 1134 636 509 284 184 67 1173 1544 12275
NM_006216chr24674 665 486 40 ------
NM_006223chrX----137 --
NM_006224chr1762418 1945 425 334 87 24 1453 12459 --
NM_006251chr592831 2734 2443 2413 2404 2197 1190 862 412 33314 2464 298 2525 192 --
NM_006252chr1197395 7296 7150 6106 6087 6043 5607 4840 2904 2796 2750 2729 2719 2261 1622 1317 1245 352 71 77075 5886 5364 2680 2004 1144 1051 25259 4897 --
NM_006255chr1431112 1026 788 --11137 --
NM_006256chr1122728 2478 2414 2362 2170 1922 1900 1097 1034 335 316 272 --12208 --
NM_006264chr42501 185 --1572 --
NM_006265chr821213 137 --11463 --
NM_006267chr241214 639 561 147 21781 1657 ----
NM_006275chr2082506 1754 969 836 748 732 636 39 42449 1896 392 218 ----
NM_006279chr1----1329 --
NM_006283chr884412 4118 3869 3409 3276 1916 1663 319 21795 623 41923 1729 1201 150 --
NM_006301chr121484 ------
NM_006309chr3------1160
NM_006313chr12101661 1592 1535 1334 1205 687 634 511 358 33 --11449 --
NM_006315chr4104356 3853 3843 3697 2875 2800 1722 1239 870 793 12756 ----
NM_006345chr431198 996 313 1533 1255 --
NM_006352chr12300 134 11981 11479 --
NM_006366chr661290 1177 984 392 330 107 ----1170
NM_006372chr61384 1456 1484 --
NM_006378chr94583 521 490 406 21418 496 21364 1249 --
NM_006380chr17134086 4023 3991 3268 2996 2921 1620 1345 1128 973 795 229 134 --1290 --
NM_006389chr1111357 --11208 --
NM_006393chr1094234 2793 1756 1713 1379 1269 1241 183 75 34450 1022 903 1363 --
NM_006401chr96446 403 360 339 333 62 --1382 --
NM_006413chr102958 219 --2560 314 --
NM_006451chr591038 848 837 736 729 412 321 284 140 21078 259 ----
NM_006464chr284534 4188 1520 1447 1423 508 223 216 44260 1412 575 71 43301 3150 978 236 --
NM_006466chr202664 425 --130 1247
NM_006467chr572129 2072 1906 1535 767 755 416 22294 1888 --2920 149
NM_006469chr161434 1118 232 219 209 157 ------
NM_006471chr18----2123 43 --
NM_006472chr16913 802 471 388 268 69 --11200 --
NM_006486chr222677 230 ------
NM_006496chr132031 359 148 --21416 1401 21877 1534
NM_006504chr10112730 2648 2471 2187 1958 1087 530 440 402 116 48 12943 11010 --
NM_006517chrX3776 277 72 ------
NM_006534chr2093410 2859 2711 2629 1264 1043 720 640 317 1115 23422 1303 --
NM_006537chr153167 112 96 ------
NM_006546chr17156545 6034 5749 5683 5559 5179 5168 5110 4423 2640 2393 1909 1464 535 248 36504 6456 6348 36657 4759 4057 --
NM_006547chr752108 1983 629 552 175 ----11649
NM_006558chr83328 192 139 ------
NM_006559chr11907 --21141 1094 --
NM_006565chr1651097 840 514 109 93 --11164 --
NM_006575chr1451132 571 423 358 133 11273 --11021
NM_006587chr451218 1112 242 187 98 --21331 1131 --
NM_006593chr23660 218 109 ------
NM_006595chr1181857 1802 1284 809 627 605 264 206 --1494 --
NM_006602chr204573 525 340 272 1144 1156 --
NM_006609chr282563 2240 2029 1897 1885 1874 271 71 ------
NM_006618chr13518 196 143 --1479 --
NM_006621chr141613 1490 668 626 --11978 --
NM_006622chr52565 183 ------
NM_006624chr1071821 1528 426 272 251 137 121 1638 22090 101 --
NM_006626chr9112133 1946 1876 1664 1000 696 601 519 512 431 114 21827 1082 --12338
NM_006628chr15123988 3981 3608 3115 1645 1521 717 706 409 342 112 69 --14006 11029
NM_006653chr61102 1339 1348 --
NM_006675chr1253336 3156 2960 1135 64 --1335 --
NM_006681chr4----163 --
NM_006690chr2032328 1765 1753 --21669 713 --
NM_006698chr2031192 547 496 1990 ----
NM_006699chr182501 2349 1026 911 761 460 449 178 42710 1706 235 164 12531 --
NM_006700chr12----1138 --
NM_006711chr164792 769 328 62 ------
NM_006713chr52201 136 ------
NM_006717chr9103257 3213 2416 2377 2283 890 824 801 603 302 --1179 --
NM_006729chrX145270 5259 5143 4607 4448 4120 3798 3532 1253 810 777 764 598 225 15490 21065 514 157
NM_006734chr69514 493 325 280 257 220 130 43 35 ------
NM_006751chr231076 795 300 --184 --
NM_006754chr73238 129 101 1934 11122 --
NM_006756chr8151506 1491 1456 1429 1406 1354 1282 1227 1198 1128 992 575 384 124 48 1511 11330 --
NM_006772chr611632 --1449 --
NM_006773chr24619 525 303 33 --31514 1177 1141 --
NM_006775chr6113102 3016 2980 2913 2473 2352 2172 2151 999 992 932 12879 --12229
NM_006777chrX102896 2741 2686 2634 2614 1180 949 669 653 372 1869 ----
NM_006783chr131282 ----1240
NM_006793chr104770 616 589 70 ----1693
NM_006800chrX2596 214 ------
NM_006805chr54547 494 398 224 ------
NM_006807chr1731314 1138 383 21003 996 1243 1484
NM_006814chr2042389 2192 1995 405 12117 22628 346 1895
NM_006822chr171274 --1556 --
NM_006832chr1421074 104 --1712 --
NM_006856chr1211018 --2798 730 --
NM_006875chrX1285 --1267 --
NM_006885chr16104167 3862 3772 2858 1447 1302 1090 1063 847 732 13839 1523 --
NM_006887chr2----1726 --
NM_006888chr1452835 1338 1192 1102 911 ------
NM_006902chr192969 2594 2215 2170 2151 2140 1343 421 399 12734 12361 --
NM_006908chr731077 371 159 --21291 53 --
NM_006912chr142460 1594 963 615 12322 31700 899 765 --
NM_006915chrX102214 2058 968 548 524 461 368 225 180 73 11597 ----
NM_006920chr2122077 1690 1541 1525 1516 1444 1320 1292 677 386 331 307 --11924 --
NM_006930chr571737 1530 454 366 315 165 79 11834 ----
NM_006931chr1231640 611 277 --21743 1490 --
NM_006940chr1291851 1697 1633 1356 766 753 577 494 107 11314 ----
NM_006948chr2132318 1601 193 --12486 --
NM_006951chr103725 266 242 --1781 --
NM_006981chr963015 2497 2251 1094 375 290 12002 ----
NM_006991chr321006 722 1218 --1178
NM_006996chr151861 1564 1533 1438 1261 ------
NM_006999chr532092 1882 608 1691 1445 --
NM_007005chr921301 294 11481 147 --
NM_007007chr12144720 4703 4676 4447 3300 3102 3073 1691 1637 1550 1244 721 529 180 44203 1819 917 636 34088 3043 1717 1391
NM_007008chr22771 292 ------
NM_007011chr15156882 6820 6802 6573 6551 6244 5993 5962 5339 1994 1952 1541 1249 740 333 11327 65418 4271 2452 1844 587 387 26234 1480
NM_007013chr84908 890 791 173 2742 228 ----
NM_007017chr52855 631 1712 --1701
NM_007026chr172387 197 --1213 --
NM_007034chr121003 871 129 1744 --
NM_007038chr21176040 5888 5577 5564 5392 5256 5006 4867 4674 4653 3862 2206 2052 1849 905 416 350 25725 652 12063 21893 625
NM_007039chr1481912 1860 899 856 625 482 438 79 1591 21890 276 11650
NM_007040chr193732 446 185 ------
NM_007068chr221361 11037 1699 --
NM_007084chr1361550 1330 1299 1181 586 289 11356 11404 11020
NM_007106chr1382572 2419 1996 1904 1719 1063 972 179 --1302 --
NM_007124chr691779 1433 1426 1290 758 446 398 391 181 11552 ----
NM_007137chrX104868 4670 4593 4528 4403 4024 3990 1260 501 442 25147 795 25050 616 --
NM_007146chr17102385 1919 1808 1155 1136 863 522 351 199 136 12897 ----
NM_007157chrX92668 2374 2252 2096 803 549 521 437 37 155 22649 1973 --
NM_007159chr371679 1647 1530 1414 493 366 80 1676 ----
NM_007173chr1152316 900 689 534 232 31901 508 317 ----
NM_007174chr12112400 2159 2145 2123 1546 1480 839 826 778 496 366 --1245 --
NM_007175chr873561 3358 2836 2797 2661 2578 600 --33283 2317 611 11222
NM_007190chr1041159 1107 915 25 --41044 956 930 734 --
NM_007192chr1421144 922 ------
NM_007197chr123662 381 343 --2927 746 --
NM_007214chr621325 1309 --2901 476 --
NM_007218chr83973 350 248 1612 ----
NM_007229chr221288 1412 --1399
NM_007246chr441030 675 323 104 11069 1840 --
NM_007249chr13228385 8010 7979 7769 7618 7277 6948 6932 6876 6504 5701 3636 3474 3455 2669 2593 2554 1820 1778 1413 1106 300 --59426 9389 5793 3696 320 18131
NM_007271chr671857 1695 1557 1398 590 383 229 11478 ----
NM_007276chr721093 1053 2184 64 ----
NM_007345chr18102355 2110 2072 2036 2029 1820 1786 1770 1587 1477 11892 --1506
NM_007349chr72451 436 1380 ----
NM_007361chr141557 --1134 --
NM_007372chr172854 54 2840 790 ----
NM_007375chr192453 2447 2195 2160 2033 1838 922 691 151 12714 12284 --
NM_012069chrX42714 2324 1812 1763 22317 1723 ----
NM_012074chr143819 396 49 --11053 --
NM_012081chr5103770 3392 2997 2639 1495 1435 914 148 134 94 23607 1320 --23483 2990
NM_012090chr131198 1164 826 ----137
NM_012095chr1072969 2465 1342 1300 692 232 207 --13033 --
NM_012096chr3153599 3517 3500 3409 3351 2811 2388 1371 1284 1138 1038 792 682 583 135 22585 2367 23681 399 --
NM_012104chr1183782 3451 3363 3337 3026 2531 2500 1044 --33352 2678 59 --
NM_012137chr142788 2733 2131 481 11172 ----
NM_012158chr13101794 1786 1749 1683 1445 1208 1198 663 383 92 11282 1450 11864
NM_012161chr491105 925 791 766 432 377 245 191 61 1317 11090 --
NM_012164chr9197487 7392 7027 6814 6382 6065 5608 5416 5383 2903 2576 2514 2198 2166 2145 1825 1571 1209 31 12813 36239 5665 270 --
NM_012180chr43206 186 148 1552 ----
NM_012193chr11175433 5026 4965 4415 4259 3887 3542 2084 1661 993 820 734 553 408 262 192 180 --34465 1748 55 133
NM_012197chr921642 651 11224 1518 --
NM_012199chr1144427 4338 4050 3994 3680 3235 1815 1598 1130 1119 1004 916 650 402 24550 728 ----
NM_012215chr1051915 1606 1320 1273 601 21440 1364 11707 2767 157
NM_012218chr1942340 1112 682 233 ------
NM_012223chr241117 1109 986 21 --11096 --
NM_012224chr43235 193 161 2850 325 ----
NM_012233chr22938 444 ------
NM_012234chr3113707 3699 3471 3344 3129 2670 2653 2339 952 266 195 1818 12318 --
NM_012245chr142398 126 1168 174 --
NM_012247chr107977 963 944 874 866 703 365 ----1260
NM_012249chr2123498 3085 3068 2915 2875 2725 2532 2489 798 786 680 218 23595 331 23380 866 --
NM_012257chr751039 860 831 798 204 ------
NM_012259chr641405 1356 948 519 ------
NM_012262chr1164688 4543 4283 4107 4000 3757 3552 3178 1801 1713 1649 1449 880 459 346 194 44942 4206 3409 1132 14366 11375
NM_012281chr752363 1734 798 717 229 ----1366
NM_012288chr6115672 5431 5302 5065 4782 4738 4327 2122 1167 638 154 --25739 1394 --
NM_012290chr23675 572 295 1222 11515 --
NM_012293chr232309 2192 333 --12270 --
