TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-523-3p
miRNA Sequence: GAACGCGCUUCCCUAUAGAGGGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000088chr1711085 ------
NM_000094chr31111 ------
NM_000109chrX12408 12013 ----
NM_000141chr101257 --1297 --
NM_000161chr14----123 --
NM_000188chr102576 172 ------
NM_000192chr121371 ------
NM_000217chr121145 ------
NM_000259chr1514717 --14786 --
NM_000264chr922093 615 ------
NM_000267chr171220 23225 3194 ----
NM_000278chr1022241 1580 ------
NM_000310chr111202 ------
NM_000346chr1711897 ------
NM_000430chr1713699 ------
NM_000461chr333015 2999 2993 ------
NM_000609chr1022465 2275 ------
NM_000675chr221850 ------
NM_000767chr191600 ------
NM_000817chr2----11207 --
NM_000826chr4--179 ----
NM_000829chr1122202 2024 ------
NM_000841chr6156 ------
NM_000842chr11253 31 ------
NM_000875chr1524396 1385 --12406 --
NM_000899chr121843 ------
NM_000951chr193410 197 156 ------
NM_000961chr2032877 1397 875 ------
NM_001001502chr51543 ------
NM_001001549chr732692 2069 927 --168 --
NM_001001550chr732692 2069 927 --168 --
NM_001001555chr732692 2069 927 --168 --
NM_001001890chr2113978 ------
NM_001002032chr17----1623 --
NM_001002295chr1011091 ------
NM_001002860chr1424349 984 --12983 --
NM_001002876chr22130 ----1385
NM_001003688chr41405 ------
NM_001003694chr31495 ------
NM_001003792chr3----1877 --
NM_001003793chr3----1877 --
NM_001003800chr911290 --21396 1322 --
NM_001003810chr41856 ------
NM_001004317chr614381 ------
NM_001004342chr125671 1596 ------
NM_001005404chr1733551 1729 1541 ----11545
NM_001005415chr191423 ------
NM_001005416chr191423 ------
NM_001005861chr31664 ------
NM_001006944chr111459 ------
NM_001007466chr644999 4659 4635 807 ------
NM_001007553chr1--1152 ----
NM_001008225chr7------1146
NM_001008407chr71425 ------
NM_001008701chr1911238 ------
NM_001009880chr221922 14783 ----
NM_001009899chr3156 11530 ----
NM_001009960chr722808 941 ------
NM_001010854chr14----1177 --
NM_001010857chr11102 ------
NM_001010867chr111959 ------
NM_001010924chr102452 66 ------
NM_001010986chrX----12363 --
NM_001012512chr18152 ------
NM_001012513chr18163 ------
NM_001012977chrX11029 ------
NM_001013031chr101273 ------
NM_001013437chr181167 ------
NM_001014839chr12683 182 --11050 --
NM_001014841chr12683 182 --11050 --
NM_001017368chr171756 ------
NM_001018111chr722789 760 --1971 --
NM_001023567chr151929 ------
NM_001025076chr10----13969 --
NM_001025077chr10----15327 --
NM_001025105chr511369 11009 ----
NM_001025108chr234030 2538 1122 --13804 --
NM_001025201chr21685 ------
NM_001025266chr3--13915 ----
NM_001025595chr421681 33 ------
NM_001029858chr613131 ------
NM_001031690chr7----12172 --
NM_001031804chr1614180 ------
NM_001032288chr20------11636
NM_001032296chr1322610 1083 ------
NM_001032999chr2014561 --14315 --
NM_001033057chr331642 1518 839 ------
NM_001033112chr51831 ------
NM_001033117chr321814 203 ------
NM_001033581chr11349 ------
NM_001033581chr11349 ------
NM_001033582chr11349 ------
NM_001034852chr14----1155 --
NM_001035003chr411402 ------
NM_001035004chr411402 ------
NM_001037172chr311198 ------
NM_001037331chr181271 ------
NM_001039350chr721304 474 --21660 477 --
NM_001039649chr131224 ------
NM_001039690chr1611720 ------
NM_001039709chr2014561 --14315 --
NM_001039937chr131278 ------
NM_001040144chr1611720 ------
NM_001040146chr1611720 ------
NM_001040153chr131352 ------
NM_001040167chr73992 768 115 ------
