TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-524-5p
miRNA Sequence: CUACAAAGGGAAGCACUUUCUC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr571520 630 423 234 163 132 64 1101 --11984
NM_000084chrX66006 5843 4273 2353 2335 2092 26980 889 36291 5485 2446 25952 1051
NM_000088chr1731330 1028 975 ------
NM_000089chr72768 728 ----1265
NM_000090chr22864 203 ----1904
NM_000104chr252928 2829 2631 2000 88 12703 ----
NM_000110chr13991 969 297 1149 ----
NM_000111chr71252 ------
NM_000115chr131928 ------
NM_000125chr654189 4173 4048 813 801 --12607 1223
NM_000138chr1552557 1953 1898 1884 118 32489 670 364 2932 140 12416
NM_000161chr1452002 1811 1454 207 76 ------
NM_000163chr531676 1501 411 12063 ----
NM_000165chr631583 1070 370 ------
NM_000167chrX21531 1429 --21669 716 --
NM_000168chr762776 2233 1319 552 465 67 23327 310 13375 --
NM_000170chr92411 346 ------
NM_000176chr5113875 3571 3299 3014 2879 2818 1470 1019 782 124 88 21267 1233 ----
NM_000176chr5113875 3571 3299 3014 2879 2818 1470 1019 782 124 88 21267 1233 ----
NM_000176chr5113875 3571 3299 3014 2879 2818 1470 1019 782 124 88 21267 1233 ----
NM_000189chr231756 1505 137 --12246 --
NM_000194chrX3544 459 138 ------
NM_000208chr1984043 3843 3440 3378 1153 1009 401 271 --14549 13330
NM_000210chr262093 2037 1751 1637 864 824 ------
NM_000214chr2031513 500 382 --21417 586 11141
NM_000216chrX54085 3965 832 466 260 44018 3490 2964 22 1948 --
NM_000222chr451936 1847 1742 1546 161 11950 11760 --
NM_000244chr112809 764 ------
NM_000248chr342309 966 926 517 42553 1115 977 163 11048 --
NM_000252chrX41238 1081 365 313 61475 1394 1354 1209 1160 71 --11276
NM_000259chr15106319 5847 5817 5263 5228 4384 2130 2062 606 542 25470 4982 ----
NM_000264chr9143282 3140 2991 2643 2580 2438 2312 2240 876 676 666 529 294 158 1426 ----
NM_000267chr17123322 3061 2920 2914 2907 2894 2870 2633 2579 1040 822 815 23140 831 11324 --
NM_000278chr1032316 2269 1554 ------
NM_000280chr112857 276 1263 2990 183 --
NM_000286chr171935 ------
NM_000304chr1751063 818 347 334 322 ------
NM_000313chr35423 411 274 142 108 1280 ----
NM_000314chr1052860 2157 1310 349 229 11082 12683 1387
NM_000321chr1361723 1463 1401 1228 355 122 ------
NM_000332chr6167008 6590 5385 5315 5277 5227 4371 4350 2690 2530 2480 2468 1992 1484 987 46 25602 5233 ----
NM_000337chr585281 2595 2338 2212 2010 1654 1086 630 11736 24929 477 --
NM_000340chr361492 1155 949 535 511 231 ------
NM_000345chr441020 986 316 235 --1220 --
NM_000346chr17141991 1940 1901 1889 1864 1427 1393 1384 1365 1350 594 116 103 94 --11330 1379
NM_000393chr242009 1643 1567 1549 31574 688 459 --11352
NM_000399chr1041015 1006 108 52 21180 1022 11043 --
NM_000405chr551283 418 378 148 61 ------
NM_000408chr283445 3400 2750 2719 2257 1361 297 185 2374 267 ----
NM_000430chr1753172 2645 1513 1088 555 11108 --1715
NM_000461chr374582 4547 4437 4065 2948 559 76 33527 1654 1576 21068 89 --
NM_000489chrX63036 2870 2714 2408 2329 446 22495 2265 12891 --
NM_000495chrX31062 369 22 ----1454
