TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-522-3p
miRNA Sequence: AAAAUGGUUCCCUUUAGAGUGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000051chr1183525 3504 2743 2548 882 837 483 111 --2854 646 --
NM_000052chrX53478 3307 3012 938 125 22817 2806 ----
NM_000081chr121582 190 ----11664
NM_000084chrX146946 6175 6133 5870 5835 5581 5035 4738 2718 1844 1671 1628 1531 1404 --46264 2253 2130 1417 --
NM_000092chr2164535 4198 3955 3907 3749 3366 3291 3262 3110 1816 1807 1551 1257 1085 494 93 11145 13359 --
NM_000097chr351116 846 771 363 233 1216 ----
NM_000104chr273086 2628 2565 2217 2158 1053 373 11167 ----
NM_000109chrX92638 1933 1755 1728 917 758 671 630 338 ------
NM_000112chr5115552 5388 4604 4505 4330 2124 1879 1496 812 801 558 13749 11248 --
NM_000115chr1362309 1859 608 486 115 28 21933 1784 ----
NM_000125chr6104281 4152 3567 3300 3023 2930 1490 1334 1226 139 23719 2922 1643 --
NM_000138chr15112606 2465 1862 1827 1669 965 620 611 416 349 133 2404 283 ----
NM_000139chr1162731 2505 2449 2190 207 184 ------
NM_000161chr1451992 1876 1410 772 86 21977 1700 --1736
NM_000163chr562301 2273 1889 1811 1492 576 11946 22203 1463 --
NM_000168chr773094 2644 2213 2200 1173 976 205 --12772 --
NM_000176chr553568 2468 1159 950 562 23904 3837 23396 989 --
NM_000189chr262383 1695 1546 784 590 233 ------
NM_000192chr122636 114 ----11207
NM_000216chrX83549 3486 3254 3068 2669 1622 889 284 13918 1493 --
NM_000217chr1295147 4338 4181 3816 3665 3589 1786 1124 978 44780 4066 1008 131 44529 3301 1018 212 15128
NM_000237chr831209 612 367 ----11190
NM_000248chr392891 2504 2371 2134 945 918 459 308 185 --1887 1543
NM_000252chrX31122 1061 58 11144 --11220
NM_000259chr1545733 2302 603 539 15907 35725 4082 1629 --
NM_000264chr973278 2880 2856 2586 2259 910 849 11145 ----
NM_000267chr1763452 3424 3397 2521 2131 354 1422 --13234
NM_000280chr113956 246 222 1733 1854 --
NM_000297chr431856 1341 353 11503 --178
NM_000321chr1341790 1545 1538 575 31472 1101 231 31765 1602 1491 --
NM_000332chr6147005 6983 6692 6619 5735 5505 4497 4441 2752 2700 1701 1669 1480 730 25691 2199 32241 1989 43 22551 591
NM_000337chr5106496 6237 5492 2209 2178 1610 1140 340 269 74 24425 2527 ----
NM_000340chr341198 1187 603 381 21076 474 1321 --
NM_000362chr2262572 1169 1108 336 301 215 --2962 464 22786 2443
NM_000391chr1151678 1154 644 577 100 11711 21176 325 1380
NM_000393chr262082 1651 1602 1439 301 53 --11930 1793
NM_000408chr283241 3106 3076 2803 778 743 234 194 ------
NM_000430chr1793796 1454 948 869 795 754 696 388 320 1688 --13153
NM_000441chr762083 1812 1573 1474 803 110 --168 --
NM_000448chr1192965 2844 2098 1240 1193 823 461 438 382 22056 1275 23021 2178 --
NM_000461chr341453 259 181 50 2834 796 1594 --
NM_000489chrX113438 3345 3061 2989 2937 2907 2572 2159 981 711 459 12619 21383 167 12609
NM_000508chr47965 748 382 354 307 251 116 1865 --1679
NM_000555chrX157882 7847 7219 6749 6717 6163 6114 5824 5077 2922 2451 2016 2000 1987 49 27420 2192 37142 4889 1377 --
NM_000599chr283961 3913 3763 1312 865 486 128 91 34481 878 102 --14562
NM_000609chr1052212 2074 2003 644 243 1190 32068 1248 151 --
NM_000610chr1162399 2268 1060 406 50 35 22438 547 12849 1565
NM_000617chr1241610 922 241 120 ----12285
NM_000618chr12106520 6383 5896 4923 4605 4281 1802 1029 911 374 24998 2420 22554 711 24747 4589
NM_000618chr12106520 6383 5896 4923 4605 4281 1802 1029 911 374 24998 2420 22554 711 24747 4589
NM_000627chr24935 783 371 314 --1806 --
NM_000633chr18115217 5167 4809 4719 4471 4240 3799 3626 1322 1181 435 23423 203 11873 21736 226
NM_000668chr461291 1155 393 277 255 83 ----11338
NM_000686chrX31216 1174 345 ----1400
NM_000719chr12166644 6503 6426 5680 5464 5364 4859 4722 4112 2601 1978 1571 1317 1013 965 120 24881 1423 31718 993 375 --
NM_000788chr441416 1070 1033 984 --21336 1053 --
NM_000793chr1473751 3430 1664 1517 1250 520 409 13301 34514 3453 1375 --
NM_000800chr541432 1368 1288 85 --21357 355 --
NM_000806chr531287 613 334 21476 135 11382 --
NM_000809chr4148247 8189 7843 6849 6425 6165 5964 5772 5701 3650 3077 2443 2100 1780 79292 5881 5820 5681 3586 3352 120 28972 5918 --
NM_000813chr5215475 5448 5438 5164 5085 4428 4159 3898 3643 2259 2009 1892 1750 1744 1556 1541 1280 707 631 341 143 14036 22143 153 14361
NM_000814chr15114086 3749 3671 3555 3513 3250 2952 2726 2674 1308 976 134 --11459
NM_000824chr45914 770 356 119 37 1729 1864 --
NM_000875chr15176990 6549 6310 6247 6094 6000 5774 5504 5208 5152 5117 4919 4568 2808 2208 1278 678 11845 46524 5986 1828 570 --
NM_000891chr1783604 3573 3194 3103 3070 2688 1093 843 ------
NM_000899chr12114230 3829 3732 3705 3510 2939 1551 1094 939 883 246 41201 1116 672 275 34116 4001 332 13348
NM_000901chr43988 839 599 ----2929 855
NM_000902chr363247 3097 2056 946 785 538 12956 1214 33053 885 574
NM_000910chr421697 93 ----2775 731
NM_000926chr11169075 8969 7945 7476 6389 3329 2850 2743 2599 2589 1959 1668 1328 1176 1112 658 48945 7398 3086 2861 66838 6202 3190 2278 2220 604 12574
NM_000944chr422360 157 1771 --1487
NM_000950chrX93660 3551 3447 2455 1438 1309 1153 183 169 --23593 31 --
NM_000961chr2083985 3968 3144 3126 2886 2672 1602 542 ------
NM_001001323chr1263165 3133 3035 2880 2549 2297 13193 --12329
NM_001001331chr352678 956 834 764 613 12748 --1449
NM_001001344chrX62094 2035 1881 844 749 393 ----1707
NM_001001389chr1162399 2268 1060 406 50 35 22438 547 12849 1565
NM_001001390chr1162399 2268 1060 406 50 35 22438 547 12849 1565
NM_001001391chr1162399 2268 1060 406 50 35 22438 547 12849 1565
NM_001001392chr1172445 2314 1106 452 96 81 59 22484 593 12895 1611
NM_001001395chr1292459 1954 1932 722 698 634 441 360 287 12588 1349 --
NM_001001396chr174159 3813 1432 552 328 322 313 1655 ----
NM_001001419chr584802 4594 4513 3650 3343 1927 1655 822 31739 1632 718 ----
NM_001001420chr584802 4594 4513 3650 3343 1927 1655 822 31739 1632 718 ----
NM_001001433chr2062575 2038 1026 962 619 354 3983 933 703 ----
NM_001001481chr873189 2735 2418 590 399 255 64 1941 43010 2985 2642 935 --
NM_001001484chr1041979 753 636 244 --22335 113 --
NM_001001664chr2103932 3861 2779 2723 2567 1573 1216 1055 559 277 33319 3254 3074 --11298
NM_001001668chr1932906 299 245 1207 23863 1388 --
NM_001001711chr115448 337 330 186 86 --1401 --
NM_001001928chr22157824 7569 7392 6073 5707 5320 3178 2990 2863 2545 2421 1920 1216 979 385 27216 6744 48365 6959 6273 5861 1325
NM_001001971chr1041191 1124 1060 567 --31342 1199 1020 --
NM_001001974chr1051890 1632 1611 1573 1558 1363 31495 528 511 --
NM_001001995chrX71582 1474 1435 708 643 471 214 11885 ----
NM_001002257chr283477 3462 3430 2648 1246 1176 953 115 ------
NM_001002258chr22672 123 11557 --11927
NM_001002296chr851316 1180 563 348 93 2288 129 ----
NM_001002838chrX31699 167 107 --1307 11338
NM_001002860chr1484643 4610 4079 3540 3429 935 581 47 ----13005
NM_001002926chr772286 2277 2067 948 697 683 412 --22367 207 --
NM_001003652chr18138713 8673 7535 7232 6357 6112 5816 5380 5350 2843 2252 1677 751 58523 7732 5394 2825 1313 46158 5405 1630 1046 --
NM_001003674chr18127077 6721 6700 6647 6640 6612 6551 6427 4590 4403 4396 1330 --25376 2431 --
NM_001003675chr18127077 6721 6700 6647 6640 6612 6551 6427 4590 4403 4396 1330 --25376 2431 --
NM_001003681chr2252040 1993 630 621 41 21860 1559 1404 --
NM_001003712chr1283813 3426 3407 3148 2876 2813 406 185 22954 2769 21582 511 12544
NM_001004065chr953724 2700 2564 1282 482 11565 31148 988 823 189
NM_001004346chr441258 1100 129 40 190 ----
NM_001004360chr251980 1836 1759 323 200 11259 --11992
NM_001004419chr1264245 3953 3482 3275 1478 132 44466 4287 538 445 13420 --
NM_001005242chr1261294 1264 1082 415 114 55 ----11033
NM_001005386chr272482 2223 2084 1576 954 290 272 --12069 --
NM_001005463chr1092605 2360 1772 1730 1032 788 283 209 162 --21857 362 --
NM_001005473chr596409 4899 4852 4773 2634 2297 321 201 194 1642 26106 4429 --
NM_001005474chr331290 420 135 1632 177 --
NM_001006600chr531841 1540 730 1903 181 11864
NM_001006605chr12860 825 --31041 247 24 --
NM_001006605chr12860 825 --31041 247 24 --
NM_001007023chr1473751 3430 1664 1517 1250 520 409 13301 34514 3453 1375 --
NM_001007097chr964928 4549 3533 3255 1903 1842 24809 1623 35094 5020 4897 --
NM_001007245chr74525 150 50 38 --124 --
NM_001007257chr141430 1281 1046 1039 1428 ----
NM_001007278chr13105012 4859 4734 4463 4395 4339 3920 3611 2116 2045 12090 25143 4620 13691
NM_001007466chr664507 3944 3911 3658 1799 317 21919 263 14332 --
NM_001007559chr1811370 12055 --1734
NM_001008239chr1893628 3538 3493 3363 3067 2917 2524 1419 1366 --33838 3176 1441 --
NM_001008408chr7146356 5537 5502 5087 4993 4673 4414 4160 2554 1971 1803 1228 1055 665 25448 4537 11196 --
NM_001008495chr862118 1884 1720 1649 892 509 21566 587 21469 161 --
NM_001008564chr133273 59 41 11607 21726 1714 1293
NM_001008738chr542307 1789 1009 581 --1782 12206
NM_001008801chr1951854 1839 828 818 365 11885 11904 --
NM_001008925chr4113245 3104 3055 2682 2405 2369 2331 1423 1343 1094 524 1953 13564 --
NM_001009899chr375940 5389 4803 4476 4282 2370 752 31028 919 884 25871 5013 --
NM_001009909chr1193954 3890 2978 1421 1178 1130 439 299 32 --12756 --
NM_001009959chr242505 2227 2101 585 --32025 358 345 --
NM_001009993chr254322 4190 3892 1668 964 12813 24467 4311 --
NM_001010000chr1832255 1102 450 11259 23396 859 12778
NM_001010853chr652852 2244 2077 1222 234 --2316 287 --
NM_001010861chr141797 602 376 316 ----12254
NM_001010862chrX83182 3142 3084 2989 2925 2549 2399 461 ------
NM_001010888chrX114352 3931 3909 3819 3809 3632 3522 3204 1612 1528 1484 1849 34666 4301 1813 1124
NM_001010891chr5126930 6567 6555 5039 4288 4192 2203 1760 644 468 148 140 36398 2405 1084 46293 6146 5051 4819 --
NM_001011513chr483945 3932 3123 2650 1050 927 851 265 13609 23734 3483 23637 3384
NM_001011666chr7156340 5822 5487 5237 4542 4484 4334 4177 4098 1987 1829 1732 762 616 127 55699 5504 4593 4356 642 35400 4210 2271 14808
NM_001011885chr1531635 1300 390 11163 2606 567 --
NM_001012393chr11104335 4117 3730 3609 2008 1223 736 351 305 226 33714 1029 905 ----
NM_001012418chr6113924 3301 3240 3061 1339 1237 1138 852 528 435 343 34208 3027 639 ----
NM_001012420chr1592675 2662 850 722 690 578 324 149 92 184 22514 311 1496
NM_001012423chr1572675 2662 850 722 690 578 324 184 22514 311 1496
NM_001012751chr1081665 1588 1555 1482 773 511 322 56 1431 21774 1509 --
NM_001012755chrX85087 4838 4815 4449 4141 1034 976 895 --45045 4423 1985 763 --
NM_001012968chrX62757 1845 1777 1763 393 259 --31927 1044 637 --
NM_001013031chr1083131 2718 2705 2655 2168 477 358 210 --12249 --
NM_001013620chr12208397 8356 8004 7631 7514 7227 7192 6553 6517 6246 6185 5226 3386 3286 3133 2998 2452 1585 400 365 37418 6870 5347 27077 50 27408 3297
NM_001013659chr19125234 4902 4890 4781 4476 1550 1446 1432 1101 1048 1016 139 23501 2055 21332 376 --
NM_001014797chr1088223 6265 6001 3087 2937 2548 1574 987 1331 25264 153 --
NM_001015045chr472124 1958 1865 1842 517 502 384 --22373 131 --
NM_001015877chrX43103 548 243 56 --22384 941 --
NM_001015882chr91208 1257 --1314
NM_001017420chr851361 1254 1239 1170 937 ----176
NM_001017440chr7168243 7983 7003 6614 6368 6288 5771 5739 5248 3286 1322 1198 760 635 554 126 17964 ----
NM_001018065chr9136038 5765 5200 5163 4922 4841 4650 4297 4269 2325 1944 1318 813 25581 4582 ----
NM_001018066chr9136038 5765 5200 5163 4922 4841 4650 4297 4269 2325 1944 1318 813 25581 4582 ----
NM_001018067chr1114842 4656 1854 1776 1607 1434 949 758 553 359 119 34986 3722 1513 13407 11016
NM_001018068chr1114842 4656 1854 1776 1607 1434 949 758 553 359 119 34986 3722 1513 13407 11016
NM_001018069chr1114842 4656 1854 1776 1607 1434 949 758 553 359 119 34986 3722 1513 13407 11016
NM_001018074chr553568 2468 1159 950 562 23904 3837 23396 989 --
NM_001018075chr553568 2468 1159 950 562 23904 3837 23396 989 --
NM_001018076chr553568 2468 1159 950 562 23904 3837 23396 989 --
NM_001018077chr553568 2468 1159 950 562 23904 3837 23396 989 --
NM_001023567chr1562463 2044 1759 581 232 92 184 ----
NM_001024094chr553568 2468 1159 950 562 23904 3837 23396 989 --
NM_001024380chr862383 2227 1641 983 822 600 12051 --12320
NM_001024381chr862383 2227 1641 983 822 600 12051 --12320
NM_001024455chrX81882 1850 1796 1062 930 922 551 83 12017 ----
NM_001024649chr582601 2403 2201 1943 1859 1114 891 498 12895 12783 1379
NM_001024948chr163368 3091 2381 2132 975 513 23473 579 1507 --
NM_001024956chr11115590 5482 5131 4883 4346 4288 3616 3569 1605 748 372 45297 4561 1444 1089 33806 1927 118 24932 3818
NM_001025068chr331596 1143 626 ----11710
NM_001025069chr331596 1143 626 ----11710
NM_001025076chr1084369 2462 1932 1673 996 665 562 31 14517 45903 5404 5351 3939 11017
NM_001025077chr10125727 4780 3031 2354 2023 1920 1202 1017 862 644 299 31 15875 67261 6762 6709 5297 4694 4610 12375
NM_001025079chr3114005 3992 3830 3780 3767 3684 3640 3473 3369 2596 619 ----13256
NM_001025105chr541403 1084 965 373 11474 --1117
NM_001025252chr883237 3074 2992 2801 2565 902 662 230 1925 31046 692 676 1935
NM_001025253chr883237 3074 2992 2801 2565 902 662 230 1925 31046 692 676 1935
NM_001025266chr3134793 4043 3815 3509 1924 1915 1554 1520 1388 1237 1098 483 391 11352 14806 14544
NM_001025356chr12113028 2876 2647 2323 1013 581 444 390 338 121 115 --22813 2668 --
NM_001025366chr62404 265 ----21736 1333
NM_001025366chr62404 265 ----21736 1333
NM_001025367chr62404 265 ----21736 1333
NM_001025367chr62404 265 ----21736 1333
NM_001025368chr62404 265 ----21736 1333
NM_001025368chr62404 265 ----21736 1333
NM_001025369chr62420 281 ----21752 1349
NM_001025369chr62420 281 ----21752 1349
NM_001025370chr62404 265 ----21736 1333
NM_001025370chr62404 265 ----21736 1333
NM_001025580chrX114289 4156 3758 3077 3001 2937 1488 1124 1062 368 337 23610 2989 198 24312 701
NM_001025595chr481553 1544 1417 1381 1306 632 436 263 11628 1465 --
NM_001025616chr421754 371 --11176 1129
NM_001029858chr683329 2539 2300 1294 1115 1013 691 371 12605 1798 13174
NM_001029863chr673113 3041 3005 2776 2587 592 243 --43072 2809 2169 968 --
NM_001029875chr572802 2734 1959 1940 1181 959 478 41965 1835 539 434 ----
NM_001030007chr1673681 3357 3215 3091 1102 780 734 ----12937
NM_001030055chr14164472 4257 4024 4010 4001 3983 3824 3574 3511 3212 3017 1782 996 706 623 276 14541 54690 4609 3834 3221 1159 14651
NM_001031732chr483669 3272 2833 2396 2353 1061 951 880 --12886 13579
NM_001031804chr1684360 4105 3471 3196 1616 861 473 422 --22877 2754 --
NM_001032394chr672821 2540 1784 885 624 522 485 12351 22729 562 --
NM_001032395chr672688 2407 1651 752 491 389 352 12218 22596 429 --
NM_001032999chr20105252 4769 4279 4125 3364 1271 974 886 715 197 --11231 --
NM_001033045chr263869 3413 1585 1154 961 841 22865 1177 34093 1736 1533 --
NM_001033047chr472453 2439 2396 2085 1634 524 130 22356 1720 --11979
NM_001033057chr342105 1512 571 313 11848 21781 360 --
NM_001033117chr364676 3184 1948 1827 1470 1160 13353 11059 11071
NM_001033557chr221289 939 ----1904
NM_001033578chr861859 835 263 104 64 24 11866 --1581
NM_001033602chr134679 617 403 332 --11870 --
NM_001033756chr62338 199 ----21670 1267
NM_001033756chr62338 199 ----21670 1267
NM_001034841chr16105531 5508 5454 5255 5170 3362 1623 1153 701 509 --34708 4361 3993 --
NM_001034954chr1072892 2532 2226 842 624 372 50 43185 3132 3017 941 ----
NM_001034955chr1072892 2532 2226 842 624 372 50 43185 3132 3017 941 ----
NM_001034956chr1072892 2532 2226 842 624 372 50 43185 3132 3017 941 ----
NM_001034957chr1072892 2532 2226 842 624 372 50 43185 3132 3017 941 ----
NM_001035chr161257 1186 1177 1089 839 253 ----11335
NM_001035511chr172044 1921 1452 805 645 530 367 --11661 --
NM_001035512chr172151 2028 1559 912 752 637 474 --11768 --
NM_001035513chr172151 2028 1559 912 752 637 474 --11768 --
NM_001037132chr762243 1898 1458 606 415 29 --1691 --
NM_001037133chr762243 1898 1458 606 415 29 --1691 --
NM_001037317chr141797 602 376 316 ----12254
NM_001037334chr1882184 2071 1894 1649 1626 407 310 114 1879 2294 57 --
NM_001037954chr11103364 2422 1359 1221 1084 978 915 745 698 359 32969 2655 1003 11111 --