NM_001040284chr1621082 124 ------
NM_001042437chr21760 ------
NM_001042492chr171220 23225 3194 ----
NM_001042533chr3----11335 --
NM_001044305chr61141 ------
NM_001046chr511868 ----1284
NM_001071775chr1311803 ------
NM_001083620chr4--179 ----
NM_001094chr171197 ------
NM_001126chr1----1347 --
NM_001147chr81110 ------
NM_001149chr101239 ------
NM_001175chr12----156 --
NM_001204chr2------17772
NM_001219chr7----1255 --
NM_001222chr101278 1735 ----
NM_001256chr17152 11902 ----
NM_001290chr41302 ------
NM_001300chr10----176 --
NM_001315chr62773 128 12083 --1146
NM_001332chr51566 --1538 --
NM_001356chrX11616 ------
NM_001357chr1167 ------
NM_001378chr21520 ------
NM_001386chr822400 1670 1692 ----
NM_001396chr2131953 1735 1017 ------
NM_001400chr1--11073 ----
NM_001419chr1933772 646 334 14841 1428 --
NM_001619chr1111085 ------
NM_001663chr14--1226 ----
NM_001681chr12----158 --
NM_001754chr2113978 ------
NM_001822chr21685 ------
NM_001892chr511369 11009 ----
NM_001936chr721304 474 --21660 477 --
NM_001938chr111709 ------
NM_001939chrX12422 ------
NM_001988chr17131 ------
NM_001995chr41115 ------
NM_002017chr1111189 ------
NM_002025chrX38287 7894 2615 --19247 --
NM_002045chr31321 ------
NM_002051chr1011091 ------
NM_002091chr18152 ------
NM_002137chr71458 ------
NM_002138chr41856 ------
NM_002193chr221267 510 ------
NM_002196chr201286 --1887 --
NM_002196chr201286 --1887 --
NM_002214chr725358 510 ------
NM_002226chr141241 ------
NM_002229chr191432 ------
NM_002233chr111301 ------
NM_002241chr111904 ------
NM_002254chr261952 1940 1713 213 107 85 --21955 1943 --
NM_002285chr234030 2538 1122 --13804 --
NM_002309chr2222090 1043 ------
NM_002341chr6129 ------
NM_002359chr1743921 3587 1258 354 --12689 --
NM_002360chr722613 2396 --11764 --
NM_002361chr19--1262 ----
NM_002383chr161851 ------
NM_002399chr1511329 ------
NM_002401chr1711944 ------
NM_002500chr2163 ------
NM_002509chr202677 256 ------
NM_002520chr51113 ------
NM_002522chr1751031 454 338 308 70 ------
NM_002582chr163765 759 268 ------
NM_002607chr7------172
NM_002609chr52577 144 ------
NM_002655chr81735 ------
NM_002656chr6----1217 --
NM_002667chr6------11231
NM_002697chr11107 ------
NM_002719chr1422260 136 ------
NM_002737chr1734822 1762 746 ------
NM_002744chr11349 ------
NM_002745chr2233540 1706 1211 ------
NM_002874chr91907 ------
NM_002896chr11----1106 --
NM_002912chr6--1384 ----
NM_002923chr11522 ------
NM_002926chr431157 795 771 ------
NM_002958chr31664 ------
NM_002972chr221267 ------
NM_003010chr171650 ------
NM_003016chr171379 183 11651 --
NM_003031chr161363 --1366 --
NM_003043chr322634 150 --13846 --
NM_003072chr191341 ------
NM_003085chr51543 ------
NM_003128chr222314 1144 --1847 --
NM_003131chr612053 ------
NM_003144chr61230 ------
NM_003155chr8--1449 ----
NM_003185chr2011144 ------
NM_003188chr6----1105 --
NM_003199chr1811029 ------
NM_003216chr2223270 3262 --1431 --
NM_003222chr20----1859 --
NM_003223chr162765 208 ------
NM_003247chr611686 ------
NM_003253chr2121518 451 ------
NM_003270chrX11010 ------
NM_003275chr911134 ------
NM_003286chr20----1371 --
NM_003339chr5----1150 --
NM_003341chr3----1508 --
NM_003342chr1712462 ------
NM_003349chr20------11636
NM_003350chr81283 ------
NM_003360chr41303 ------
NM_003367chr191105 ------
NM_003378chr7167 ------
NM_003392chr323968 1054 --22816 1685 --
NM_003410chrX1599 ------
NM_003412chr31759 ------
NM_003458chr313662 ----1415
NM_003482chr1212423 ------