NM_000523chr231205 261 219 21107 122 1185 --
NM_000527chr1952457 2155 862 543 107 --12172 --
NM_000533chrX41794 1584 1569 1510 11743 ----
NM_000555chrX116711 6042 5949 5647 4763 2552 2063 1968 1027 385 113 --36966 5924 2939 11540
NM_000574chr121263 1241 ------
NM_000599chr284605 4598 4490 4324 3905 1195 1007 312 24413 891 ----
NM_000609chr1052971 2469 834 312 121 ------
NM_000610chr11112955 2702 2538 890 883 876 702 634 154 147 140 21220 180 12839 --
NM_000615chr1162948 1104 990 713 218 193 --21182 533 --
NM_000618chr12106032 5095 4984 4868 4405 4392 4075 1720 914 602 15307 ----
NM_000627chr23810 618 302 ------
NM_000633chr18105186 5014 4999 4963 4938 4896 4186 3437 2010 1837 23630 1877 ----
NM_000641chr1921411 387 ----1412
NM_000719chr1252474 1945 1721 1017 706 36516 5855 5444 25297 4981 14552
NM_000720chr31126 ------
NM_000767chr1941315 1098 971 389 ------
NM_000788chr461484 1221 1074 325 183 116 --152 --
NM_000806chr561633 1497 598 533 495 337 ------
NM_000813chr585127 5121 4620 4517 4003 1979 1339 1085 14962 ----
NM_000814chr1533968 3710 1050 22569 1508 ----
NM_000839chr31466 ------
NM_000840chr71374 ------
NM_000844chr35907 808 797 791 51 2981 390 ----
NM_000859chr561705 1678 1563 1381 1353 432 1502 ----
NM_000861chr321724 1717 21951 1920 12431 --
NM_000872chr1031594 1022 377 ------
NM_000875chr1596908 6682 6533 6286 5698 5475 1678 1285 1117 35767 5669 2466 21374 1299 --
NM_000885chr242192 1904 814 92 12069 11610 --
NM_000891chr1783617 3226 2777 914 595 443 421 249 ------
NM_000901chr442402 2274 869 446 2895 765 12300 --
NM_000938chr41162 ------
NM_000943chr52372 115 ------
NM_000944chr472056 1958 1941 1722 788 625 389 12030 ----
NM_000965chr331217 866 389 --1332 --
NM_001001323chr1292891 2526 1269 1263 1200 1131 963 762 748 23169 2175 12848 --
NM_001001331chr331704 837 391 --21672 620 --
NM_001001395chr1252190 802 774 352 253 12754 22565 371 --
NM_001001396chr1114129 3337 3290 3150 2786 1315 1002 855 848 634 486 13309 ----
NM_001001419chr5165204 5067 4974 4642 4538 4284 3845 3519 2034 1969 1012 984 948 433 171 143 33788 659 151 14752 --
NM_001001433chr2063178 3137 2864 2023 1150 190 ------
NM_001001481chr851250 1040 994 973 851 ------
NM_001001483chr113454 375 40 ------
NM_001001484chr1072245 2061 2051 1701 988 864 670 --12395 --
NM_001001549chr792820 2563 2518 2307 2142 2114 671 412 382 12648 12370 --
NM_001001664chr283844 3327 2961 2768 2652 1592 862 104 1975 ----
NM_001001668chr1923784 3348 ------
NM_001001870chr172838 680 --1769 --
NM_001001890chr21113931 3798 3746 3654 3583 3423 3403 3367 3257 864 684 13699 24256 1468 --
NM_001001924chr842071 1984 1666 1318 ----1355
NM_001001938chr91896 12758 31431 595 360 11556
NM_001001971chr1021115 1023 11066 --1884
NM_001001974chr1021590 869 1767 ----
NM_001001994chrX2427 93 1108 ----
NM_001002243chr23723 584 245 ----1278
NM_001002258chr23560 331 162 ------
NM_001002295chr102914 440 ------
NM_001002838chrX2755 136 ----11883
NM_001002860chr1474135 3955 3816 3409 175 131 119 23086 1299 11612 14478