NM_001038640chr156920 760 649 392 168 38 1160 --1216
NM_001039538chr293220 3028 1301 1246 1156 804 367 360 192 32898 931 150 ----
NM_001039547chr3178084 7205 7071 6918 6482 6434 6178 2940 2486 2432 1475 1421 1349 1267 430 260 229 27804 6286 36419 4936 2118 --
NM_001039577chr144493 1483 1202 510 1742 14235 14550
NM_001039585chr1103725 3564 3386 2984 2958 1155 707 581 387 219 11596 ----
NM_001039590chrX73464 3279 2913 2650 2638 809 100 11398 ----
NM_001039591chrX73464 3279 2913 2650 2638 809 100 11398 ----
NM_001039618chr11105583 5465 5387 4177 4126 2342 2186 1134 857 194 15484 24312 1194 --
NM_001039709chr20105252 4769 4279 4125 3364 1271 974 886 715 197 --11231 --
NM_001039762chr1052194 786 678 449 436 --12207 --
NM_001039840chrX115916 5583 5052 4790 3923 1961 1281 871 852 259 38 --51629 1521 1101 904 359 --
NM_001039937chr13124003 3135 2720 2522 1213 1090 743 523 300 172 108 84 24116 806 22568 150 1570
NM_001040001chr651951 1924 1475 448 439 1198 11546 --
NM_001040057chr751479 1345 1339 195 128 ------
NM_001040142chr271823 1641 1566 861 449 217 24 12265 1463 --
NM_001040143chr271823 1641 1566 861 449 217 24 12265 1463 --
NM_001040152chr755101 4655 1746 1388 317 13274 13384 --
NM_001040202chr492491 2057 1899 1808 1788 1729 987 656 295 12460 21852 71 --
NM_001040214chr662243 1949 1923 1695 1483 334 12148 ----
NM_001040272chr952015 1917 1841 1548 85 ----12127
NM_001040284chr1694276 2074 1674 1615 1569 1433 1258 960 265 15973 35188 1184 490 --
NM_001040402chr452812 2242 1973 1264 1177 --2621 537 --
NM_001040409chr26972 816 680 645 366 230 --1847 --
NM_001040429chr1373366 904 853 695 642 603 82 32879 2507 768 --1970
NM_001040441chr185427 4048 2116 1871 1017 607 585 154 13705 33432 1518 1394 24877 4870
NM_001040446chr532132 1782 255 ----12502
NM_001040458chr551837 1563 331 276 122 11553 11682 --
NM_001040665chr7104939 4799 4612 3540 3531 1676 1493 1014 700 48 1969 --24984 4686
NM_001040666chr72641 501 ----1686
NM_001040712chr9113589 3101 2763 2722 2629 2550 2340 622 581 543 127 11043 1702 --
NM_001040876chr431523 731 341 131 21902 1556 --
NM_001042355chr16105406 5201 5182 1422 1355 1349 1184 760 659 611 14877 45396 4172 1994 394 --
NM_001042361chr1041479 1108 591 308 --1196 1979
NM_001042364chr1041479 1108 591 308 --1196 1979
NM_001042365chr1041479 1108 591 308 --1196 1979
NM_001042387chr1041479 1108 591 308 --1196 1979
NM_001042393chr1041479 1108 591 308 --1196 1979
NM_001042396chr1041479 1108 591 308 --1196 1979
NM_001042397chr1041479 1108 591 308 --1196 1979
NM_001042403chr124936 807 407 80 --2315 68 --
NM_001042404chr1101995 1715 1584 1546 787 621 477 436 430 27 ----1184
NM_001042406chr661262 1066 897 455 68 26 ------
NM_001042412chr16105406 5201 5182 1422 1355 1349 1184 760 659 611 14877 45396 4172 1994 394 --
NM_001042413chr993861 3277 2678 2637 1507 1316 1171 696 179 11491 12723 --
NM_001042424chr462533 878 820 501 492 299 --1532 --
NM_001042453chrX41359 1110 443 272 11278 3251 166 146 --
NM_001042473chr1031961 594 357 22127 1784 42002 1758 777 294 --
NM_001042492chr1763452 3424 3397 2521 2131 354 1422 --13234
NM_001042493chr661680 1244 733 571 562 175 ------
NM_001042510chr862045 1903 1693 1363 751 131 1290 1586 --
NM_001042511chr862045 1903 1693 1363 751 131 1290 1586 --
NM_001042543chr471521 1337 1155 1124 1096 224 114 --31349 1009 430 21567 522
NM_001042555chr12154163 3900 3766 3589 3557 3302 1814 1770 1722 1001 827 667 226 75 69 3840 647 242 11562 --
NM_001042599chr2167414 6828 6461 6406 6301 6055 4937 4883 2725 2312 2173 1618 1126 696 654 220 11769 27380 1632 11403
NM_001042601chr393142 2786 2771 867 715 467 370 184 50 --13121 12549
NM_001042603chr1295208 4741 4601 4534 3932 1398 1288 1118 731 25195 4402 14893 --
NM_001042604chr3114661 4196 3656 3649 3360 3158 3106 1014 396 320 130 24515 1480 24574 94 --
NM_001042669chr421754 371 --11176 1129
NM_001042681chr192622 2170 2131 1882 1866 880 634 593 582 ------
NM_001042682chr192622 2170 2131 1882 1866 880 634 593 582 ------
NM_001042682chr192622 2170 2131 1882 1866 880 634 593 582 ------
NM_001044385chr2113699 3513 2952 2865 2737 2622 1036 403 289 261 47 --23787 3682 --
NM_001046chr532792 2641 2413 23050 922 --2808 478
NM_001071775chr1321618 642 --21947 1515 21375 736
NM_001106chr3109566 8568 7825 7586 7016 6789 3653 3540 2241 118 16800 49764 3298 1741 1618 12456
NM_001113490chrX43681 1378 618 178 --42437 962 339 51 --
NM_001121chr1051789 757 535 175 74 11815 --11662
NM_001126chr12811 422 169 21012 216 --
NM_001128chr1673681 3357 3215 3091 1102 780 734 ----12937
NM_001159chr21708 1164 1202 1745
NM_001167chrX96780 6422 4730 4258 1395 846 569 510 201 11826 26459 4621 15139
NM_001173chr14164472 4257 4024 4010 4001 3983 3824 3574 3511 3212 3017 1782 996 706 623 276 14541 54690 4609 3834 3221 1159 14651
NM_001186chr2183001 2951 2581 2411 2005 974 889 759 --32592 2093 1176 --
NM_001198chr661936 1813 864 472 386 325 11522 21778 634 --
NM_001201chr4133742 2691 1496 1392 1351 1320 1201 1052 919 787 683 235 39 53271 1471 762 368 359 23936 2407 13216
NM_001204chr2197128 6657 6252 6146 6097 6051 5649 5499 5382 3021 2970 2687 2020 1849 1335 1218 895 887 764 47781 6431 5862 937 45642 2500 2406 2236 21898 45
NM_001206chr973077 2880 2817 2683 2085 1160 1063 ------
NM_001233chr772109 1967 1943 1912 612 113 85 1596 12285 --
NM_001256chr1752804 2099 692 431 328 22133 1865 ----
NM_001259chr7116192 5270 4766 4502 4190 2471 1965 1155 766 290 209 1727 1799 25280 4332
NM_001278chr105899 768 751 479 83 2946 263 ----
NM_001304chr1793322 2943 2828 2604 2366 1131 1056 675 265 23314 2950 13426 --
NM_001310chr1252655 2088 1236 594 546 22204 91 12795 --
NM_001351chr351603 743 636 331 70 11553 11310 --
NM_001364chr1164609 3785 3535 3446 1863 660 22918 669 24204 1299 11174
NM_001390chr1853498 3043 2497 2444 576 --13429 13605
NM_001396chr2142309 1794 331 245 --22786 873 --
NM_001401chr921178 494 31149 371 282 --11198
NM_001417chr1221691 699 1306 --11337
NM_001419chr19104906 4227 4219 3869 3381 2950 1186 959 839 82 34079 3918 1631 24609 4535 --
NM_001420chr1922294 599 22488 2444 --23100 2140
NM_001427chr71428 12039 11442 1154
NM_001430chr22386 188 ----21633 106
NM_001432chr463673 3473 2896 2654 1228 64 33573 2575 2566 2871 167 --
NM_001438chr183538 3245 2710 2509 2430 2349 822 792 21447 1084 13195 13023
NM_001453chr631744 706 190 21266 448 21468 1354 --
NM_001460chr152901 2395 2369 966 658 32410 2217 919 ----
NM_001490chr953725 3579 3439 1271 1088 23102 1449 33641 397 373 13424
NM_001518chr721102 428 ----1447
NM_001527chr694051 3505 3000 1724 1397 894 863 89 33 24678 3582 43886 1806 466 404 13958
NM_001550chr74525 150 50 38 --124 --
NM_001560chrX72178 1858 1757 963 850 377 61 22449 2197 --1109
NM_001570chr321434 144 11463 --11196
NM_001604chr113956 246 222 1733 1854 --
NM_001616chr2103413 3309 2499 2292 988 820 736 464 402 377 23209 1018 --13252
NM_001621chr732479 1059 336 --22521 671 --
NM_001621chr732479 1059 336 --22521 671 --
NM_001650chr1852966 1605 1239 598 247 23940 561 23518 1281 --
NM_001656chr562028 1836 1773 1354 789 744 --22082 1810 --
NM_001659chr1242487 2131 1993 1972 11978 1729 --
NM_001682chr1262879 2847 2749 2594 2263 2011 12907 --12043
NM_001683chr352678 956 834 764 613 12748 --1449
NM_001684chr183876 3530 1593 1149 269 45 39 30 1372 ----
NM_001689chr22672 123 11557 --11927
NM_001695chr873834 2854 2617 901 833 323 314 --23956 649 --
NM_001723chr63813 312 117 1210 --1348
NM_001742chr731598 1309 226 1339 2105 42 --
NM_001746chr582601 2403 2201 1943 1859 1114 891 498 12895 12783 1379
NM_001755chr1672265 2196 1461 519 479 436 162 22045 376 1427 --
NM_001759chr12145318 4875 4806 4750 4563 4462 1774 1649 1566 1513 1347 1218 956 201 1420 1526 --
NM_001777chr3114005 3992 3830 3780 3767 3684 3640 3473 3369 2596 619 ----13256
NM_001781chr122388 29 1894 --1339
NM_001830chrX84034 3843 3702 1553 1529 920 790 710 2822 47 21567 667 13868
NM_001854chr141300 420 264 61 --11131 1128
NM_001858chr684996 4847 3392 3194 808 572 431 340 14337 44427 3968 3282 145 24959 3926
NM_001859chr993803 2977 2946 2928 2578 1453 1066 751 228 --13041 --
NM_001873chr42604 208 ----1118
NM_001875chr271113 1003 970 830 371 336 109 1224 ----
NM_001892chr541403 1084 965 373 11474 --1117
NM_001918chr199268 8946 7074 5913 5875 5734 2186 720 642 37776 6222 5863 48958 8235 2261 1255 16827
NM_001935chr241030 933 884 44 21012 24 1243 --
NM_001938chr151889 1752 682 188 24 ------
NM_001939chrX73229 3075 2902 1358 744 610 296 --23335 3104 --
NM_001942chr1831821 1579 309 11482 21495 485 --
NM_001949chr632824 2486 2094 1832 1860 12074
NM_001957chr441636 1585 1415 491 1917 12063 --
NM_001980chr1242237 2042 856 73 124 11546 --
NM_001981chr152436 856 771 592 280 ----162
NM_001992chr522179 2107 11504 12019 11366
NM_001999chr541127 1076 491 236 11196 ----
NM_002006chr4175704 5692 4963 4837 4730 4575 4425 4281 3622 3539 2332 1821 1578 1373 1224 151 27 14825 1383 --
NM_002009chr1552406 2299 2059 918 559 11744 ----
NM_002015chr1392996 2832 2239 2201 2059 999 900 676 243 --11294 --
NM_002024chrX62002 1896 1417 516 430 324 --2304 37 --
NM_002025chrX178825 8808 8209 7813 7484 7437 7354 7187 6165 5841 3335 3287 2634 1422 1358 657 207 12472 36029 1456 1230 --
NM_002033chr1184059 3778 3595 2907 2818 1194 237 115 ------
NM_002035chr1893929 3719 3475 2895 2849 2658 891 771 305 1322 1216 --
NM_002040chr2173220 3157 2835 2536 2163 2140 1171 --32492 1114 373 12237
NM_002069chr741839 1599 1237 404 --21218 563 1649
NM_002092chr4104690 4388 3912 3876 3682 3390 1839 1599 884 49 1367 44507 3956 3209 1854 --
NM_002126chr17113576 3224 3186 2989 2940 1534 1200 860 682 225 129 13835 ----
NM_002128chr1321905 535 21937 1016 22237 2000 --
NM_002154chr5133 ----1220
NM_002158chr293541 3419 3374 3137 1165 879 847 639 361 22386 984 21273 1231 --
NM_002182chr362757 2750 2663 2345 2171 153 22270 760 21914 1749 12795
NM_002190chr64928 469 312 95 2432 420 11340 --
NM_002196chr20--11077 --21119 974
NM_002196chr20--11077 --21119 974
NM_002203chr5124158 4005 3753 3631 3288 3155 2814 2746 1509 1164 970 223 21171 694 13720 12770
NM_002210chr253104 2569 2481 2314 1440 1852 ----
NM_002211chr101267 11136 11051 1743
NM_002214chr785691 5215 3912 3760 3677 3644 922 905 34349 4222 912 25247 4657 --
NM_002232chr151125 976 555 269 93 21223 288 ----
NM_002245chr12521 72 ----1502
NM_002264chr384459 3628 3468 3157 3101 803 582 125 11306 33699 1630 1224 --
NM_002270chr585519 4989 4874 3999 3565 2027 1856 1579 23890 963 11963 --
NM_002336chr1254540 3658 3625 1017 767 11201 14065 23257 1084
NM_002350chr861237 1009 810 359 270 23 2398 46 --11062
NM_002356chr662100 876 812 219 204 47 22040 656 22845 1842 --
NM_002374chr293220 3028 1301 1246 1156 804 367 360 192 32898 931 150 ----
NM_002408chr146819 701 543 336 190 34 ------
NM_002416chr442122 1491 65 46 11521 --11990
NM_002427chr1151159 911 859 500 377 ------
NM_002448chr4--1655 --1747
NM_002480chr1241441 224 153 105 --21264 1172 --
NM_002487chr153641 173 163 --3667 600 576 --
NM_002500chr21494 1219 122 11137
NM_002515chr1492045 2038 1791 1763 1751 1672 1297 271 49 11832 1667 11947
NM_002522chr1743918 3662 2772 381 23338 2707 13882 --
NM_002545chr11104335 4117 3730 3609 2008 1223 736 351 305 226 33714 1029 905 ----
NM_002547chrX104291 4189 3194 2782 1440 847 726 448 369 92 --24126 1351 11182
NM_002577chr383452 3351 2650 1375 784 740 132 36 32854 727 270 11315 --
NM_002581chr965353 4669 3615 2257 2186 276 12173 12077 --
NM_002594chr2062275 1967 1764 1579 566 316 12375 ----
NM_002595chr1261647 1385 779 315 223 103 --21830 1315 --
NM_002613chr1654682 4126 3402 1960 1287 ----13300
NM_002628chr361217 1136 971 808 427 104 1378 1142 --
NM_002629chr104664 158 150 144 ------
NM_002641chrX61599 1498 643 607 364 131 21696 1677 11636 --
NM_002645chr1162966 2322 1972 857 321 215 11917 22792 1953 --
NM_002655chr894334 3715 3396 3365 3240 924 332 299 269 23331 767 31123 177 61 15186
NM_002670chr341560 1341 1205 293 --11176 1446
NM_002677chr841083 1043 937 919 --31968 1114 880 138
NM_002706chr22572 222 ----1187
NM_002711chr77782 349 327 314 193 179 74 140 2891 768 1120
NM_002715chr531278 396 258 1343 --1491
NM_002716chr1173675 3563 2240 1132 1086 412 206 --31378 1142 974 1141
NM_002719chr1472312 2167 1824 1732 1717 1710 410 --2908 264 --
NM_002731chr172230 2224 1925 1076 572 317 271 22243 1961 ----
NM_002736chr751794 1767 1732 1400 696 12157 1469 --
NM_002737chr17166705 6632 6533 6429 6223 5428 5060 4994 4424 4393 4129 2001 1359 1121 794 299 15264 66552 6285 4449 2326 1598 756 --
NM_002740chr342792 2406 1815 932 142 42668 940 388 87 --
NM_002745chr2273903 3082 1533 1519 1074 676 128 12766 --11501
NM_002748chr1581186 1032 852 761 364 195 178 79 1106 ----
NM_002837chr1264403 4004 3847 1542 900 93 --1252 13480
NM_002839chr9113589 3101 2763 2722 2629 2550 2340 622 581 543 127 11043 1702 --
NM_002843chr1162872 2239 729 664 510 405 --23335 336 --
NM_002844chr6------21034 542
NM_002874chr952337 2300 796 635 617 11986 ----
NM_002886chr3165162 5156 4725 4196 3967 3600 1696 1585 1493 1468 1442 1430 1270 772 455 413 34829 2063 275 14476 25092 4415
NM_002906chr1182329 2167 2134 2049 1957 1680 1635 399 --22204 744 --
NM_002938chr4112025 1866 1750 1652 1646 1607 730 672 631 544 75 ------
NM_002940chr431523 731 341 131 21902 1556 --
NM_002941chr381361 1339 1326 1013 643 635 480 236 11491 1146 --
NM_002959chr164203 3698 2946 2710 1773 1255 --22750 1473 --
NM_002993chr441091 710 326 111 --1990 2916 216
NM_002994chr451629 1491 1314 350 240 1738 11869 2708 544
NM_002998chr862229 1838 1727 580 331 107 125 --1674
NM_003001chr172151 2028 1559 912 752 637 474 --11768 --
NM_003016chr1771996 1366 1271 675 605 449 106 --1243 --
NM_003051chr161688 1610 1591 1560 726 352 --1333 --
NM_003068chr8----41058 800 707 355 --
NM_003081chr2041122 262 255 219 --2974 820 1813
NM_003099chr15136599 6344 6326 4108 2443 2252 2134 1866 1582 842 738 504 158 35033 2108 168 26538 1905 --
NM_003108chr2126660 6556 5861 5648 5477 4914 4641 2105 1838 1513 1423 600 15067 1362 --
NM_003112chr793073 3020 2770 2619 2415 2291 2239 1070 654 22926 853 ----
NM_003118chr572061 1547 1388 387 243 230 196 11349 1629 --
NM_003128chr272764 2465 924 887 876 769 396 1409 1544 --
NM_003137chr672162 1986 1938 1652 686 185 144 32029 1613 1565 1586 --
NM_003144chr662156 2091 1929 268 211 174 ------
NM_003161chr1763454 3100 2205 1189 869 668 1781 32935 2261 788 --
NM_003162chr23838 725 695 ----1952
NM_003168chr174927 838 749 670 1893 2152 144 --
NM_003185chr2041236 1039 1003 397 ----1457
NM_003199chr18175499 5314 5142 4671 4607 4575 4553 4504 4107 3765 2081 1917 1718 696 583 242 102 12042 --14142
NM_003211chr1251733 1521 463 360 224 21367 253 ----
NM_003246chr15112013 1950 1852 1769 1734 1527 1469 1357 750 559 538 11806 11959 --
NM_003262chr3214337 4125 3399 1979 1972 1923 1732 1674 1610 1588 1486 1228 1125 986 702 404 248 215 197 175 155 --1521 --
NM_003274chr2182962 2925 2899 2825 2298 2117 770 349 21868 476 ----
NM_003298chr3106245 5953 5225 4247 2112 1977 642 579 110 49 25373 5182 25906 1926 1555
NM_003299chr121214 --158 1204
NM_003319chr22630 147 1702 --1250
NM_003320chr1184382 4358 3987 3484 1659 1595 1379 948 11667 ----
NM_003338chr1031922 1494 125 1455 2201 110 --
NM_003342chr1733308 3160 1331 2948 477 12354 --
NM_003369chr1162474 2228 1119 1044 283 161 12687 ----
NM_003376chr62404 265 ----21736 1333
NM_003376chr62404 265 ----21736 1333
NM_003387chr262254 2216 2080 1892 1868 1038 ----12013
NM_003392chr372938 2924 2640 1742 992 962 641 --34366 4276 126 --
NM_003406chr881847 1514 1458 1232 650 562 380 122 21633 1284 21618 54 --
NM_003410chrX63048 2086 545 392 338 56 22527 495 ----
NM_003411chrY41242 556 363 53 ----1280
NM_003412chr332239 2206 774 22315 35 ----
NM_003463chr682627 2599 2094 1284 643 552 240 187 --1453 --
NM_003468chr254317 3048 1609 1486 203 185 24259 3716 --
NM_003471chr362377 1447 876 608 576 202 11479 22108 1724 --
NM_003478chr1132694 2246 660 ----12223
NM_003483chr1232550 777 659 2816 706 12712 --
NM_003489chr21103343 3274 3072 2568 2125 1229 1168 891 709 118 --12532 --
