TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-521
miRNA Sequence: AACGCACUUCCCUUUAGAGUGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000084chrX15743 1575 35815 1125 117 --
NM_000125chr623699 909 --13880 --
NM_000138chr15--1210 1589 --
NM_000176chr513303 --13555 --
NM_000192chr1211465 --21472 1444 21153 372
NM_000220chr11----11075 --
NM_000280chr11----1636 --
NM_000362chr2222250 507 --13624 --
NM_000368chr923478 3021 1784 1238 --
NM_000430chr1732910 2724 454 11151 23280 850 --
NM_000461chr353991 3239 3019 2995 2852 13820 14005 --
NM_000615chr1112708 12639 1556 --
NM_000617chr12--11942 22089 47 --
NM_000725chr121237 --1971 --
NM_000813chr515071 13958 --15610
NM_000814chr1533821 3742 636 --14011 1753
NM_000827chr5----31634 367 357 --
NM_000875chr1555761 5749 5521 2557 2534 24276 2543 11385 --
NM_000876chr6----11018 --
NM_001001323chr12------12643
NM_001001396chr11747 --24225 402 --
NM_001001484chr1012209 12067 11676 --
NM_001001664chr262993 2956 2946 2924 2796 1481 12935 11528 --
NM_001002243chr2------1926
NM_001002296chr8----11343 --
NM_001004065chr964001 2823 1323 1288 1262 1250 21334 1275 11168 --
NM_001004342chr145122 5100 1596 225 ------
NM_001005209chr22280 264 1273 1253 --
NM_001005404chr1763551 1756 1541 1286 995 706 13570 13062 --
NM_001005476chr2----1124 --
NM_001005505chr321788 1489 --11400 --
NM_001006600chr511940 ------
NM_001008391chr11----1482 --
NM_001008407chr721372 1313 ----1426
NM_001010861chr1----1515 --
NM_001012761chr522679 301 --12604 22688 2109
NM_001013415chr4----11014 --
NM_001014809chr43694 173 167 ------
NM_001014812chr15----1108 --
NM_001017395chr323475 952 ----13491
NM_001017424chr111619 ----1614
NM_001018067chr133792 3780 968 --11826 1334
NM_001024401chr1642490 1116 887 64 22483 2475 1658 12467
NM_001025076chr1015604 16119 22285 1126 --
NM_001031732chr42705 63 --1294 --
NM_001031812chr521910 654 12043 11447 12116
NM_001032283chr12----1830 --
NM_001032288chr2021631 495 ------
NM_001033507chr12498 401 ----1414
NM_001037164chr711964 1681 ----
NM_001037332chr512295 --1242 --
NM_001039350chr731659 1251 128 --1474 --
NM_001039675chr15------1369
NM_001040101chr411254 ----11138
NM_001040152chr711684 ----13695
NM_001040214chr622173 668 --1714 --
NM_001040402chr413115 ------
NM_001040429chr1321219 337 ----11071
NM_001040712chr9--13108 1945 --
NM_001042406chr6----1409 --
NM_001042486chr2021021 58 21097 1064 11073 --
NM_001042517chr13----1318 --
NM_001042555chr1244379 4238 3668 596 13256 13251 --
NM_001042646chr31161 --31962 1406 346 --
NM_001100108chr158158 7796 7678 5418 1770 18052 1110 --
NM_001121chr10----11491 --
NM_001157chr101158 --1500 --
NM_001204chr247769 7550 7425 5893 1272 ----
NM_001356chrX32182 1948 1616 ------
NM_001364chr11----14670 1536
NM_001386chr812139 ----12324
NM_001390chr1853614 3539 2632 1106 255 --13082 --
NM_001396chr2121019 33 ------
NM_001419chr1934557 1653 424 --14167 --
NM_001426chr2----1563 --
NM_001444chr8----1156 --
NM_001616chr21503 --11062 --
NM_001679chr32683 108 ------