NM_001002926chr772370 2111 2095 1935 707 686 375 12693 22794 975 --
NM_001003398chr122540 158 ------
NM_001003652chr18198602 7431 6934 6668 5537 2881 2870 2803 2770 2729 2290 1770 1690 871 755 671 661 651 466 32185 1382 1149 12342 38370 8266 6900
NM_001003674chr18126348 5576 5519 5128 4921 4727 2693 1982 1838 1445 472 135 46809 5140 5111 4984 1556 --
NM_001003679chr162200 1538 677 584 572 470 ----12227
NM_001003681chr2272119 2052 1959 1949 1936 1899 52 ------
NM_001003688chr431135 1096 489 --1268 --
NM_001003712chr12153847 3499 3472 3078 2818 2808 2785 2705 2669 2647 1229 1198 801 790 656 23957 238 21011 322 --
NM_001003845chr22473 425 --1404 --
NM_001003927chr172607 184 ------
NM_001004019chr31405 ----199
NM_001004065chr943817 3785 2610 991 31537 1472 1294 13083 --
NM_001004317chr63493 328 313 13585 --13618
NM_001004342chr185985 5962 5078 5024 4247 4194 3984 1502 ------
NM_001004360chr231605 1502 774 --1207 --
NM_001005291chr171515 ------
NM_001005335chr193278 73 67 ------
NM_001005366chr125913 903 307 276 262 1807 ----
NM_001005377chr191302 ------
NM_001005404chr1744442 4351 4227 1752 33808 3145 205 1194 --
NM_001005463chr1072454 2368 1962 876 467 286 139 1906 11724 32293 610 351
NM_001005473chr5116628 6393 4635 4587 4460 4432 2627 604 474 438 258 34662 4369 2237 --1280
NM_001005505chr321725 1712 ----11776
NM_001005743chr1471311 1130 1115 1096 440 372 80 11074 11163 --
NM_001005849chr171477 ------
NM_001006600chr531590 272 124 ----11827
NM_001006610chr163853 287 247 2953 679 ----
NM_001006623chr242510 2457 2328 304 11877 ----
NM_001006634chr161495 ------
NM_001006684chrX2413 108 ------
NM_001006945chr13632 297 204 1569 ----
NM_001007024chr17114356 4344 3713 3288 2919 2694 1746 1619 1484 1386 250 ----14295
NM_001007097chr944134 3925 1398 787 --11269 --
NM_001007102chr661631 1619 1592 1390 1311 488 1340 --1248
NM_001007237chr132391 575 471 12842 1618 1339
NM_001007246chr212382 281 ----11824
NM_001007257chr171190 1101 1049 1014 987 948 534 ------
NM_001007278chr13125146 5115 5015 3192 2119 1567 1318 940 934 533 198 31 14479 15027 --
NM_001007466chr6115043 4531 4499 4447 4031 3532 1583 1577 1571 1558 1545 --24521 3953 --
NM_001007468chr222266 260 ------
NM_001007471chr92850 709 ------
NM_001007559chr1892046 1787 1620 1613 1606 1600 1571 705 418 32095 374 262 3776 323 156 --
NM_001008239chr18123710 3469 3458 3179 1350 1344 1338 1329 1313 1172 113 104 12831 1624 159
NM_001008393chr4102301 2243 1053 986 947 838 825 703 178 63 21840 152 22819 1137 --
NM_001008405chr74463 380 348 197 ------
NM_001008408chr776359 6258 5930 4586 2562 2110 257 14427 24003 303 --
NM_001008491chr252038 1538 741 520 173 1229 ----
NM_001008530chr141453 ------
NM_001008539chr875142 4572 4532 1823 1110 1093 724 25339 4514 ----
NM_001008541chr1042171 2105 1944 824 --11472 11686
NM_001008564chr1352230 2021 1805 1689 308 12174 11430 --
NM_001008660chr1161597 1539 1369 1296 543 335 --11173 --
NM_001008925chr443569 3433 2962 292 1126 13441 --