NM_003483chr12------12322
NM_003487chr171224 ------
NM_003508chr71298 ------
NM_003565chr1211626 11745 ----
NM_003574chr18--21195 638 ----
NM_003576chr1322610 1083 ------
NM_003583chr12--13312 12710 --
NM_003590chr223867 252 ------
NM_003615chr32511 54 ------
NM_003620chr171779 ------
NM_003670chr321156 171 --1198 --
NM_003671chr913505 ------
NM_003704chr42193 180 ------
NM_003716chr31276 ------
NM_003745chr16--147 ----
NM_003749chr1321959 230 ------
NM_003768chr12145 135 ------
NM_003794chr3--1149 ----
NM_003822chr11702 12189 ----
NM_003828chrX1523 ------
NM_003896chr21760 ------
NM_003924chr421426 345 11355 ----
NM_003929chr11308 ------
NM_003936chr21792 ------
NM_003938chr191163 ------
NM_003941chr7----12289 --
NM_003942chr111459 ------
NM_003951chrX164 ------
NM_003987chr1022241 1580 ------
NM_003988chr1022318 1657 ------
NM_003989chr1022177 1516 ------
NM_003990chr1022177 1516 ------
NM_003994chr121843 ------
NM_004006chrX12408 12013 ----
NM_004007chrX12408 12013 ----
NM_004009chrX12408 12013 ----
NM_004010chrX12408 12013 ----
NM_004011chrX12408 12013 ----
NM_004012chrX12408 12013 ----
NM_004013chrX12408 12013 ----
NM_004014chrX12408 12013 ----
NM_004015chrX12408 12013 ----
NM_004016chrX12322 11927 ----
NM_004017chrX12408 12013 ----
NM_004018chrX12322 11927 ----
NM_004020chrX12408 12013 ----
NM_004021chrX12322 11927 ----
NM_004022chrX12322 11927 ----
NM_004023chrX12322 11927 ----
NM_004075chr121462 ------
NM_004093chr1332597 2239 2215 ------
NM_004171chr11------1400
NM_004217chr17127 ------
NM_004232chr1823808 3105 ------
NM_004277chr611567 ------
NM_004293chr91541 ------
NM_004302chr1242671 613 571 59 ------
NM_004329chr101122 ------
NM_004331chr82810 30 ------
NM_004364chr1931009 183 150 ------
NM_004383chr151520 ------
NM_004397chr111955 ------
NM_004430chr841838 570 520 510 ------
NM_004432chr922096 1976 ------
NM_004443chr32718 671 ------
NM_004449chr21----11131 --
NM_004455chr111086 ------
NM_004499chr51191 ------
NM_004503chr12--1787 ----
NM_004516chr1911073 ------
NM_004535chr2031598 1591 438 --31738 1577 473 --
NM_004538chrX1731 ------
NM_004571chr2141255 203 195 132 ------
NM_004575chr41379 ------
NM_004630chr11----11099 --
NM_004634chr31495 ------
NM_004655chr17----1492 --
NM_004667chr151186 ------
NM_004687chr1712064 ------
NM_004745chr8--26857 2586 1286 14988
NM_004759chr1----1519 --
NM_004762chr17----11722 --
NM_004783chr161274 ------
NM_004796chr141570 ------
NM_004840chrX21853 171 ------
NM_004859chr17195 ------
NM_004891chr2179 ------
NM_004899chr21130 ------
NM_004921chr11131 ------
NM_004929chr811498 ------
NM_004976chr1124928 3545 ------
NM_004978chr11567 ------
NM_004981chr22----1389 --
NM_004992chrX66630 6620 6500 6113 2855 2359 --16633 --
NM_004992chrX66630 6620 6500 6113 2855 2359 --16633 --
NM_005028chr102435 260 ------
NM_005067chr31118 ------
NM_005093chr2014561 --14315 --
NM_005095chr112074 ------
NM_005137chr222342 136 ------
NM_005157chr911830 ------
NM_005238chr1122726 55 ------
NM_005249chr141858 ------
NM_005252chr141127 ------
NM_005276chr12----11783 --
NM_005276chr12----11783 --
NM_005311chr732692 2069 927 --168 --
NM_005324chr1711803 ------
NM_005340chr51179 ------
NM_005342chrX22287 262 ------
NM_005375chr61892 ------
NM_005381chr22349 166 ------
NM_005392chr911425 ------
NM_005397chr722789 760 --1971 --
NM_005402chr71251 ------
NM_005417chr2021540 1526 ------
NM_005425chr16----134 --
NM_005461chr2011469 --11447 1370