NM_001706chr3------1730
NM_001755chr1612280 --11681 --
NM_001792chr18----11041 --
NM_001854chr11939 --1365 --
NM_001946chr122145 88 --11031 --
NM_001949chr632538 2221 582 12927 22908 2619 --
NM_002025chrX59245 8287 8174 7896 3048 --18253 --
NM_002070chr3----1676 --
NM_002094chr161379 --1388 --
NM_002103chr19----11119 --
NM_002126chr1763959 3943 205 199 181 147 13952 23917 701 --
NM_002139chrX----1635 --
NM_002158chr2----1829 --
NM_002166chr2----1633 --
NM_002214chr734366 856 594 ----1577
NM_002254chr282125 1952 1936 113 107 97 91 84 21929 1665 ----
NM_002265chr17181 ------
NM_002268chr32219 60 165 1461 --
NM_002270chr532123 2052 1217 11154 ----
NM_002360chr772613 2243 923 639 518 458 255 ------
NM_002397chr521683 102 --144 --
NM_002401chr1742285 1944 776 269 --11647 --
NM_002408chr14----1558 --
NM_002504chr911025 --1148 --
NM_002537chr15----11094 --
NM_002628chr3----1848 --
NM_002655chr81949 15101 23842 2086 --
NM_002718chr3------1113
NM_002737chr1756401 4821 4729 4433 1758 21852 1544 --26684 781
NM_002815chr17----134 --
NM_002834chr1213065 --23537 2962 --
NM_002840chr111102 ------
NM_002846chr21570 --1586 --
NM_002869chr1121518 75 --12184 --
NM_002874chr9------1214
NM_002971chr3------1269
NM_003016chr17----1575 --
NM_003043chr32179 150 24146 171 ----
NM_003074chr32813 222 --12206 --
NM_003107chr61730 12371 ----
NM_003108chr236963 2311 1995 --17061 16779
NM_003112chr7------22961 616
NM_003131chr642145 2135 2055 2020 --22163 902 12184
NM_003144chr62226 116 2804 235 ----
NM_003178chr341640 835 460 284 ----11891
NM_003201chr101806 --1413 --
NM_003205chr15----1266 --
NM_003216chr2253262 2138 1005 623 447 --23280 3118 --
NM_003222chr2011147 11229 21160 858 1478
NM_003274chr211399 --21128 918 --
NM_003298chr375406 4014 1319 1032 1019 998 667 1354 14094 --
NM_003304chr311153 ----1164
NM_003339chr52593 335 --1223 --
NM_003378chr7----1340 --
NM_003405chr221711 --1236 --
NM_003406chr8----11276 --
NM_003409chr18------11048
NM_003410chrX--1894 1173 --
NM_003463chr631354 1238 967 13154 1938 --
NM_003469chr21454 --172 --
NM_003472chr61442 --21084 462 --
NM_003478chr111853 --1833 --
NM_003483chr1222320 2079 1445 ----
NM_003586chr16----168 --
NM_003592chr7----1404 --
NM_003664chr5------1157
NM_003722chr3------11746
NM_003749chr132638 532 ------
NM_003768chr131839 342 139 ------
NM_003771chr17----1218 --
NM_003787chr1811164 --1239 --
NM_003797chr11----132 --
NM_003800chr612411 --1703 12420
NM_003850chr13----195 --
NM_003861chr142955 265 11783 22018 1765 --
NM_003873chr10----2556 100 --
NM_003885chr1722072 1998 11820 12581 --
NM_003916chrX----11268 --
NM_003939chr1023757 1026 22837 1074 14130 --
NM_003948chr421662 419 ----1355
NM_004086chr14----1563 151
NM_004093chr1322597 2238 12222 12215 --
NM_004130chr3----1641 --
NM_004136chr15----1228 --
NM_004229chrX11967 1558 1201 --
NM_004232chr1821088 871 13746 --23900 3555
NM_004430chr83572 534 522 1527 2546 506 --
NM_004438chr242808 2399 2160 1171 --12996 --
NM_004501chr11872 --11141 --
NM_004529chr9----11048 --