NM_012294chr773590 3011 2898 1396 1218 709 395 21633 823 2922 616 140
NM_012297chr4112406 2044 2013 1974 1923 1894 1790 936 664 587 80 --22343 334 --
NM_012300chr5102398 2223 2154 1944 1776 1618 950 460 419 370 11937 1377 --
NM_012301chr74773 705 664 228 ------
NM_012302chr14789 360 312 183 1825 ----
NM_012308chr1142219 2125 2049 2038 11874 11753 --
NM_012322chr75295 284 145 75 30 2384 128 ----
NM_012325chr2071640 1603 1587 1271 1126 569 463 --1142 --
NM_012329chr1761615 1421 1241 1192 434 389 11448 ----
NM_012330chr1061756 1397 1245 1215 430 228 11591 31336 694 486 --
NM_012333chr11567 --1515 --
NM_012342chr102361 72 ------
NM_012343chr531113 421 279 ------
NM_012345chr1371848 1693 1628 1449 1365 1317 1292 11198 1395 --
NM_012382chr5114259 3306 1541 1358 1307 918 830 757 742 569 277 2615 179 --21676 486
NM_012383chr9159 1352 --1448
NM_012384chr2042425 2354 1561 753 12460 ----
NM_012388chr1593016 2701 2609 2503 2308 2036 721 428 209 33141 2244 235 23006 1019 --
NM_012395chr7103299 3239 3052 2588 1070 1022 660 589 299 249 11250 2838 478 --
NM_012416chr92815 798 1989 ----
NM_012419chr63638 444 149 1536 125 --
NM_012420chr1041951 1607 438 149 1463 145 12003
NM_012464chr492875 2560 1896 1042 1021 624 514 437 410 11934 12418 12163
NM_012471chrX51896 393 296 181 158 --1339 11953
NM_012482chr13614 144 44 155 ----
NM_013230chrY61722 1391 1339 1170 599 584 ----11756
NM_013231chr14103651 3618 3379 2758 1594 1452 1406 1277 1080 861 32836 2748 1392 24352 341 --
NM_013246chr11----2803 50 --
NM_013255chr7288876 8868 8780 8758 7215 7180 7146 7100 7037 6892 6507 6456 5718 5547 5460 2743 2737 2542 2126 1981 1922 1510 1476 1432 1106 972 267 228 46246 1033 744 394 38386 7817 447 15566
NM_013261chr493581 3545 3328 3170 3021 2734 1454 260 106 22615 2342 --1855
NM_013262chr681348 1264 1241 1047 926 457 411 398 --21326 1137 --
NM_013263chr16139 ------
NM_013272chr153390 147 48 1258 ----
NM_013275chr163812 761 735 --1630 --
NM_013277chr124898 873 697 95 --2912 202 --
NM_013281chr2051241 1108 596 407 294 --1415 --
NM_013283chr5295 58 --1211 --
NM_013293chr76678 258 169 137 115 30 ----1206
NM_013313chr2272936 2899 2890 2826 1363 1092 1045 --22784 395 --
NM_013357chr84805 766 637 620 ------
NM_013372chr1563015 1201 942 833 326 233 --22583 588 --
NM_013374chr382914 2796 2669 2264 843 655 428 303 --1553 --
NM_013396chr2151425 1141 498 287 199 --11076 --
NM_013437chr881432 1313 1298 1014 991 921 317 59 ------
NM_013438chr961602 463 423 412 277 132 ----184
NM_013438chr961602 463 423 412 277 132 ----184
NM_013444chrX51085 747 441 143 91 ----21028 99
NM_013446chr761440 1413 1372 1188 1012 366 11342 11046 1326
NM_013449chr1262559 2104 1944 1152 1127 67 ------
NM_013450chr26932 923 791 390 382 154 ------
NM_013943chr1102736 2263 725 618 600 587 451 269 96 52 12218 12132 22980 2111
NM_013995chrX62530 818 763 492 291 176 --11038 --
NM_014011chr252494 2059 824 449 39 --1228 --
NM_014023chr10112880 2832 2625 2066 1842 939 732 461 190 117 85 1680 1970 --
NM_014028chr6123208 2424 2403 2060 1307 1256 1126 883 842 798 527 131 22834 398 12114 --
NM_014034chr631549 1257 429 11385 ----
NM_014048chr16145299 5293 4964 4681 4345 4132 3819 3390 3231 1145 856 624 602 371 --35167 4324 3590 15325
NM_014079chr331066 845 57 ------
NM_014112chr8185396 5186 5006 4791 4307 3807 2205 2197 2191 2042 2019 1913 1834 1193 1037 796 755 228 21951 554 1735 14900
NM_014117chr16112198 2179 2079 1772 1735 1689 920 913 762 451 392 32063 1916 831 1648 --
NM_014154chr351444 1254 1099 1036 208 11060 ----
NM_014171chr23303 264 42 1654 1139 --
NM_014181chr242855 2798 2686 2585 12631 --1765
NM_014191chr122387 356 11033 1980 --
NM_014240chr351543 1148 738 568 219 ----13711
NM_014243chr4101847 1784 1606 1504 1412 1375 391 377 150 112 21862 1687 ----
NM_014245chr3----1163 --
NM_014271chrX3255 219 210 ------
NM_014280chr13766 707 594 --1122 --
NM_014283chr151228 1008 441 333 226 1478 ----
NM_014300chr151466 1312 ----
NM_014317chr102105 57 --171 --
NM_014323chr223827 375 112 ------
NM_014325chr1292267 1484 892 789 554 462 455 438 285 ----1634
NM_014326chr152574 566 --1111 --
NM_014331chr4287794 7783 7730 7713 7687 7355 6829 6793 6768 6609 6394 6303 6286 6235 5361 4906 2817 2585 2472 2004 1725 1206 1052 1039 869 728 96 69 56313 5883 5574 1792 1024 11382 1565
NM_014332chrX2396 338 1302 ----
NM_014338chr22------11098
NM_014345chr65997 776 704 338 245 2345 328 2826 281 --
NM_014372chr142044 1578 788 448 12083 141 --
NM_014379chr821004 425 ----11016
NM_014382chr371767 1712 1706 1638 1189 1126 531 1186 ----
NM_014399chr74775 297 278 48 ------
NM_014409chr131150 1143 306 --21027 782 --
NM_014415chr321395 349 11188 2362 146 1340
NM_014421chr482090 2059 1791 1653 1580 1550 1542 673 ------
NM_014423chr5165598 5444 5317 5248 5142 4997 4787 4213 3639 3521 3490 2266 1596 1540 1388 413 23843 1637 ----
NM_014454chr641024 982 896 233 ------
NM_014458chr171307 1217 1117 1029 544 304 65 152 ----
NM_014488chr112536 525 1493 ----
NM_014494chr1631779 362 118 22317 2254 2717 126 2738 700
NM_014515chr126865 798 768 689 670 380 ------
NM_014516chr191219 --1242 --
NM_014517chr3101932 1910 1500 1341 1230 1201 766 747 738 695 31792 1494 1443 ----
NM_014554chr1252027 1500 786 527 201 12317 --12098
NM_014572chr1371723 1172 481 288 274 193 168 31827 1198 318 ----
NM_014575chr32198 42 --1466 --
NM_014577chr227921 854 817 807 635 302 252 1719 1789 --
NM_014587chr1641375 1366 1357 1317 --1300 --
NM_014591chr1021333 1307 --11314 --
NM_014612chr95979 412 334 169 122 21298 451 191 11263
NM_014620chr121503 --1281 --
NM_014635chr261570 1501 1302 637 426 342 21680 325 11309 --
NM_014636chr9164346 4267 4090 3883 3751 3451 3236 3052 3003 2973 2863 1725 1298 1280 1142 451 24374 1590 21664 541 1580
NM_014637chr851449 1212 569 323 191 11410 ----
NM_014647chr1632234 2221 661 1169 ----
NM_014655chr132077 620 455 1151 11646 --
NM_014667chr391919 1775 1726 1581 1525 987 740 646 321 21794 54 1363 --
NM_014670chr261600 1287 1271 1207 587 315 11534 --21427 1308
NM_014678chr221772 ------
NM_014679chr1151197 1015 532 464 403 1555 1269 --
NM_014682chr842233 2119 1669 302 --11884 1356
NM_014683chr1762153 1991 1790 840 769 629 21367 535 ----
NM_014686chr1962282 2248 1994 1979 992 399 --12546 --
NM_014689chr22628 141 --1166 --
NM_014701chr1583337 3054 3008 2390 2368 1050 978 229 12808 179 22311 307
NM_014702chr6153391 3113 3098 2788 2775 2456 2443 2213 2174 2148 1284 1176 1041 835 460 1383 12855 1171
NM_014707chr761935 1875 1763 663 651 613 1307 11568 --
NM_014711chr1692077 2013 1808 1520 1366 803 477 436 305 32034 1534 1438 1554 --
NM_014713chr22365 199 --1342 --
NM_014720chr1071504 1480 1432 1400 1333 1284 238 ----11144
NM_014729chr871856 737 704 645 553 90 65 22169 2163 ----
NM_014730chr1275287 4670 3938 2022 1635 1560 611 45142 4614 3287 1657 24228 2112 1726
NM_014746chr2144393 4076 3661 3607 3587 3142 3104 1545 1493 1478 1038 871 845 569 11263 24215 3748 11060
NM_014757chr572394 2360 2178 2103 2021 1523 78 ------
NM_014764chr122940 149 21295 348 --1204
NM_014765chr1112267 2027 2002 1955 1919 875 857 716 381 249 137 1192 1399 --
NM_014774chr1133265 3235 3186 3166 3146 2913 836 779 389 350 235 180 115 22046 1013 12117 --
NM_014779chr381067 887 790 772 384 259 101 75 1758 ----
NM_014798chr1731932 708 349 ------
NM_014810chr1103673 3568 3538 3401 3362 3016 1171 1000 536 378 --1858 --
NM_014827chr141605 1202 183 21 --1195 11195
NM_014829chr5102342 2296 2283 2259 2211 1677 823 416 362 350 1661 12220 12190
NM_014830chr12123827 2884 2792 2759 2753 2747 1284 1111 1088 646 453 97 13647 --1821
NM_014839chr182496 1599 864 753 725 573 549 332 --1421 --
NM_014864chr163543 3209 3103 991 741 387 23876 1542 1400 --
NM_014872chr921998 627 12248 1570 --
NM_014873chr1134846 4792 4626 4573 4538 4494 3387 3348 3299 3153 1550 730 717 11755 24193 685 1931
NM_014876chr2262250 1759 1639 1373 737 377 ------
NM_014877chr17257653 7552 7356 7227 6751 6390 5498 5303 5082 4976 3061 3004 2328 1740 1511 1479 1348 1246 1031 971 935 648 188 182 135 44832 2532 1236 207 16883 25381 2633
NM_014893chrY82093 1670 1606 1539 1470 598 398 172 21844 944 ----
NM_014903chr1272464 2242 2234 1817 353 211 31 12003 --22252 2123
NM_014904chr1043945 3639 2532 1471 11569 ----
NM_014909chr1453939 3909 3866 2857 185 ------
NM_014910chr192806 137 2519 201 ----
NM_014912chr10103382 3318 3222 3076 2601 1340 1157 978 776 644 22204 570 --1231
NM_014915chr1051392 1378 304 271 176 11300 2361 41 --
NM_014918chr1551583 1491 1360 1294 653 1224 11596 --
NM_014920chr6112969 2374 2342 937 766 670 632 302 287 113 49 1370 2623 260 --
NM_014924chr14142959 2873 2831 2688 2673 2598 2565 2236 1139 1016 922 537 386 72 ----1789
NM_014926chr341019 1006 948 738 1295 ----
NM_014932chr351682 1522 1461 226 136 11544 ----
NM_014936chr682368 1848 1757 1111 917 436 314 138 196 ----
NM_014937chr1011284 11269 3869 269 234 --
NM_014939chr182542 484 2576 126 1138 --
NM_014949chr15997 983 965 871 818 1391 ----
NM_014950chr1411731 21607 1110 2191 180 --
NM_014953chr13123830 3539 2720 1292 1284 947 922 369 321 136 112 100 2596 335 ----
NM_014961chr442172 858 504 285 2243 124 ----
NM_014969chr161135 1041 987 908 815 446 ------
NM_014974chr1031224 327 218 ------
NM_014982chr14114587 4006 3796 3556 3330 3284 1861 1764 1350 1120 707 14513 55446 4642 1994 1500 239 199
NM_014989chr682084 1730 1594 1380 1263 759 679 39 12004 21610 1440 --
NM_014990chr141367 1398 11165 --
NM_014991chr482834 2796 2790 2282 2127 1082 323 238 --12854 --
NM_014999chr1271562 1460 1387 1266 1194 1070 197 ------