NM_005465chr11516 ------
NM_005563chr1----1748 --
NM_005599chr121241 971 ------
NM_005613chr1--11517 ----
NM_005647chrX32164 911 283 1103 ----
NM_005668chr5--1859 ----
NM_005692chr7247 31 ------
NM_005736chr101102 ------
NM_005737chr2135 ------
NM_005746chr711978 ------
NM_005754chr51397 ------
NM_005840chrX12879 ------
NM_005860chr1931437 1404 211 ------
NM_005900chr41405 ------
NM_005904chr181376 ------
NM_005909chr511062 --11122 --
NM_005934chr1932548 2343 637 --1597 --
NM_006007chr9--13848 ----
NM_006015chr1139 11320 ----
NM_006022chr13135 ------
NM_006037chr213586 24917 4889 14351 --
NM_006040chr1611413 ------
NM_006047chr20--11081 ----
NM_006054chr1111590 ------
NM_006080chr712853 ------
NM_006095chr423280 742 24244 767 ----
NM_006136chr7--143 ----
NM_006160chr1731060 539 390 --11626 --
NM_006195chr911356 ------
NM_006203chr545415 3896 1298 1039 ------
NM_006237chr13----22264 686 --
NM_006251chr51637 2355 341 ----
NM_006312chr122787 284 ------
NM_006317chr51761 ------
NM_006322chr133726 166 146 ------
NM_006324chr16159 ------
NM_006325chr12175 ------
NM_006403chr6--131 ----
NM_006454chr432537 1906 48 ------
NM_006482chr12--13312 12710 --
NM_006521chrX----11408 --
NM_006534chr201191 1809 ----
NM_006548chr31340 ------
NM_006549chr1232945 717 64 ------
NM_006561chr10----13969 --
NM_006570chr9--1413 ----
NM_006614chr323591 3163 ------
NM_006624chr10--11817 ----
NM_006717chr923205 2571 ------
NM_006718chr6----1217 --
NM_006749chr82930 53 ------
NM_006756chr8--11369 ----
NM_006766chr812423 ------
NM_006805chr5--1608 1695 --
NM_006832chr14--1810 ----
NM_006924chr1724104 1675 ------
NM_006981chr911198 ------
NM_007005chr9----21497 367 --
NM_007054chr523320 794 ------
NM_007084chr132457 310 ------
NM_007158chr1--1152 ----
NM_007174chr1211648 --1942 --
NM_007182chr32672 50 ------
NM_007218chr81304 ------
NM_007313chr911830 ------
NM_007371chr9----1610 1180
NM_007375chr11851 ------
NM_009588chr62484 471 ------
NM_012064chr1211068 ------
NM_012081chr5--13660 ----
NM_012083chr101128 ------
NM_012090chr11994 ------
NM_012104chr111388 ------
NM_012104chr111388 ------
NM_012141chr131278 ------
NM_012154chr81571 ------
NM_012156chr2013400 ------
NM_012161chr421138 1072 ------
NM_012183chr11597 ------
NM_012193chr1124070 1254 ------
NM_012197chr921291 1029 ------
NM_012218chr191186 1296 ----
NM_012234chr322925 2765 ------
NM_012242chr101757 ------
NM_012257chr71761 ------
NM_012281chr712251 ------
NM_012294chr711519 --1149 --
NM_012297chr42611 49 ------
NM_012302chr11880 ------
NM_012309chr1113279 ------
NM_012316chr11230 ------
NM_012325chr201467 ------
NM_012428chr151943 ------
NM_012448chr1722149 216 --1219 --
NM_012476chr21178 ------
NM_012479chr732659 1965 892 ------
NM_013261chr42295 57 12500 ----
NM_013354chr81241 ------
NM_013372chr151142 ------
NM_013373chr221985 ------
NM_013437chr81469 ------
NM_013995chrX11720 ------
NM_014011chr21539 ------
NM_014021chr113361 ------
NM_014071chr20--1500 ----
NM_014117chr1622192 1806 ------
NM_014191chr121932 ------
NM_014212chr121912 ------
NM_014213chr21206 ------
NM_014240chr333402 789 185 ------
NM_014253chrX1602 ------
NM_014283chr1----11346 --
NM_014284chr12683 182 --11050 --
NM_014319chr1211397 ------
NM_014332chrX1358 ------
NM_014333chr111322 ------
NM_014350chr5----1957 --
NM_014351chr2221018 108 ------
NM_014423chr515487 ------
NM_014447chr421680 33 ------
NM_014488chr111468 ------
NM_014494chr16--12343 12201 --