NM_004571chr2142878 2611 470 437 --1165 --
NM_004603chr72247 193 ------
NM_004667chr15186 ----1271
NM_004668chr72751 80 --1303 --
NM_004685chr13----11894 --
NM_004719chr121274 --12307 22885 2744
NM_004739chr11----1125 --
NM_004788chr11--12128 1832 12003
NM_004824chr6------11320
NM_004836chr2----1940 --
NM_004850chr211210 --11362 --
NM_004852chr18713849 10227 9954 9461 8819 4233 1053 ------
NM_004902chr202589 164 --1775 --
NM_004947chr342295 1710 901 565 --11597 --
NM_004974chr1------192
NM_004992chrX67549 6630 6620 6502 6113 5296 --35996 2855 2197 --
NM_004993chr1421471 261 ------
NM_005225chr204349 312 268 256 2238 207 1337 --
NM_005312chr932290 2178 1790 11759 11754 --
NM_005339chr413530 --21103 361 --
NM_005384chr9------1261
NM_005400chr2----11014 --
NM_005417chr2061540 1526 1514 1502 1444 1417 11507 ----
NM_005418chr11----1603 --
NM_005430chr12------1679
NM_005491chrX1424 --22178 1783 --
NM_005499chr19----1221 --
NM_005547chr1------1292
NM_005573chr51282 ------
NM_005587chr152225 165 ----1152
NM_005596chr945945 5259 1996 1382 ----1686
NM_005721chr21357 ----1317
NM_005730chr1242479 914 251 221 --22738 241 --
NM_005736chr1021515 94 --2120 102 --
NM_005822chr61359 ------
NM_005828chr17--23980 278 1459 --
NM_005938chrX----31407 1116 874 --
NM_006010chr3----1215 --
NM_006017chr41389 ------
NM_006054chr1121590 441 11577 ----
NM_006154chr15----1583 --
NM_006251chr5----23152 2575 --
NM_006283chr821082 211 --24784 4690 --
NM_006372chr6----1355 --
NM_006375chrX11229 ------
NM_006420chr2012896 --1463 --
NM_006559chr1------1241
NM_006570chr9----1108 --
NM_006618chr1----1622 --
NM_006717chr922567 981 1418 ----
NM_006765chr8----1293 --
NM_006772chr611506 --11736 --
NM_006813chr62749 663 124 1303 --
NM_006814chr2011062 --1219 --
NM_006888chr1411317 --23287 1292 --
NM_006981chr922816 1169 --12944 --
NM_007011chr1544931 1152 886 504 --22422 1391 --
NM_007137chrX34522 866 259 --11713 --
NM_007191chr12------1269
NM_007218chr81303 1836 --187
NM_007347chr1522680 118 ----1275
NM_012081chr51668 --22527 749 --
NM_012089chr111419 ----1134
NM_012129chr712503 ----1360
NM_012193chr1164201 4069 3632 1311 1028 531 11255 ----
NM_012262chr1------1455
NM_012300chr52982 969 11749 21744 851 --
NM_012309chr1113187 --14730 --
NM_012325chr20--11403 11169 --
NM_012476chr22190 178 --1197 --
NM_013231chr14161 --24283 4183 --
NM_013246chr111253 --1870 --
NM_013261chr44336 329 313 292 1318 11313 --
NM_013390chr911681 --21627 1345 --
NM_013444chrX----11113 --
NM_013446chr71269 --1176 --
NM_013449chr1231042 1003 950 --1480 --
NM_013995chrX21639 428 --1944 --
NM_014112chr821690 821 ------
NM_014181chr212167 ----12548
NM_014223chr12669 307 1482 1245 --
NM_014232chr172125 109 11307 11097 --
NM_014361chr11----1336 --
NM_014390chr7----2459 125 --
NM_014454chr6------1712
NM_014517chr3----156 --
NM_014646chr18----22345 988 --
NM_014667chr342337 596 441 398 32362 1816 450 ----
NM_014682chr8----1382 --
NM_014767chr1093508 3502 2406 1153 213 180 149 135 129 1206 ----
NM_014787chr11933 --151 --