NM_015000chr1272871 2479 2199 2163 2106 2083 971 32607 2502 324 ----
NM_015020chr1643496 2777 1493 881 ----1624
NM_015023chr1----11854 --
NM_015025chr2122680 2669 2653 2610 2603 2522 1930 1017 875 863 762 445 2415 363 3506 463 198 --
NM_015026chr12144699 4538 4462 4436 4132 3819 3079 3062 1712 1216 949 778 620 330 21287 787 54707 3783 3318 2925 1060 14753
NM_015032chr13112931 2435 2208 2160 2083 2024 796 662 475 137 37 ----12514
NM_015033chr933190 1265 809 --23201 685 --
NM_015035chr2076621 5959 1587 1276 849 628 386 34888 4370 947 26163 5302 --
NM_015040chr293328 2901 2816 2672 2600 2301 2231 2168 630 --21106 180 --
NM_015045chr1092280 2125 2019 1934 1816 1623 661 529 267 1847 ----
NM_015049chr2113258 3008 2904 2625 2590 2469 2234 2019 760 690 663 11103 12264 --
NM_015051chr942754 1159 240 123 42497 703 569 103 ----
NM_015063chr1951168 1132 1124 897 368 21412 149 ----
NM_015064chr1262485 1426 1280 937 920 550 23362 3336 129 --
NM_015071chr5146246 6031 5984 5878 5592 5379 5371 4940 2302 2216 1963 1664 807 782 11772 36139 6128 299 --
NM_015072chr14----1388 --
NM_015073chr191607 --11849 --
NM_015074chr1174819 4805 4793 4732 4625 4543 3611 3567 1869 1656 1549 1020 758 474 442 348 138 ------
NM_015076chr6114557 4435 4303 4197 3887 3516 3384 1551 1177 811 537 1888 11647 --
NM_015082chr561855 1044 593 587 384 81 --1114 12618
NM_015090chr1106068 6053 5604 5401 4664 4189 4164 4047 1573 1092 --32200 374 31 --
NM_015092chr16204632 4544 4425 4343 4256 3873 3551 3511 3412 3205 3028 2851 1872 1848 1837 1310 1225 1177 965 720 --11549 --
NM_015093chr621619 94 21353 344 11626 --
NM_015097chr371877 1850 1738 1541 779 391 285 21933 435 ----
NM_015116chr1341639 1551 1391 171 --21740 485 --
NM_015124chr2252528 2464 2449 2355 1582 --1829 --
NM_015130chr431163 1058 486 ----11128
NM_015132chr741312 1250 444 221 --132 1464
NM_015137chr882509 1919 1815 1640 786 625 264 184 2768 219 --1883
NM_015138chr1592866 2660 2525 1934 1849 1834 1034 829 633 --22313 1051 --
NM_015143chr461377 1328 1010 423 258 51 ------
NM_015144chr16123976 3950 3793 3700 3241 3146 2562 1596 1410 440 255 120 33897 841 806 ----
NM_015149chr152085 1749 1418 655 386 --1601 --
NM_015155chr1072952 2826 2739 2081 1317 1210 1125 --22395 748 12863
NM_015156chr1493996 3690 3195 2562 1428 1312 498 415 398 ----11294
NM_015161chr1641541 1507 1437 973 1618 ----
NM_015170chr842308 2239 1597 594 ------
NM_015176chr151628 1273 1200 402 198 31688 1666 1218 --11104
NM_015185chrX62841 2671 927 878 526 298 12887 1810 --
NM_015192chr20142970 2947 2904 2676 2325 2303 2262 2170 2065 1999 911 897 509 495 32776 1914 430 --12009
NM_015198chr751172 938 535 357 103 --11083 --
NM_015199chr372975 2873 2532 1886 1865 978 664 --1479 170
NM_015203chr1------126
NM_015215chr152721 2516 819 800 205 12186 12251 --
NM_015230chr451827 1465 1260 387 194 11874 --1395
NM_015236chr411254 21372 1304 11440 --
NM_015245chr642725 2618 2119 859 12557 --22639 955
NM_015252chr25904 343 132 121 34 --2779 99 --
NM_015265chr272366 2201 1970 1960 935 469 257 --21010 557 21752 971
NM_015267chr1262164 2085 1915 1825 1772 203 11802 --11586
NM_015271chr4144225 4023 4005 3575 3277 3028 2696 1627 1613 1330 520 487 458 287 13052 --11487
NM_015277chr187743 537 499 470 448 367 53 21502 590 ----
NM_015282chr292968 2769 2748 2724 2664 577 398 351 132 ------
NM_015299chr1451393 1075 727 228 119 --1138 --
NM_015313chr11154712 4679 4651 4512 4493 4470 4366 3648 3401 3378 3225 1678 892 376 285 13016 --23769 253
NM_015317chr2142631 2526 2236 2226 2193 2068 2038 1817 1800 1793 1740 882 831 302 1540 12583 11052
NM_015326chr193001 2923 2017 1079 904 888 625 480 444 --12134 --
NM_015328chr792830 2776 2605 2455 2426 952 925 627 548 ------
NM_015329chr1952933 2293 2102 1068 528 12048 11831 --
NM_015335chr1262660 2650 2606 2272 880 542 22573 1867 32459 1831 596 --
NM_015336chr12102677 2588 2398 2300 2027 2012 1790 1696 830 151 11981 11845 --
NM_015339chr2041023 993 819 406 1835 1900 --
NM_015347chr12112781 2538 2443 2346 2272 1921 1903 1154 1077 690 403 ----12177
NM_015349chr6112982 2908 2623 2404 2006 1914 1900 1042 981 927 426 2489 361 22919 286 --
NM_015355chr1772007 1297 374 356 223 193 45 21893 515 1768 --
NM_015358chr212335 74 --11127 --
NM_015359chr882781 2639 2493 2345 1978 850 671 494 1813 ----
NM_015375chr194821 4568 4168 3995 3908 3894 3618 3337 3187 --33964 3373 728 14919
NM_015393chr483556 2930 2845 2625 2425 1276 1089 347 33662 3477 1210 --1300
NM_015396chr34578 429 265 170 --1306 --
NM_015409chr1272694 2623 1860 728 346 143 61 12384 ----
NM_015429chr38859 729 368 350 315 226 188 85 --11107 --
NM_015435chr841435 1337 495 129 ----1572
NM_015443chr1731390 1366 137 --11113 --
NM_015446chr151569 1507 1336 552 340 11324 1526 1437
NM_015455chr5103412 3049 2713 1484 1443 1399 1379 655 492 394 12845 33386 3171 1107 --
NM_015463chr25790 339 265 225 49 1141 ----
NM_015475chr211079 180 122 --
NM_015484chr13797 239 184 1817 1312 --
NM_015488chr221398 564 --11622 --
NM_015509chr1271395 1385 1374 1352 1229 1221 1147 31250 1098 503 ----
NM_015520chr362127 2106 1059 969 922 831 --1320 11778
NM_015530chr22925 790 --1626 --
NM_015534chr111009 --11033 --
NM_015548chr63939 726 360 1873 1710 --
NM_015550chr7113533 3484 3418 3407 3340 2508 2301 1146 1093 928 544 13231 --11427
NM_015553chr6105165 4033 3773 1595 1359 1235 1113 875 646 74 14330 13250 --
NM_015554chr1592926 2877 2801 2265 1818 935 867 798 82 1840 1247 12454
NM_015560chr382868 2811 2574 2389 1134 1020 212 154 ------
NM_015570chr741596 1318 460 229 ----1155
NM_015576chr382954 2604 2524 2464 2156 2127 1088 297 --1362 31897 658 319
NM_015577chr541795 1684 1533 1279 11205 11845 --
NM_015578chr19102033 1462 1449 1284 803 795 696 650 539 176 11351 ----
NM_015589chr141141 ------
NM_015601chr101366 --1401 --
NM_015602chr161821 1482 1341 1253 1169 54 ------
NM_015626chr1711031 ----1137
NM_015630chr26956 843 781 398 355 157 --1371 --
NM_015642chr32112 106 ------
NM_015678chr1371630 1196 680 657 464 428 157 1357 11371 --
NM_015691chrX72386 2038 1847 1147 427 413 358 22817 2174 1116 --
NM_015713chr873338 3314 2857 2784 2352 823 679 --23559 2851 --
NM_015714chr1----2362 295 1370
NM_015726chr151248 1211 614 571 287 --1100 --
NM_015878chr862221 1891 1361 699 588 553 21841 472 11428 --
NM_015879chr18248649 8239 8013 7448 7301 7081 6982 6727 6538 6231 6224 5923 5546 2862 2842 2807 2769 2585 2498 2372 2152 2125 1349 305 27988 626 31871 1418 573 --
NM_015888chr1153126 2365 2326 2097 1097 1081 1061 973 917 826 804 623 592 153 65 13274 --12118
NM_015891chr642080 1436 1418 34 1725 1174 1770
NM_015902chr87928 888 799 668 632 599 46 --1851 --
NM_015906chr1134355 4247 3904 3832 3092 3031 1938 1876 1853 1503 1409 547 495 23688 1121 1967 --
NM_015913chr1----1711 --
NM_015938chr33894 424 370 1175 ----
NM_015986chr1731286 1060 21 --1137 --
NM_015995chr1565462 5451 4992 4599 1183 950 24015 1664 --15574
NM_016009chr1104888 4587 3768 3227 3165 1499 1461 1451 259 38 11806 13392 --
NM_016019chr74741 394 365 357 ------
NM_016021chr6142941 2761 2718 2690 2568 2421 2317 2156 2033 1978 624 297 235 95 1814 --1637
NM_016026chr1461356 1247 1107 1053 276 198 11215 ----
NM_016037chr121091 769 1296 ----
NM_016040chr17754 647 620 278 258 211 154 3537 269 99 12368 --
NM_016045chr2081697 1579 1421 1184 669 469 341 92 21231 223 ----
NM_016062chr16----1109 --
NM_016075chr1373212 3179 3169 2155 2039 372 297 1648 22700 625 --
NM_016076chr193235 3164 2559 2067 2035 999 804 189 90 32886 846 706 ----
NM_016078chr174989 829 105 23 11100 --1344
NM_016081chr482182 2125 1685 1561 1485 825 441 107 ------
NM_016083chr6153763 3666 2965 2876 2828 2790 2617 2402 1492 1411 1019 749 557 421 393 1634 --23058 2611
NM_016107chr531365 896 427 21373 374 11272 --
NM_016123chr123980 364 54 --21100 476 --
NM_016131chr2102249 2158 1693 1511 678 503 472 367 228 79 ------
NM_016133chr221654 1602 1376 --11375
NM_016141chr32743 157 1252 1226 --
NM_016147chr1121139 813 ------
NM_016156chr1171935 1582 930 871 511 335 115 --12132 --
NM_016201chr372096 1998 1949 1887 1856 1676 1625 ------
NM_016206chr3248743 8472 8416 8381 8234 7806 7555 6496 6332 6260 6159 6116 5832 5688 5633 5493 3410 3269 2341 1975 1880 1645 1600 194 28949 778 29009 1837 25892 296
NM_016216chr33720 568 204 ----1691
NM_016217chr6103561 3087 2969 2588 1396 1371 1335 579 117 47 12634 ----
NM_016221chr542170 1663 939 557 --1516 11912
NM_016226chr123345 106 94 1389 ----
NM_016231chr1721678 1270 --11690 1406
NM_016248chr13193934 3717 3618 3536 3451 3441 3348 3264 3025 3018 2787 1479 1439 1418 889 735 511 384 176 43880 3117 2959 1454 32576 2434 144 --
NM_016250chr141642 ----1249
NM_016258chr13549 258 252 --1692 --
NM_016275chr342630 859 466 188 32798 2612 2588 ----
NM_016277chr691646 1488 1309 1224 1160 1066 487 430 97 11040 ----
NM_016281chr1271124 1103 1032 796 779 289 87 ------
NM_016284chr163926 289 189 1888 --1236
NM_016306chr3122 --1374 --
NM_016308chr172077 1844 1763 1327 558 501 343 148 ----
NM_016322chr983169 2972 1195 1098 622 519 337 62 --23071 2486 --
NM_016333chr16----1481 --
NM_016338chr531076 1034 127 ------
NM_016356chr652476 2271 454 315 192 22966 2450 32869 2487 579 --
NM_016374chr171431 1395 1269 1223 364 153 52 --125 --
NM_016424chr1771913 1774 1530 1517 1474 467 218 21858 323 --2190 58
NM_016436chr2081883 1094 1016 992 984 753 553 450 12673 32550 2184 164 --
NM_016441chr272257 2067 1899 1677 867 671 182 ----12424
NM_016448chr181806 1687 1569 1231 276 130 55 30 21873 1628 --1258
NM_016467chr231016 978 533 11159 ----