NM_003557chr131432 580 291 --11577 11454
NM_003566chr1262925 2340 2146 2130 1126 170 33245 782 216 184 --
NM_003574chr18105078 4832 4822 4688 3976 3919 1913 1886 1655 1495 22116 1243 33634 104 74 --
NM_003583chr1293412 2681 2609 1242 1210 916 450 157 112 ----13153
NM_003590chr293784 3205 3137 2913 1264 995 339 127 72 43873 3396 3235 804 ----
NM_003603chr442006 793 768 360 11915 ----
NM_003607chr1104054 3836 3617 3558 3514 3489 3436 3355 2914 1474 --34123 1686 1488 --
NM_003615chr373232 1482 975 878 491 480 211 43905 3770 2460 1146 33991 3542 3309 1694
NM_003622chr1282341 2240 2107 1851 1719 1705 906 679 1223 --12055
NM_003630chr62588 133 137 2774 703 --
NM_003663chr383119 3084 2766 2441 2415 743 593 74 32485 1387 92 33342 3030 2669 --
NM_003671chr993385 3067 3016 1452 1347 1241 972 841 330 13136 2503 476 --
NM_003676chr14959 620 293 254 1865 --1271
NM_003714chr5102401 2343 2270 2221 1936 877 633 610 79 45 12412 ----
NM_003722chr352181 1675 1089 924 613 --1440 11876
NM_003758chr1521564 345 ----11201
NM_003758chr1521564 345 ----11201
NM_003759chr493970 3808 1272 1098 720 711 623 316 187 11562 ----
NM_003763chr2062575 2038 1026 962 619 354 3983 933 703 ----
NM_003774chr123425 418 143 12949 12135 1856
NM_003783chr151052 769 469 381 362 1205 11038 1824
NM_003791chr164635 473 440 424 ------
NM_003799chr18143864 3687 3677 3650 2849 2840 1499 1318 1240 925 574 407 252 225 --34238 4121 1009 --
NM_003800chr641710 1633 614 64 22147 2103 22232 568 1467
NM_003816chr83385 229 221 ----21338 943
NM_003825chr1531253 994 980 ----128
NM_003848chr33719 65 37 1336 1632 1393
NM_003850chr133568 164 49 ----1478
NM_003861chr1462715 2244 1938 1895 1021 188 22077 1003 32705 2627 2307 --
NM_003872chr292928 2461 2354 1011 793 663 595 418 289 --11215 13053
NM_003884chr341172 380 267 231 1223 1698 --
NM_003887chr262319 2160 2054 1681 580 263 21994 1623 ----
NM_003888chr1531105 520 376 11488 1506 11380
NM_003909chr863024 2417 2177 1014 917 676 12423 11037 --
NM_003913chr6124079 4027 3601 3549 3064 2990 1625 1566 1303 993 954 343 34218 3931 863 34287 3769 943 --
NM_003930chr7102532 2337 2247 2215 1727 1563 375 337 266 230 --22260 294 --
NM_003934chr971282 1202 1129 1090 526 57 39 1456 2873 189 --
NM_003953chr121965 901 2278 173 --2496 319
NM_003958chr693938 3470 1581 1318 1230 777 449 404 186 ------
NM_003966chr5117725 4893 4763 2991 2751 2453 2288 1389 649 254 207 --46092 6011 5981 1023 37859 6086 2838
NM_003968chr32440 77 1460 --1684
NM_003980chr631106 490 98 --31299 1138 121 --
NM_003994chr12114230 3829 3732 3705 3510 2939 1551 1094 939 883 246 41201 1116 672 275 34116 4001 332 13348
NM_004006chrX92638 1933 1755 1728 917 758 671 630 338 ------
NM_004007chrX92638 1933 1755 1728 917 758 671 630 338 ------
NM_004009chrX92638 1933 1755 1728 917 758 671 630 338 ------
NM_004010chrX92638 1933 1755 1728 917 758 671 630 338 ------
NM_004011chrX92638 1933 1755 1728 917 758 671 630 338 ------
NM_004012chrX92638 1933 1755 1728 917 758 671 630 338 ------
NM_004013chrX92638 1933 1755 1728 917 758 671 630 338 ------
NM_004014chrX92638 1933 1755 1728 917 758 671 630 338 ------
NM_004015chrX92638 1933 1755 1728 917 758 671 630 338 ------
NM_004016chrX92552 1847 1669 1642 831 672 585 544 252 ------
NM_004017chrX92638 1933 1755 1728 917 758 671 630 338 ------
NM_004018chrX92552 1847 1669 1642 831 672 585 544 252 ------
NM_004020chrX92638 1933 1755 1728 917 758 671 630 338 ------
NM_004021chrX92552 1847 1669 1642 831 672 585 544 252 ------
NM_004022chrX92552 1847 1669 1642 831 672 585 544 252 ------
NM_004023chrX92552 1847 1669 1642 831 672 585 544 252 ------
NM_004028chr1852966 1605 1239 598 247 23940 561 23518 1281 --
NM_004087chr351966 567 206 192 41 32030 1653 1383 ----
NM_004094chr1452896 2479 675 283 228 12153 22347 957 --
NM_004100chr642001 1831 870 27 1469 1911 --
NM_004113chr351781 1738 1687 486 66 21461 59 --1586
NM_004117chr62762 272 11700 11457 12198
NM_004124chr14143353 3238 3094 3049 2744 2251 2182 1243 699 577 429 418 308 135 ----1297
NM_004133chr882581 2315 1857 963 740 591 293 134 ------
NM_004136chr15103150 2619 2545 2539 1008 981 889 839 590 441 1454 22661 281 11019
NM_004171chr11137975 7384 7246 7007 6706 6050 5954 3710 3094 2821 1828 1518 994 47054 5960 3796 2798 58237 6333 3739 3137 2991 --
NM_004172chr541804 1395 493 48 --21927 215 11787
NM_004180chr22173 123 ----196
NM_004232chr1873072 2839 2817 2742 1392 688 422 23304 1252 43752 2483 2409 106 12589
NM_004274chr1462133 1268 692 668 577 565 2593 127 12196 22155 768
NM_004279chr772116 2054 941 921 731 533 303 ------
NM_004293chr963673 3160 3006 2597 1091 822 --22456 1247 --
NM_004323chr992225 2083 1796 1786 1711 1702 917 885 111 11815 ----
NM_004331chr862697 2622 2509 2386 348 82 11802 ----
NM_004337chr842333 1853 133 39 1243 1288 12130
NM_004338chr18127077 6721 6700 6647 6640 6612 6551 6427 4590 4403 4396 1330 --25376 2431 --
NM_004346chr431543 1018 83 ----1505
NM_004392chr1362460 2323 2024 1742 1684 1075 --1342 --
NM_004397chr11114012 3546 2886 2864 2786 1702 1666 818 539 477 418 13530 33593 1555 665 12919
NM_004438chr263172 2215 1322 375 360 197 23240 2279 --12340
NM_004440chr641962 1667 603 408 --21869 425 --
NM_004458chrX41719 1057 384 104 11823 --1479
NM_004459chr174753 437 233 203 --158 21944 1908
NM_004464chr4104267 3776 3604 3389 3334 2870 888 541 130 29 --44204 1527 1367 501 --
NM_004472chr52641 122 1197 --1532
NM_004485chr194332 3739 3609 3346 2743 1459 995 186 171 14181 ----
NM_004490chr2129 ----1184
NM_004496chr1431061 1052 133 --21343 122 1936
NM_004501chr183581 3533 3010 2800 1060 768 724 354 1931 ----
NM_004504chr272764 2207 2111 971 963 439 312 1520 42667 2188 1866 431 --
NM_004505chr1751980 1802 1451 576 222 11338 ----
NM_004506chr62490 251 1519 171 155
NM_004514chr1773008 2253 935 818 681 529 481 --1924 --
NM_004529chr9132 21010 409 --1938
NM_004535chr2021482 100 21168 488 21270 1202 143
NM_004537chr1251490 1322 615 390 93 --180 --
NM_004540chr213643 568 73 1312 --1863
NM_004566chr1052255 2192 1564 33 27 12356 ----
NM_004571chr2172275 2097 753 607 571 544 318 1818 22309 2142 --
NM_004580chr1531606 459 267 21298 544 --11200
NM_004586chrX65352 4907 4066 1723 699 557 21830 413 13375 --
NM_004598chr572937 2682 2337 2106 998 604 541 ------
NM_004612chr931082 800 583 21756 1474 21933 1823 --
NM_004650chrX51748 1444 1208 1196 506 --21730 229 --
NM_004654chrY11048 --11205 11359
NM_004666chr641057 1016 978 970 --11282 11111
NM_004685chr1362942 2655 2213 1193 1084 170 --12249 12610
NM_004703chr1752338 2233 1611 878 501 --22521 537 --
NM_004709chrX61521 1293 458 446 362 23 11233 21274 52 --
NM_004717chr771416 1334 1295 1274 1162 602 530 ----1558
NM_004726chrX105582 5426 5375 4940 4195 3534 2309 2259 1683 577 --11655 --
NM_004730chr521819 1752 1461 1524 11952
NM_004731chr1261710 1679 1430 735 394 60 11845 11512 --
NM_004736chr152139 1684 1412 231 207 ----12054
NM_004742chr331579 1287 1202 ----11398
NM_004744chr453760 3420 2650 930 506 13898 11068 --
NM_004745chr8106755 5257 5168 4314 4279 2240 1941 1704 1324 350 26530 6043 36721 6478 2782 1876
NM_004748chr1573690 2895 1042 962 605 548 409 --159 --
NM_004757chr4195 2627 131 --1197
NM_004760chr742252 1838 1562 209 1797 21915 1895 --
NM_004774chr17113090 3064 2837 1091 1008 892 513 480 376 352 47 1586 ----
NM_004775chr1842119 2018 2002 1785 32388 964 325 11922 --
NM_004779chr521097 280 ----11308
NM_004788chr1182509 2449 1960 1723 1681 1107 797 347 ------
NM_004791chr134266 124 108 45 --1570 1675
NM_004804chr262394 2310 1850 773 570 379 1102 11872 1283
NM_004808chr1062851 2254 797 442 210 71 23279 2393 139 --
NM_004815chr174875 4618 3526 2999 1341 882 300 34280 3169 1075 63816 1908 1884 1133 918 494 --
NM_004834chr262949 2070 1196 1024 697 648 ------
NM_004842chr641722 1452 1189 615 1344 11682 --
NM_004849chr661667 1533 1324 1209 1166 208 1620 ----
NM_004857chr14114691 4559 4092 3473 3459 3387 1907 1581 1055 942 629 24120 3191 34358 1786 1469 --
NM_004863chr1475103 4975 1267 623 501 328 272 11061 11358 --
NM_004869chr1851760 1470 1367 403 63 ------
NM_004904chr7156340 5822 5487 5237 4542 4484 4334 4177 4098 1987 1829 1732 762 616 127 55699 5504 4593 4356 642 35400 4210 2271 14808
NM_004921chr132471 2284 522 12319 32554 2179 2142 --
NM_004929chr831517 1046 452 ----11116
NM_004947chr372478 2245 2091 2044 1834 520 232 --42382 2074 712 702 --
NM_004949chr1862149 2098 2039 756 744 300 11601 32107 1400 546 11507
NM_004956chr774028 4021 3951 3514 1835 1806 786 2830 451 23720 424 21224 1163
NM_004985chr1263771 3661 3583 1581 660 649 23516 1654 54366 4274 4233 3477 757 --
NM_004992chrX118013 7923 6811 5516 3066 2797 2452 1248 1231 985 396 18526 18451 --
NM_004992chrX118013 7923 6811 5516 3066 2797 2452 1248 1231 985 396 18526 18451 --
NM_004999chr674441 4069 2869 1537 525 241 78 13178 ----
NM_005010chr762243 1898 1458 606 415 29 --1691 --
NM_005023chr531222 1022 983 ----21068 399
NM_005036chr22157824 7569 7392 6073 5707 5320 3178 2990 2863 2545 2421 1920 1216 979 385 27216 6744 48365 6959 6273 5861 1325
NM_005054chr231494 338 107 ----1597
NM_005056chr1295452 4985 4845 4778 4176 1642 1532 1362 975 25439 4646 15137 --
NM_005057chr161809 467 374 360 347 71 1267 --11709
NM_005065chr14105319 4187 3754 3728 3453 1995 1330 1113 1027 997 --11190 --
NM_005079chr883237 3074 2992 2801 2565 902 662 230 1925 31046 692 676 1935
NM_005093chr20105252 4769 4279 4125 3364 1271 974 886 715 197 --11231 --
NM_005105chr182131 1991 1750 1648 624 226 149 42 ------
NM_005116chr2074562 4258 3243 1090 739 413 300 21157 909 ----
NM_005121chr1773730 2749 2434 943 700 171 96 12675 21325 982 --
NM_005151chr1882184 2071 1894 1649 1626 407 310 114 1879 2294 57 --
NM_005154chr151514 2656 97 --1210
NM_005156chr9125328 5299 5143 4529 4516 4189 4107 3944 3851 3739 1673 362 --1657 13333
NM_005160chr22136595 6513 6432 6133 6089 5560 5443 5277 4342 4189 1722 688 664 12195 26758 6279 14738
NM_005164chr1252582 2495 2404 2319 680 2915 420 2965 923 --
NM_005180chr1051674 1515 516 278 64 21712 1246 --1623
NM_005188chr11198278 8210 8199 8193 8120 7693 7514 6111 5948 3123 2710 2628 2060 1949 1543 1445 1180 781 588 21855 1095 48069 7417 3209 2447 --
NM_005197chr1465815 5353 1845 1054 742 298 --46128 5240 1004 38 26137 5311
NM_005233chr352168 2101 2033 874 290 2890 674 12015 1181
NM_005235chr2167414 6828 6461 6406 6301 6055 4937 4883 2725 2312 2173 1618 1126 696 654 220 11769 27380 1632 11403
NM_005238chr1152449 1196 556 111 90 --43509 3288 2593 306 1498
NM_005241chr321284 1164 ----2180 69
NM_005261chr85974 332 274 217 51 2892 688 2985 917 --
NM_005277chr431593 1403 444 21194 251 128 --
NM_005333chrX31086 991 490 11035 4352 199 61 34 --
NM_005339chr4144179 4040 3980 3817 3646 3572 3398 2903 1554 1510 902 716 371 131 --43895 1267 1186 495 --
NM_005359chr18105948 5920 4792 4727 4386 4323 1978 1846 349 275 15228 15052 15087
NM_005385chr342413 301 237 85 1142 2885 683 --
NM_005399chr183538 2948 1451 1371 1279 1213 1187 566 11179 11308 --
NM_005400chr273000 2589 2583 2574 2190 889 269 1133 --1996
NM_005402chr751592 1279 634 449 65 11848 1369 --
NM_005410chr53766 263 51 1523 1509 --
NM_005433chr1832429 1976 1950 --22046 304 --
NM_005436chr1083393 3357 2663 2551 1510 1064 933 879 11130 21147 947 --
NM_005455chr171790 1762 1650 647 611 406 397 1346 2355 336 --
NM_005475chr1253187 2920 2259 2005 663 --22947 2888 --
NM_005487chr2252040 1993 630 621 41 21860 1559 1404 --
NM_005502chr9103110 3064 2987 2785 2772 2750 2733 2183 903 134 12147 33181 2298 1146 11252
NM_005504chr12146231 6209 5827 5763 5600 5490 5236 4698 4343 4251 4039 2358 1034 609 12366 35612 2456 2244 25707 4384
NM_005509chr541765 734 692 73 --11625 11317
NM_005578chr3125091 4520 4106 3868 3659 1857 1731 1403 1021 981 453 426 14192 21599 420 --
NM_005596chr976027 4661 4082 2533 1986 570 496 --21602 1586 --
NM_005603chr1861702 1630 1253 376 154 45 ------
NM_005604chr6102289 1963 1899 1643 1007 930 767 680 609 590 --12334 --
NM_005611chr1621113 211 ----11050
NM_005614chr751074 1048 951 334 187 --1119 --
NM_005637chr1811370 12055 --1734
NM_005638chrX41766 1266 650 206 31730 1442 275 --11128
NM_005639chr1251797 1547 1405 378 88 --21728 542 --
NM_005665chr194952 4864 3232 3207 1853 1619 833 316 202 24741 4463 23463 1084 11498
NM_005668chr563369 3042 3003 1274 1059 285 14359 34609 4386 1164 13255
NM_005711chr5135 1900 11023 1804
NM_005717chr111278 --1234 1912
NM_005721chr271057 1012 999 986 966 854 713 ------
NM_005722chr272482 2223 2084 1576 954 290 272 --12069 --
NM_005725chr152347 810 403 304 74 1362 ----
NM_005739chr1562314 2283 1794 1548 934 49 --31647 885 281 21514 945
NM_005746chr731999 627 131 ----11053
NM_005759chr294708 4018 3569 3320 3226 2929 1874 1781 696 14132 64545 2982 935 503 239 197 13278
NM_005779chr553193 2520 981 302 21 --23033 67 --
NM_005788chr112613 585 1806 1214 1289
NM_005795chr272851 2580 2034 822 712 623 326 12060 21199 851 --
NM_005798chr13105012 4859 4734 4463 4395 4339 3920 3611 2116 2045 12090 25143 4620 13691
NM_005813chr262658 2498 1865 477 308 36 --12570 --
NM_005822chr642013 1864 1541 612 1781 22352 2292 --
NM_005828chr1774978 4690 4248 3937 1443 963 540 ----14440
NM_005840chrX126946 6244 5950 5766 5654 5144 5111 2178 1580 1383 1173 642 14710 --37716 6206 753
NM_005845chr1351217 1078 416 294 125 2392 374 ----
NM_005862chr35977 935 744 719 237 --2413 224 --
NM_005868chr782531 2416 1891 1730 1534 554 208 196 1938 1733 12049
NM_005871chr103836 429 108 3901 692 176 1782 --
NM_005877chr2262472 2065 904 895 256 33 12491 22376 367 --
NM_005880chr1621041 194 --11253 1449
NM_005898chr1153171 2976 2690 827 85 --1190 --
NM_005901chr18138713 8673 7535 7232 6357 6112 5816 5380 5350 2843 2252 1677 751 58523 7732 5394 2825 1313 46158 5405 1630 1046 --
NM_005902chr1534441 4040 3632 13558 --14058
NM_005903chr584802 4594 4513 3650 3343 1927 1655 822 31739 1632 718 ----
NM_005906chr661083 499 352 189 152 87 --1243 --
NM_005909chr543702 3523 3225 569 23476 1425 23494 3347 13818
NM_005930chr142228 45 --3798 738 207 --
NM_005935chr484770 3755 3381 1319 811 795 301 166 11901 138 --
NM_005941chr8184183 4162 3820 3603 3276 3220 3082 2900 2880 1603 1525 1403 878 846 775 708 645 372 --1587 --
NM_005955chr1175446 5224 5116 5009 4548 4364 4329 4229 4121 3996 3832 2207 1638 1239 553 176 164 ------
NM_005964chr1771170 1036 589 517 491 244 234 --1270 --
NM_005966chr242236 1887 1583 250 --22312 932 --
NM_005986chr1352071 1935 828 801 614 12619 ----
NM_005999chr11308 180 1173 1257
NM_006016chr682257 2099 1554 1523 584 432 177 38 11877 ----
NM_006022chr132136 93 --1672 1702
NM_006033chr1892258 2030 924 825 681 602 590 577 536 ----12271
NM_006037chr254693 4670 4472 1766 1433 --24324 3435 11606
NM_006047chr2052778 2578 597 467 240 --1253 --
NM_006055chr2103064 3015 2645 2390 2240 691 583 476 384 218 43150 2557 2053 2006 1561 22943 169
NM_006080chr762916 2765 2625 841 361 315 12432 --12837
NM_006095chr4114535 4282 4161 3059 1699 1651 1405 1325 895 367 308 33171 2965 1184 21458 1385 1847
NM_006106chr1162434 870 573 306 262 144 11338 22907 339 --
NM_006108chr1141640 1504 442 106 --22094 1593 --
NM_006136chr73174 163 53 3868 483 107 127 --
NM_006139chr272840 2770 2679 2671 616 498 401 1545 22145 164 --
NM_006141chr1632281 555 342 --11964 12337
NM_006154chr1562817 2411 2221 1813 770 474 1515 42922 2833 2617 1096 12104
NM_006166chr124954 887 793 417 11716 21670 561 11744
NM_006197chr862083 2051 1972 654 239 134 ------
NM_006203chr595315 4633 4277 2193 1533 1404 1355 1227 1157 24597 4029 22001 964 --
NM_006206chr432592 2484 635 1616 22523 508 --
NM_006241chr382386 2291 2153 1994 1608 920 872 782 --32266 1967 542 --
NM_006251chr562836 2442 1275 861 272 71 23389 2169 1190 23060 1245
NM_006252chr1127614 7105 6368 6085 5429 5257 5208 2857 2749 2259 1379 1003 46585 5409 814 764 25286 4839 --
NM_006256chr14946 290 152 67 12067 --11701
NM_006267chr241357 1213 438 291 1452 2656 370 --
NM_006275chr2042504 985 548 518 1268 --1790
NM_006281chr881107 1061 1045 938 885 434 419 29 1380 ----
NM_006281chr881107 1061 1045 938 885 434 419 29 1380 ----