NM_014810chr123510 1042 13464 1937 13080
NM_014869chr331165 921 170 --11012 --
NM_014872chr921737 1572 ----1702
NM_014931chr191686 ------
NM_014936chr622897 790 12363 1782 12877
NM_014982chr1425282 3923 13934 15294 21186 724
NM_015032chr13----21029 761 12455
NM_015033chr943170 2287 2125 472 ------
NM_015101chr142717 1995 455 137 --12117 --
NM_015138chr1532612 601 222 1608 1615 1594
NM_015191chr1131785 1037 375 ----12682
NM_015192chr201737 ----12348
NM_015205chr1374776 3197 1954 1489 928 738 591 ------
NM_015265chr2--1404 1399 --
NM_015310chr81918 --15602 --
NM_015338chr2021551 609 --139 --
NM_015339chr20159 --1863 --
NM_015375chr131599 1507 1030 11013 1591 14786
NM_015378chr1----22941 318 --
NM_015382chr14----1622 --
NM_015435chr82250 154 ----11453
NM_015446chr151262 1256 1245 1164 54 ----11078
NM_015483chr74931 908 377 336 ------
NM_015497chr15----1282 --
NM_015545chr71249 --1558 --
NM_015570chr711267 --11275 --
NM_015607chr1----1153 --
NM_015852chr753579 2342 562 478 58 --23162 2271 --
NM_015891chr6------12033
NM_015999chr1----1552 --
NM_016035chr9----1403 --
NM_016037chr1----1272 --
NM_016061chr2----1328 1197
NM_016083chr631099 1076 1069 32422 1507 1092 12446 --
NM_016120chrX------1854
NM_016200chr72320 224 --187 --
NM_016206chr3----18065 --
NM_016248chr1321372 684 31389 1377 723 1232 --
NM_016275chr32602 267 1595 ----
NM_016338chr5--1471 ----
NM_016353chr81644 ------
NM_016372chr3------1408
NM_016374chr11228 --11411 --
NM_016376chr1713735 11588 32992 1538 184 --
NM_016605chr542692 2501 452 251 12466 1418 --
NM_017415chr543629 1109 370 163 1321 1300 --
NM_017590chr2242320 2127 1906 863 1172 --11832
NM_017633chr642998 1144 1038 716 32811 1043 1022 13473 --
NM_017635chr1111044 --1652 --
NM_017670chr111165 ------
NM_017715chr71197 --2699 617 --
NM_017740chr1681719 1627 1218 632 622 608 592 211 --11798 --
NM_017742chr182262 38 ----1590
NM_017745chrX----129 1500
NM_017798chr202884 847 --182 --
NM_017848chrX43160 1576 890 838 41038 1026 1018 938 24421 1013 --
NM_017902chr10114708 4576 1803 1728 1526 1038 952 912 865 853 332 2880 301 21744 263 --
NM_017969chr2----191 --
NM_018086chr21308 --1278 --
NM_018092chr16--138 1527 --
NM_018094chrX1371 --1357 --
NM_018098chr31966 --1770 --
NM_018121chr1033184 2355 936 12477 ----
NM_018222chr1131365 688 360 ------
NM_018364chr1----14044 --
NM_018387chr9------1531
NM_018482chr81145 --12373 178
NM_018490chr1111285 --11642 --
NM_018686chr122258 103 ----1309
NM_018700chr511189 ----1557
NM_018834chr5------1778
NM_018994chr1------158
NM_019006chr151574 1668 1548 --
NM_019049chr1------1216
NM_019116chr1613266 --1299 --
NM_019610chr1----1644 --
NM_019843chr22----1506 --
NM_020066chr1------1886
NM_020116chr4------11555
NM_020156chr7----1176 --
NM_020182chr2042428 1459 1181 306 ----1547
NM_020354chr101290 --1775 --
NM_020433chr201355 ------
NM_020702chr91459 ------
NM_020718chr1644218 1570 147 123 --11231 22029 376
NM_020810chr1412545 --23289 2871 --
NM_020951chr1942394 885 742 490 1717 1727 1878
NM_021033chr1323138 1010 ------