NM_016470chr201370 --184 --
NM_016472chr1431379 1223 427 2495 296 --21531 380
NM_016485chr652075 1524 614 379 313 ------
NM_016525chr9--1953 --1247
NM_016530chr15123831 3761 3569 3179 2604 2537 1352 715 653 602 352 291 12892 12845 --
NM_016531chr4104155 3461 3354 3075 2611 1273 844 223 97 82 --44126 3673 3584 791 --
NM_016563chr1561535 1443 1437 1139 999 960 --1978 --
NM_016592chr2021330 1225 1328 ----
NM_016604chr561275 1259 1247 1204 952 886 ------
NM_016605chr552761 2656 2355 2202 2127 --22222 653 --
NM_016620chr131397 1292 401 ------
NM_016623chr82667 496 ----1524
NM_016628chr104665 613 92 68 ------
NM_016631chr215670 348 238 220 57 ------
NM_016644chr52549 70 1373 ----
NM_016653chr231254 461 250 ----1454
NM_016952chr1173764 3436 3351 2714 1289 1119 854 24071 3338 --1753
NM_017412chr85899 450 322 284 266 ------
NM_017415chr5114230 3644 3055 2823 1373 1347 1015 941 590 574 258 22911 1593 21748 1173 --
NM_017420chr14123547 3483 3458 3438 1248 1181 913 906 807 510 406 76 ------
NM_017423chr4132089 2052 2026 1902 1811 1777 1691 1666 1468 872 686 633 216 22115 1647 ----
NM_017426chr44700 619 276 229 --1632 --
NM_017440chr122655 591 3621 489 108 --1667
NM_017444chr861665 1457 650 517 385 86 41290 747 620 339 1756 --
NM_017508chr1182548 2465 2428 2374 2238 930 672 312 2598 555 22017 1858 --
NM_017542chr161795 1554 1521 1427 1172 512 11889 ----
NM_017544chrX3903 671 298 1840 1402 --
NM_017551chr1092663 2651 2608 2081 1033 762 248 239 127 2716 183 ----
NM_017580chr1032140 1543 441 --22340 1683 --
NM_017594chr982918 2408 2077 1208 978 628 493 486 32728 2184 1033 11012 12482
NM_017612chr125514 508 395 370 38 ------
NM_017628chr4135148 5114 5107 4880 3833 3797 3769 3737 3272 1730 1406 711 56 11609 14213 25200 491
NM_017629chr171668 1468 566 496 315 184 145 ------
NM_017633chr6103906 3600 3566 3398 2805 2777 1068 1055 669 344 23807 3754 13202 22647 1390
NM_017635chr1161471 1375 1333 618 191 36 ----11286
NM_017637chr9239415 9320 8508 8475 8339 7577 7568 6865 6654 5949 3684 3177 3121 3091 2755 2471 2295 2019 1891 1080 999 821 685 32772 2441 1471 12590 27341 6856
NM_017643chr1793086 3031 2636 1243 649 567 552 422 241 11912 199 11151
NM_017645chr942652 2297 2132 770 22866 753 --1259
NM_017650chr7175281 5023 4291 3886 3673 2285 2248 2057 1918 1671 1478 1406 1198 1096 1048 918 153 35094 2374 1109 35303 3764 2160 15819
NM_017658chr14204413 4235 4088 3964 3797 3475 3071 1809 1510 1484 1251 1154 1021 562 516 509 468 256 236 147 23343 1348 ----
NM_017664chr135970 902 390 299 234 1866 11051 --
NM_017666chrX82160 1752 1741 1642 1616 874 699 383 --1790 --
NM_017680chr92733 167 --1311 --
NM_017684chr1521673 177 12006 1747 11933
NM_017694chr242026 1856 1619 443 1721 ----
NM_017709chr193864 3581 3402 3339 3330 1353 1034 894 813 14290 23653 991 11263
NM_017724chr31189 --1182 1160
NM_017742chr1861805 1362 506 419 395 81 21894 1666 --11563
NM_017744chr112149 1960 32481 303 124 --
NM_017745chrX3623 240 221 1649 ----
NM_017752chrX81890 1813 1784 467 343 267 180 170 2401 240 11772 --
NM_017753chr93917 352 136 --1876 --
NM_017754chr684716 4441 4153 3965 3249 1918 656 471 25021 1063 23824 1849 --
NM_017755chr52511 229 ------
NM_017769chr14122944 2621 2528 2191 2147 932 787 503 451 409 335 220 13124 12262 188
NM_017780chr83831 764 757 ------
NM_017784chr311171 --21213 359 --
NM_017798chr2041103 477 286 167 141 1392 --
NM_017811chr983097 3067 2595 1984 1024 745 695 603 12656 ----
NM_017813chr8185814 5621 5177 4534 3861 3767 2257 1724 1530 1493 1239 1156 845 794 732 345 310 188 23545 1700 24234 963 24743 3646
NM_017822chr12124 2780 152 1768 --
NM_017824chr1072670 2173 2002 1760 623 548 214 1683 ----
NM_017845chr43778 750 644 ------
NM_017855chr4----129 --
NM_017896chr2083555 2586 2558 2511 2421 2413 625 118 --22522 2480 --
NM_017910chr22370 92 1135 ----
NM_017918chr4------186
NM_017919chr9145699 5334 5304 5091 4801 4366 4074 2217 1850 1804 1531 1412 1393 153 33844 3739 1731 13775 --
NM_017922chr144659 594 501 208 ----1640
NM_017944chr1183061 3037 2724 2237 1989 1190 581 572 11234 179 --
NM_017945chr341083 1033 566 49 1440 1462 181
NM_017964chr23935 248 70 --1798 --
NM_017969chr22172 83 ------
NM_017983chr17----1463 --
NM_017987chr10102089 2026 1901 1874 1741 1380 888 645 528 364 --11712 --
NM_017994chr752345 1143 719 624 204 11985 2529 464 --
NM_018011chr132643 45 --1584 --
NM_018013chr662895 2049 2028 673 609 569 ----12935
NM_018027chr1083319 2281 2201 2111 1233 1163 220 206 --13284 --
NM_018036chr14174125 3937 3358 3265 2970 2928 2768 1745 1629 1216 1119 1103 1038 941 597 264 121 --1332 1967
NM_018046chr541955 1655 1645 160 --21876 488 --
NM_018047chr51581 --1329 --
NM_018061chr161750 1470 1411 1298 229 120 1432 11256 --
NM_018064chr6----1234 --
NM_018071chr141599 --2542 51 --
NM_018079chr23482 435 136 ------
NM_018084chr2143262 2909 2809 2497 2394 2388 2310 2281 2224 1033 856 565 476 118 1591 23270 938 --
NM_018085chr1168125 8101 7734 7693 6036 5457 5203 3267 3239 2935 2798 2635 1529 460 342 82 --46136 5245 1205 53 --
NM_018086chr281903 1872 1607 1496 1358 774 719 493 ----11371
NM_018098chr351210 1182 1037 291 177 2785 213 ----
NM_018120chr88618 514 454 345 308 221 204 155 --1555 --
NM_018121chr1082776 2606 2231 2150 1952 1126 891 562 --22660 2315 11944
NM_018126chr441514 509 438 149 11141 --1410
NM_018133chr382175 1982 1929 1639 1491 830 311 267 ----1688
NM_018144chr10----121 147
NM_018151chr24680 525 291 163 --1810 --
NM_018181chr1861923 1900 1761 1644 1637 56 1382 21267 366 1703
NM_018199chr1431195 225 72 11068 ----
NM_018202chr13276 125 101 ------
NM_018222chr1111645 11346 --11691
NM_018227chr4132915 2786 2272 2255 2243 1974 1963 1281 1099 1057 941 838 41 2465 229 22897 170 --
NM_018237chr102250 221 ------
NM_018243chr4113959 3862 3745 3576 3378 1513 1449 925 558 552 411 --23811 301 22609 1543
NM_018247chr6112932 2494 2169 1920 1149 1104 1017 905 758 483 377 43030 2982 2231 574 --198
NM_018263chr251835 985 462 212 165 2870 312 1265 --
NM_018293chr3172890 2883 2580 2558 2222 2070 1996 1987 1935 1907 1899 1025 813 703 665 234 145 --22798 2262 --
NM_018312chr1152109 1511 502 447 417 2531 372 22099 1995 --
NM_018314chr114767 712 300 256 1152 ----
NM_018323chr451791 1292 1173 717 606 31622 1460 132 1569 --
NM_018325chr921116 561 11669 11165 --
NM_018351chr12114701 4654 4402 4390 3958 3899 3583 3210 2908 996 788 1203 11309 --
NM_018362chr11134002 3958 3560 3526 2701 1302 1271 837 597 317 262 181 131 23899 531 43770 1396 523 29 --
NM_018364chr1133729 3673 3660 3411 3028 2701 1486 1192 815 738 583 230 24 2888 44 1801 13820
NM_018371chr851321 1047 1023 635 31 --1184 --
NM_018373chr14136478 6397 6131 5267 4645 2349 1998 1986 1894 1183 579 485 479 25168 983 35872 1315 761 --
NM_018375chr1441932 1533 731 410 --21343 248 --
NM_018383chr242008 1939 578 547 21713 1318 11423 12047
NM_018387chr94513 452 371 135 ------
NM_018398chr31325 ------
NM_018403chr3114004 3879 3119 1577 1287 1091 1054 981 761 427 332 22692 1177 21252 601 1863
NM_018419chr202371 304 ------
NM_018445chr154505 467 76 21 ------
NM_018451chr132586 148 ----1228
NM_018460chr21140 --1118 --
NM_018477chr145920 858 737 250 159 ------
NM_018482chr892575 2270 2092 1904 1015 868 601 512 311 32290 1642 719 ----
NM_018489chr131951 1906 294 --11788 --
NM_018527chr131139 1426 --1111
NM_018557chr281715 1635 1578 1525 1290 631 366 53 2571 531 21682 1662 --
NM_018566chr1135064 5042 4995 4566 4293 3913 3501 1607 1535 1487 1030 887 867 24090 1169 54414 4075 1145 450 343 --
NM_018584chr131128 1113 961 1371 --187
NM_018602chr1551705 309 291 262 79 ----11468
NM_018638chr12205524 5415 5216 4566 4490 4385 4315 3790 3553 3497 2229 2152 1863 1754 1712 1603 1393 1248 1009 393 12030 ----
NM_018649chr10----1537 --
NM_018650chr182289 2168 2119 2105 2015 1699 802 247 3741 413 339 ----
NM_018652chr152978 287 --1683 --
NM_018682chr75716 205 144 77 21 --1461 --
NM_018685chr751093 833 249 221 86 ----21018 920
NM_018691chr551232 1128 1093 441 331 ------
NM_018704chr161941 1788 1663 1626 678 538 193 21318 143 1330
NM_018710chr84989 955 390 128 --1442 --
NM_018715chr152303 1654 677 526 119 1276 ----
NM_018717chr462820 2760 2529 2445 2412 406 22678 536 ----
NM_018834chr54826 397 352 235 ------
NM_018837chr204858 251 217 198 --1936 --
NM_018898chr562265 2044 1920 1913 1756 783 22068 1840 12163 12352
NM_018945chr693560 3435 2422 2267 1418 1217 791 565 95 --43596 2811 1110 641 --
NM_018948chr131457 513 181 21439 1105 11425 --
NM_018963chr2141542 1465 1308 461 1952 ----
NM_018975chr161814 1526 2776 545 --
NM_018976chr1282780 2685 1961 1770 1063 769 620 482 1884 12267 12483
NM_018979chr1272513 2195 1825 1640 901 789 656 22265 596 22589 2547 12412
NM_018992chr1641621 1613 658 109 11086 11166 --
NM_018999chr10164735 4639 4417 4195 4136 4056 3990 3943 3866 3847 3194 1610 1482 1236 1051 885 44356 3693 1789 1718 ----
NM_019004chr792336 2306 2239 1929 1639 961 885 427 160 178 ----
NM_019018chr53656 619 230 ------
NM_019022chr18153123 3052 2898 2882 2722 2415 2205 2189 2076 1248 574 540 455 407 114 ------
NM_019026chr11584 --1506 --
NM_019050chr4132186 2103 1660 1616 914 900 860 797 715 533 499 397 198 ------
NM_019063chr23415 108 48 22300 317 ----
NM_019072chr5114202 4196 4032 3856 3646 3557 3465 3322 1329 881 274 34236 2720 501 24269 3584 14158
NM_019083chr15656 449 336 135 83 11441 ----
NM_019084chr1072321 2143 2071 1852 1819 1019 37 ----1315
NM_019091chr271101 993 896 765 422 151 104 --11060 1262
NM_019094chr12143556 3421 3403 2970 2816 2714 2697 1539 1402 1106 563 539 329 262 12996 21267 586 --