NM_014498chr3------1319
NM_014552chr2------11502
NM_014577chr221213 ------
NM_014634chr2233496 3258 2871 ------
NM_014667chr321815 445 --1422 --
NM_014690chr7----12172 --
NM_014707chr711556 ------
NM_014729chr812204 ------
NM_014747chr142065 605 173 165 ------
NM_014776chr1223041 2985 ------
NM_014810chr113510 ------
NM_014827chr111646 ------
NM_014839chr1----1649 --
NM_014849chr131287 139 116 ------
NM_014850chr321814 203 ------
NM_014876chr2222228 1415 11717 ----
NM_014901chr521553 442 ------
NM_014921chr1911238 ------
NM_014924chr141267 ------
NM_014937chr10--11322 ----
NM_014947chr111939 ------
NM_014961chr411711 ------
NM_014974chr1011137 ------
NM_014975chr19169 ------
NM_014978chr101621 ------
NM_014991chr41116 ------
NM_014996chr31159 ------
NM_015002chr1222100 438 ------
NM_015017chr1----186 --
NM_015018chr6170 ------
NM_015024chr811010 ------
NM_015045chr101121 ------
NM_015076chr613979 23288 903 ----
NM_015091chr141656 ------
NM_015097chr31886 ------
NM_015113chr171166 ------
NM_015149chr121947 1579 ------
NM_015155chr1033018 2441 848 ------
NM_015184chr31172 ------
NM_015225chr91708 ------
NM_015238chr51554 ------
NM_015250chr92505 460 ------
NM_015264chr221922 14783 ----
NM_015284chr111469 ------
NM_015299chr1413522 ------
NM_015336chr12--12603 ----
NM_015343chr171212 ------
NM_015426chr31559 ------
NM_015435chr8143 ------
NM_015443chr17166 ------
NM_015457chr11--1362 ----
NM_015483chr72931 463 ------
NM_015520chr322340 2216 ------
NM_015530chr2152 ------
NM_015534chr11239 ------
NM_015567chr131230 ------
NM_015575chr21996 ------
NM_015635chr9------1456
NM_015657chr221005 29 ------
NM_015879chr1838618 8493 1916 12361 ----
NM_015892chr1062462 1828 1792 1636 776 463 12345 ----
NM_015915chr141277 ------
NM_015980chr51251 ------
NM_016040chr112452 ------
NM_016083chr622421 1504 ------
NM_016120chrX1946 ------
NM_016221chr511821 155 ----
NM_016227chr1----11346 --
NM_016231chr1711600 ------
NM_016275chr31602 ------
NM_016315chr2----11829 --
NM_016322chr922679 2461 ------
NM_016357chr12--1833 ----
NM_016374chr111334 ------
NM_016374chr111334 ------
NM_016403chr111531 ------
NM_016424chr1711534 ------
NM_016447chr71259 ------
NM_016480chr51831 ------
NM_016496chr191423 ------
NM_016530chr1513706 --13140 --
NM_016544chr213383 ------
NM_016547chr11654 ------
NM_016592chr201386 ------
NM_016605chr51422 ------
NM_016612chr81498 ------
NM_016623chr81595 ------
NM_016626chr1811519 ------
NM_016643chr16--1205 ----
NM_016823chr1721299 497 ------
NM_016931chr111343 ------
NM_016953chr225754 4115 ------
NM_017415chr51368 ------
NM_017455chr151943 ------
NM_017456chr17----11722 --
NM_017583chr11159 ------
NM_017594chr9--1102 --1368
NM_017637chr928349 51 ------
NM_017650chr734927 4590 1379 ------
NM_017651chr6--1350 ----
NM_017670chr111169 ------
NM_017714chr201212 ------
NM_017740chr1651706 1580 618 608 598 ------
NM_017742chr1821780 263 ------
NM_017793chr151236 ------
NM_017798chr2011179 ------
NM_017813chr8--14918 --15338
NM_017848chrX24047 3740 ------
NM_017873chr91688 ------
NM_017902chr1054902 1718 926 879 332 --11745 --
NM_017933chr221471 1462 11113 ----
NM_017994chr732983 2841 2825 ------
NM_018105chr811000 ------
NM_018120chr821039 525 ------
NM_018144chr10126 ------
NM_018198chr121448 1377 ------
NM_018216chr1175 ------
NM_018287chr101206 ------
NM_018361chr82984 930 1570 ----
NM_018362chr1133312 3000 33 13371 ----
NM_018364chr113916 ------