NM_021202chr2022213 771 13036 ----
NM_021637chrX2338 309 --170 --
NM_021813chr675113 4910 4445 3867 3858 3644 2249 --14544 --
NM_021960chr1----12765 --
NM_021964chr335262 4884 1983 --1481 --
NM_022369chr15----1586 --
NM_022459chr1335507 1955 1323 --11078 --
NM_022726chr6------11684
NM_022728chr7----1124 --
NM_022776chr3----11354 --
NM_022781chr92567 245 2532 491 22025 452 12503
NM_023010chrX----1714 --
NM_024052chr17--11243 21214 95 --
NM_024490chr15----1243 --
NM_024595chr1--1358 2345 333 --
NM_024670chr10----11085 --
NM_024721chr81525 1958 22194 2126 --
NM_024989chr226776 5142 17976 28061 5707 --
NM_025054chr82782 681 --1150 --
NM_025126chr12----1655 --
NM_025146chr321024 806 --1420 12088
NM_025219chr2021581 771 ----1173
NM_025248chr1772703 2579 2547 2526 2388 2359 135 --32834 2683 2645 --
NM_030627chr512790 12779 12853 --
NM_030647chr735935 5924 2318 21217 100 1472 --
NM_030648chr414360 13989 15488 1638
NM_030753chr171222 --133 --
NM_030940chr911104 --1129 --
NM_031426chr932771 2752 2452 ------
NM_032160chr1831480 1248 1150 --192 --
NM_032199chr1043289 3241 2877 732 11442 12620 --
NM_032217chr4------1116
NM_032229chr13----185 --
NM_032289chr521355 366 --11578 --
NM_032446chr533556 3258 3225 ----1876
NM_032505chr312353 --12160 --
NM_032521chr2012054 ------
NM_032790chr121364 ----1355
NM_032859chr1332686 1175 216 --23697 75 --
NM_032873chr1132813 368 54 --23349 42 --
NM_032961chr4----1248 --
NM_033081chr2011008 --11362 --
NM_033211chr5----1673 --
NM_033222chr9----1282 --
NM_033224chr724948 1078 ----17472
NM_033259chr3----1920 --
NM_033315chr171817 --12148 --
NM_033360chr1214465 ----1112
NM_052845chr1233066 564 340 --1628 --
NM_052874chr165710 585 294 283 277 ------
NM_052876chr1922208 1093 --1760 --
NM_052879chr121942 ----1538
NM_053281chrX----1326 --
NM_078476chr631896 1513 274 --158 --
NM_101395chr212701 53 --12201 --
NM_138333chr9----1226 --
NM_138357chr1011726 ------
NM_138459chr6--11116 1161 --
NM_138473chr1243259 1845 1697 1678 11728 ----
NM_139072chr2----1244 --
NM_144571chr416759 12465 --16006
NM_145284chrX1627 ----12556
NM_145313chr10----11363 --
NM_152380chr1----1325 --
NM_152556chr722531 2062 ----1640
NM_152663chr1----1301 --
NM_152721chr181572 1599 ----
NM_152765chr8----2919 361 --
NM_153607chr5----12300 --
NM_173156chr161884 1544 1522 1462 743 152 ----1537
NM_173495chrX----12296 --
NM_175061chr7----1870 --
NM_175854chr13----12711 --
NM_177966chr3------11413
NM_178450chr5----1765 --
NM_178505chr1011212 11232 13669 --
NM_181358chr123611 1562 --23073 1586 11371
NM_181672chrX1291 ------
NM_181704chr2131442 324 192 11384 1370 --
NM_181784chr211746 ----12274
NM_182935chr321551 208 22202 1594 ----
NM_194247chr244468 4284 648 635 13052 1793 --
NM_194282chr411956 ------
NM_197941chr531171 1128 977 --11156 --
NM_198270chrX12430 ----13497
NM_198465chrX32392 882 415 ----11852
NM_198560chr343482 2497 1256 1228 --13726 --
NM_203301chr1431574 327 74 --11594 --
NM_203365chr2----189 --
NM_203458chr133055 1240 754 --11460 --
NM_207647chr9----11946 --