NM_006282chr2044577 4129 1902 1392 --11814 13647
NM_006283chr894478 4151 3408 1763 1375 1323 975 904 620 1885 34915 1786 719 --
NM_006287chr262117 1995 1715 860 309 72 32272 1036 256 22089 1783 11845
NM_006306chrX64490 4134 1292 885 587 534 21563 551 25863 2029 11973
NM_006330chr821528 41 1634 21201 313 11517
NM_006353chr6--11408 158 1951
NM_006364chr143998 307 56 173 1873 --
NM_006379chr752323 2155 1970 1669 1531 11957 --11584
NM_006380chr17174325 4312 4286 3960 3929 3759 3256 3137 2990 1680 1419 1211 1159 1127 972 288 132 22863 818 24077 3942 1335
NM_006393chr1094376 3667 2935 1755 1240 1041 611 423 93 31497 640 601 11268 --
NM_006420chr2093442 3338 2336 2320 2246 248 242 234 53 1890 --12439
NM_006434chr1072892 2532 2226 842 624 372 50 43185 3132 3017 941 ----
NM_006457chr483945 3932 3123 2650 1050 927 851 265 13609 23734 3483 23637 3384
NM_006467chr582361 2071 1965 1707 1487 917 355 322 11808 21905 1598 --
NM_006469chr131361 1347 137 --2467 273 --
NM_006482chr1293412 2681 2609 1242 1210 916 450 157 112 ----13153
NM_006489chr1492045 2038 1791 1763 1751 1672 1297 271 49 11832 1667 11947
NM_006504chr1042915 2527 2455 1183 11918 21086 752 1273
NM_006526chr2081985 1834 1667 1583 1525 1396 654 262 1515 1348 --
NM_006532chr1951363 831 728 641 377 --21909 1870 --
NM_006534chr2083451 2628 2490 1042 585 579 148 76 --13420 --
NM_006544chr14164814 4523 4457 4437 4408 4193 2138 1635 1629 1617 1463 1444 1343 1184 1178 379 45055 4633 1719 365 55315 4275 4072 695 628 25604 4109
NM_006546chr17106655 5553 4553 4428 2416 2392 2228 1245 915 390 1457 26207 2639 --
NM_006547chr742107 2071 1406 449 1858 1653 22147 846
NM_006561chr1084369 2462 1932 1673 996 665 562 31 14517 45903 5404 5351 3939 11017
NM_006572chr1763381 2846 1065 1004 936 464 12622 23312 3136 --
NM_006575chr1451352 1131 1018 436 103 --1357 --
NM_006599chr16208167 7991 7983 7587 7470 7128 6830 5826 5146 5060 2368 2221 2063 2000 1948 1527 1431 1263 901 240 35127 1884 1533 36031 5070 1992 25890 5049
NM_006601chr123759 180 128 ----1937
NM_006606chr20113143 2944 2911 2878 2650 1163 916 383 221 163 21 13137 ----
NM_006614chr373343 3226 3011 2244 821 582 319 --22583 2267 --
NM_006618chr161376 1348 1326 416 222 121 --1142 --
NM_006620chr644352 4158 3794 812 24470 1465 13388 13920
NM_006625chr13780 402 394 1849 1458 --
NM_006625chr13780 402 394 1849 1458 --
NM_006625chr13780 402 394 1849 1458 --
NM_006626chr992076 2058 1839 994 798 718 518 412 134 32617 2608 2534 11851 --
NM_006628chr15114404 4004 3987 3002 1839 1408 1026 937 839 715 96 --11802 --
NM_006629chr1832211 968 174 1215 1130 12845
NM_006636chr26972 816 680 645 366 230 --1847 --
NM_006644chr131688 --2459 253 185
NM_006646chr1352745 2477 2420 755 738 12110 --12434
NM_006654chr12154163 3900 3766 3589 3557 3302 1814 1770 1722 1001 827 667 226 75 69 3840 647 242 11562 --
NM_006699chr172348 2183 621 459 177 124 22 1723 1604 --
NM_006717chr9113256 3161 2915 2769 2376 2282 2221 1322 1094 800 221 32539 2230 276 1301 --
NM_006722chr392891 2504 2371 2134 945 918 459 308 185 --1887 1543
NM_006726chr451250 1078 251 140 60 --1887 --
NM_006729chrX145578 5115 4846 4466 4447 3850 3531 2227 2073 789 619 511 224 157 --1247 14362
NM_006738chr1574497 3416 3204 3181 2977 857 633 --13424 --
NM_006750chr16217740 7454 7267 6665 6282 5975 5444 5110 2964 2953 2582 2425 2260 1641 1286 1201 919 832 564 326 239 27049 6860 1895 16683
NM_006756chr831505 1404 32 --31328 1127 603 --
NM_006766chr882721 2331 2208 2136 1856 465 402 180 --12383 --
NM_006775chr682762 2536 2225 2096 1917 860 831 488 --1680 --
NM_006803chr842001 1382 649 44 --1267 11414
NM_006823chr821238 236 --11364 11016
NM_006826chr23932 915 229 ----11023
NM_006827chr14103307 3280 3204 2851 2824 1219 1118 847 606 421 ------
NM_006838chr122647 409 ----11183
NM_006873chr293263 3213 3077 2690 1287 662 617 560 358 --22724 812 12174
NM_006885chr1651426 1150 974 537 270 23591 2632 1846 13277
NM_006915chrX72374 2273 2029 930 388 224 179 42249 632 312 216 --1154
NM_006918chr11115590 5482 5131 4883 4346 4288 3616 3569 1605 748 372 45297 4561 1444 1089 33806 1927 118 24932 3818
NM_006922chr242001 1601 578 335 --21645 431 11906
NM_006924chr17144414 4353 3932 3389 2758 2704 1627 1455 1333 1258 896 705 671 73 23772 3655 1430 12920
NM_006948chr2131991 957 717 22110 55 12484 12177
NM_006996chr151532 1460 1437 1384 165 1713 21247 577 --
NM_007006chr1653555 3097 1217 606 394 1659 22191 307 13417
NM_007007chr1274776 4675 3348 3219 3066 1798 282 --14446 --
NM_007011chr15106860 6380 6011 5206 2737 2693 2450 1878 385 182 12065 46801 5992 5843 575 --
NM_007038chr21136038 5993 5742 5440 4510 4215 3861 2306 2061 2010 1162 511 495 34385 4126 708 44962 1727 622 349 25917 4166
NM_007039chr1442186 1634 342 307 1687 22024 1647 --
NM_007073chr674239 3712 3304 3296 3273 1599 392 54156 3725 3112 2864 1044 33690 2744 2630 14046
NM_007084chr1341549 1402 1275 1180 --31061 578 220 --
NM_007106chr1362705 2034 1994 1724 883 87 11747 32643 595 300 --
NM_007111chr133281 258 251 ----1829
NM_007114chr363210 3169 2835 2280 240 208 22746 1192 22813 1002 --
NM_007125chrY51448 437 377 320 294 ------
NM_007137chrX95534 5048 4591 4560 4031 3904 3434 2061 1639 ------
NM_007150chrX62031 1374 557 486 473 249 11715 ----
NM_007153chr1974293 4136 4039 2927 2876 1588 190 13391 23878 3198 --
NM_007157chrX42537 2342 2221 91 22765 992 22932 548 --
NM_007159chr361677 1521 1437 1103 491 365 --41728 1529 547 79 --
NM_007173chr1142315 1762 808 142 2772 498 2937 175 1211
NM_007175chr843425 3390 3006 348 23111 2689 23281 2442 13057
NM_007195chr1883662 2473 2328 1449 871 765 220 42 33181 2351 2286 ----
NM_007200chr1574497 3416 3204 3181 2977 857 633 --13424 --
NM_007203chr953724 2700 2564 1282 482 11565 31148 988 823 189
NM_007212chr141869 804 556 46 --32164 1498 288 --
NM_007231chrX42455 2369 967 252 22106 760 ----
NM_007249chr13169448 8902 8128 7768 7356 6830 5700 3635 3586 3079 2906 2890 2221 1819 1412 645 38327 1126 275 35817 5791 2668 --
NM_007287chr363247 3097 2056 946 785 538 12956 1214 33053 885 574
NM_007288chr363247 3097 2056 946 785 538 12956 1214 33053 885 574
NM_007289chr363247 3097 2056 946 785 538 12956 1214 33053 885 574
NM_007331chr462498 1983 1756 632 609 551 142 12693 --
NM_007332chr871329 1096 1090 1077 1029 323 100 --11188 --
NM_007347chr1553193 1152 1003 714 585 --1961 --
NM_007350chr1254643 4431 4016 1450 877 13335 1372 12886
NM_007373chr1041728 1275 1198 46 31507 153 77 31538 1459 1318 --
NM_007375chr172767 2468 2282 2194 690 550 352 21742 528 12738 --
NM_012081chr583594 3084 2350 1228 943 678 427 147 11058 23604 2638 --
NM_012089chr131089 291 118 --21384 1272 1514
NM_012095chr1052245 2220 1120 519 63 12952 32861 2464 732 --
NM_012096chr343679 3556 3019 2507 ----1345
NM_012102chr192622 2170 2131 1882 1866 880 634 593 582 ------
NM_012104chr1173436 3362 3159 2676 2530 475 306 11247 --22963 564
NM_012104chr1173436 3362 3159 2676 2530 475 306 11247 --22963 564
NM_012141chr13124003 3135 2720 2522 1213 1090 743 523 300 172 108 84 24116 806 22568 150 1570
NM_012164chr9167507 6968 6902 6451 5821 5778 5663 4644 3031 2680 2540 2143 1988 1824 230 220 26411 6220 47064 5552 2621 1208 25257 132
NM_012180chr43483 154 146 ----1680
NM_012193chr1154513 3873 3472 733 30 15427 22083 407 --
NM_012214chr2106381 5980 5748 5021 4125 2396 962 591 372 131 26050 612 45500 2536 1778 253 --
NM_012223chr281242 1203 1094 1022 903 443 304 226 ------
NM_012234chr363442 3116 2890 1421 951 823 13734 23706 890 1238
NM_012247chr105872 670 364 257 47 1780 ----
NM_012249chr253253 3013 2311 1274 35 33231 2942 2279 23378 2663 13029
NM_012252chr7125254 5247 4609 4555 4386 3738 3253 1940 1109 793 631 387 45091 3831 3310 1193 33418 1979 1068 14239
NM_012259chr641291 947 126 45 --1924 1252
NM_012262chr175263 4617 4106 1712 1566 1443 379 44966 4333 3801 1079 24364 896 24021 3967
NM_012281chr742268 2084 1766 888 --11733 --
NM_012287chr3124309 4162 3751 3685 3277 2898 2783 1387 1043 888 557 231 24396 220 34341 3254 1432 24218 1163
NM_012288chr6125430 5180 5148 4736 4457 2014 1895 1725 899 884 360 193 --15671 --
NM_012297chr472448 2386 2240 1922 1882 915 719 11761 2663 108 --
NM_012316chr1125468 5434 4503 3536 3482 2267 2082 2032 1937 1533 1231 883 14009 ----
NM_012330chr1081600 1547 1243 692 631 523 218 41 11465 11755 1128
NM_012334chr563882 3526 3439 3416 1019 949 ----13493
NM_012382chr582899 1809 1262 1183 899 741 502 483 23370 3199 12871 --
NM_012397chr1881752 1719 1673 1578 1395 1278 1254 424 --11711 --
NM_012399chr2231842 1733 404 ----1631
NM_013231chr14104036 3954 3695 3413 3378 3206 1764 1757 462 187 11035 ----
NM_013233chr271370 1242 924 392 266 107 83 1282 --1899
NM_013250chr113430 261 160 2510 50 11157 11267
NM_013255chr7238875 8625 8142 7980 7892 7815 6656 6360 6311 6125 5698 5545 5519 3493 3458 2579 2211 2155 942 800 440 416 366 53364 2902 2607 982 912 --27745 1965
NM_013257chr861859 835 263 104 64 24 11866 --1581
NM_013261chr463335 3132 3020 2732 2652 75 12358 1417 --
NM_013262chr63502 59 49 --1456 --
NM_013269chr1264172 3880 3409 3202 1405 59 44393 4214 465 372 13347 --
NM_013302chr16114707 3822 3486 1785 1775 1721 1518 607 601 588 138 13590 1264 --
NM_013309chr1552316 1726 1716 845 361 12410 12596 12460
NM_013372chr1541224 1064 586 231 --11078 13230
NM_013374chr382913 2632 1926 1248 1123 877 551 426 23102 1007 12275 12252
NM_013381chr1252439 1643 1536 945 619 11827 12070 --
NM_013386chr191569 1274 1172 722 625 610 457 443 330 21434 712 ----
NM_013436chr22669 140 --2565 72 1240
NM_013437chr871312 1134 931 476 316 305 240 21280 51 1186 --
NM_013450chr251055 930 922 381 374 --2979 153 --
NM_013943chr162130 2108 1108 872 803 306 32917 2504 1119 --12998
NM_013989chr1473751 3430 1664 1517 1250 520 409 13301 34514 3453 1375 --
NM_013995chrX52384 762 738 290 255 12377 12163 1320
NM_014005chr572831 2773 2414 1961 1054 967 470 ----1206
NM_014011chr22313 235 ----11881
NM_014021chr193107 2959 2459 2385 2317 1370 1083 796 619 33235 1311 167 ----
NM_014023chr1022820 83 12485 32654 646 595 --
NM_014028chr6113278 2905 2852 1164 1124 841 526 299 269 224 130 11218 --12870
NM_014033chr1251965 1755 1523 892 798 1792 22310 1937 --
NM_014034chr651488 1335 975 559 302 --4428 356 178 55 --
NM_014043chr31346 2500 151 21432 21 --
NM_014057chr951520 1359 1295 520 109 ----1258
NM_014089chr133273 59 41 11607 21726 1714 1293
NM_014106chr1542517 2299 1143 314 21100 881 --12846
NM_014109chr841235 1176 401 52 144 ----
NM_014112chr8115418 5074 5005 2196 2190 2049 2018 795 754 733 398 --35164 1662 407 --
NM_014141chr794315 4137 3601 3371 2012 1889 1831 1501 1441 25316 3557 24986 493 11433
NM_014155chr11187186 6338 6256 6230 5967 4881 4708 2955 2536 2258 2084 1864 1417 1349 818 581 266 102 16590 17203 12329
NM_014181chr252721 2641 2521 2041 179 1811 1762 --
NM_014191chr123967 765 355 ----21056 996
NM_014250chr2252040 1993 630 621 41 21860 1559 1404 --
NM_014253chrX52493 2236 1850 668 389 1817 12291 --
NM_014267chr113891 875 312 1699 2320 184 1685
NM_014331chr4177592 7117 6828 6608 5177 4749 2521 2510 2471 2222 2162 2142 1870 1235 1003 727 68 26971 3067 27793 7782 16433
NM_014333chr1152241 2217 1908 1790 399 144 12769 12129
NM_014342chr11----11421 1107
NM_014368chr931476 1425 732 2357 274 1528 12012
NM_014382chr361761 1608 1588 1239 435 104 --2530 419 2373 55
NM_014393chr872347 2171 2040 472 273 224 169 1738 --11490
NM_014415chr351671 1326 683 585 331 21555 180 --1546
NM_014423chr574975 4818 4786 4661 4563 4018 1539 --33605 1709 878 --
NM_014447chr481552 1543 1416 1380 1305 632 436 263 11627 1465 --
NM_014458chr131438 1068 543 1324 11329 21386 343
NM_014494chr1621495 715 1206 21918 361 1806
NM_014517chr341555 1340 765 737 21772 1724 11397 --
NM_014572chr1351781 1763 1679 699 287 11403 1480 --
NM_014584chr1451427 1351 1325 1145 658 21416 1182 ----
NM_014615chr1682517 1077 861 841 518 326 193 51 ------
NM_014616chr3113234 3213 3194 2897 2228 1358 820 789 585 440 304 22275 391 22133 576 --
NM_014635chr221466 302 144 --1561
NM_014636chr963928 3892 3882 3050 1662 1141 13327 23235 3002 --
NM_014637chr821079 925 ----1457
NM_014666chr52454 255 1286 1213 1836
NM_014701chr1573007 2587 1193 1142 976 643 51 13173 12308 --
NM_014702chr673112 3030 2853 2815 2787 2491 637 33304 1344 979 23426 3390 --
NM_014705chr761991 1487 1387 1307 618 227 21868 42 ----
NM_014711chr1661729 1518 1334 745 435 154 2789 71 31351 552 118 --
NM_014721chr6227426 7128 6912 6704 5662 5409 5345 4926 4756 4720 4691 4684 2517 2148 1889 1802 1618 1567 1560 1342 598 574 67458 6999 4971 2748 1090 107 32892 2113 1657 --
NM_014730chr12104919 4611 4226 2110 2068 1508 1497 1325 799 294 11178 1723 --
NM_014730chr12104919 4611 4226 2110 2068 1508 1497 1325 799 294 11178 1723 --
NM_014735chrX52067 1913 1887 1347 1339 11672 2781 639 --
NM_014739chr6113486 3134 2581 2554 1298 1103 972 818 770 734 697 --148 --
NM_014746chr264391 3586 3561 3412 1137 1057 23686 1658 21199 1106 --
NM_014751chr8--2495 277 --11652
NM_014752chr1151234 782 771 654 388 --1459 --
NM_014755chr273265 3238 2729 2668 629 351 248 ------
NM_014765chr172543 2102 1954 1858 726 159 151 1484 ----
NM_014774chr193263 3164 2816 2115 1146 960 930 835 778 145 2790 179 --
NM_014776chr1262403 1266 845 571 411 203 1860 --1175
NM_014779chr34779 755 459 138 1427 ----
NM_014781chr831094 270 160 1828 1501 2817 463
NM_014810chr163536 3361 1295 1170 856 518 13500 22458 535 --
NM_014812chr1101995 1715 1584 1546 787 621 477 436 430 27 ----1184
NM_014820chr351995 1962 1645 1402 523 --1783 1806
NM_014826chr1104054 3836 3617 3558 3514 3489 3436 3355 2914 1474 --34123 1686 1488 --
NM_014827chr151192 1040 428 211 202 --31666 193 89 --
NM_014830chr1283866 2995 2883 2785 2746 2619 740 467 1631 12917 --
NM_014838chr2282651 2474 2451 2075 1128 1087 1079 628 --1335 --
NM_014839chr141985 1645 929 419 22288 502 1308 --
NM_014841chr621214 333 ----11248
NM_014850chr364676 3184 1948 1827 1470 1160 13353 11059 11071
NM_014860chr241644 1024 799 451 3629 438 305 ----
NM_014873chr1114876 4625 4572 4549 3943 1797 1671 1536 1109 928 683 --14191 --
NM_014883chr472124 1958 1865 1842 517 502 384 --22373 131 --
NM_014893chrY62092 1605 1538 927 877 824 --1295 --
NM_014904chr1053708 3578 3539 2966 1219 12846 12742 1195
NM_014905chr261985 1938 1536 815 793 111 139 ----
NM_014912chr1083381 3260 3221 2563 977 567 503 307 --43075 2940 1339 855 --
NM_014918chr1551542 1489 1188 492 441 11461 21594 525 --
NM_014920chr6103496 3268 3255 2968 2838 2694 2652 765 744 603 12784 12607 13377
NM_014923chr1362190 1942 1905 782 478 132 11925 1124 --
NM_014926chr361119 737 441 328 265 217 --1384 --
NM_014932chr331743 550 419 --124 193
NM_014934chr1362768 2526 1341 1084 862 746 43777 3092 1596 1529 --1899
NM_014946chr222368 1166 12160 12429 12980
NM_014947chr173050 2607 2401 906 823 457 322 13166 --12413
NM_014959chr19123282 3111 3020 2367 2327 2218 2178 833 823 389 240 76 --32920 1298 259 11129
NM_014982chr14125444 4639 4612 3308 2078 2015 1992 1461 796 706 632 328 44328 3868 1776 409 11532 11943
NM_014988chr442356 2281 941 622 32744 2260 2087 2774 34 --
NM_014991chr463294 2661 1183 635 322 144 23312 93 --22843 1133
NM_015000chr1242499 2029 2002 1067 22859 967 1909 1368
NM_015002chr1252166 800 717 705 320 21809 1683 1569 --
NM_015017chr111155 1123 137 1114
NM_015020chr1673787 3646 3451 2524 596 255 207 13157 2658 621 --
NM_015025chr252652 2481 2380 862 283 --21711 461 22535 2506
NM_015026chr1284749 4025 3361 3078 1650 1058 848 715 24160 589 34435 4096 2923 --
NM_015032chr1362511 2152 1833 795 587 474 22902 1842 22493 491 --
NM_015035chr20106588 6155 6046 5376 5100 2039 1849 1464 985 717 24711 4300 ----
NM_015039chr164228 3425 3264 2974 947 467 22837 969 24299 898 --
NM_015040chr283342 3153 3022 2909 2300 1311 803 780 ------
NM_015042chr1574228 2809 1273 1086 461 260 121 2615 81 --13992
NM_015045chr1062144 1712 1575 1439 473 115 --21838 653 --
NM_015049chr253233 2837 2582 689 604 --23007 2468 --
NM_015071chr596554 6297 5982 4317 2510 1304 297 263 74 --15686 --
NM_015074chr184804 4542 4081 3476 3453 3404 1937 61 14347 --14399