NM_001009554chr464579 3491 3174 3121 687 521 12932 ----
NM_001009569chr1081669 1589 1516 1388 589 470 377 225 21432 1377 ----
NM_001009571chr76633 626 488 240 196 183 11189 ----
NM_001009899chr396501 6209 4816 3999 2373 2005 1764 755 53 56304 5696 5419 4810 953 ----
NM_001009960chr752830 2374 2232 862 554 12408 12201 --
NM_001010853chr683040 2625 2310 1226 988 677 518 430 53247 2913 2550 2260 347 13064 --
NM_001010888chrX164669 4584 4502 4415 4355 4317 4003 3508 3470 3359 3207 3057 2852 1661 581 89 13502 13961 44535 4240 4015 3403
NM_001010895chr921299 410 --1708 --
NM_001010922chr174108 3466 3318 1699 1338 654 196 42954 2925 2884 1275 ----
NM_001010935chr13946 733 724 ------
NM_001010942chr1231299 1214 79 --21074 342 --
NM_001010942chr1231299 1214 79 --21074 342 --
NM_001010971chr13874 707 227 --1997 176
NM_001011513chr474033 3827 3354 2766 2512 1626 1616 --12760 --
NM_001011515chr44265 254 246 172 --11053 --
NM_001011553chr72970 146 1662 ----
NM_001011663chr102437 320 11060 --21049 677
NM_001011666chr796561 6552 6444 6430 6325 5095 4506 2553 448 36344 6308 1667 26301 4703 1951
NM_001011713chr1441466 566 337 66 ------
NM_001011885chr151556 ------
NM_001012393chr11105116 4995 4567 4109 2074 2068 797 137 131 96 14395 ----
NM_001012423chr153893 743 122 1153 12221 1507
NM_001012426chr643098 2713 1051 1035 13333 ----
NM_001012755chrX84699 4654 1819 1619 1558 1351 828 29 14633 ----
NM_001012968chrX82778 2446 2416 1808 1047 1010 891 54 11767 --12628
NM_001012989chrX2685 631 ------
NM_001013031chr1053234 1059 978 969 277 11363 21412 587 --
NM_001013415chr431444 1292 520 ------
NM_001013438chr32984 757 ------
NM_001013620chr12208481 8139 8027 8015 6971 6615 6536 5868 5434 2832 2822 2693 2666 2582 2166 2147 1762 1144 432 292 48401 7509 5925 1395 37501 2111 1530 --
NM_001013690chr123722 420 329 1787 ----
NM_001014797chr10188259 8226 8199 6811 5904 5286 5267 5235 3047 2635 2420 2065 1895 1474 1159 793 756 279 22730 1091 --13187
NM_001014809chr41864 ----1883
NM_001015045chr422133 875 1211 --12208
NM_001015877chrX83063 3023 2935 2630 2482 2470 1009 429 2932 95 11957 --
NM_001015887chr331326 1256 1193 ----11729
NM_001017371chr221032 201 1406 1154 --
NM_001017415chr13638 513 297 ------
NM_001017420chr831432 1415 154 1452 1272 1305
NM_001017423chr104726 712 546 535 --1317 --
NM_001017920chr21119 ------
NM_001017922chr161753 1722 1712 1498 136 122 ------
NM_001017923chr142325 70 1184 1260 --
NM_001017992chr531407 1245 445 --1463 --
NM_001017999chr13359 353 330 22171 433 ----
NM_001018037chr931325 1091 393 1272 ----
NM_001018053chr151854 1718 1694 682 248 11973 ----
NM_001018065chr976010 5055 1963 1470 1401 913 712 16024 15474 --
NM_001018067chr165384 5327 4676 362 277 203 --44945 4501 3326 2076 21123 35
NM_001018089chr1583920 3902 3514 3346 3101 2693 955 432 33741 1583 1567 ----
NM_001018108chr1562142 1920 1841 721 505 147 12164 --1270
NM_001018111chr764035 3849 3767 3195 1175 979 13954 ----
NM_001020658chr131448 1418 297 31637 1320 611 --1173