NM_019114chr962128 841 777 406 356 66 1384 ----
NM_019116chr1673392 3172 3010 350 229 162 98 --11427 --
NM_019117chrX33128 375 130 11365 13456 --
NM_019556chrX31502 1385 973 11379 --1313
NM_019593chr20122807 2568 2498 2358 2142 1228 943 907 856 563 529 58 22532 2483 125 1301
NM_019600chr154786 629 517 271 ------
NM_019605chr12686 78 268 23 ----
NM_019610chr162172 2165 1736 1585 1394 755 --1570 --
NM_019857chrX51641 1293 1270 665 546 1400 ----
NM_019885chr262934 2740 2628 2519 2031 1854 --12926 --
NM_020116chr431848 1686 463 ----1342
NM_020123chr1071356 1200 1007 496 449 115 25 ------
NM_020135chr6--1178 1114 --
NM_020144chr782061 2025 1754 1641 1466 1334 1312 605 11849 11904 --
NM_020150chr1042253 1640 1391 796 21421 862 11941 --
NM_020177chr5123200 3155 2825 2785 2764 2292 2080 1217 1025 726 414 329 11210 ----
NM_020184chr242225 2186 888 280 --1298 --
NM_020190chr1----1461 --
NM_020193chr1171230 1167 1160 956 477 194 24 3936 391 71 191 --
NM_020205chr183049 2642 2346 2326 1204 1113 907 804 12764 ----
NM_020243chr225780 708 611 298 96 --1560 1832
NM_020336chr2093170 2826 2786 2446 1151 1093 383 233 167 --11488 --
NM_020337chr4103053 2788 2543 1174 1140 990 960 547 244 217 22314 2061 33163 773 208 --
NM_020338chr1093656 3517 3377 3094 2903 2877 2715 900 64 --21465 1406 --
NM_020341chr2081913 1898 1673 805 559 431 400 351 2601 485 11307 --
NM_020342chr2102600 2529 2318 1945 1888 758 751 398 386 50 1486 ----
NM_020346chr1141642 1502 1224 554 --31712 1366 1264 --
NM_020357chr381544 1510 1141 1117 1073 209 115 97 --11399 --
NM_020360chr172638 257 ----1458
NM_020390chr3234871 4782 4670 4654 4598 4398 4240 4185 3801 3503 3490 3222 1900 1847 1416 1368 1083 798 743 549 520 452 201 ------
NM_020403chr1371763 1690 1633 1612 261 193 123 21723 268 ----
NM_020429chr762968 2896 2871 2394 687 266 11945 13116 --
NM_020432chr781713 1594 736 720 475 429 389 168 21849 633 21823 1502 --
NM_020440chr193068 2993 2968 2715 2156 1338 1239 1199 206 ----12744
NM_020443chr196860 6649 6461 5065 4239 849 839 817 254 --15766 --
NM_020463chr241428 1352 1334 1285 ----1940
NM_020466chr694998 4325 3859 3619 3455 3344 1538 1097 332 --21985 1702 1181
NM_020474chr1831978 1438 492 12042 1644 --
NM_020546chr572965 1259 1237 1175 940 924 57 1661 ----
NM_020640chr322303 1543 42154 1890 1608 313 1429 --
NM_020647chr882212 1972 1770 1634 649 381 213 205 21786 772 22166 1780 --
NM_020648chr1862344 1937 1083 459 238 118 22766 344 ----
NM_020651chr251833 1765 1715 1336 605 31689 1369 237 ----
NM_020673chr20207719 7677 7214 6908 6469 6449 5803 5697 5432 4895 4794 2768 2408 2103 1878 1811 1605 842 550 347 15786 47776 7374 6358 2618 22608 1166
NM_020689chr2041467 1351 446 263 --21695 1075 --
NM_020696chr32265 64 131 1205 --
NM_020697chr841139 1067 905 457 ------
NM_020699chr195398 4318 3331 3304 1714 1674 1639 1355 360 12158 24901 3625 --
NM_020713chr2042897 2687 2306 1045 --12100 12952
NM_020718chr16256499 6412 6342 6294 5916 5646 5562 4703 4617 4575 4466 4191 4164 2136 2059 1916 1690 1621 1354 963 942 855 680 516 97 14694 11440 14178
NM_020734chr1263219 3203 1077 1068 303 176 23080 3054 --12305
NM_020740chr17269 28 ----1262
NM_020742chrX72746 2681 2661 1738 1681 612 475 ----1704
NM_020747chr56708 605 378 255 124 53 ------
NM_020748chr1731873 1580 203 22151 1734 ----
NM_020752chr1062658 2475 582 502 425 195 2771 307 ----
NM_020768chr5102945 2153 1241 1206 1160 799 790 716 426 147 --12106 143
NM_020772chr17248183 7979 7941 7794 7469 7250 7137 7093 6923 6860 6640 5966 5916 5722 5640 5307 3233 2933 2796 2747 1556 638 514 477 46766 6361 5764 1975 27122 2317 22638 1899
NM_020774chr18206281 5910 4730 4545 4407 4341 4311 3853 2415 2344 2241 1979 1598 1276 1188 931 800 607 298 22 46170 5566 3879 1758 14646 13830
NM_020778chr1594820 4610 4221 3806 1947 1866 1409 520 173 --23785 295 --
NM_020782chr12204703 4647 4572 4417 4268 4084 4019 3820 3041 1941 1705 1639 1365 1277 971 929 880 539 524 191 23626 1245 ----
NM_020783chr1871963 1769 1622 1507 898 698 273 ------
NM_020791chr1761325 1271 1010 1004 379 135 1219 ----
NM_020792chr3112673 2255 1780 1014 647 591 528 455 306 71 55 12191 ----
NM_020795chr1722009 1723 --11628 --
NM_020800chr311272 ------
NM_020801chr542356 1624 501 108 1466 22037 807 --
NM_020807chr1631779 1766 267 --21712 1649 11353
NM_020808chr131090 745 438 1874 11123 --
NM_020815chr42359 292 ------
NM_020824chr10----1126 --
NM_020825chr1633745 2865 2399 --23156 3094 --
NM_020830chr232707 2192 124 32356 989 983 13173 --
NM_020834chr1441605 504 116 80 --11542 --
NM_020839chr341620 1119 1043 291 ----11481
NM_020843chr152135 90 ------
NM_020856chr1951407 1180 1004 407 234 2399 38 ----
NM_020858chr1582387 2330 1958 1827 829 518 387 138 1733 12116 --
NM_020860chr41274 --1302 1896
NM_020871chrX62338 1944 1922 835 684 623 ----1959
NM_020872chr361663 1656 1574 660 470 457 11164 31728 1319 592 --
NM_020909chr274047 4018 3300 2649 1632 440 232 ------
NM_020925chr131145 580 113 --21248 446 11009
NM_020935chr2134556 4103 3921 3822 3617 3142 1855 1374 1226 1133 756 714 185 23962 3042 24430 3721 --
NM_020937chr142294 131 ----1191
NM_020940chr1072888 2856 2814 2357 1178 978 967 1320 --1368
NM_020943chr21230 166 ----
NM_020964chr18134752 4705 4222 4204 2952 1740 1667 1207 1103 413 160 75 55 21409 457 44362 4161 4125 1455 14185
NM_020967chr2021291 1205 ----1924
NM_021003chr144842 782 270 61 ------
NM_021012chr17------13217
NM_021038chr3113360 3303 3271 3213 2807 2625 2153 1078 1030 512 172 22504 2141 2732 209 --
NM_021072chr53966 495 298 12206 12280 --
NM_021090chr2294697 4056 3589 2005 1979 1869 1339 755 718 23424 1255 190 --
NM_021109chrX2341 81 ------
NM_021110chr83773 734 90 ------
NM_021132chr1041241 990 340 271 1469 1846 --
NM_021137chr1762136 2060 1729 1587 829 734 11902 1593 --
NM_021144chr9----2374 21 --
NM_021145chr7------1722
NM_021167chr742685 2282 2033 332 22082 955 22420 660 --
NM_021174chr81720 --1253 --
NM_021180chr11684 --1776 --
NM_021183chrX92228 1961 1953 1881 973 783 568 523 71 42018 1786 1709 516 12533 --
NM_021190chr151228 1112 1002 531 255 1457 1228 --
NM_021218chr93719 94 31 1105 1781 --
NM_021222chr161444 1438 1208 937 905 217 --21451 469 11350
NM_021238chr1242054 1701 1615 629 2727 51 22014 1864 --
NM_021239chr1441381 1124 575 329 162 ----
NM_021255chr14104093 3010 2571 1534 1496 1477 1226 904 637 52 13572 --11239
NM_021572chr65792 371 354 329 297 ------
NM_021629chr3164563 4444 4082 3938 3910 3900 3692 3526 3507 1446 1317 736 665 354 346 330 23971 1688 34350 3225 1105 1768
NM_021638chr4134618 4611 4515 4440 4193 4120 3804 3791 3045 1534 505 224 211 --14932 --
NM_021643chr241871 1703 637 293 --1301 --
NM_021648chr642714 774 411 382 ------
NM_021813chr6125823 5579 5530 5108 4706 3907 2207 1959 1621 964 851 615 14784 24815 4738 --
NM_021914chr1442277 885 512 198 22133 735 ----
NM_021956chr621565 1207 --1268 --
NM_021960chr1112699 2586 2401 2232 1871 948 833 780 585 559 240 ------
NM_021961chr11127467 7260 6344 6129 5624 4929 4787 4768 4607 2253 660 170 25079 1772 17448 27418 5458
NM_021963chrX1732 ----1742
NM_021964chr3255926 5885 5845 5564 5426 5057 4779 4646 4569 4491 4164 4152 4026 2140 1849 1522 1514 1421 1184 1156 895 660 643 419 35 44835 4540 2167 1786 22532 556 11627
NM_021965chr941330 250 118 98 ----11249
NM_021979chr142414 368 ------
NM_021998chrX61291 1208 983 388 366 296 --11104 --
NM_021999chr132813 312 --165 --
NM_022037chr261024 934 916 763 278 134 ------
NM_022048chr15115838 5548 5204 5051 4637 4571 3962 829 753 744 406 16289 ----
NM_022049chr141868 1802 1678 376 --1204 --
NM_022051chr14568 485 175 110 1161 ----
NM_022058chr242115 785 558 421 21915 162 11866 11490
NM_022093chr11163 1706 1912 --
NM_022118chr132188 70 1168 ----
NM_022123chr14159 ----188
NM_022130chr551238 1127 544 448 89 1280 ----
NM_022138chr621333 108 --2126 102 --
NM_022145chr53658 159 119 ------
NM_022166chr16126240 6155 5993 5907 5865 5439 4603 2459 2430 2260 1575 584 21841 913 22387 1475 --
NM_022340chr342636 1174 944 294 12539 32699 1409 810 23632 158
NM_022351chr863713 3509 3366 3272 385 228 22774 1413 ----
NM_022365chr10132 ------
NM_022458chr783147 2281 942 842 491 455 384 131 1600 ----
NM_022459chr13146005 5352 5196 5097 4851 4004 3913 2448 2438 2324 1562 1397 1256 112 55479 5371 1803 1698 130 22416 105 --
NM_022465chr1272687 2636 2443 2412 577 348 93 --12993 --
NM_022473chr15124471 4426 3871 3658 3399 3224 3154 3042 1624 1234 1184 174 1441 44398 2984 2738 1313 --
NM_022474chr1482685 2530 2151 937 822 649 559 504 12797 3544 267 227 --
NM_022482chr20112523 2385 2374 2090 1804 900 845 816 433 214 167 --11722 --
NM_022484chr771454 1307 1266 934 251 178 65 --1127 --
NM_022494chr102468 439 ----1157
NM_022648chr2134615 4502 4494 3704 3666 3647 2837 2820 1225 904 406 362 98 ------
NM_022658chr1241340 1305 1131 468 11032 ----
NM_022726chr671581 1539 1103 538 433 258 203 1382 11176 --
NM_022739chr1771076 900 853 831 821 207 138 31191 485 169 11204 1420
NM_022758chr642831 411 352 51 --1245 --
NM_022771chr1231052 836 242 --2326 35 1311
NM_022780chr291399 1348 1301 589 494 363 354 290 129 ------
NM_022781chr983306 3232 3116 2229 2203 2140 936 240 12943 13056 --
NM_022818chr1651636 1611 1229 263 196 ------
NM_022824chr531813 1642 1492 1316 ----
NM_022826chr241116 1075 398 74 ----1469
NM_022832chr452596 2391 1795 1612 419 ------
NM_022836chr151778 1721 1511 218 100 21572 1191 11846 --
NM_022841chr1562800 2492 2369 598 293 106 21810 919 12451 --
NM_022893chr282877 2849 2837 2019 1093 959 904 293 1306 13174 --