NM_015076chr684302 4263 1819 1654 1562 969 695 543 1101 11111 14105
NM_015087chr1382480 2324 2281 2262 2237 2059 1901 1012 21026 158 1319 --
NM_015115chr452812 2242 1973 1264 1177 --2621 537 --
NM_015129chrX2211 59 134 11758 11508
NM_015137chr852297 1985 1894 1814 676 ------
NM_015149chr181898 1527 886 819 791 760 225 97 12071 ----
NM_015153chr66749 617 611 601 120 112 1568 --1489
NM_015156chr1494043 4003 3995 3932 3881 3246 3217 1397 414 12800 11457 1662
NM_015191chr1142387 2100 1798 55 31922 1101 336 21933 1916 --
NM_015192chr2092759 2675 2370 2261 1992 903 621 465 414 22288 925 1756 12398
NM_015199chr352353 2342 708 476 322 12940 52523 1194 894 832 684 --
NM_015200chr461031 988 716 415 339 147 11890 ----
NM_015208chr1883494 3196 1072 996 938 235 210 148 12768 13394 --
NM_015215chr153075 2249 546 327 57 12445 1726 --
NM_015216chr531266 1238 1031 ----1465
NM_015225chr972429 2115 2087 529 256 194 117 --2813 657 12261
NM_015230chr431826 1580 1170 11868 21649 1457 --
NM_015233chr134679 617 403 332 --11870 --
NM_015247chr16105406 5201 5182 1422 1355 1349 1184 760 659 611 14877 45396 4172 1994 394 --
NM_015265chr242447 2070 1663 57 22419 618 1603 11807
NM_015271chr4104329 4119 3481 3026 2772 1557 1328 1086 794 109 24155 417 ----
NM_015272chr1682027 1782 1317 677 538 332 285 167 --1863 --
NM_015278chr652374 2108 1117 475 356 13382 --12902
NM_015291chr183097 3031 2654 2629 2416 2342 1124 249 --13543 --
NM_015310chr8118152 7595 6674 5972 5921 2816 2337 1738 1253 700 665 16195 77801 6638 6046 5989 5807 5790 3097 15230
NM_015313chr1164795 4667 4405 3377 1086 250 24218 3046 34307 3549 886 --
NM_015317chr262580 2490 2192 2121 2098 140 ----1120
NM_015323chr621591 361 1340 11124 11464
NM_015328chr7102214 1946 1226 1144 1034 786 626 435 311 278 12649 23048 270 --
NM_015335chr1232605 1698 594 12524 11645 --
NM_015344chr842150 1931 53 43 1832 2342 155 --
NM_015347chr1252670 2411 1076 944 156 --2251 241 --
NM_015349chr683084 2878 1899 1229 1047 903 377 254 1990 32622 2599 1913 --
NM_015355chr1721694 1295 21848 1404 3699 536 500 --
NM_015365chrX114289 4156 3758 3077 3001 2937 1488 1124 1062 368 337 23610 2989 198 24312 701
NM_015385chr1072892 2532 2226 842 624 372 50 43185 3132 3017 941 ----
NM_015387chr241916 717 620 286 2795 362 21785 62 --
NM_015393chr463314 3125 2992 1255 365 190 43753 1120 499 390 23653 960 --
NM_015394chr1272210 2195 1690 1625 948 580 316 ------
NM_015429chr34187 83 49 33 2976 74 2858 270 --
NM_015431chr183599 3238 2529 2280 713 578 398 224 21241 95 12476 --
NM_015435chr831266 543 494 1474 1553 --
NM_015436chr4113064 2923 2874 2501 2224 2188 2150 1242 1162 913 343 1772 13383 --
NM_015446chr151092 524 339 188 32 11381 1418 --
NM_015455chr5103509 3356 2712 2685 1441 1398 1284 382 260 238 31518 1459 1315 33275 1378 506 13180
NM_015458chr8115159 4911 4580 4317 1255 1167 516 486 294 278 240 34218 4210 270 31347 1322 380 --
NM_015464chr71303 ----1656
NM_015472chr34509 208 202 149 ----1488
NM_015472chr34509 208 202 149 ----1488
NM_015484chr12903 754 1793 --1607
NM_015496chr8------2322 224
NM_015508chr331518 1417 124 2613 396 --11269
NM_015509chr1281526 1394 1273 1227 1169 1041 532 88 1402 ----
NM_015534chr131084 160 55 ----21023 938
NM_015535chr274171 3756 2818 2781 1370 1276 979 12824 1133 --
NM_015550chr793339 3294 3285 3279 3256 1164 849 834 537 12894 43406 2945 2417 2341 1241
NM_015553chr6105164 5048 3564 3401 1593 1447 1234 1140 1073 178 11368 ----
NM_015560chr392892 2388 1787 1107 705 668 462 258 210 22309 842 32135 902 499 --
NM_015564chr5123386 3037 2927 2902 2891 2714 2704 2580 2249 2243 1163 44 32649 2498 2229 22348 313 --
NM_015569chr1144588 4201 3832 3679 3448 3394 3169 1670 1585 1551 894 850 442 67 21624 475 33965 1396 270 --
NM_015571chr651911 1731 902 887 22 --32256 865 720 --
NM_015575chr2113509 3223 2818 2387 2313 1470 926 768 374 335 173 11246 22342 839 185
NM_015576chr3112581 2498 2371 2264 2107 1031 796 625 384 296 229 --12155 --
NM_015601chr106900 835 399 383 344 96 --148 --
NM_015602chr141797 1443 1168 149 11489 21128 187 1441
NM_015605chr1041479 1108 591 308 --1196 1979
NM_015608chr101604 1104 1641 2660 226
NM_015640chr1114842 4656 1854 1776 1607 1434 949 758 553 359 119 34986 3722 1513 13407 11016
NM_015660chr72267 225 --1290 137
NM_015713chr883337 2906 2782 2482 775 502 454 56 33358 2745 1372 43557 3112 2849 1164 23378 1101
NM_015866chr141430 1281 1046 1039 1428 ----
NM_015878chr841360 745 136 122 21607 706 --11747
NM_015879chr18168237 7998 7611 7270 7020 6230 2707 2124 2039 1385 1348 1341 1276 1148 880 304 1112 58637 8532 7447 3110 1178 17679
NM_015886chr894920 4397 4092 2274 2108 686 467 297 199 --35568 5507 4812 14712
NM_015888chr183255 2985 2645 2325 2266 2204 1284 1080 --22927 1343 --
NM_015891chr651795 1434 223 172 160 --21979 33 --
NM_015906chr1124539 3414 3091 2995 2959 1843 1423 1408 1097 912 546 530 11620 --21596 653
NM_015975chrX4680 672 565 497 11243 --11663
NM_015984chr12391 58 ----1510
NM_015994chr144656 562 498 47 3259 139 86 --1179
NM_016009chr174502 4203 3767 1185 1045 1032 910 31417 780 369 23744 1489 13158
NM_016021chr672815 2760 2717 2688 2298 1901 918 --22155 224 --
NM_016023chr831815 1514 227 1269 21918 369 --
NM_016045chr2021696 503 --21391 1260 11803
NM_016072chr124740 468 270 55 127 12124 --
NM_016076chr162953 2862 2339 1050 917 803 ------
NM_016078chr172948 846 1315 --11140
NM_016083chr673201 2921 2875 2401 1254 1018 392 22579 627 22687 2628 --
NM_016087chr771650 1596 1388 1079 1069 624 403 21482 455 ----
NM_016096chr862045 1903 1693 1363 751 131 1290 1586 --
NM_016099chr851316 1180 563 348 93 2288 129 ----
NM_016124chr1----11056 21382 186
NM_016131chr2101840 1625 1539 723 598 471 227 133 78 41 --2736 311 --
NM_016132chr15113256 2853 2803 2141 2095 685 656 549 526 254 63 1786 11099 22238 1171
NM_016206chr3159006 7766 7669 6158 5821 3367 2275 2219 1887 1599 1501 1422 442 398 293 22011 1771 58742 8493 7938 7837 7805 --
NM_016217chr673086 1384 1100 822 578 559 29 --21334 1031 1717
NM_016224chr641800 1363 233 193 11569 22132 1823 --
NM_016248chr1343450 2465 1478 510 23483 206 --23647 563
NM_016255chr683317 3218 1224 1164 1143 1103 1056 623 1943 --11328
NM_016260chr2127075 7038 6902 6224 4974 2980 2204 1872 1761 1620 266 158 42129 1895 1543 1241 46947 2077 1887 1707 --
NM_016271chr1882290 2013 1919 1871 1823 1648 118 74 1338 1547 --
NM_016275chr352636 2513 2368 901 45 1884 --12203
NM_016277chr621644 1487 --21259 1065 1625
NM_016289chr272160 1449 854 795 745 222 127 ----12135
NM_016297chr263792 3419 1033 311 108 102 33387 1232 914 ----
NM_016308chr131940 1466 243 --21294 527 11411
NM_016315chr23454 325 158 41674 703 297 58 1473 11330
NM_016322chr942039 1089 800 27 1572 1621 12621
NM_016374chr12428 422 21193 397 1101 --
NM_016374chr12428 422 21193 397 1101 --
NM_016376chr1784249 4059 3486 3474 2926 2782 238 155 --23049 320 --
NM_016377chr641722 1452 1189 615 1344 11682 --
NM_016396chr1593038 2803 2751 2431 1903 800 601 423 76 22568 677 ----
NM_016422chr1133119 177 103 1851 33066 1006 138 --
NM_016436chr2042099 1896 1063 161 1794 22548 449 12126
NM_016442chr592324 2144 1864 1814 1729 1548 769 747 741 32366 1796 644 1651 12135
NM_016472chr1451528 1275 284 256 218 1522 21255 275 --
NM_016485chr621716 855 22159 190 --11394
NM_016507chr1732419 1946 272 --42771 2609 2466 81 --
NM_016513chr6103496 3268 3255 2968 2838 2694 2652 765 744 603 12784 12607 13377
NM_016530chr15113692 3568 3367 3178 3023 2902 1290 808 714 519 319 12921 --22832 858
NM_016531chr453101 2756 2610 1440 1154 1726 33073 1379 1232 --
NM_016542chrX41359 1110 443 272 11278 3251 166 146 --
NM_016544chr243038 224 152 125 --23116 1212 --
NM_016575chr1255245 4114 1793 1559 1244 65443 5419 4961 4367 4332 3531 33849 1112 522 --
NM_016577chr343904 1285 418 323 13132 1208 14174
NM_016603chr531975 1481 115 --11730 11885
NM_016605chr552760 2273 2220 2108 651 --12372 12302
NM_016607chrX51201 676 305 248 45 11683 ----
NM_016824chr1051789 757 535 175 74 11815 --11662
NM_016936chr1661865 1833 883 683 677 657 --12111 --
NM_016953chr2116074 6005 5891 5735 5635 4992 3969 1875 1865 1482 50 --11519 15720
NM_017412chr821070 283 ----11184
NM_017420chr141376 2956 84 11247 1275
NM_017423chr451810 1492 666 553 85 --22007 1690 --
NM_017437chr1421573 1550 11739 21540 674 --
NM_017447chr21154127 3698 3470 3128 3092 2994 2874 2855 1016 449 433 277 199 160 91 13368 34407 3519 189 --
NM_017519chr61430 ----21306 133
NM_017548chr33404 286 64 11376 32137 1601 1498 --
NM_017553chr1531240 1145 516 11192 --11133
NM_017563chr3166092 5932 5642 5587 5197 4795 4279 3893 1815 1688 1622 1254 1090 1059 663 337 24101 494 ----
NM_017594chr952479 2279 1247 977 485 --2867 627 --
NM_017610chr1512026 --1228 1733
NM_017628chr4125277 5231 5147 4917 4906 4751 4736 4724 3768 3383 1070 488 33641 456 210 14951 14490
NM_017633chr663524 3098 2803 1386 949 34 11407 23396 2546 --
NM_017634chr851988 1612 1380 665 571 1212 11651 --
NM_017637chr9189191 8703 6984 6653 5857 5773 3431 3195 3110 2307 2294 2172 2018 1793 1650 1306 881 549 1663 18507 13646
NM_017641chr122762 363 ----1794
NM_017643chr1763030 2946 964 845 566 153 22790 2151 22872 1148 --
NM_017644chr3115190 5019 4767 4505 4233 2072 1675 1276 1208 826 580 24856 3169 24269 1823 1410
NM_017650chr7105421 4765 3913 3716 3696 2055 1956 1829 1128 647 24494 238 25832 917 25273 2356
NM_017651chr631137 222 213 ----1377
NM_017658chr14114630 3796 3183 1690 1664 1650 1525 1039 837 645 474 44670 4576 4260 3050 23473 1808 --
NM_017666chrX72038 1913 1877 1740 1686 1403 415 --2788 382 --
NM_017719chr332160 129 74 --187 11994
NM_017737chr132077 1800 841 22182 263 1254 --
NM_017752chrX31760 1682 145 1377 1493 --
NM_017754chr684933 3822 3255 1482 1303 1135 663 314 23947 710 ----
NM_017761chr131382 293 81 --21054 599 --
NM_017769chr14113213 3129 2886 2726 2572 2260 2052 982 974 408 219 13036 22190 931 --
NM_017770chr672959 2804 2470 2334 727 462 456 1823 1122 --
NM_017778chr861160 1105 452 373 317 119 21268 1183 --1253
NM_017798chr2061158 979 476 390 317 284 1399 --11274
NM_017799chr1421938 696 1181 2310 221 --
NM_017813chr8135292 4838 4740 4488 4232 3961 3860 3766 1723 1062 844 731 725 --2309 223 14254
NM_017824chr1042594 924 236 70 11823 12253 --
NM_017831chr1834793 4583 4095 33637 844 529 --23236 46
NM_017848chrX114150 3995 3928 3795 3654 3562 3366 3050 3013 1652 1616 1981 33258 1588 1441 --
NM_017922chr142658 637 --1225 1195
NM_017938chrX31836 1777 1735 11723 --1883
NM_017946chr741163 427 367 166 1135 --1967
NM_017952chr263917 1438 1336 745 684 208 ----13068
NM_018015chrX71010 908 826 296 290 258 175 --164 --
NM_018018chr1231819 1587 1407 21856 1339 11732 1431
NM_018046chr551913 1798 1762 1618 716 2427 266 21654 159 --
NM_018084chr273268 3073 2908 2639 2393 2386 817 2953 434 32237 368 117 1972
NM_018085chr198154 7957 7691 5456 5360 1832 1528 1411 452 12655 151 1378
NM_018133chr342069 1490 652 403 --31670 1637 503 --
NM_018155chr393355 2924 2750 2152 1351 1161 977 253 116 13287 --1830
NM_018178chr141641 1544 261 169 22042 1413 194 --
NM_018181chr1831635 1233 700 21982 1209 2364 269 --
NM_018200chr1592043 1966 1807 1786 1047 973 570 485 275 --22140 269 --
NM_018222chr1151688 1199 555 405 339 11263 --11192
NM_018225chr985285 5134 5099 4073 1925 1875 1160 913 --24598 4083 12153
NM_018227chr462895 2467 1269 1076 782 360 1245 21962 749 --
NM_018229chr1431095 975 262 --1445 2911 780
NM_018243chr4103809 3752 3581 3488 2907 1540 1168 992 557 132 --13958 --
NM_018247chr663143 3105 2904 2362 679 95 --42682 2228 739 482 --
NM_018254chr132265 513 44 --32393 456 92 --
NM_018270chr201669 ----1650
NM_018293chr3122952 2919 2624 2579 2221 2156 2034 1986 1865 1066 1019 83 --12260 1404
NM_018299chr873189 2735 2418 590 399 255 64 1941 43010 2985 2642 935 --
NM_018312chr1142097 1510 833 446 --31993 1346 754 --
NM_018313chr372499 1879 1751 315 165 134 58 1847 ----
NM_018323chr461893 1332 1172 519 485 181 --1567 --
NM_018339chr951720 684 665 599 160 --21822 1359 --
NM_018340chr1664604 3621 3534 1086 841 671 --34704 3750 41 23414 555
NM_018351chr1284401 4371 4257 3898 3107 1806 995 310 1182 33729 787 260 --
NM_018361chr893523 3428 2639 2523 1395 759 590 252 46 ------
NM_018362chr11143697 3490 3088 2961 1529 1270 1179 831 675 512 416 145 130 27 44022 755 631 362 11200 1157
NM_018364chr1104062 3817 3659 3436 3333 2522 1027 1010 912 839 --13911 --
NM_018367chr1152359 1792 1779 1580 1558 21964 990 11666 --
NM_018373chr14106076 5988 5870 5265 4730 4644 4362 4039 2524 1938 2835 703 11847 24241 4226
NM_018374chr7145188 4750 4340 3697 3239 2106 1816 1808 1801 1727 1656 1263 929 524 22090 1105 34026 1721 1256 1716
NM_018383chr232007 318 93 12062 21698 577 --
NM_018401chr441479 1317 1193 217 1650 31900 1630 331 --
NM_018403chr3123996 3762 3718 3292 3266 1576 1250 898 760 563 250 128 23739 1126 1657 21400 1302
NM_018409chr473220 2132 1288 1084 1033 855 268 2485 462 1383 22575 902
NM_018424chr971565 1525 1381 1174 532 445 425 --1277 --
NM_018429chr552343 2245 1076 634 448 12863 12938 --
NM_018439chr1852497 1044 524 508 297 21859 447 ----
NM_018440chr8178480 8254 6757 6724 6487 5795 5647 3393 3360 2940 2928 2687 2427 2320 1680 1136 374 27114 6632 47061 6129 5531 1353 --
NM_018448chr1241232 944 886 25 2381 306 1506 --
NM_018452chr6_random83335 3262 3164 2638 2631 2579 1366 743 ----1215
NM_018477chr1441057 919 684 377 2719 661 --11034
NM_018490chr1151791 1455 374 320 157 11801 122 11668
NM_018557chr261680 1660 1551 1515 314 169 --1181 --
NM_018566chr1125069 5041 4984 4660 4382 4336 3691 2032 1803 1308 935 810 --13912 --
NM_018638chr12115623 5052 4557 4537 4216 3596 2207 2090 2051 1601 149 --64565 4313 3789 3552 2027 775 1476
NM_018640chr1292459 1954 1932 722 698 634 441 360 287 12588 1349 --
NM_018652chr156920 760 649 392 168 38 1160 --1216
NM_018657chr34277 104 90 35 2613 309 1230 --
NM_018685chr731092 917 248 11060 --1419
NM_018695chr531841 1540 730 1903 181 11864
NM_018698chrX51963 1457 546 431 24 11552 1189 --
NM_018700chr541720 1557 563 373 1670 --11301
NM_018704chr152037 1787 1662 327 299 --1141 1449
NM_018841chr193903 3810 3731 3426 3418 3184 2594 497 148 23584 2944 23979 3356 12875
NM_018945chr693683 3594 2857 2667 2306 945 734 485 182 --12384 --
NM_018947chr764826 4669 4299 1846 726 433 14722 14790 13937
NM_018948chr141456 1423 511 453 21313 522 ----
NM_018970chr7133185 2991 2874 2638 2555 2390 2296 2107 2011 1951 621 443 164 23011 719 12860 1934
NM_018976chr1272350 2265 1769 1760 711 432 417 32124 1860 699 22864 366 --
NM_018999chr10114579 3865 3203 3193 3168 1608 1531 1333 957 911 884 13812 44406 1759 1142 198 23560 1453
NM_019001chr3114661 4196 3656 3649 3360 3158 3106 1014 396 320 130 24515 1480 24574 94 --
NM_019008chr2272544 2378 1515 380 350 191 169 12466 ----
NM_019022chr18122968 2929 2721 2677 2394 2236 2100 1247 1116 804 392 261 156 ----
NM_019027chr461912 1850 1055 962 708 364 22575 1026 42390 607 432 177 162
NM_019035chr462064 1981 691 489 471 318 ------
NM_019036chr661262 1066 897 455 68 26 ------
NM_019050chr461845 1611 773 567 395 350 32141 2048 136 12102 --
NM_019053chr10--1335 4419 213 188 157 --
NM_019072chr594267 3608 3555 3472 3459 3416 3321 345 273 13862 24155 4031 14142
NM_019080chr1391482 1463 1229 1153 1018 973 360 199 166 1229 11288 --
NM_019087chr541547 121 107 61 21497 1167 1375 --
NM_019094chr12103555 2829 2539 831 638 584 561 514 305 273 13441 21538 1043 --
NM_019114chr951969 1560 631 489 405 21720 445 1349 --
NM_019556chrX4493 448 101 74 ----11003
NM_019593chr2072607 2357 2161 561 348 57 23 1164 1528 12938
NM_019596chr2182779 2335 2019 1187 1123 709 344 43 --11102 --
NM_019885chr232649 2448 2030 21843 224 22662 2257 --
NM_019903chr1051789 757 535 175 74 11815 --11662
NM_020122chr2105801 4290 3984 3733 2352 2047 1879 1736 1726 1458 35736 5459 853 1162 --
NM_020133chr6136154 5652 4838 4770 4171 4007 2428 2146 1959 1893 1429 1190 1078 11438 ----
NM_020141chr162394 2150 1754 876 785 778 ------
NM_020144chr771902 1801 1749 835 712 690 352 --22024 456 --
NM_020152chr215951 808 319 203 189 ------