NM_001023567chr1552197 1536 896 746 122 1153 --1510
NM_001024226chr131121 998 186 ------
NM_001024660chr331407 1400 1365 ------
NM_001024948chr1113436 3348 2794 2727 2503 957 731 648 446 263 174 12647 --12536
NM_001024956chr11125893 5843 5772 5404 5146 4626 3679 1960 1745 1652 1174 272 44899 1427 1068 899 24580 1164 14521
NM_001025068chr341263 1136 634 479 11565 11304 --
NM_001025076chr10126169 5464 2465 2404 1887 1570 1176 1029 968 836 668 612 23884 1304 11860 --
NM_001025077chr10217527 6822 5021 4860 4809 4731 4613 4595 2928 2534 2387 2326 2194 2026 1970 1349 1080 1062 647 251 202 45242 2662 1086 846 ----
NM_001025079chr3123995 3604 3526 3359 2841 2580 1541 1519 1357 1274 1260 242 ----13942
NM_001025105chr531057 343 330 11555 ----
NM_001025108chr2114045 3695 3019 2901 2697 1656 1352 1333 583 232 160 ------
NM_001025201chr21147 ------
NM_001025205chr31425 ------
NM_001025252chr893218 3163 2819 2619 2570 2404 2181 352 141 33169 680 605 ----
NM_001025366chr661898 1800 1579 1384 1373 577 ------
NM_001025579chr1731054 856 331 11030 11072 --
NM_001025580chrX73860 3531 3339 2711 2612 548 529 23840 1712 12644 --
NM_001025780chr921082 84 11446 ----
NM_001029858chr682318 2210 2165 1362 801 576 352 299 --1591 --
NM_001029875chr572783 2737 2419 1148 1104 1084 813 1642 22872 2238 --
NM_001029884chr692514 2482 2156 1991 1826 1809 867 543 466 22757 104 12667 --
NM_001030007chr1663672 3666 3008 1129 700 367 2738 666 23658 3297 --
NM_001030055chr14164639 4491 4378 4129 4052 3588 3553 3094 3078 3070 1591 1322 1236 1101 738 398 13569 13642 --
NM_001031623chr671570 1356 1232 483 355 165 152 --1557 --
NM_001031679chr1233426 2827 111 --1489 23468 226
NM_001031685chr13784 669 635 ------
NM_001031695chr22105338 4649 4485 3825 3795 3781 2089 791 562 216 --21330 1187 25181 1814
NM_001031700chr482316 2220 2129 834 730 652 371 54 12227 ----
NM_001031732chr493407 2991 2568 856 788 750 317 143 59 --22323 1096 --
NM_001031748chr124561 520 464 191 1254 ----
NM_001031803chr171253 ------
NM_001031812chr54750 677 214 143 21925 494 --11568
NM_001032279chr111111 --1400 --
NM_001032296chr1392793 2360 1909 1833 684 624 436 248 26 ------
NM_001032363chr131850 248 170 ------
NM_001032380chr1081459 559 496 371 284 249 153 139 ------
NM_001032394chr662663 2611 2592 2567 1131 257 32285 385 274 --12721
NM_001033047chr42649 161 12660 ----
NM_001033081chr151866 1785 1751 738 671 ------
NM_001033087chr2033176 2298 150 13024 12196 12846
NM_001033557chr231363 1210 70 ----11122
NM_001033557chr231363 1210 70 ----11122
NM_001033561chr175780 767 751 641 211 ------
NM_001033578chr842297 2235 407 67 11985 1939 1387
NM_001033659chr1731305 1174 1039 21594 1371 ----
NM_001033723chr852795 622 565 457 434 ------
NM_001033925chr1031904 733 188 11408 ----
NM_001034852chr1432071 375 159 ----12048
NM_001034954chr1032499 2369 2093 12330 22742 1160 --
NM_001035254chr912607 ------
NM_001035260chr1031288 512 311 1415 ----
NM_001037131chr211145 ------
NM_001037132chr741532 751 541 373 22150 1543 1467 12266