NM_018375chr142478 252 ------
NM_018419chr20197 ------
NM_018488chr17135 ------
NM_018593chr61691 --1702 --
NM_018638chr1215179 15131 ----
NM_018708chr191344 11538 ----
NM_018959chr19----1761 --
NM_018993chr201368 ------
NM_019004chr71971 ------
NM_019102chr71388 ------
NM_019102chr71388 ------
NM_019885chr222381 297 ------
NM_020180chr182433 236 ------
NM_020182chr2033081 2300 306 ------
NM_020225chr4----1353 --
NM_020245chr644905 4565 4541 713 ------
NM_020337chr412682 ------
NM_020381chr6--31918 1805 83 ----
NM_020403chr13156 ------
NM_020443chr137011 6592 5441 ------
NM_020449chrX1544 ------
NM_020525chr12--1149 ----
NM_020708chr201539 ------
NM_020718chr1676123 5700 4218 1996 402 375 145 ------
NM_020752chr1012903 ------
NM_020772chr171781 12992 ----
NM_020815chr42389 126 ------
NM_020834chr141481 ------
NM_020858chr1542072 2038 574 44 ------
NM_020927chr162112 104 ------
NM_020948chr11738 ------
NM_020951chr1911525 ------
NM_020987chr101239 ------
NM_021003chr141232 ------
NM_021079chr1732349 463 216 ------
NM_021129chr10143 ------
NM_021183chrX11731 ------
NM_021224chr9----1398 --
NM_021619chr911159 ------
NM_021643chr211928 ------
NM_021914chr1412199 ------
NM_021940chr61141 ------
NM_021954chr1321260 163 ------
NM_021956chr621273 1075 ------
NM_021964chr336216 1451 573 ------
NM_021973chr41301 ------
NM_021988chr20------11636
NM_021999chr13----1660 --
NM_022048chr1525395 5356 ------
NM_022080chr2031101 684 312 ------
NM_022114chr134108 1672 95 ------
NM_022129chr10191 ------
NM_022137chr14----1155 --
NM_022170chr711242 --1213 --
NM_022442chr20------11636
NM_022497chr31244 ------
NM_022566chr152534 453 ------
NM_022574chr712092 ------
NM_022737chr192376 368 ------
NM_022743chr1131 ------
NM_022751chr18146 ------
NM_022780chr2----1622 --
NM_022810chrX164 ------
NM_022898chr1433536 2959 106 ------
NM_022970chr101257 --1297 --
NM_023010chrX1644 ------
NM_023018chr1174 ------
NM_024050chr191599 ------
NM_024085chr21822 ------
NM_024295chr82811 74 ------
NM_024328chr142621 258 ------
NM_024329chr121431 1158 ------
NM_024337chr51309 ------
NM_024496chr141695 ------
NM_024541chr1021211 701 ------
NM_024595chr11333 ------
NM_024612chr172924 349 ------
NM_024770chr216190 ------
NM_024798chr1522321 1925 ------
NM_024830chr531552 410 293 --11692 --
NM_025090chr174254 225 174 106 ------
NM_025133chr21430 ------
NM_025179chr124626 1992 ------
NM_025187chr161436 ------
NM_025195chr811647 ------
NM_025219chr202784 172 ------
NM_025221chr411402 ------
NM_025237chr17176 ------
NM_025268chr141387 ------
NM_030621chr1422848 2720 ------
NM_030629chr161654 ------
NM_030648chr413988 1124 ----
NM_030806chr136351 2959 2482 ------
NM_030964chr513428 12937 ----
NM_031216chr1811972 ------
NM_031243chr71458 ------
NM_031266chr51191 ------
NM_031369chr41856 ------
NM_031370chr41856 ------
NM_031371chr111334 ------
NM_031371chr111334 ------
NM_031426chr922774 2756 ------
NM_031442chrX1787 ------
NM_031477chr161342 ------
NM_031892chrX1392 ------
NM_031992chr711242 --1213 --
NM_032017chr111853 ----1822
NM_032189chr1323103 394 --11761 --
NM_032228chr111701 11210 ----
NM_032316chr3--1165 ----
NM_032420chr51709 ------
NM_032434chr211208 ------
NM_032457chr413683 ------
NM_032494chr2----159 --
NM_032547chr41334 ------
NM_032557chr4--1283 ----
NM_032569chr161212 ------
NM_032646chr17169 ------
NM_032682chr313421 ------
NM_032711chr1743921 3587 1258 354 --12689 --