NM_020159chr481478 1261 1128 1069 700 503 492 434 --1237 --
NM_020177chr562957 2824 2763 2398 2085 109 192 63199 3154 2742 500 434 307 --
NM_020245chr664413 3850 3817 3564 1705 223 21825 169 14238 --
NM_020297chr12133623 3406 3294 2895 2794 2702 2287 1267 1240 987 860 654 511 23537 3320 11049 13024
NM_020338chr1053729 3684 3065 2875 694 --23509 995 13273
NM_020340chr682276 1710 1621 885 596 360 337 320 ----1373
NM_020341chr2052029 1878 1429 1394 500 --11470 --
NM_020342chr242599 2153 1944 894 --22528 591 1357
NM_020346chr1151710 1606 1364 1274 528 21748 674 1192 1303
NM_020357chr341543 459 305 114 1342 ----
NM_020390chr3104696 4285 4255 3980 3800 3489 3288 1531 300 104 13938 24419 1230 1563
NM_020425chr661680 1244 733 571 562 175 ------
NM_020432chr741898 1593 1513 323 --22143 337 --
NM_020443chr1137005 6859 6368 2493 2186 1867 1561 1522 1293 914 906 861 848 25164 870 11342 16574
NM_020455chr672821 2540 1784 885 624 522 485 12351 22729 562 --
NM_020456chr1352098 2042 823 493 479 ----156
NM_020466chr644057 3170 806 264 --15033 195
NM_020473chrX61599 1498 643 607 364 131 21696 1677 11636 --
NM_020647chr831810 1769 648 32035 1955 801 1422 --
NM_020673chr20147384 7085 6468 6386 6268 6258 5731 4894 4820 2766 2605 2407 960 908 23089 1229 26351 5724 1437
NM_020704chr74818 688 556 496 1975 32162 1625 933 --
NM_020711chr242505 2227 2101 585 --32025 358 345 --
NM_020718chr16196341 5735 5691 5235 5137 4691 4615 4573 4506 4444 4374 4335 4051 2504 2159 2135 654 368 197 11164 24190 941 --
NM_020727chr2183900 3892 3794 3718 1607 1194 1182 840 13453 12980 21025 308
NM_020732chr61430 ----21306 133
NM_020734chr1283244 2927 2868 2590 2457 2247 474 58 22875 182 12196 --
NM_020739chr1573690 2895 1042 962 605 548 409 --159 --
NM_020752chr1072844 2395 2047 1985 1090 501 242 22178 434 --12067
NM_020760chr261510 1330 1265 653 482 260 1453 ----
NM_020766chrX144461 4419 4268 4192 4057 3563 1638 1629 1042 866 852 458 335 147 43041 2917 1472 446 13388 --
NM_020772chr17127978 7443 7352 6431 6244 3332 3240 2839 2315 1972 1875 1275 48520 5577 787 653 28182 6614 --
NM_020774chr18115971 5944 5909 5071 4832 4791 4643 4011 3827 904 367 1925 42280 1755 1275 798 11662
NM_020782chr12114776 4646 4571 4018 3559 3110 3039 1633 1584 630 384 21886 1732 24416 1343 --
NM_020783chr1841767 1651 584 526 3950 400 188 22133 2050 --
NM_020800chr341271 1152 370 359 11072 --1464
NM_020801chr53876 788 397 11743 12035 --
NM_020805chr1871599 1479 734 680 567 227 65 ------
NM_020809chr1192310 2087 1976 1922 1621 752 568 527 116 1816 ----
NM_020810chr14113397 3390 3356 2394 2358 1444 1089 746 726 642 95 11268 11246 12410
NM_020830chr263255 3028 2687 2475 1251 798 --22191 980 12383
NM_020839chr331465 1140 550 132 11056 21386 494
NM_020841chr1283813 3426 3407 3148 2876 2813 406 185 22954 2769 21582 511 12544
NM_020844chr8177520 6958 6327 6270 6048 5557 5513 5088 5065 5039 4922 2879 1996 1705 1082 155 128 1105 36237 6104 1864 12915
NM_020853chr1242660 646 473 179 1110 11024 12774
NM_020859chr463567 3529 2948 2621 2571 402 12607 33699 2592 782 2287 52
NM_020860chr441106 252 227 48 2412 263 ----
NM_020868chr251980 1836 1759 323 200 11259 --11992
NM_020871chrX52326 2210 1920 1805 1787 32065 829 38 12415 --
NM_020872chr331662 1560 370 1355 11425 --
NM_020909chr2114093 3895 3100 2737 2566 1681 912 895 379 318 53 24099 1251 14016 --
NM_020917chr1963089 2996 2839 1413 295 54 ----1147
NM_020921chr1453587 2981 2271 1193 710 43297 1465 985 124 ----
NM_020922chrX31699 167 107 --1307 11338
NM_020925chr131497 1006 135 11316 --1552
NM_020935chr2103942 3719 3418 3324 1788 1612 1433 1391 811 172 13517 --11120
NM_020940chr1062060 976 753 559 516 134 22737 1044 ----
NM_020948chr1103712 2731 2527 2244 1392 1335 1136 813 333 255 --12521 12367
NM_020951chr1962249 2217 2073 1956 505 302 12267 1448 --
NM_020980chr1541750 1355 324 185 ----1666
NM_021007chr271823 1641 1566 861 449 217 24 12265 1463 --
NM_021032chr351781 1738 1687 486 66 21461 59 --1586
NM_021033chr1363331 2885 2816 914 312 267 --21317 198 23400 2585
NM_021038chr393251 2771 2743 2227 2076 991 772 511 481 11040 ----
NM_021061chr884046 3809 3778 3574 3552 2825 1314 320 --21767 439 --
NM_021069chr442006 793 768 360 11915 ----
NM_021072chr552214 494 462 333 250 ----12039
NM_021090chr2264696 4001 3154 1978 717 432 24505 3876 --34857 4675 4398
NM_021097chr263067 2691 2434 1162 919 452 12062 12210 --
NM_021116chr7128981 8894 8760 8279 8146 7594 6619 6483 5961 5498 3488 876 38621 8539 7645 27542 5723 --
NM_021127chr1841536 1456 1150 189 11237 1568 --
NM_021145chr72932 879 ----1780
NM_021163chr763790 2693 1107 846 508 129 22450 691 23041 802 --
NM_021167chr772701 1839 1796 1040 1019 489 255 12302 ----
NM_021183chrX42531 1940 1678 475 52344 1912 822 755 151 ----
NM_021191chr1251761 1654 693 380 316 1130 1806 --
NM_021222chr141461 1207 1006 246 1401 --1538
NM_021252chr1072098 1989 1873 1844 744 556 78 --1356 --
NM_021255chr14154119 4091 4067 3717 3490 3447 3094 2985 1649 1523 1503 1378 1231 1215 273 ------
NM_021622chr1051890 1632 1611 1573 1558 1363 31495 528 511 --
NM_021627chr341094 944 928 851 1394 --1442
NM_021629chr3115062 4790 4348 4181 4065 3691 3525 804 687 586 317 --24081 573 --
NM_021638chr484192 4104 3505 3043 1972 1951 651 307 13077 13773 --
NM_021643chr241803 1701 583 299 11190 --1602
NM_021648chr652329 1705 788 456 180 ----12707
NM_021813chr6135864 5772 5234 5135 4923 4735 4173 4096 1978 1298 884 750 614 45752 4129 3574 539 25837 5578 --
NM_021911chr5215475 5448 5438 5164 5085 4428 4159 3898 3643 2259 2009 1892 1750 1744 1556 1541 1280 707 631 341 143 14036 22143 153 14361
NM_021912chr15114086 3749 3671 3555 3513 3250 2952 2726 2674 1308 976 134 --11459
NM_021914chr144951 465 175 43 21797 1503 12276 22293 147
NM_021942chr44257 237 136 111 ----2779 610
NM_021947chr1741326 904 412 111 31029 1013 985 11344 --
NM_021949chrX62389 2330 2176 1139 1044 688 ----11002
NM_021954chr13102836 2675 2596 2263 1480 1182 808 703 545 486 43602 2966 2288 1327 32817 2629 1402 --
NM_021960chr152156 2011 1802 1113 720 12059 ----
NM_021961chr11157365 7058 6557 6241 5608 5272 4972 4786 4767 2920 1918 1442 1350 192 169 14718 15455 --
NM_021964chr3155824 5801 5311 5098 5056 5044 4778 4426 2654 1961 1888 1624 1513 937 554 34525 1780 1689 25844 1251 22425 627
NM_021999chr133846 812 155 --1740 1283
NM_022041chr1642582 2307 1763 788 1541 22631 815 --
NM_022048chr15156257 6074 5988 5547 5309 5129 4357 4202 2254 2151 1990 1750 1269 866 68 11817 12101 --
NM_022049chr141902 1801 567 202 --11834 1504
NM_022051chr12477 455 --151 1693
NM_022079chr106900 835 399 383 344 96 --148 --
NM_022091chr652116 831 299 167 56 21740 146 ----
NM_022114chr164314 4193 3887 1439 671 578 31709 1638 473 ----
NM_022121chr621167 88 --11138 1493
NM_022133chr861824 1661 1324 1200 1170 34 21892 27 165 11649
NM_022140chr561983 1766 1505 1453 539 517 11572 11643 --
NM_022154chr42993 245 21113 85 --1890
NM_022166chr1674287 4264 2226 2077 1863 712 583 26000 5518 15863 --
NM_022336chr272264 2104 2039 2030 1942 1783 277 22150 786 --11748
NM_022351chr873712 3649 3456 3365 3014 2860 2832 1674 --1648
NM_022444chr761830 1597 1552 1523 771 731 1538 21746 436 --
NM_022458chr752280 1210 1063 963 129 --1490 22914 2628
NM_022459chr13106055 5540 5351 4938 1873 1489 1173 884 102 95 13886 12323 --
NM_022469chr162940 2870 2438 991 905 719 12969 22176 1045 --
NM_022474chr1462393 2204 1982 396 265 225 1579 --12450
NM_022482chr2061839 1001 956 844 589 490 12353 32384 2373 1720 --
NM_022491chr12103203 3155 2601 2401 1018 965 948 779 764 339 --22511 472 --
NM_022716chr142593 2331 2244 1186 12821 32568 1221 820 --
NM_022725chr1151820 1593 1470 539 262 11996 --21835 293
NM_022726chr631174 488 247 11305 11527 --
NM_022739chr1731202 933 417 2235 33 1323 --
NM_022745chr152517 2051 2038 1840 626 ----12202
NM_022763chr321106 766 1561 23084 525 12442
NM_022781chr973115 3062 3054 2600 2202 1185 278 --23194 3103 --
NM_022784chr1541042 353 52 34 1855 ----
NM_022828chr541516 555 417 290 142 1388 --
NM_022841chr1531817 311 92 32645 654 241 --1545
NM_022845chr1672219 2150 1415 473 433 390 116 21999 330 1381 --
NM_022893chr243172 1092 389 286 12065 3903 708 255 12959
NM_022898chr14104782 4674 3768 3739 3634 3584 2953 1623 1583 43 11170 11120 14589
NM_022918chr1161912 1893 1704 669 553 125 1838 31574 1500 591 --
NM_022977chrX41719 1057 384 104 11823 --1479
NM_023073chr55449 242 207 146 116 31289 1070 1054 --11248
NM_023927chr5----21329 1065 1960
NM_023929chr852647 919 870 517 443 31940 536 358 1284 12175
NM_024007chr532768 2124 952 --21084 311 12295
NM_024345chr9135629 5453 5433 4391 4205 3944 2312 1858 1360 1034 991 315 269 25852 4571 34934 2377 1961 --
NM_024408chr193176 2642 2569 1476 1245 711 546 465 275 11194 32986 2760 1489 --
NM_024416chr951520 1359 1295 520 109 ----1258
NM_024511chr463157 2555 2509 2389 833 128 12477 1988 --
NM_024524chr382233 1985 1112 1080 1038 796 610 490 12700 ----
NM_024529chr121193 867 --41108 1059 450 176 --
NM_024548chr31174 21234 297 --1220
NM_024569chr122042 978 2355 250 --2573 396
NM_024612chr171358 1862 1915 1453
NM_024613chr851645 1303 1226 1149 321 11365 11191 --
NM_024624chr23334 261 193 --11073 --
NM_024631chr115568 540 517 244 197 1637 ----
NM_024636chr752031 2001 1969 1908 1104 --32808 596 189 --
NM_024641chr651200 910 685 285 103 --32991 2670 874 --
NM_024646chr183891 3504 3345 1462 903 892 216 57 11267 ----
NM_024665chr3124330 3727 3473 3088 3071 3062 2872 1795 1585 1182 1077 964 13516 34404 3418 1674 --
NM_024670chr1021200 591 ----1247
NM_024674chr143170 2070 915 769 --43181 2387 2077 884 --
NM_024692chr231839 1487 126 21865 1621 31416 1401 415 --
NM_024715chr531701 1280 220 --21907 127 --
NM_024740chr11143573 3357 1665 1642 1554 1382 1161 1045 946 867 731 667 153 44 --23650 618 23677 3561
NM_024749chr141948 824 510 155 1283 21843 655 187
NM_024761chr9125377 5117 4853 4818 4695 4496 3891 3842 3608 3281 780 248 15234 34911 4876 4535 --
NM_024770chr2105476 5213 4348 4336 2636 2565 1517 1394 502 120 26015 4502 24251 245 15229
NM_024817chr15104860 4551 4395 2352 2058 1768 1645 998 803 655 --25843 1824 --
NM_024824chr1421726 1348 1696 11395 11648
NM_024828chr941456 624 283 123 --21310 462 154
NM_024834chr1041441 1389 523 486 170 2722 297 --
NM_024913chr751770 1349 1297 1266 219 --21547 1088 --
NM_024930chr54634 561 500 348 32683 553 450 12141 --
NM_024941chr551337 1245 941 246 229 131 1285 --
NM_024947chr3159644 9617 9423 9284 8037 7643 6923 6646 6624 6345 3700 2357 1985 1644 313 37663 6803 2035 16814 29564 7888
NM_024948chr102562 194 1276 --1570
NM_024949chr4114490 4365 4229 3627 3582 1976 1170 1055 937 460 282 34371 1921 1323 ----
NM_024989chr2257545 7286 6972 6934 6758 5855 5714 5252 5239 5216 2656 2589 2147 1566 1446 1374 1155 987 807 763 716 666 371 255 115 27904 5876 47769 1990 911 214 --
NM_024991chr1072892 2532 2226 842 624 372 50 43185 3132 3017 941 ----
NM_025054chr883814 3685 3498 3285 2941 2735 1501 703 --21676 1136 13449
NM_025073chr1154704 4474 3859 3572 2932 1551 1527 1172 865 842 621 433 403 242 208 21442 1179 24222 1628 --
NM_025074chr462824 2590 2236 2162 1089 984 --21233 38 --
NM_025114chr12--128 --136
NM_025146chr342599 2527 2102 1947 --11959 --
NM_025154chr721254 983 --11044 11029
NM_025160chr173930 3611 3095 2759 1165 716 330 --24303 128 --
NM_025184chrX3849 142 45 ----1199
NM_025191chr142152 1392 992 881 32363 562 339 1870 --
NM_025235chr1062197 1915 1729 1652 392 223 22251 657 ----
NM_030579chr1673537 3525 3196 3137 1204 1092 402 23088 2397 11197 --
NM_030621chr14103907 3884 3821 3755 3569 3060 2927 2789 918 738 ------
NM_030625chr1082335 1847 633 567 482 460 327 105 ----1715
NM_030627chr5104048 3991 3972 3956 3603 3477 2677 1516 988 22 --11038 14103
NM_030647chr7156273 5618 5047 5039 4704 4642 4173 2352 2175 1431 1411 881 821 814 22 21369 392 55247 4882 729 604 181 --
NM_030648chr4104694 3526 3414 1919 1648 1574 1206 1109 554 341 13610 44014 3680 3450 669 --
NM_030650chr2124247 3426 3239 2826 2628 1408 1086 856 746 329 234 138 1480 33893 2907 115 23118 1397
NM_030664chr1041979 753 636 244 --22335 113 --
NM_030674chr12115515 5341 4954 3640 2191 2157 2130 1322 1138 1132 492 --1267 14615
NM_030755chr1453087 3029 849 368 278 12205 159 --
NM_030758chr2251222 1025 393 128 116 ------
NM_030786chr141791 1730 1224 217 --21519 606 --
NM_030791chr1481813 1504 1316 1179 564 482 193 155 31209 1198 224 21740 1522 --
NM_030799chr562067 1787 1380 265 243 155 ------
NM_030806chr1149346 8329 7203 6051 5972 2444 2139 2055 1981 1757 1611 1016 991 337 38218 6555 3056 27308 711 --
NM_030816chr193396 3267 2287 1161 752 701 594 381 189 12351 ----
NM_030817chr1263753 3540 2777 2685 747 735 --33395 2725 2715 --
NM_030925chr1371777 227 187 107 79 64 39 ------
NM_030939chr651015 983 346 329 279 --1160 --
NM_030945chr54783 683 563 313 --12431 --
NM_030964chr573675 3644 3580 3559 3434 2314 1251 --1876 --
NM_031216chr18102258 2214 1884 1860 829 816 541 367 321 96 1661 1205 --
NM_031268chr1654682 4126 3402 1960 1287 ----13300
NM_031296chr452337 2208 1933 740 298 --12052 --
NM_031305chr421754 371 --11176 1129
NM_031371chr12428 422 21193 397 1101 --
NM_031371chr12428 422 21193 397 1101 --
NM_031419chr331290 420 135 1632 177 --
NM_031427chr14155795 5585 4651 3896 3673 2363 2309 2282 1763 1244 848 348 306 205 77 --35295 1719 721 11436
NM_031435chr1263332 2904 2433 1331 1322 615 ------
NM_031442chrX63170 1208 1180 827 290 176 --31145 758 79 --
NM_031445chr263416 3299 2164 1293 1180 58 12256 22489 110 --
NM_031461chr882219 2201 2158 1810 1769 838 448 35 --22175 102 --
NM_031468chr7168243 7983 7003 6614 6368 6288 5771 5739 5248 3286 1322 1198 760 635 554 126 17964 ----
NM_031469chr693847 3158 3033 2510 1259 1028 898 677 219 12853 13809 --
NM_031483chr2093241 2909 2370 1247 1118 640 544 508 490 43310 2935 2285 139 23148 1220 11349
NM_031844chr183581 3533 3010 2800 1060 768 724 354 1931 ----
NM_031845chr293220 3028 1301 1246 1156 804 367 360 192 32898 931 150 ----
NM_031847chr293220 3028 1301 1246 1156 804 367 360 192 32898 931 150 ----
NM_031940chr862383 2227 1641 983 822 600 12051 --12320
NM_032021chr1151057 376 350 197 122 2913 323 1316 --
NM_032121chrX32092 2036 544 22718 2188 12747 1137
NM_032145chr641579 1503 454 143 11943 11848 --
NM_032147chr124936 807 407 80 --2315 68 --
NM_032153chr322770 2175 2701 296 22538 289 --
NM_032160chr1854018 3775 3526 1462 1196 --24044 1725 14150
NM_032189chr1354429 1982 1235 254 218 11934 11476 14708
NM_032199chr1093442 2803 2674 2390 1413 601 493 483 249 12868 12468 13309
NM_032217chr45534 196 152 88 39 11263 2997 225 --
NM_032221chr203569 498 360 21788 1715 11478 --
NM_032228chr1153236 2319 561 517 445 12214 22514 597 --
NM_032229chr131235 1750 --1379
NM_032239chr42518 48 --21151 432 11467
NM_032256chr122375 167 --1403 1858
NM_032281chr1922294 599 22488 2444 --23100 2140
NM_032291chr151771 1697 1486 1196 297 11943 1578 --
NM_032373chr1085615 1301 982 848 837 711 190 127 --34311 2120 43 --
NM_032383chr351244 1021 871 510 188 --1352 --
NM_032410chr851249 1200 966 931 131 11255 1811 --
NM_032435chr152429 2399 755 458 322 1307 1357 --
NM_032439chr1041292 1092 365 70 --2650 161 --
NM_032440chr1092907 2569 1837 941 874 742 614 69 55 2582 90 12456 --
NM_032446chr573807 3692 2878 2852 1137 936 369 23854 3619 --13358
NM_032457chr493912 3725 3718 3044 2967 2386 965 906 807 12394 33626 3228 1206 13847
NM_032458chrX53433 2140 878 573 386 --42714 2163 2088 1271 --
NM_032466chr831654 1443 500 --11130 1662
NM_032468chr831654 1443 500 --11130 1662
NM_032505chr351846 954 594 486 177 --22227 244 --
NM_032510chr1861955 1921 1675 1529 161 81 ------
NM_032521chr2042428 2354 974 776 32524 2418 1970 1307 --
NM_032582chr1741814 1474 1226 234 11357 1176 --
NM_032590chr1251025 990 159 118 81 1970 2475 229 --
NM_032632chr1442005 1776 460 192 --1226 --
NM_032682chr383651 1062 830 749 659 441 173 92 12355 1633 --
NM_032689chr192390 324 1438 --1366
NM_032765chr53638 283 69 158 --1262
NM_032810chr1051516 1026 567 560 553 ------