NM_022894chr241557 706 471 255 1160 --1490
NM_022898chr14154728 4632 4422 4244 4131 3741 3709 3585 3440 3432 1733 1382 517 313 271 --1665 --
NM_022912chr263095 2720 2181 460 245 209 42923 610 496 162 12742 --
NM_022918chr11102086 1913 1894 1852 1705 1530 1493 1354 395 331 ------
NM_023037chr133928 800 429 ------
NM_023072chr192853 383 11128 21030 266 --
NM_023076chr1662115 2062 1854 1831 935 613 --2994 387 --
NM_024016chr174792 775 656 626 ------
NM_024057chr122111 33 154 ----
NM_024336chr161237 ----1376
NM_024408chr1133684 3219 3169 2950 2761 2562 2384 930 757 741 625 568 334 --13159 --
NM_024430chr1851696 677 496 488 379 1106 ----
NM_024490chr151585 --1625 --
NM_024491chr32622 56 2167 76 149 --
NM_024529chr141173 825 740 116 3856 453 222 11132 --
NM_024539chrX61112 1076 973 961 342 240 1880 ----
NM_024595chr13137 98 59 --11009 --
NM_024612chr1741114 802 275 60 ------
NM_024613chr851861 1290 539 464 53 21567 1265 11193 --
NM_024617chr93723 716 688 ----1918
NM_024624chr271533 1434 1177 1139 503 292 198 --1347 --
NM_024631chr111541 ----1200
NM_024639chr672075 2048 2026 1109 1011 1005 84 12183 ----
NM_024665chr3104331 3992 3507 3452 3345 2982 1789 1018 697 618 54739 4686 4305 1765 1693 13771 --
NM_024680chr11----1393 --
NM_024713chr1521151 515 --11077 --
NM_024749chr162242 1849 786 656 291 53 1307 --1462
NM_024757chr921171 966 --1239 --
NM_024761chr964157 3574 1697 1614 1466 442 23938 1722 34913 4537 160 --
NM_024770chr2116130 5964 5165 4556 4532 4363 4337 4252 1410 327 149 32511 306 197 52265 1950 1747 679 247 15216
NM_024779chr1241415 1352 440 205 --1406 --
NM_024798chr1542728 2235 1837 924 12644 1288 --
NM_024817chr15125909 5515 5409 5062 5043 4545 4107 3747 2302 1421 968 656 ------
NM_024828chr971587 1311 445 239 172 124 60 1465 ----
NM_024884chr1494511 4280 4092 3958 3771 3751 1516 1235 869 11422 1367 --
NM_024915chr842631 2547 1025 488 12411 123 --
NM_024920chr471404 1324 976 534 457 309 222 --1348 --
NM_024939chr1611164 1621 ----
NM_024944chr2141100 466 214 29 ------
NM_024946chr1651570 1469 1269 233 125 21350 1181 ----
NM_024949chr4124902 3726 3645 3421 1978 1602 1534 1362 1172 1056 454 40 11674 1284 --
NM_024953chr12122833 2827 2795 2661 2624 2580 1753 1101 1061 938 268 221 1129 --12100
NM_024989chr2227970 7928 7546 7372 7287 6823 6608 5857 5716 5357 5253 5218 5049 2731 2624 2590 2484 1568 1173 1146 912 215 77515 6638 5110 1910 1649 578 407 --26975 2701
NM_025004chr114508 493 264 31 ------
NM_025054chr864130 3997 3286 1535 1441 1411 23336 867 1586 --
NM_025076chr23539 199 188 1561 ----
NM_025134chr1672537 1829 1673 769 327 249 37 11697 ----
NM_025146chr34624 432 160 84 32320 2076 1909 1450 --
NM_025154chr741449 1274 561 29 11411 1345 --
NM_025160chr1164084 4042 3931 3685 3547 3486 3323 3182 3096 3063 2955 2695 1344 1166 1034 625 43533 1353 1190 869 11079 --
NM_025195chr821578 1539 41712 1605 1436 372 ----
NM_025208chr1192444 2376 2147 2104 1919 1574 1524 591 149 3812 457 439 1708 --
NM_025251chr81999 11016 11007 --
NM_030567chr5------1131
NM_030627chr5153973 3957 3937 3478 3272 2679 2658 1138 1120 1047 1039 383 335 282 23 11393 13193 1991
NM_030629chr1651931 1622 1572 1531 240 ------
NM_030647chr7236101 6086 5751 5671 5619 5559 5179 5128 4792 4705 4395 4174 2353 2065 1516 1225 1082 876 773 651 605 276 148 --56275 5041 4819 731 183 --
NM_030648chr4134171 3933 3694 3681 3594 1733 1361 883 830 791 670 512 342 14218 35080 4972 1209 --
NM_030650chr2143776 3553 3341 3086 3014 2794 2714 1388 1117 983 799 348 255 80 32997 1104 409 1858 1332
NM_030661chr721366 385 ----1456
NM_030755chr14123124 2923 2608 2434 2227 1967 1217 1115 830 822 727 687 136 22851 61 1961
NM_030759chr102663 589 --1532 --
NM_030790chr161230 ------
NM_030806chr1228842 8746 8445 8330 8056 6984 6508 6226 6080 3412 2534 2490 2140 1972 1759 1373 1128 1018 756 732 676 500 33591 1481 1351 1993 49429 9349 8902 714
NM_030885chr372292 2230 2138 1659 904 346 97 1821 187 11997
NM_030906chr112564 427 --1412 156
NM_030912chr103676 162 145 1829 1858 --
NM_030915chr242363 2344 2011 804 --22070 790 --
NM_030920chr192095 1993 1946 1890 1735 738 583 311 283 12083 ----
NM_030938chr1761174 720 386 280 161 146 --11140 --
NM_030939chr681108 1089 444 427 330 223 161 72 --11017 1127
NM_030949chr641477 1439 1380 590 ------
NM_030960chr64411 188 161 86 ------
NM_030962chr1141561 1486 1408 1282 1988 ----
NM_030963chr64617 575 257 250 --195 --
NM_030964chr533436 3382 228 13634 3878 528 199 --
NM_031216chr1872215 1885 1536 689 495 358 25 ------
NM_031291chr45691 453 207 138 103 ----181
NM_031372chr4111564 1246 1224 1217 680 662 637 360 230 178 99 ------
NM_031422chr182504 490 ----1478
NM_031439chr881960 1906 1760 1226 649 494 456 216 --1757 --
NM_031442chrX52465 2144 1209 580 177 13140 11147 --
NM_031469chr6134098 4064 3035 2846 2512 1041 1022 951 900 815 523 274 116 --12885 136
NM_031476chr1642743 2696 2571 69 --1134 12386
NM_031480chr6130 ------
NM_031483chr2073469 3369 3172 2519 2371 682 491 ----11390
NM_031954chr12112555 2263 2025 1153 665 651 564 535 228 142 117 --1958 --
NM_032021chr1141229 1215 1076 317 --11103 --
NM_032109chr541542 1323 1253 496 ----11011
NM_032121chrX82759 2722 2322 1959 477 328 296 94 12676 ----
NM_032138chr132525 437 1127 --1593
NM_032144chr241288 1141 124 113 11822 11653 --
NM_032153chr352176 1713 813 797 290 --12486 --
NM_032160chr18124065 4045 3776 3482 3358 2953 1463 1165 891 870 747 227 23502 2935 23642 52 --
NM_032172chr72696 217 ------
NM_032181chr21559 --1807 --
NM_032182chr1031487 546 397 31623 1597 485 ----
NM_032199chr10123870 3864 3774 3604 3568 2727 2469 1508 952 892 768 602 2958 759 --1486
NM_032214chr201424 --1957 --
NM_032221chr2021422 1390 --21800 1485 --
NM_032239chr471407 1216 925 433 311 296 153 --150 --
NM_032256chr12--1406 ----
NM_032291chr161772 1487 634 493 291 73 11799 1388 --
NM_032303chr941806 1297 465 292 ----1531
NM_032320chr111323 ----1196
NM_032364chr121819 --1760 --
NM_032408chr71789 3877 821 269 ----
NM_032410chr85967 812 309 266 187 --11213 1134
NM_032411chr2----1217 --
NM_032424chr1141464 1457 1213 321 11563 11391 --
NM_032434chr261494 1402 1345 1267 1198 627 11064 21231 433 1168
NM_032439chr1081389 617 366 240 197 162 138 71 --11094 --
NM_032440chr10102457 2427 2024 2005 1912 875 594 468 359 119 2716 542 ----
NM_032445chr15122553 2412 2008 1761 1718 905 775 732 614 420 393 249 12426 ----
NM_032446chr593508 3388 3032 2771 2602 1138 618 82 75 32755 2572 571 --23695 977
NM_032457chr4133913 3858 3650 3105 2539 1462 1266 1248 1207 966 575 244 119 31539 1342 1315 13046 21290 404
NM_032458chrX143352 2996 2943 2336 2285 2164 2141 2089 1349 1315 1257 311 184 144 22767 828 ----
NM_032466chr861465 1208 1062 588 461 162 --11445 11133
NM_032491chr1251050 1026 851 306 131 ----1949
NM_032505chr3162778 2468 2436 2429 2344 2255 2212 1954 1930 1760 1750 1063 820 259 250 217 --12751 --
NM_032510chr1892439 2297 1922 1916 1621 1558 340 310 82 11736 1524 --
NM_032521chr2093108 3041 2979 2555 2388 2317 1977 651 173 2779 466 --12229
NM_032523chr21586 --1179 --
NM_032539chrX5736 554 532 301 156 2588 121 ----
NM_032547chr421422 45 --11366 --
NM_032569chr1641982 1907 1701 1488 21600 129 ----
NM_032590chr123789 427 183 11123 1120 --
NM_032595chr1721247 1124 --11206 --
NM_032603chr21303 --1734 --
NM_032632chr1452007 1963 1464 1254 372 --11778 --
NM_032682chr3113599 3572 3183 2418 2348 2337 2267 2229 634 314 199 1330 13381 --
NM_032737chr1932696 2444 1807 ----12740
NM_032787chr31108 ----1279
NM_032801chr1111552 32005 1754 775 22069 569 --
NM_032810chr1031517 1027 419 11398 ----
NM_032832chr651671 1518 1454 1431 1298 2661 181 ----
NM_032833chr1152450 2390 2140 2050 1890 990 713 684 676 558 549 403 362 311 93 --1305 --
NM_032842chr731729 1542 220 21309 310 ----
NM_032859chr13213961 3653 3607 3570 3274 3217 3095 3047 2948 2883 1583 1557 1406 935 831 797 619 566 488 421 197 31443 761 114 ----
NM_032873chr11174305 4120 4025 3886 3858 3834 3211 3163 3145 2949 2923 2861 713 695 617 438 229 --14271 21796 911
NM_032875chr172828 190 ----1800
NM_032876chr1471974 1726 1645 1427 1379 679 307 11719 21634 1514 --
NM_032900chr1053317 623 542 413 321 22580 1308 13426 2536 110
NM_032930chr11246 33 ------
NM_032932chr1796142 5733 5623 5515 4684 2216 1835 1628 1282 14925 35352 4521 225 --
NM_032961chr421378 230 1950 11037 --
NM_033055chr13995 866 96 1416 ----
NM_033081chr2021158 130 ----11052
NM_033117chr92376 70 ------
NM_033122chr41239 --1231 --
NM_033132chr1322017 1984 --11666 --
NM_033141chr141440 --21997 1710 1129
NM_033143chr4174579 4536 3936 3721 3673 3203 1699 1273 970 915 897 833 797 730 684 600 169 1712 1326 --
NM_033224chr7197707 7644 7396 7197 7158 7124 6059 6018 5969 5527 5420 2677 2446 2355 2136 1769 1391 951 645 57863 6037 3166 2828 1589 1480 16512
NM_033260chr6176 ----2147 84
NM_033285chr8204297 4193 4070 3852 3584 3449 3385 3275 3007 2797 1317 1114 460 414 357 351 345 301 213 200 24026 3067 24450 4374 --
NM_033340chr1021309 177 11291 11358 125
NM_033389chr17194894 4708 4570 4541 4507 4261 4195 4005 3927 3652 3585 3168 2945 1125 253 217 111 103 79 11236 43917 3327 543 319 13665
NM_033396chr111315 --2419 160 --
NM_033407chr11220 ------
NM_033505chr2206281 6273 5903 5567 5414 4893 4461 4284 4239 2513 2080 1976 1799 1556 1474 1443 716 395 310 159 26320 5355 25046 212 --
NM_033656chr21155590 5532 4822 4558 4370 2193 2143 1861 1645 1605 740 640 566 507 319 45953 2365 2060 236 25757 218 15844
NM_052832chr8142887 2800 2607 2546 1873 1132 845 803 770 498 441 345 290 181 12250 168 --