NM_032778chr3----11335 --
NM_032859chr131695 ------
NM_032875chr171783 1322 ----
NM_032918chr12----1161 --
NM_032961chr41548 ------
NM_033023chr7------148
NM_033044chr11994 ------
NM_033081chr20152 ------
NM_033181chr622421 1504 ------
NM_033225chr82893 198 ------
NM_033285chr814044 ------
NM_033326chr112792 485 ------
NM_033331chr913505 ------
NM_033337chr32853 279 ------
NM_033496chr102576 172 ------
NM_033497chr102576 172 ------
NM_033498chr102576 172 ------
NM_033500chr102576 172 ------
NM_033535chr421138 1072 ------
NM_033624chr1222100 438 ------
NM_052864chr42486 274 ------
NM_052869chr17169 ------
NM_052876chr192764 210 ------
NM_052879chr1211436 ------
NM_052886chr8--12157 ----
NM_052918chr101472 ------
NM_053025chr311631 ------
NM_053026chr311631 ------
NM_053027chr311631 ------
NM_053028chr311631 ------
NM_053031chr311631 ------
NM_053032chr311631 ------
NM_053056chr1132468 2334 412 ------
NM_053281chrX1157 ------
NM_057169chr1223041 2985 ------
NM_057170chr1223041 2985 ------
NM_057178chr171756 ------
NM_078471chr17------1784
NM_080391chr11559 ------
NM_080392chr11608 ------
NM_080552chr202625 194 ------
NM_080605chr141509 1109 561 140 ------
NM_080618chr20----121 --
NM_080632chrX1644 ------
NM_080717chr121371 ------
NM_130436chr2131953 1735 1017 ------
NM_130797chr721304 474 --21660 477 --
NM_133369chr51289 ------
NM_133474chr4--11557 ----
NM_133477chr4--11266 ----
NM_133486chrX----1135 --
NM_134269chr221245 ------
NM_138494chr722808 941 ------
NM_138576chr1433536 2959 106 ------
NM_138638chr1412199 ------
NM_138782chr511983 ------
NM_138795chr111235 ------
NM_138966chr18----1454 --
NM_138970chr141570 ------
NM_138971chr111388 ------
NM_138971chr111388 ------
NM_138972chr111388 ------
NM_138972chr111388 ------
NM_138973chr111388 ------
NM_138973chr111388 ------
NM_139012chr62773 128 12083 --1146
NM_139014chr62853 208 12163 --1226
NM_139057chr151613 12625 ----
NM_139135chr1139 11320 ----
NM_139168chr51677 ------
NM_139215chr171224 ------
NM_139321chr201180 ------
NM_144586chr21124 ------
NM_144595chr131352 ------
NM_144601chr1611061 ------
NM_144723chr5153 ------
NM_144949chr21539 ------
NM_145113chr1411506 ------
NM_145159chr141241 ------
NM_145173chr1932124 389 339 ------
NM_145175chr221119 115 ------
NM_145331chr6----1105 --
NM_145753chr3--11383 ----
NM_145891chr1611149 ------
NM_145892chr1611149 ------
NM_145893chr1611271 ------
NM_147156chr101178 ------
NM_147181chr411402 ------
NM_147182chr411402 ------
NM_147183chr411402 ------
NM_152282chr311198 ------
NM_152288chr1611087 ------
NM_152380chr11108 ------
NM_152390chr21211 ------
NM_152470chr1823693 1326 --11500 --
NM_152493chr111049 ------
NM_152622chr5128 ------
NM_152641chr1212441 ------
NM_152678chr322546 1974 ------
NM_152721chr181582 ------
NM_152758chr812961 ------
NM_152838chr20--11081 ----
NM_152868chr22----1389 --
NM_152890chr12500 307 ------
NM_152995chr42666 261 ------
NM_153181chr18----1454 --
NM_153182chr3----11335 --
NM_153184chr3----11462 --
NM_153255chr61950 ------
NM_153367chr1033879 828 84 ------
NM_153464chr191666 ------
NM_153499chr1233043 815 162 ------
NM_153500chr1233043 815 162 ------
NM_153607chr5138 ------
NM_153616chr1542072 2038 574 44 ------
NM_153617chr1542072 2038 574 44 ------
NM_153618chr1542072 2038 574 44 ------
NM_153619chr1533310 3276 1282 ------
NM_153693chr12--1787 ----
NM_153810chr10----14693 --
NM_170665chr12----13893 --
NM_170674chr1511329 ------