NM_032859chr13103967 3804 3523 3273 3094 2806 913 611 564 547 23600 2517 --11010
NM_032873chr11104507 4288 4136 4024 3885 3620 3269 2948 437 315 24334 3818 14392 --
NM_032876chr1442223 1973 1572 1377 11398 11644 --
NM_032968chrX94230 4171 3665 3447 2952 1405 1339 820 684 --43676 951 748 269 --
NM_032969chrX94230 4171 3665 3447 2952 1405 1339 820 684 --43676 951 748 269 --
NM_032973chrY74222 4163 3657 2947 1405 1339 684 --43668 951 748 269 --
NM_032975chr1853498 3043 2497 2444 576 --13429 13605
NM_032980chr1853498 3043 2497 2444 576 --13429 13605
NM_032991chr431543 1018 83 ----1505
NM_032999chr721102 428 ----1447
NM_033000chr721102 428 ----1447
NM_033001chr721102 428 ----1447
NM_033014chr951520 1359 1295 520 109 ----1258
NM_033020chr1124539 3414 3091 2995 2959 1843 1423 1408 1097 912 546 530 11620 --21596 653
NM_033030chr221150 493 2547 516 1419 1472
NM_033055chr14711 393 244 78 --1320 --
NM_033083chr353171 3034 1182 703 188 32801 609 257 12951 --
NM_033087chr961376 1184 1035 356 202 35 ------
NM_033136chr551613 1549 1469 266 38 --21538 536 --
NM_033137chr551613 1549 1469 266 38 --21538 536 --
NM_033143chr4114598 4107 3935 3720 3665 3201 1219 872 461 360 168 --44535 1858 1698 832 --
NM_033181chr673201 2921 2875 2401 1254 1018 392 22579 627 22687 2628 --
NM_033211chr531925 1762 194 11454 --11965
NM_033224chr7167791 7643 7258 7170 6509 6471 6058 5968 5419 5410 5314 5069 2354 2203 644 372 36273 5810 5534 27157 1980 22283 1223
NM_033285chr893384 3274 3157 1414 1113 797 595 350 344 ------
NM_033290chrX63756 2809 1472 917 764 335 1323 23798 1131 157
NM_033331chr993385 3067 3016 1452 1347 1241 972 841 330 13136 2503 476 --
NM_033360chr1263892 3782 3704 1702 781 770 23637 1775 54487 4395 4354 3598 878 --
NM_033389chr17124260 3915 3857 3619 3325 3203 3167 1155 1030 317 252 110 11617 23641 216 1210
NM_033394chr261640 1413 1190 461 130 100 11136 11505 --
NM_033425chr11103364 2422 1359 1221 1084 978 915 745 698 359 32969 2655 1003 11111 --
NM_033429chr1573079 2871 2708 2487 2033 1103 584 1571 1324 --
NM_033430chr484161 4033 3867 3728 3444 2753 1638 174 11235 33921 3438 367 --
NM_033437chr484161 4033 3867 3728 3444 2753 1638 174 11235 33921 3438 367 --
NM_033505chr2166382 6280 4571 4542 4366 4175 2287 2257 1555 1498 1473 1391 1197 1021 183 67 26046 1212 35490 1833 1723 26006 1377
NM_033624chr1252166 800 717 705 320 21809 1683 1569 --
NM_033656chr21135841 5646 5608 5546 5377 5056 2088 1721 1623 1603 1269 233 216 44774 4418 1184 25 65531 4557 4248 2142 1974 1746 --
NM_052811chr13105012 4859 4734 4463 4395 4339 3920 3611 2116 2045 12090 25143 4620 13691
NM_052832chr873049 2545 894 593 439 379 180 --12534 --
NM_052879chr1263557 2875 1599 872 263 122 2669 444 ----
NM_052885chr1254010 3083 1827 1206 940 34595 4451 4290 54798 3150 3011 972 927 24032 322
NM_052898chr85643 550 322 296 129 --2542 136 --
NM_052905chr241923 1247 764 308 21764 1555 --11913
NM_052907chr12114260 3797 3662 3168 2901 2851 1531 1276 1067 360 127 13477 12744 12690
NM_052917chr283147 2462 2180 969 963 867 734 223 --11250 --
NM_052918chr1093330 2917 2904 2854 2367 676 557 409 128 --12448 --
NM_052937chr872711 2143 2122 2069 1800 837 191 1413 11738 1449
NM_052958chr81692 ----2658 96
NM_053002chr32745 101 --11136 1823
NM_053016chr9207805 7556 7250 6383 6298 6234 6133 5482 5232 5144 2814 2603 2487 2050 1996 1808 1656 899 356 145 22119 1492 22667 736 22562 2082
NM_053024chr361539 1458 1293 1130 1053 426 --1464 --
NM_053042chr461020 934 595 518 420 303 --32711 2062 784 --
NM_053043chr7146356 5537 5502 5087 4993 4673 4414 4160 2554 1971 1803 1228 1055 665 25448 4537 11196 --
NM_053064chr1473111 2432 2159 2133 1219 668 114 ------
NM_054016chr151719 1485 250 37 21 21834 43 --11417
NM_054016chr151719 1485 250 37 21 21834 43 --11417
NM_054016chr151719 1485 250 37 21 21834 43 --11417
NM_057159chr921178 494 31149 371 282 --11198
NM_057168chr771650 1596 1388 1079 1069 624 403 21482 455 ----
NM_057169chr1262403 1266 845 571 411 203 1860 --1175
NM_057170chr1262403 1266 845 571 411 203 1860 --1175
NM_057175chr442574 2269 2191 899 12046 --1513
NM_058170chr171588 595 583 536 362 85 71 2468 438 2493 99 --
NM_078473chr862383 2227 1641 983 822 600 12051 --12320
NM_078487chr953108 2882 2755 2654 2593 --23222 2505 --
NM_080546chr972301 2205 1879 1801 1535 1414 539 1255 12239 --
NM_080629chr141300 420 264 61 --11131 1128
NM_080630chr141300 420 264 61 --11131 1128
NM_080717chr122636 114 ----11207
NM_080743chr631926 800 323 22575 173 42071 1769 229 217 --
NM_080759chr1362460 2323 2024 1742 1684 1075 --1342 --
NM_080760chr1362460 2323 2024 1742 1684 1075 --1342 --
NM_080832chrX71578 1453 1268 536 326 193 154 1688 ----
NM_080867chr14175091 4521 4359 4230 3945 3457 3430 3401 3237 3111 1654 829 678 518 428 368 145 --23508 720 13438
NM_080872chr873623 1608 1206 1180 1076 491 447 23189 110 24001 3452 --
NM_080874chr44216 164 145 46 --11331 1177
NM_130391chr9113589 3101 2763 2722 2629 2550 2340 622 581 543 127 11043 1702 --
NM_130392chr9113589 3101 2763 2722 2629 2550 2340 622 581 543 127 11043 1702 --
NM_130393chr9113589 3101 2763 2722 2629 2550 2340 622 581 543 127 11043 1702 --
NM_130435chr1042915 2527 2455 1183 11918 21086 752 1273
NM_130436chr2142309 1794 331 245 --22786 873 --
NM_130798chr1531253 994 980 ----128
NM_130809chr563080 2381 2336 1052 971 818 1251 41093 1011 207 115 --
NM_130811chr2041122 262 255 219 --2974 820 1813
NM_130831chr392892 2388 1787 1107 705 668 462 258 210 22309 842 32135 902 499 --
NM_130832chr392892 2388 1787 1107 705 668 462 258 210 22309 842 32135 902 499 --
NM_130833chr392892 2388 1787 1107 705 668 462 258 210 22309 842 32135 902 499 --
NM_130834chr392892 2388 1787 1107 705 668 462 258 210 22309 842 32135 902 499 --
NM_130835chr392892 2388 1787 1107 705 668 462 258 210 22309 842 32135 902 499 --
NM_130836chr392892 2388 1787 1107 705 668 462 258 210 22309 842 32135 902 499 --
NM_130837chr392892 2388 1787 1107 705 668 462 258 210 22309 842 32135 902 499 --
NM_133264chr1773812 3581 3373 2789 2750 851 733 12384 23246 690 1414
NM_133265chrX43681 1378 618 178 --42437 962 339 51 --
NM_133329chr261711 1693 1465 656 402 254 --21835 321 --
NM_133330chr462533 878 820 501 492 299 --1532 --
NM_133331chr462533 878 820 501 492 299 --1532 --
NM_133334chr4126208 5278 4848 4035 2325 2085 1976 1916 1458 1049 1043 932 25249 190 45342 4257 2074 79 2613 591
NM_133335chr462533 878 820 501 492 299 --1532 --
NM_133367chr673479 3443 3345 3109 3102 824 461 12952 ----
NM_133370chr483669 3272 2833 2396 2353 1061 951 880 --12886 13579
NM_133372chr542307 1789 1009 581 --1782 12206
NM_133378chr22630 147 1702 --1250
NM_133432chr22630 147 1702 --1250
NM_133437chr22630 147 1702 --1250
NM_133468chr742296 914 342 248 --1971 2731 165
NM_133493chr6134683 4329 4243 4102 4096 3929 3514 3410 3346 768 606 316 89 23269 1390 34076 4017 3316 --
NM_133496chr184329 3907 3692 3653 3347 1715 1330 1043 --14159 --
NM_133507chr127820 715 623 605 368 199 157 ------
NM_133631chr381361 1339 1326 1013 643 635 480 236 11491 1146 --
NM_133646chr275592 5547 4458 1839 1630 1533 1115 1946 45457 4486 4274 359 --
NM_134424chr1221253 279 ----1266
NM_138270chrX113438 3345 3061 2989 2937 2907 2572 2159 981 711 459 12619 21383 167 12609
NM_138286chr1973661 3336 1698 1531 544 312 191 22948 815 24312 1095 23494 1594
NM_138288chr1482137 1881 803 785 362 344 238 221 --12163 --
NM_138292chr1183525 3504 2743 2548 882 837 483 111 --2854 646 --
NM_138333chr952622 2138 444 101 94 1310 ----
NM_138348chr5106643 6454 5700 5200 5053 2274 1854 1586 1494 637 24894 2542 11513 26108 4579
NM_138357chr1081783 1404 1144 573 564 458 395 370 21657 1619 --11811
NM_138400chr773089 2834 2714 2144 1126 177 108 --13406 --
NM_138423chr1531458 784 51 ----12320
NM_138444chr13124935 4673 4459 4408 4086 4034 3794 3138 3113 1873 1789 1349 24482 1060 24682 3238 24513 4018
NM_138459chr653192 3020 1310 582 337 --1971 --
NM_138468chr296323 5433 4475 1994 1971 1111 1065 593 490 11179 12521 14499
NM_138473chr1264290 4265 1981 514 488 378 --12055 --
NM_138572chr643252 2784 2704 166 ----11146
NM_138576chr14104782 4674 3768 3739 3634 3584 2953 1623 1583 43 11170 11120 14589
NM_138633chr641722 1452 1189 615 1344 11682 --
NM_138638chr144951 465 175 43 21797 1503 12276 22293 147
NM_138694chr653610 2816 1037 742 579 13522 13096 --
NM_138713chr16208167 7991 7983 7587 7470 7128 6830 5826 5146 5060 2368 2221 2063 2000 1948 1527 1431 1263 901 240 35127 1884 1533 36031 5070 1992 25890 5049
NM_138714chr16208167 7991 7983 7587 7470 7128 6830 5826 5146 5060 2368 2221 2063 2000 1948 1527 1431 1263 901 240 35127 1884 1533 36031 5070 1992 25890 5049
NM_138715chr8101938 1900 1882 1864 1812 1806 1776 1750 803 500 2383 79 41819 1590 188 166 --
NM_138731chr14124069 3363 3328 1610 1404 1322 1292 1246 954 858 770 307 11255 1261 --
NM_138771chr761486 1061 444 407 398 335 ------
NM_138971chr1173436 3362 3159 2676 2530 475 306 11247 --22963 564
NM_138971chr1173436 3362 3159 2676 2530 475 306 11247 --22963 564
NM_138972chr1173436 3362 3159 2676 2530 475 306 11247 --22963 564
NM_138972chr1173436 3362 3159 2676 2530 475 306 11247 --22963 564
NM_138973chr1173436 3362 3159 2676 2530 475 306 11247 --22963 564
NM_138973chr1173436 3362 3159 2676 2530 475 306 11247 --22963 564
NM_139057chr1572884 2777 2692 2655 2240 1832 148 1974 12918 1309
NM_139182chr431826 1580 1170 11868 21649 1457 --
NM_139207chr1252164 1996 1582 1425 767 --31564 1452 754 --
NM_139279chr283510 3050 3008 2739 1107 633 595 86 ------
NM_139283chr1292394 2111 1750 1718 1689 619 522 240 177 32183 1865 1666 11944 --
NM_139321chr2083721 3444 3267 3064 2955 891 690 597 33450 1533 479 24060 2989 --
NM_144571chr4127033 6913 6366 5383 4615 2779 2506 1670 1098 901 893 485 46672 6176 4346 2341 2366 168 26581 6505
NM_144578chr1485557 5273 4547 3652 3481 577 210 91 24177 656 15326 13459
NM_144599chr15115267 4529 4441 4307 4145 4012 3964 1597 1324 251 245 ------
NM_144600chr1621383 1376 21297 519 --11700
NM_144632chr271779 1673 1628 1615 849 807 64 31893 1690 829 22064 131 --
NM_144664chr1172520 2402 2374 1925 1682 797 560 1932 ----
NM_144718chr352072 2020 1769 1760 1719 22397 350 22478 2223 12452
NM_144721chr472277 2255 1991 889 634 439 241 165 1759 192
NM_144767chr1574497 3416 3204 3181 2977 857 633 --13424 --
NM_144775chr1774627 4107 3621 3589 3128 3061 3014 13420 ----
NM_144778chr1322201 370 42249 1963 1703 478 22375 2113 --
NM_144949chr22313 235 ----11881
NM_144963chr862542 2239 2140 1675 664 624 ----1678
NM_145055chr1893628 3538 3493 3363 3067 2917 2524 1419 1366 --33838 3176 1441 --
NM_145207chr474416 4391 4268 3598 1230 531 257 ----14035
NM_145244chr481779 1203 653 355 279 227 72 49 ------
NM_145251chr1431364 433 37 --1570 --
NM_145259chr2187128 6547 6486 6144 5515 5378 5323 5291 5072 4488 2418 2116 1797 1761 1043 940 78 50 1649 ----
NM_145263chr432373 2237 193 --1389 1930
NM_145284chrX72390 2188 1855 1756 558 296 212 --12017 --
NM_145307chr1064547 3410 3273 1682 1317 1097 33039 1425 803 33703 3552 986 23466 3102
NM_145320chr793339 3294 3285 3279 3256 1164 849 834 537 12894 43406 2945 2417 2341 1241
NM_145321chr793339 3294 3285 3279 3256 1164 849 834 537 12894 43406 2945 2417 2341 1241
NM_145322chr793339 3294 3285 3279 3256 1164 849 834 537 12894 43406 2945 2417 2341 1241
NM_145686chr262949 2070 1196 1024 697 648 ------
NM_145687chr262949 2070 1196 1024 697 648 ------
NM_145690chr881847 1514 1458 1232 650 562 380 122 21633 1284 21618 54 --
NM_145698chr1031961 594 357 22127 1784 42002 1758 777 294 --
NM_145735chr1392691 2367 2274 2167 2161 1133 974 342 189 11009 22712 2095 --
NM_145799chrX32145 981 523 --13089 12839
NM_145808chr763029 2943 2491 2149 2051 723 11956 ----
NM_145891chr1641090 663 399 367 --189 1540
NM_145892chr1641090 663 399 367 --189 1540
NM_145893chr1631212 521 489 --2211 109 1662
NM_147147chr674239 3712 3304 3296 3273 1599 392 54156 3725 3112 2864 1044 33690 2744 2630 14046
NM_147150chr953724 2700 2564 1282 482 11565 31148 988 823 189
NM_147175chrX42157 2096 1467 821 1503 21825 799 1337
NM_148174chr841360 745 136 122 21607 706 --11747
NM_148955chr15136599 6344 6326 4108 2443 2252 2134 1866 1582 842 738 504 158 35033 2108 168 26538 1905 --
NM_148957chr1352612 2574 2536 2123 498 --32656 2619 2079 --
NM_152261chr1251920 1570 829 592 477 11781 ----
NM_152265chr141572 1160 485 158 1357 11383 --
NM_152275chr241647 706 495 441 1152 22361 939 --
NM_152277chr541828 813 89 63 --11666 1259
NM_152291chr41126 133 --1309
NM_152292chr462241 1622 542 456 298 288 ------
NM_152332chr1452829 1789 893 408 385 --52584 1842 726 509 500 --
NM_152387chr251058 921 908 191 184 1710 ----
NM_152388chr2113699 3513 2952 2865 2737 2622 1036 403 289 261 47 --23787 3682 --
NM_152389chr261638 1386 1207 1168 627 107 --1389 --
NM_152400chr4----1685 11890
NM_152407chr5102870 2846 2406 2111 1223 927 792 593 561 191 2982 933 2742 445 --
NM_152409chr563513 3239 2395 2355 607 335 33577 2248 1241 2732 237 22708 1224
NM_152418chr831608 1423 513 21537 468 2228 69 --
NM_152424chrX74197 3921 3776 3470 1707 829 637 11116 21827 1246 --
NM_152450chr1521392 276 1783 2712 341 1577
NM_152520chr25966 949 789 330 322 ------
NM_152529chr263869 3413 1585 1154 961 841 22865 1177 34093 1736 1533 --
NM_152556chr762349 676 596 501 346 136 21685 780 32440 2150 1835 --
NM_152594chr1542336 1580 1544 107 11571 32181 1533 232 1460
NM_152608chr141991 1918 581 25 42442 2135 863 264 21984 1699 146
NM_152622chr553257 1235 1216 828 164 32793 2460 770 22983 2391 13061
NM_152624chr5117419 6508 6355 6118 5694 5669 5214 4685 2685 1155 472 54888 1824 1514 1445 1397 16185 36020 2436 1845
NM_152629chr993861 3277 2678 2637 1507 1316 1171 696 179 11491 12723 --
NM_152630chrX31301 1250 988 --21009 151 149
NM_152641chr1232330 954 912 --1973 1429
NM_152665chr131304 1169 465 --1874 1999
NM_152678chr342402 2345 670 570 12684 12334 --
NM_152682chr441347 1328 1131 325 1587 21593 74 --
NM_152686chr561523 786 768 526 495 68 151 1108 --
NM_152699chr383271 2418 928 872 202 176 155 120 12505 ----
NM_152723chr1141076 369 181 167 2303 89 11150 --
NM_152756chr583425 3181 1367 1139 660 308 298 253 33550 3121 771 21268 741 --
NM_152758chr84840 552 433 350 22916 2760 23035 2767 --
NM_152765chr872292 1916 1822 936 540 295 216 12273 --12254
NM_152787chrX83373 2811 2776 1454 1401 912 791 99 --23868 1279 --
NM_152789chr751479 1345 1339 195 128 ------
NM_152793chr7105185 5013 4730 4194 3773 2078 592 281 267 248 14544 ----
NM_152826chr15136599 6344 6326 4108 2443 2252 2134 1866 1582 842 738 504 158 35033 2108 168 26538 1905 --
NM_152835chr142762 1066 169 145 --21965 647 12058
NM_152836chr861824 1661 1324 1200 1170 34 21892 27 165 11649
NM_152837chr861824 1661 1324 1200 1170 34 21892 27 165 11649
NM_152838chr2052778 2578 597 467 240 --1253 --
NM_152924chr15106860 6380 6011 5206 2737 2693 2450 1878 385 182 12065 46801 5992 5843 575 --
NM_152999chr7104939 4799 4612 3540 3531 1676 1493 1014 700 48 1969 --24984 4686
NM_153020chr631431 607 471 21404 1102 11518 --
NM_153035chr122024 1231 --11263 12215
NM_153042chr641682 1126 693 149 ----1388
NM_153050chr2264696 4001 3154 1978 717 432 24505 3876 --34857 4675 4398
NM_153051chr2264696 4001 3154 1978 717 432 24505 3876 --34857 4675 4398
NM_153184chr3101470 1244 772 693 388 350 294 229 168 78 21619 714 ----
NM_153188chr585519 4989 4874 3999 3565 2027 1856 1579 23890 963 11963 --
NM_153207chr1231632 1388 542 22577 813 43280 3272 1625 852 --
NM_153223chr551371 1183 448 397 217 1555 ----
NM_153235chr651926 1827 1658 721 166 1204 12363 --
NM_153260chr1571477 1291 1157 404 265 217 155 1303 ----
NM_153261chr1621281 611 31445 1386 644 ----
NM_153262chr193164 2470 2433 2236 666 659 613 311 228 ------
NM_153371chr13122390 2295 2217 2159 2037 2009 1804 1779 909 770 568 475 21556 144 12281 --
NM_153456chr13126132 5353 4129 2247 1818 1508 1111 603 525 245 147 86 26269 5098 26087 6007 14893
NM_153607chr553049 2694 1948 1217 433 22625 1166 ----
NM_153634chr121562 11336 21530 1417 --
NM_153686chr442390 1867 184 121 --1135 12046
NM_153687chr1251638 1219 384 289 34 --1193 --
NM_153689chr251850 826 797 412 391 11993 1456 --