NM_001037164chr741444 1436 336 119 --11976 1392
NM_001037172chr351376 1370 943 125 72 ------
NM_001037174chr242135 1895 711 30 ------
NM_001037332chr542521 2409 2385 2291 ------
NM_001037535chrX41487 1247 1228 95 21185 978 ----
NM_001037553chr2144451 4050 3289 755 15116 ----
NM_001037582chr491495 1444 1180 1119 1082 374 212 203 142 --11551 11513
NM_001037872chr22299 128 ------
NM_001037954chr114862 774 426 105 13497 1895 1936
NM_001038493chr211470 --21525 487 21547 1401
NM_001038702chr542671 2598 2547 1107 1225 1842 --
NM_001039459chr721025 1019 ------
NM_001039479chr1462436 2103 2003 919 599 141 ------
NM_001039547chr3187872 7154 6951 6921 6890 6867 4939 2974 2943 2782 2558 2480 1944 1791 1397 869 839 232 25376 5172 16815 --
NM_001039570chr2244610 4104 4062 410 14497 ----
NM_001039590chrX73634 3482 2706 2642 1519 1476 986 23368 202 ----
NM_001039618chr11175346 5037 4966 4881 4766 4130 4038 3793 3666 2003 1977 1894 1612 1559 1000 363 333 11680 21992 1347 11292
NM_001039711chr11387 ----1306
NM_001039762chr1021523 920 --1149 --
NM_001039802chr14411 298 267 244 1873 11383 --
NM_001039840chrX145799 5555 5283 4824 3937 3892 2432 1837 1452 1391 874 495 173 137 34964 2410 1405 --1775
NM_001039884chr192927 200 ----1343
NM_001039916chr1241062 1007 997 935 --1767 --
NM_001039937chr1373288 3257 2677 1577 718 498 421 1188 23683 771 1375
NM_001040001chr631788 259 59 12023 21966 25 --
NM_001040002chr1711141 ----11484
NM_001040057chr741279 975 950 939 --11195 --
NM_001040101chr41333 ----11062
NM_001040142chr262242 2223 2217 1589 480 66 2469 29 12068 --
NM_001040152chr774527 4329 3819 3456 3370 3150 706 --14593 --
NM_001040153chr133618 248 105 ------
NM_001040159chr431298 938 118 ----1294
NM_001040284chr1685239 4513 3996 2143 2133 1932 1261 823 2794 537 35963 4667 922 --
NM_001040402chr4123240 2861 1230 1185 1158 1010 769 346 275 203 75 46 ------
NM_001040429chr1373468 3119 1423 1187 907 698 540 2646 440 ----
NM_001040440chr55532 510 494 422 158 --1677 --
NM_001040446chr582508 2406 2366 2266 2136 1824 450 66 --1361 12187
NM_001040450chr153636 284 113 --1712 1834
NM_001040613chr81426 ------
NM_001040633chr731083 1023 215 1900 ----
NM_001040665chr774830 4211 4070 3270 1204 857 231 13759 ----
NM_001040708chr82283 227 ----2305 273
NM_001040712chr973230 3104 2906 2358 1186 837 722 22858 2205 13019 --
NM_001042355chr1695338 3944 3854 1997 1175 1066 403 214 161 13848 1109 --
NM_001042404chr161974 1948 1916 697 580 241 --11253 --
NM_001042413chr973883 3713 3422 3308 3089 1569 58 13672 ----
NM_001042424chr443263 2484 2183 538 --1806 --
NM_001042440chr551549 1262 408 380 129 1275 ----
NM_001042493chr682005 1582 1576 1417 783 768 265 154 11384 11948 --
NM_001042510chr842048 1758 1507 1370 ------
NM_001042537chrX82320 2182 929 470 451 437 367 62 130 ----
NM_001042555chr12114406 4195 4154 3580 3235 2955 1851 975 922 882 822 --23832 3722 135
NM_001042599chr2157827 7329 7284 7013 6215 5954 5209 5103 4794 2976 2965 1993 1903 657 338 37252 2435 2121 --26348 5607