NM_170675chr1511005 ------
NM_170676chr1511005 ------
NM_170677chr1511329 ------
NM_170711chr19----1937 --
NM_170712chr32672 50 ------
NM_170713chr32672 50 ------
NM_170714chr32672 50 ------
NM_172020chr721709 1325 ------
NM_172071chr146337 1640 1270 863 ------
NM_172169chr101278 1735 ----
NM_172170chr101278 1735 ----
NM_172171chr101278 1735 ----
NM_172173chr101278 1735 ----
NM_172216chr1232945 717 64 ------
NM_172226chr1233043 815 162 ------
NM_172315chr1511329 ------
NM_172316chr1511329 ------
NM_173076chr221005 29 ------
NM_173082chr611211 ------
NM_173198chr911198 ------
NM_173200chr911198 ------
NM_173470chrX22884 2478 ------
NM_173510chr22----12628 --
NM_173588chr112342 171 ------
NM_173642chr117770 ------
NM_173694chrX----12429 --
NM_173827chr422844 1073 ------
NM_174890chr101645 ------
NM_174937chr101608 --1566 --
NM_175884chr7--1962 ----
NM_175902chr17--1316 ----
NM_175907chr1811067 11002 ----
NM_177401chr19--11419 ----
NM_177438chr1422848 2720 ------
NM_177952chr141232 ------
NM_177996chr2013400 ------
NM_178496chr311391 ------
NM_178498chr1112495 ------
NM_178562chr7----1949 --
NM_178585chr41116 ------
NM_178586chr1422260 136 ------
NM_178812chr831433 1243 997 ------
NM_178818chr16----1130 --
NM_178864chr111597 ------
NM_180989chr1311002 ------
NM_181077chr151929 ------
NM_181457chr21214 ------
NM_181458chr21347 ------
NM_181459chr21113 ------
NM_181460chr21160 ------
NM_181486chr121371 ------
NM_181552chr71389 ------
NM_181553chr1611061 ------
NM_181554chr1611061 ------
NM_181598chr141277 ------
NM_181659chr201191 1809 ----
NM_181659chr201191 1809 ----
NM_181838chr5----1150 --
NM_182528chr21162 ------
NM_182565chr172669 268 ------
NM_182666chr3----1508 --
NM_182691chr7--1901 ----
NM_182692chr7--1901 ----
NM_182918chr21----11131 --
NM_183353chrX1946 ------
NM_183377chr171197 ------
NM_183393chr31276 ------
NM_183394chr31276 ------
NM_183416chr111404 ------
NM_183419chr8143 ------
NM_183422chr13135 ------
NM_194282chr412753 11144 ----
NM_194434chr18--21195 638 ----
NM_198074chr12268 207 ------
NM_198182chr2------11502
NM_198291chr2021540 1526 ------
NM_198390chr161654 ------
NM_198395chr51397 ------
NM_198447chr11292 ------
NM_198513chr81821 ------
NM_199131chr101543 ------
NM_199144chr20------11636
NM_199169chr2033081 2300 306 ------
NM_199170chr2033081 2300 306 ------
NM_199171chr2033081 2300 306 ------
NM_199185chr51113 ------
NM_199188chr1211436 ------
NM_199190chr1211436 ------
NM_199191chr2152 ------
NM_199194chr2152 ------
NM_199203chr20------11636
NM_199262chr171103 ------
NM_199282chr172297 283 ------
NM_199320chr412442 ------
NM_199320chr412442 ------
NM_199324chr4----12882 --
NM_199454chr134108 1672 95 ------
NM_201428chr1111590 ------
NM_201429chr1111590 ------
NM_201430chr1111516 ------
NM_201437chr8--11369 ----
NM_201624chr1----186 --
NM_201995chr11----1670 --
NM_201998chr11----1735 --
NM_202002chr121611 ------
NM_203303chrX1212 ------
NM_203318chr17------1784
NM_203350chr111438 ------
NM_203351chr1711944 ------
NM_203399chr1----1748 --
NM_203401chr1----1748 --
NM_203487chr13156 ------
NM_203504chr42611 49 ------
NM_203505chr42611 49 ------
NM_205860chr11702 12189 ----
NM_206853chr63865 789 631 ------
NM_206854chr643731 2126 2050 1892 ------
NM_206855chr614696 ------
NM_206907chr51637 2355 341 ----
NM_206914chr12176 ------
NM_207291chr191105 ------
NM_207371chr1011012 ------
NM_207645chr1111011 ------
NM_213609chr3----1138 --