NM_052864chr482016 1982 1711 833 784 635 537 335 ----22008 142
NM_052879chr1273548 3425 3169 2938 2602 430 136 33340 957 313 12826 --
NM_052880chr2251379 1308 531 225 116 --182 --
NM_052898chr8101817 1681 1579 1549 1383 1202 1193 644 543 310 11446 ----
NM_052900chr841776 1741 1291 92 ----11520
NM_052910chr1332183 797 776 2841 490 --11677
NM_052911chr185945 855 744 135 86 1332 --1912
NM_052917chr293303 3241 3131 1251 1144 970 964 79 38 ------
NM_052918chr1083226 3170 2368 1374 695 662 130 90 23746 3260 12541 --
NM_052927chr582156 2108 2076 2016 1782 1734 712 404 2896 743 1702 --
NM_052932chr11122420 2213 2128 2022 1880 1651 882 853 607 519 386 58 22146 1621 --12004
NM_052934chr1----12279 --
NM_052950chr1371649 1372 388 375 337 324 309 12199 11364 --
NM_052958chr83715 693 259 ------
NM_052966chr1103767 3493 3409 3229 3102 1211 1185 386 369 341 13687 23888 2777 --
NM_052971chr51142 --2302 80 --
NM_053002chr341144 990 194 113 ------
NM_053023chr11113246 3063 3036 2413 2307 2178 2093 1326 905 510 40 31176 969 938 --1811
NM_053042chr4153188 2861 2745 2712 2480 2255 2076 2063 1988 1966 1954 668 597 483 230 22663 2413 22687 422 --
NM_053053chr121026 1020 1708 1141 --
NM_054114chr61318 ----1704
NM_057175chr472654 2270 2009 1815 462 348 32 ------
NM_057749chr831282 1171 335 1400 ----
NM_058170chr16558 537 427 398 363 118 --1495 --
NM_058237chr1451033 707 696 101 88 ------
NM_080415chr171372 --1171 --
NM_080422chr182313 276 140 ----
NM_080616chr202169 153 --189 --
NM_080671chr292272 2110 1979 1819 424 412 312 255 85 1638 22228 1720 21926 107
NM_080672chr203544 481 409 ----1529
NM_080743chr6122588 2546 2297 2217 1770 819 366 259 230 218 146 113 1677 31821 965 776 --
NM_080764chr2293226 3192 3010 2917 2899 2737 2174 748 307 22680 172 23149 2302 --
NM_080832chrX101496 1486 1454 1359 672 577 537 254 201 155 --1195 11762
NM_080867chr14175016 4875 4787 4498 4372 4109 3903 3878 3509 1868 1669 1587 1406 939 413 254 146 24382 810 23947 76 --
NM_080927chr352636 2370 2228 2211 1049 --32725 1177 598 --
NM_101395chr2172978 2812 2493 2479 2463 914 453 ------
NM_130386chr182540 479 ------
NM_130768chr71294 1126 ----
NM_130808chr34448 316 292 83 ----1352
NM_130847chr1175216 5157 4928 1796 1667 723 143 1920 --12158
NM_133264chr1793247 2791 1459 1271 1063 834 691 562 459 --13583 13186
NM_133265chrX93127 2716 2259 2232 1077 631 340 180 52 43191 2440 1025 1005 13645 --
NM_133334chr4176336 6070 5875 5191 5183 5121 4849 4258 2075 2052 1482 1169 1071 920 770 307 80 25762 4567 15504 --
NM_133433chr53889 207 154 ----1905
NM_133445chr993728 3639 3570 3472 3376 2402 1439 1216 958 --21057 61 --
NM_133452chr193333 90 46 1409 ----
NM_133493chr6134624 4496 4097 4077 3803 3765 3477 3411 3049 3003 2883 1521 294 23916 92 1318 --
NM_133496chr1204429 4207 4098 3997 3908 3881 3654 3206 2767 1817 1716 1499 1458 1219 1195 1185 1109 849 461 152 11249 11439 --
NM_133638chr521185 445 1582 --1178
NM_133646chr2145326 4805 4479 4459 4355 4241 3677 1876 1359 436 360 318 160 112 15306 25594 3822 25550 378
NM_134424chr1291125 1018 916 825 503 302 180 58 46 ------
NM_138288chr1442170 2164 695 329 2320 247 ----
NM_138316chr1041070 1029 490 334 1283 180 --
NM_138333chr982604 2309 1991 1007 936 892 646 73 ------
NM_138340chr183687 165 143 --125 --
NM_138357chr1041201 1188 616 565 ------
NM_138423chr1552190 2092 1509 277 58 ------
NM_138426chr762382 1982 1894 1885 1751 222 --22298 758 --
NM_138455chr82299 69 ------
NM_138458chr21330 --2849 61 1747
NM_138459chr673528 3467 3015 2940 1057 972 583 22675 266 ----
NM_138473chr12114463 4291 4282 3860 3528 3451 2037 1143 669 515 388 14041 --1237
NM_138571chr65682 561 529 498 184 ------
NM_138572chr653351 3157 2206 997 871 32037 391 230 ----
NM_138701chr71214 199 1309 --
NM_138731chr14134255 3702 3316 3282 3144 2824 2733 1361 1172 1074 771 439 252 --1171 --
NM_138764chr194279 270 233 98 ------
NM_138782chr592352 2309 2231 2047 1916 879 828 378 146 22099 399 ----
NM_138927chr212912 30 2811 284 --1823
NM_138959chr1176804 6730 6294 5951 5512 5504 5062 2698 2434 2352 2325 2260 1895 1636 1607 596 153 --14576 14217
NM_138966chr181614 1469 --1239
NM_138967chr1572376 2252 2020 1920 1583 461 117 ------
NM_139015chr1221093 424 --11134 --
NM_139058chrX----1422 --
NM_139072chr22590 555 ------
NM_139207chr1262166 1997 1640 866 419 168 11914 ----
NM_139279chr242920 2580 1010 64 13533 22838 109 --
NM_139281chr5133610 3147 2665 2564 2413 2249 2201 1117 1070 1030 211 148 132 ------
NM_139283chr1282351 2112 2102 1932 928 754 620 299 21753 922 ----
NM_139321chr2054183 3329 2956 1697 202 1627 ----
NM_144567chr1122656 2500 2415 2389 2339 2206 2071 1912 1047 914 726 336 1132 12823 12357
NM_144570chr1632300 2272 486 12564 --12353
NM_144571chr4286406 6217 6135 6014 5925 5518 5323 5119 5026 4616 4539 4500 4484 4322 2789 2428 2197 2092 1671 1662 1440 1099 894 595 367 335 148 140 25896 1895 37036 6915 672 14249
NM_144578chr14235411 5398 5327 5266 5241 4664 4505 4484 4130 4071 3619 3562 3527 3483 3426 2181 2100 1973 775 578 520 508 390 14031 130 21454 460
NM_144579chr262961 2394 2239 2131 331 169 ------
NM_144591chr101181 --1173 --
NM_144596chr141532 ------
NM_144599chr15115427 5204 4642 4367 4013 3560 2209 567 382 300 246 ------
NM_144604chr16384 65 30 --158 --
NM_144611chr171475 ----1538
NM_144629chr261203 1184 1004 961 144 76 21082 862 ----
NM_144632chr2122396 2349 2036 1963 1855 1710 1674 1526 1490 430 132 54 --22055 66 --
NM_144633chr341197 1000 246 204 --11450 --
NM_144642chr341330 544 295 252 --1265 1367
NM_144664chr1192612 2566 2130 1959 882 582 471 155 133 --22560 738 22405 1685
NM_144703chr202321 283 1357 21032 101 --
NM_144718chr372479 2044 495 454 384 292 254 1218 ----
NM_144721chr4112803 2645 2278 2160 1857 859 825 812 418 407 105 11897 22506 745 1657
NM_144723chr54732 158 48 26 ------
NM_144726chr54986 965 846 191 31090 325 28 2919 774 --
NM_144778chr1392453 2308 2202 1832 1073 814 795 704 277 12084 ----
NM_144963chr8142220 2173 2083 2069 2021 1676 1072 970 787 707 388 375 266 30 2923 821 ----
NM_144982chr124803 776 759 292 ------
NM_145000chr53240 167 152 ----1176
NM_145013chr1162913 2857 2819 2536 2188 2061 --12332 12385
NM_145049chr51358 --1350 --
NM_145117chr11133136 3106 3034 2946 2858 2600 2569 2553 1255 860 654 546 231 12665 12638 13085
NM_145178chr105583 504 371 360 211 ------
NM_145206chr1052784 2756 2215 1147 581 32417 1341 669 ----
NM_145235chr10------1135
NM_145257chr1134066 3691 3641 3548 3458 2764 2667 1664 1207 1129 1013 780 538 21495 156 13087 13940
NM_145284chrX72280 2189 2165 2018 711 525 167 31612 299 77 1214 --
NM_145290chr4--1125 1237 --
NM_145291chr41363 --1390 --
NM_145296chr19----1889 --
NM_145307chr10154484 4386 4334 4261 4138 3828 3756 3523 3411 3087 2880 1455 1098 757 145 ------
NM_145313chr1081567 1422 1372 1031 608 602 300 214 159 1107 --
NM_145315chr63180 123 84 --1107 --
NM_145349chr1722208 1693 ------
NM_145735chr1392851 2693 2378 2117 1944 1900 1723 335 140 --12169 12190
NM_145808chr7103049 3030 3002 2945 2457 2161 1999 783 620 107 12346 --13012
NM_147128chr771589 1568 1431 1222 1165 587 348 1248 1304 --
NM_147156chr1061515 1424 1133 541 420 380 ------
NM_147166chr72841 232 1719 2861 336 1329
NM_147190chr12----1165 1147
NM_148894chr441221 479 419 223 11188 ----
NM_152261chr1232054 1990 883 --12019 --
NM_152265chr171573 1321 567 408 165 148 117 11206 1172 --
NM_152280chr1113013 2985 2660 2209 2196 1392 1115 792 228 199 95 ----12542
NM_152292chr492254 740 692 641 299 289 190 167 84 ------
NM_152380chr111313 11021 --11338
NM_152387chr251065 1038 982 192 76 31076 894 742 1317 --
NM_152400chr4122048 1970 1862 1784 1756 1727 1585 822 718 704 673 72 22027 195 ----
NM_152414chr831209 275 77 21686 509 ----
NM_152422chr981233 614 349 270 226 190 104 89 2529 111 1311 --
NM_152431chr112356 57 1317 1388 --
NM_152433chr1141572 1476 689 550 11629 11233 1269
NM_152448chr152536 178 1465 1158 --
NM_152470chr1853985 3892 2949 652 77 --23957 124 --
NM_152493chr111195 ----1237
NM_152525chr2----1164 --
NM_152556chr771948 1837 1689 758 752 502 231 21926 894 22556 2351 1391
NM_152581chrX41333 512 361 297 1521 ----
NM_152588chr1291760 1347 1327 1314 741 529 317 309 33 --1156 --
NM_152594chr1552337 2319 1678 1545 302 1621 12305 --
NM_152608chr182177 2116 2038 1985 982 965 426 240 ------
NM_152622chr5123481 3466 2392 2269 2127 1394 1258 1237 1229 1132 495 165 13098 1951 --
NM_152624chr5206868 6398 6256 6187 6119 6080 5695 5418 4592 2542 2458 1907 1709 1468 1156 1112 755 474 278 129 36658 2957 667 1485 15672
NM_152630chrX51555 1436 1010 554 203 130 1990 --
NM_152641chr1242898 1154 955 409 11909 1914 --
NM_152660chr11270 ------
NM_152665chr141279 1242 875 29 189 1467 --
NM_152667chr2061247 1117 600 566 553 514 2524 135 ----
NM_152688chr61382 1356 ----
NM_152716chr1151633 1278 1021 274 251 --11340 --
NM_152731chr62770 66 --1975 --
NM_152753chr61301 ------
NM_152756chr5163850 3786 3345 3289 3278 3262 3107 2810 1526 1381 897 830 805 742 511 309 --23777 662 --
NM_152758chr872954 2188 1187 1164 735 221 121 32502 999 768 ----
NM_152787chrX153895 3459 3162 3151 3113 2928 2841 2778 2759 1280 1025 986 758 132 100 43706 1208 351 40 32814 1456 860 13871
NM_152793chr7144731 3865 3858 3774 3601 1819 1472 944 789 691 544 432 421 175 22001 867 31596 269 81 1252
NM_152835chr182637 2576 962 946 914 648 390 146 --31068 1018 450 --
NM_152896chr91275 --1536 --
NM_152902chr121773 1486 11834 22004 426 --
NM_153029chr1673557 3437 1635 1234 965 238 214 --13992 14005
NM_153183chrX21262 378 134 ----