NM_153810chr1094733 4633 4264 3919 3736 1061 1021 447 375 --1284 --
NM_170606chr72689 64 11288 --11882
NM_170665chr1264393 4360 1644 1207 796 74 13755 33853 1173 228 --
NM_170672chr221146 456 21310 1118 --2289 198
NM_170696chr1531105 520 376 11488 1506 11380
NM_170697chr1531105 520 376 11488 1506 11380
NM_170706chr164228 3425 3264 2974 947 467 22837 969 24299 898 --
NM_170709chr861859 835 263 104 64 24 11866 --1581
NM_170710chr452421 2392 2342 2192 2173 --22547 740 --
NM_171998chrX72356 2268 1892 1797 1626 978 100 --12248 --
NM_172069chr252267 1597 755 560 371 11996 32350 2082 247 --
NM_172070chr252266 1525 739 427 234 12056 21689 34 12155
NM_172071chr1197305 7289 7053 5876 5772 5177 5107 4972 4915 2756 2628 2594 2538 2137 1562 1315 1125 1090 727 --67067 6721 4955 4593 1652 745 15941
NM_172103chr642001 1831 870 27 1469 1911 --
NM_172105chr642001 1831 870 27 1469 1911 --
NM_172127chr461809 1553 1510 1433 1354 375 --22036 684 --
NM_172128chr461765 1509 1466 1389 1310 331 --21992 640 --
NM_172159chr362377 1447 876 608 576 202 11479 22108 1724 --
NM_172160chr362377 1447 876 608 576 202 11479 22108 1724 --
NM_172178chr1251383 204 184 49 43 31123 218 171 ----
NM_172240chr123361 296 21 41174 916 303 111 --1224
NM_172344chr261711 1693 1465 656 402 254 --21835 321 --
NM_173082chr651462 996 981 584 223 --11431 --
NM_173214chr16208167 7991 7983 7587 7470 7128 6830 5826 5146 5060 2368 2221 2063 2000 1948 1527 1431 1263 901 240 35127 1884 1533 36031 5070 1992 25890 5049
NM_173468chr4135923 5387 4819 4213 4076 3831 1874 1714 1671 1639 1483 1191 191 1350 35666 5317 3938 --
NM_173469chr1541270 1233 1014 182 1387 21581 479 --
NM_173470chrX61960 1927 1876 815 709 165 32411 1002 235 1599 --
NM_173511chr243789 3578 3094 2488 --1425 --
NM_173531chr1953254 2770 1422 807 428 21301 1075 22431 1514 --
NM_173552chr352335 770 681 667 542 2511 33 12144 --
NM_173576chr1062009 1819 370 351 244 180 --12288 1138
NM_173582chr11116204 5959 5906 5494 4437 4286 4131 3899 2045 2031 1181 1928 25421 2140 --
NM_173642chr1189177 8404 8274 7494 6892 6803 6619 2788 2266 2147 1538 1483 1224 1158 995 897 463 90 16573 --17553
NM_173645chr2142 --1182 1223
NM_173665chr53715 646 73 --1666 --
NM_173683chr871622 1320 1300 1266 1165 1158 1117 ----1392
NM_173698chrX71891 1844 1676 784 769 558 434 ------
NM_173808chr194420 4402 3729 3047 2754 1567 1296 1068 911 13436 --13507
NM_173825chr3103083 3066 2992 2313 2066 1242 1045 821 516 475 11250 ----
NM_173829chr565745 4989 1660 1232 232 140 14743 34217 3945 254 14248
NM_173851chr873987 3774 3660 3089 2895 2632 1611 1135 ----
NM_174902chr1161244 1234 514 481 256 54 ----11311
NM_175061chr741770 1473 667 207 31955 805 724 ----
NM_175736chr1286659 6064 5974 1954 762 746 558 226 1934 47283 7017 6527 272 16975
NM_175767chr531840 613 405 1373 11796 --
NM_175861chr12105983 5612 5391 5168 5139 4213 1885 1486 942 442 24697 1011 35746 1821 709 --
NM_175863chr61430 ----21306 133
NM_175873chr531513 1102 988 1572 21115 1058 --
NM_175921chr5123968 3130 3054 2851 1631 1549 1541 1405 701 629 535 494 11263 23508 343 --
NM_176823chr163876 1490 1399 1369 1238 262 --12646 13867
NM_177424chr131738 1303 498 --11889 1117
NM_177438chr14103907 3884 3821 3755 3569 3060 2927 2789 918 738 ------
NM_177538chr2138803 8197 8072 6749 6399 5954 5517 2928 2380 1827 264 115 23 12564 32247 995 206 153
NM_177947chrX51201 676 305 248 45 11683 ----
NM_177948chrX51201 676 305 248 45 11683 ----
NM_177968chr22475 133 1718 31734 1406 150 1878
NM_177969chr22572 222 ----1187
NM_177972chr1184382 4358 3987 3484 1659 1595 1379 948 11667 ----
NM_177974chr1531458 784 51 ----12320
NM_177990chr2052029 1878 1429 1394 500 --11470 --
NM_178011chr1083208 2967 2761 2307 2187 2029 1996 824 --11173 --
NM_178140chr522550 931 12318 31984 703 436 --
NM_178151chrX157882 7847 7219 6749 6717 6163 6114 5824 5077 2922 2451 2016 2000 1987 49 27420 2192 37142 4889 1377 --
NM_178152chrX157882 7847 7219 6749 6717 6163 6114 5824 5077 2922 2451 2016 2000 1987 49 27420 2192 37142 4889 1377 --
NM_178153chrX157882 7847 7219 6749 6717 6163 6114 5824 5077 2922 2451 2016 2000 1987 49 27420 2192 37142 4889 1377 --
NM_178313chr262211 1804 1535 1498 554 411 2603 508 12120 --
NM_178423chr72973 43 ----11044
NM_178425chr72973 43 ----11044
NM_178505chr1063549 3037 2308 1104 672 189 --43622 797 575 385 --
NM_178509chr17114155 3474 3382 3173 2868 2746 1493 1434 1184 1171 864 21312 394 23776 2634 --
NM_178539chr1292098 1960 1861 1744 1398 1327 736 422 126 ------
NM_178585chr463294 2661 1183 635 322 144 23312 93 --22843 1133
NM_178586chr1472312 2167 1824 1732 1717 1710 410 --2908 264 --
NM_178815chr1031700 963 469 32143 1855 31 ----
NM_178818chr1672478 2367 2125 1908 787 430 40 --2984 907 1965
NM_178842chr1532155 759 377 11514 12104 22170 776
NM_181054chr142380 353 2798 211 1400 --
NM_181077chr1572042 1757 1513 853 581 232 92 184 ----
NM_181265chr452421 2392 2342 2192 2173 --22547 740 --
NM_181354chr831142 674 282 --11533 1130
NM_181358chr193720 3519 3501 2696 864 652 505 393 213 --24094 715 --
NM_181453chr221466 302 144 --1561
NM_181457chr23497 361 202 --1433 11361
NM_181458chr23969 494 335 --1566 11494
NM_181459chr23396 260 101 --1332 11260
NM_181460chr23443 307 148 --1379 11307
NM_181481chr18127077 6721 6700 6647 6640 6612 6551 6427 4590 4403 4396 1330 --25376 2431 --
NM_181482chr18127077 6721 6700 6647 6640 6612 6551 6427 4590 4403 4396 1330 --25376 2431 --
NM_181483chr18127077 6721 6700 6647 6640 6612 6551 6427 4590 4403 4396 1330 --25376 2431 --
NM_181486chr122636 114 ----11207
NM_181504chr553540 2631 1621 930 504 13943 ----
NM_181521chr16167259 7148 6906 6689 5983 5568 5211 4821 4656 4402 1994 1098 922 828 762 126 --35911 5765 5688 25746 2243
NM_181523chr553540 2631 1621 930 504 13943 ----
NM_181524chr553540 2631 1621 930 504 13943 ----
NM_181659chr2083451 2628 2490 1042 585 579 148 76 --13420 --
NM_181659chr2083451 2628 2490 1042 585 579 148 76 --13420 --
NM_181670chr1261251 556 483 475 316 147 --21309 1123 --
NM_181702chr85974 332 274 217 51 2892 688 2985 917 --
NM_181705chr5125608 5142 4687 4587 4054 2080 1306 992 942 936 318 222 25323 3659 14462 1688
NM_181714chr621592 589 31759 1485 323 11408 11570
NM_181782chr632149 1836 814 32271 834 426 1902 22094 1777
NM_181784chr242608 2414 275 146 22087 2034 22316 652 --
NM_181787chr893646 3431 3386 1529 1180 868 740 240 21 13186 --11103
NM_181789chr1573235 2811 2010 1100 1015 657 559 12648 ----
NM_181836chr562583 1947 1075 601 204 27 32631 2498 1882 12159 1314
NM_181839chr821238 236 --11364 11016
NM_182485chr493759 3519 3189 3045 2466 964 563 514 463 --33088 2638 2357 13706
NM_182493chr1655206 4594 4552 4160 2138 14708 24140 585 --
NM_182503chr6125206 4735 4477 3950 3665 2065 1526 1191 1151 844 428 221 --45590 4268 1586 135 14424
NM_182515chr19136425 6380 5723 5578 5129 4784 4463 4417 4239 2313 1631 692 82 --36460 6301 38 46104 5900 2522 2406
NM_182551chr283477 3462 3430 2648 1246 1176 953 115 ------
NM_182607chrX61719 1450 719 96 51 30 ------
NM_182641chr174753 437 233 203 --158 21944 1908
NM_182646chr493759 3519 3189 3045 2466 964 563 514 463 --33088 2638 2357 13706
NM_182691chr72458 287 --1220 1342
NM_182692chr72458 287 --1220 1342
NM_182734chr2093006 2922 2617 2508 2239 1150 868 712 661 22535 1172 11003 12645
NM_182757chr683429 3283 3190 3090 2918 2270 1271 1042 21230 69 23447 264 --
NM_182762chr785258 1868 1767 1446 1344 743 663 571 55687 5601 5054 4500 1305 26083 3921 --
NM_182763chr162145 2000 1791 1117 1102 709 12048 ----
NM_182765chr1061643 1560 1525 852 467 266 22069 598 1802 11997
NM_182898chr7156340 5822 5487 5237 4542 4484 4334 4177 4098 1987 1829 1732 762 616 127 55699 5504 4593 4356 642 35400 4210 2271 14808
NM_182899chr7156340 5822 5487 5237 4542 4484 4334 4177 4098 1987 1829 1732 762 616 127 55699 5504 4593 4356 642 35400 4210 2271 14808
NM_182907chr661936 1813 864 472 386 325 11522 21778 634 --
NM_182948chr172230 2224 1925 1076 572 317 271 22243 1961 ----
NM_182970chr2073561 3402 3080 2739 2733 2724 1003 ------
NM_182972chr152799 2210 2096 578 264 ----1995
NM_183075chr432984 300 191 --23031 1890 11878
NM_183078chr693844 3376 1487 1224 1136 683 355 310 92 ------
NM_183227chr621644 1487 --21259 1065 1625
NM_183234chr1531606 459 267 21298 544 --11200
NM_183235chr1531606 459 267 21298 544 --11200
NM_183236chr1531606 459 267 21298 544 --11200
NM_183419chr831266 543 494 1474 1553 --
NM_183422chr132136 93 --1672 1702
NM_194247chr2104404 3594 3304 2980 1764 991 961 744 579 487 23796 909 33043 2782 501 --
NM_194250chr2142 2358 87 1459 1140
NM_194282chr463066 2377 1896 1107 765 702 12257 22518 2220 12437
NM_194285chr1173018 2681 1138 943 776 148 134 12140 186 13206
NM_194286chr1285956 5878 5668 5634 5438 4238 2135 773 25017 2102 12049 --
NM_194291chr842950 2295 2151 509 12870 32181 603 197 --
NM_194298chr107547 437 377 235 206 160 32 31479 599 340 296 23 --
NM_194314chr173727 3426 1703 1406 1361 565 85 23451 922 14126 1813
NM_194317chr252109 538 432 405 177 --22263 480 --
NM_194328chr973115 3062 3054 2600 2202 1185 278 --23194 3103 --
NM_194329chr973115 3062 3054 2600 2202 1185 278 --23194 3103 --
NM_194330chr973115 3062 3054 2600 2202 1185 278 --23194 3103 --
NM_194332chr973115 3062 3054 2600 2202 1185 278 --23194 3103 --
NM_194356chr1242360 2165 1488 196 1147 11669 --
NM_194434chr18105078 4832 4822 4688 3976 3919 1913 1886 1655 1495 22116 1243 33634 104 74 --
NM_197941chr5113006 2773 2486 2257 2232 1998 1192 757 369 324 34 ------
NM_197970chr221150 493 2547 516 1419 1472
NM_198066chr1441105 957 939 685 1352 22761 2723 --
NM_198077chr13624 490 440 ----1533
NM_198086chr1442223 1973 1572 1377 11398 11644 --
NM_198128chr1882290 2013 1919 1871 1823 1648 118 74 1338 1547 --
NM_198158chr392891 2504 2371 2134 945 918 459 308 185 --1887 1543
NM_198159chr392891 2504 2371 2134 945 918 459 308 185 --1887 1543
NM_198177chr392891 2504 2371 2134 945 918 459 308 185 --1887 1543
NM_198178chr392891 2504 2371 2134 945 918 459 308 185 --1887 1543
NM_198181chr1532439 703 77 22256 69 ----
NM_198195chr32440 77 1460 --1684
NM_198196chr352526 2353 2322 1637 729 2860 303 ----
NM_198212chr772071 1929 1905 1874 574 75 47 1558 12247 --
NM_198215chr1041191 1124 1060 567 --31342 1199 1020 --
NM_198268chr193720 3519 3501 2696 864 652 505 393 213 --24094 715 --
NM_198269chr193720 3519 3501 2696 864 652 505 393 213 --24094 715 --
NM_198270chrX63270 3005 2682 2342 1039 869 --43209 2196 742 590 --
NM_198273chr552917 2455 993 846 807 --22030 271 --
NM_198399chr331596 1143 626 ----11710
NM_198400chr1562817 2411 2221 1813 770 474 1515 42922 2833 2617 1096 12104
NM_198465chrX52977 2663 1878 1017 622 12806 11966 12170
NM_198467chr72546 386 2577 538 --1236
NM_198485chr332477 1799 75 1876 22435 2388 11870
NM_198549chr143292 2561 469 56 12362 12668 --
NM_198569chr672688 2407 1651 752 491 389 352 12218 22596 429 --
NM_198578chr1221143 377 ----1194
NM_198581chr297029 6911 6766 4813 2740 2703 2318 2290 2119 12068 27299 1603 --
NM_198595chr484192 4104 3505 3043 1972 1951 651 307 13077 13773 --
NM_198793chr3114001 3988 3826 3776 3763 3680 3636 3469 3365 2592 615 ----13252
NM_198794chr1451352 1131 1018 436 103 --1357 --
NM_198859chr3135030 4947 4843 4673 4467 4412 3911 3872 3369 1415 1163 921 520 --24483 4359 --
NM_198889chr45534 196 152 88 39 11263 2997 225 --
NM_198900chr1286659 6064 5974 1954 762 746 558 226 1934 47283 7017 6527 272 16975
NM_198935chr2073121 3092 2504 847 396 305 140 43128 3099 1121 646 ----
NM_198968chr1362768 2526 1341 1084 862 746 43777 3092 1596 1529 --1899
NM_198990chr7102895 2474 2333 2258 2192 2168 847 412 341 44 --3367 358 286 --
NM_199000chr741587 818 693 554 2560 478 12108 --
NM_199040chr12103555 2829 2539 831 638 584 561 514 305 273 13441 21538 1043 --
NM_199053chr44279 259 158 133 ----2801 632
NM_199072chr753015 2204 2177 2039 313 33115 2102 1130 22793 2239 --
NM_199132chr1951854 1839 828 818 365 11885 11904 --
NM_199160chr931417 1366 673 2298 215 1469 11953
NM_199188chr1263557 2875 1599 872 263 122 2669 444 ----
NM_199190chr1263557 2875 1599 872 263 122 2669 444 ----
NM_199320chr492591 2117 2109 1807 1116 835 487 410 151 --52807 2462 2088 1787 162 12906
NM_199320chr492591 2117 2109 1807 1116 835 487 410 151 --52807 2462 2088 1787 162 12906
NM_199324chr483221 3051 2772 2672 2432 1216 1033 974 13274 53524 3146 2977 2512 409 --
NM_199328chr2161194 1030 943 481 437 163 1145 11068 1262
NM_199421chr14175091 4521 4359 4230 3945 3457 3430 3401 3237 3111 1654 829 678 518 428 368 145 --23508 720 13438
NM_199436chr222368 1166 12160 12429 12980
NM_199454chr164314 4193 3887 1439 671 578 31709 1638 473 ----
NM_199461chr1062237 2221 2212 365 318 204 12669 1467 --
NM_199482chr241916 717 620 286 2795 362 21785 62 --
NM_201263chr111686 --21806 773 1359
NM_201266chr292928 2461 2354 1011 793 663 595 418 289 --11215 13053
NM_201279chr292928 2461 2354 1011 793 663 595 418 289 --11215 13053
NM_201437chr831505 1404 32 --31328 1127 603 --
NM_201591chr431593 1403 444 21194 251 128 --
NM_201592chr431593 1403 444 21194 251 128 --
NM_201624chr111155 1123 137 1114
NM_203282chr1941788 1367 1301 131 --11457 --
NM_203327chr2074562 4258 3243 1090 739 413 300 21157 909 ----
NM_203349chr15112174 2132 1750 1682 1593 1429 885 751 634 217 45 --1433 --
NM_203350chr171685 1657 1545 542 506 301 292 1241 2250 231 --
NM_203354chr142228 45 --3798 738 207 --
NM_203355chr142228 45 --3798 738 207 --
NM_203356chr142228 45 --3798 738 207 --
NM_203406chr562956 2765 2052 818 526 106 160 12107 22340 1113
NM_203446chr2152786 2063 621 63 47 3340 277 79 22466 940 --
NM_203458chr163862 3601 3036 2379 1012 823 22705 960 13539 13527
NM_203459chr1102624 2592 2401 2360 2299 2214 1873 1051 410 317 22460 619 11598 --
NM_203463chr2124896 4861 4743 4585 4090 3423 3371 3157 1563 650 489 180 13430 21107 39 1522
NM_203504chr472448 2386 2240 1922 1882 915 719 11761 2663 108 --
NM_203505chr472448 2386 2240 1922 1882 915 719 11761 2663 108 --
NM_205842chr22669 140 --2565 72 1240
NM_206594chr183538 3245 2710 2509 2430 2349 822 792 21447 1084 13195 13023
NM_206595chr183538 3245 2710 2509 2430 2349 822 792 21447 1084 13195 13023
NM_206853chr694039 3890 2648 2532 1596 1478 1284 964 671 12713 --13370
NM_206854chr675300 5151 3909 3793 1932 972 392 23974 1088 13597 14631
NM_206855chr676265 6116 4874 4758 1937 1357 617 24939 2053 24562 538 15596
NM_206866chr2183001 2951 2581 2411 2005 974 889 759 --32592 2093 1176 --
NM_206907chr562836 2442 1275 861 272 71 23389 2169 1190 23060 1245
NM_206909chr8118152 7595 6674 5972 5921 2816 2337 1738 1253 700 665 16195 77801 6638 6046 5989 5807 5790 3097 15230
NM_206933chr172066 1057 894 421 409 97 52 32075 589 532 --12116
NM_206943chr24935 783 371 314 --1806 --
NM_207012chr1052245 2220 1120 519 63 12952 32861 2464 732 --
NM_207015chr352188 2094 1666 512 436 --22377 284 --
NM_207170chr12903 754 1793 --1607
NM_207292chr393251 2771 2743 2227 2076 991 772 511 481 11040 ----
NM_207293chr393251 2771 2743 2227 2076 991 772 511 481 11040 ----
NM_207294chr393251 2771 2743 2227 2076 991 772 511 481 11040 ----
NM_207295chr393251 2771 2743 2227 2076 991 772 511 481 11040 ----
NM_207296chr393251 2771 2743 2227 2076 991 772 511 481 11040 ----
NM_207297chr393276 2796 2768 2252 2101 1016 797 536 506 11065 ----
NM_207303chr1064132 3885 3830 3671 2701 857 22984 1572 --11236
NM_207304chr1322088 257 32136 1850 365 22262 2000 --
NM_207406chr4126387 6247 6149 5233 5043 4493 4283 1700 1664 1417 669 149 14115 65120 2335 1212 711 638 507 --
NM_207481chr231211 1106 365 1455 --11250
NM_207647chr982513 2455 2188 2153 1626 297 269 135 12491 ----
NM_207660chr1421726 1348 1696 11395 11648
NM_207661chr1421726 1348 1696 11395 11648
NM_207662chr1421726 1348 1696 11395 11648
NM_212554chr1011544 11523 21323 552 1451
NM_213589chr295619 5508 5323 4941 4829 3685 1864 1488 463 35559 1235 241 24392 1067 --
NM_213590chr13105012 4859 4734 4463 4395 4339 3920 3611 2116 2045 12090 25143 4620 13691
NM_213606chr1041747 1041 712 200 --22438 2139 --
NM_213651chr191569 1274 1172 722 625 610 457 443 330 21434 712 ----