NM_153184chr352011 1935 1455 507 351 --21356 1246 --
NM_153208chr162222 202 ----1794
NM_153261chr1681615 1582 1561 577 390 220 187 180 11342 ----
NM_153354chr52798 716 ----1998
NM_153365chr4112431 2311 2244 2169 2139 1873 1784 1706 815 761 308 --1587 --
NM_153371chr13142320 2296 2218 2160 2082 2003 1991 1910 1675 771 641 476 455 447 42133 1938 1928 1682 ----
NM_153377chr123385 356 330 ------
NM_153442chr1065917 5057 5018 2218 2147 1469 1253 34804 3890 2234 --
NM_153607chr5143128 2894 2844 2677 2615 2609 2437 1936 1218 1119 640 612 368 180 33193 2501 1252 22657 289 --
NM_153610chr5143 --1580 --
NM_153646chr143907 648 305 ------
NM_153686chr482342 2111 1868 1705 1596 902 195 32 22222 209 --1138
NM_153689chr262277 1799 832 531 373 50 1394 1458 --
NM_153702chr4----136 --
NM_153705chr1172471 2160 2144 950 707 451 42 --12623 --
NM_153757chr441067 876 787 481 ----2329 197
NM_153810chr10175094 5037 4613 4124 3983 3877 3725 3685 3224 3209 1769 1596 1268 1254 1022 906 610 1213 2619 392 --
NM_153812chr142327 2231 2028 1579 22351 1869 12010 --
NM_170606chr751498 1209 756 242 73 ----11476
NM_171998chrX72460 2249 2158 1740 1602 1562 979 --22471 1837 11692
NM_172069chr282351 1792 1598 810 768 520 439 248 12198 11591 1758
NM_172070chr282068 1657 1619 578 356 235 93 35 21929 1823 1690 --
NM_172071chr1227250 6873 6859 6742 6722 6669 6477 6467 6311 5773 5116 4956 4908 4711 4594 2065 1400 1126 728 384 285 190 1716 47291 4974 2540 2454 12632
NM_172127chr451910 1810 1434 845 701 ----12039
NM_172373chr13111349 1331 1161 1075 1066 911 442 276 218 104 47 2966 132 ----
NM_173075chr441569 1296 1210 103 11217 1416 --
NM_173354chr2121912 1780 1182 ----
NM_173468chr4155924 5400 5388 5382 5066 4577 4528 4215 3978 2393 2103 1484 1192 74 64 54471 3941 1914 874 550 25319 728 24879 4822
NM_173469chr1581545 1489 1205 1133 1110 1015 480 183 21186 75 21272 175 --
NM_173475chr1651607 191 178 169 106 --21766 73 --
NM_173497chr1021267 177 ------
NM_173500chr1551051 986 538 271 73 ------
NM_173511chr2103790 3688 3572 2433 1568 1204 1157 722 548 449 13617 33844 3743 3108 --
NM_173515chr61985 1933 --1808
NM_173517chr73188 107 56 ------
NM_173536chr4135116 3901 3778 3561 1970 1900 1809 1766 740 696 657 617 335 24377 278 15030 13208
NM_173552chr382517 2265 1947 1870 771 428 368 212 3831 482 391 12274 --
NM_173554chr102272 125 --1228 --
NM_173557chr182626 562 ----1521
NM_173570chr331946 735 258 11934 12090 --
NM_173576chr1092289 2151 1731 1597 1573 1501 1426 1415 181 ------
NM_173582chr11166261 6205 4903 4231 4089 4004 3992 3864 2170 2141 2069 1533 1230 1012 683 451 13817 45131 4113 1624 1273 15909
NM_173602chr1293634 3341 3218 2786 1274 507 394 312 268 33449 646 218 --1540
NM_173625chr171648 --1890 --
NM_173631chr1941231 1182 365 197 --11302 11211
NM_173648chr24993 939 716 132 ------
NM_173653chr321398 1259 1479 1422 --
NM_173685chr81153 1226 ----
NM_173698chrX81695 1422 1326 1319 1278 591 435 138 2261 70 1771 --
NM_173794chrX----1148 --
NM_173797chr551312 1306 1202 354 266 ------
NM_173822chr271858 1582 707 558 518 490 143 11709 1852 --
NM_173827chr473103 2955 2924 2101 1296 973 580 --1183 --
NM_173851chr8103661 3571 3504 3262 2633 2456 1446 1052 876 126 23074 1276 1590 --
NM_173854chr152279 1553 794 479 38 ----1115
NM_174900chr431273 237 180 1371 2466 150 --
NM_174916chr1562032 744 715 350 321 271 --12240 --
NM_175061chr762005 817 668 208 175 142 41409 848 219 53 1689 11540
NM_175607chr341404 1335 625 180 1589 ----
NM_175736chr12137254 7246 7018 6724 5909 5105 2967 2477 1696 1513 1354 894 800 15945 1202 --
NM_175839chr201278 --1286 --
NM_175852chr152685 2621 1012 145 138 13050 1176 --
NM_175854chr1372651 2582 2311 1112 844 377 365 ------
NM_175861chr12155941 5874 5865 5655 5614 4439 4138 3642 2367 1439 1370 880 812 338 249 34648 4519 2068 23968 135 --
NM_175873chr551103 559 534 511 114 --11515 --
NM_176806chr52973 393 1168 ----
NM_177538chr2238797 8790 8198 8073 7743 7718 7684 6401 5955 3505 2685 2585 2393 2201 2171 1537 1238 827 329 254 233 207 128 16112 97070 6546 5381 2725 1885 692 555 419 97 --
NM_178011chr1092949 2617 2403 2030 1997 1118 896 377 39 12523 22969 186 --
NM_178126chr1732029 1464 260 ------
NM_178140chr562702 2609 2381 1846 704 448 --1438 --
NM_178313chr261712 1679 1558 1536 610 226 --22213 1612 21948 586
NM_178439chr23506 363 218 ----167
NM_178539chr12101961 1895 1745 1618 1566 1484 1399 754 738 347 11777 ----
NM_178554chr333649 3073 1024 ----12482
NM_178565chr81394 21417 175 1640 --
NM_178815chr1072792 2167 2109 1687 1003 927 51 22510 728 1965 --
NM_181077chr15102104 2043 1826 1758 1532 1514 911 582 506 219 ------
NM_181291chr142551 197 ------
NM_181354chr841338 1225 283 147 ----1262
NM_181358chr174095 3997 3917 950 473 330 245 23886 3723 1395 --
NM_181504chr594066 3541 3379 3183 2724 1656 1622 1337 931 --32741 561 506 11410
NM_181571chr102944 329 ------
NM_181670chr1231445 1271 308 ----11312
NM_181672chrX61900 1825 608 515 373 222 11574 1322 --
NM_181701chr942368 1678 341 196 --12338 --
NM_181704chr213931 399 132 --126 11367
NM_181723chr881813 1455 578 420 409 310 254 226 21572 527 --166
NM_181782chr62855 228 --32151 1847 587 --
NM_181836chr5162635 2519 2358 2345 2160 2121 1695 1647 1063 936 783 686 324 288 194 94 22449 297 1206 12039
NM_182485chr4123272 3191 3137 3046 3021 2772 2757 2358 1498 1038 598 574 12661 22903 967 1517
NM_182488chr134651 291 55 27 1322 1125 --
NM_182492chr221271 ------
NM_182501chr263295 3085 2255 2085 587 456 ------
NM_182557chr1141510 596 468 201 12181 22103 1891 --
NM_182691chr771328 562 502 307 288 221 123 1129 1151 --
NM_182700chr761941 1928 1767 1541 1371 164 ------
NM_182757chr663308 2983 1311 1117 265 233 43329 2900 127 102 ----
NM_182760chr32909 228 2958 74 1603 --
NM_182765chr1052136 2098 1891 939 260 1586 21645 1516 196
NM_183376chr1582592 2467 2253 1907 1838 1605 732 403 12413 --12399
NM_183416chr141476 580 481 208 11538 11718 1743
NM_194071chr7115397 4578 4241 3800 3437 3400 1438 1286 1243 655 42 --21150 348 --
NM_194247chr2134334 4057 3886 3570 3496 2981 2821 1075 760 514 503 416 289 24526 76 23174 1182 --
NM_194282chr4103091 3067 2425 2400 2316 1889 1108 703 344 173 32786 2550 1980 52647 2520 1898 543 464 --
NM_194285chr11103388 3072 3019 2577 2567 2173 1139 944 777 87 3898 553 332 12739 11045
NM_194291chr872874 2419 2237 1127 463 353 244 22903 2594 22499 199 12954
NM_194292chr191733 1424 1386 1089 403 395 213 130 22 11727 --11766
NM_194314chr1145536 5450 4127 3907 2141 2099 1589 1443 1256 1092 965 910 805 209 35643 3849 2121 ----
NM_194317chr232727 2264 1847 ----1181
NM_194449chr183857 818 184 ----1847
NM_198066chr1462762 2585 2423 1221 158 72 1960 ----
NM_198074chr121021 863 1337 21153 980 --
NM_198243chr156959 944 735 703 257 126 1844 ----
NM_198270chrX93397 3211 3022 3006 2646 2169 2147 743 591 --13272 --
NM_198273chr562918 2479 1923 994 761 272 23149 1943 --1142
NM_198279chrX51091 997 850 798 273 --2822 467 --
NM_198353chr4--128 1329 --
NM_198396chr171374 --1344 --
NM_198402chr31278 ------
NM_198459chr161011 852 824 694 284 226 --1740 --
NM_198463chr31276 --1137 --
NM_198465chrX93003 2497 2313 1879 1018 988 623 235 126 ------
NM_198503chr142120 1652 673 549 11714 12386 1150
NM_198513chr871980 1854 1486 760 564 445 310 1793 ----
NM_198549chr182870 2434 2261 2086 432 365 344 63 12653 23088 827 --
NM_198566chr51162 1138 ----
NM_198570chr72129 43 ------
NM_198581chr2197391 7305 6729 6112 5889 2873 2320 2291 2212 1911 1719 1650 839 534 489 380 336 243 110 21235 398 37031 5170 650 --
NM_198834chr1721807 122 --12295 --
NM_198859chr3144927 4844 4413 3874 3323 3261 3121 1715 1395 682 458 339 315 86 11425 35093 3913 210 11418
NM_198935chr2093107 3014 2631 2505 2307 2205 397 295 205 1823 22403 307 --
NM_198990chr7193137 2959 2930 2546 2475 2322 2193 2149 2108 1263 1054 973 849 522 368 359 343 287 45 12382 --22702 2349
NM_198991chr182632 600 ------
NM_199003chr861495 1243 1067 997 552 479 1262 ----
NM_199044chr122589 1225 12124 23039 2216 --
NM_199054chr1932100 2026 1385 ------
NM_199072chr793123 2825 2537 2178 2138 1296 1226 195 152 22796 380 2456 328 1247
NM_199320chr452363 2298 2089 163 152 12655 12955 11810
NM_199420chr32808 231 --1321 --
NM_203301chr1421398 565 1449 --1559
NM_203349chr1592224 1903 1452 523 506 378 252 218 77 --21600 47 --
NM_203364chr114841 367 318 305 21111 799 ----
NM_203371chr1171798 1738 1378 741 678 482 181 11326 --1125
NM_203390chr8101800 1757 1621 1397 1352 1162 425 346 335 269 ------
NM_203403chr931027 797 333 1123 ----
NM_203406chr5102957 2766 2534 2435 2297 2108 600 379 285 211 125 ----
NM_203459chr192372 2101 1851 1709 1052 999 841 693 161 ----1871
NM_203463chr2104671 4141 3790 3759 3444 3372 3067 1071 1010 405 31963 776 636 --2492 131
NM_206853chr6154041 3967 3712 3664 3428 3361 3328 3234 3198 3137 1597 1285 1254 725 118 43820 3399 2682 1109 14094 1674
NM_206854chr6175302 5228 4973 4925 4689 4622 4589 4495 4459 4398 1986 1379 981 695 671 476 112 45081 4660 3943 173 25355 3599 11935
NM_207015chr331667 1482 786 1698 22096 168 1500
NM_207351chr3----2526 132 --
NM_207371chr1031349 287 147 ----1126
NM_207381chr153483 451 25 --11235 --
NM_207517chr1551895 1776 1493 491 443 12013 21850 1487 --
NM_207577chr1132734 2458 2363 21061 390 --12344
NM_212464chr1532034 1712 199 11437 --12069
NM_212558chr9174083 4063 3674 3604 3448 2951 2904 2898 2711 1692 1390 1363 1339 1158 809 669 177 13190 ----
NM_213589chr2145285 5167 5135 4942 4933 4857 4776 3927 3906 3637 1082 1068 588 284 24479 3579 --1878
NM_213609chr34872 674 429 289 1333 --2111 54