NM_001042603chr1284280 2077 1666 1507 1407 586 576 345 --21435 1344 1650
NM_001042604chr3124750 4508 4388 4001 3720 3560 3363 1645 1429 846 617 535 54666 4073 3713 1200 991 ----
NM_001042749chrX51854 1765 779 521 160 ----11744
NM_001043351chr142249 697 310 302 2325 289 1909 --
NM_001044385chr252844 2753 847 552 51 21176 94 ----
NM_001046chr542795 1174 1152 503 1240 13005 --
NM_001065chr123515 358 352 ------
NM_001068chr3275 53 ------
NM_001071775chr1351698 1680 1416 1186 646 21608 723 11745 --
NM_001079874chr162068 2019 1989 1971 1778 1754 22137 1950 22126 1622 --
NM_001099678chr375539 5050 1733 1629 850 637 141 66185 5175 4242 2425 1951 209 16120 15502
NM_001100108chr1157978 7685 7164 6990 6528 5226 5181 5079 3029 2604 2400 2393 1290 1255 469 --13083 15275
NM_001106chr3209782 9581 9252 9181 8886 7922 7211 6831 6604 3772 3245 2681 2646 2377 1622 1500 1008 530 345 69 58898 6323 6036 1709 1552 --17674
NM_001115chr8130 ------
NM_001119chr421412 1318 --11428 --
NM_001121chr1061513 1205 750 735 678 582 ------
NM_001126chr11988 ------
NM_001144chr1621173 923 ----1172
NM_001151chr41183 ------
NM_001160chr12102684 2628 2255 2113 1901 740 607 582 434 135 12835 ----
NM_001167chrX85773 5648 4772 1750 1308 1249 849 421 36640 1142 888 11057 --
NM_001186chr2163149 2558 2022 773 554 503 22138 1066 ----
NM_001198chr662182 1959 730 460 286 25 --2979 479 --
NM_001201chr483930 3920 3337 3070 1289 854 665 105 31501 313 247 ----
NM_001204chr2167583 7494 7417 7109 6660 6040 5801 5718 5550 5173 2294 2167 1978 501 215 193 11822 16351 --
NM_001206chr963128 3039 2645 2286 294 288 13083 1763 12457
NM_001212chr171200 ------
NM_001219chr752124 1505 670 264 218 1396 31815 1674 233 --
NM_001225chr11186 ------
NM_001233chr752307 917 779 627 49 ----1209
NM_001235chr114706 666 639 577 ------
NM_001237chr441093 216 171 161 ------
NM_001241chr271903 1885 1778 1630 593 485 446 22149 222 11819 --
NM_001259chr775653 5586 1362 1331 970 964 931 1486 --24644 1405
NM_001304chr1753125 2724 2461 356 134 33778 2480 1348 ----
NM_001315chr672227 1697 1663 1581 1509 1496 606 12048 1177 --
NM_001330chr163320 139 64 1985 ----
NM_001332chr561387 1143 1099 480 398 71 ------
NM_001343chr521671 1297 ------
NM_001351chr341715 1709 1160 350 --1112 --
NM_001364chr11104612 4460 4387 3253 3165 1361 1218 1136 861 90 31245 779 767 ----
NM_001380chr105987 797 761 737 307 --1971 --
NM_001386chr831965 1832 92 22351 1735 22136 436 --
NM_001390chr1873535 3512 3183 3091 2648 241 228 13047 12372 --
NM_001396chr2172443 2115 1785 453 438 413 283 22147 978 12596 --
NM_001407chr361213 1185 1152 1110 1076 225 ----1235
NM_001412chrX103455 3042 2810 2334 1148 1142 1135 1129 1094 202 1638 12903 12532
NM_001416chr171458 ------
NM_001417chr1241954 1855 1401 1281 11886 ----
NM_001419chr19124569 4236 4155 1216 1200 1157 1148 1059 992 973 113 21 ------
NM_001422chr1121048 239 11396 ----
NM_001424chr16161 ------
NM_001430chr23542 461 237 ----1771
NM_001431chr65959 933 284 255 214 --2919 301 139
NM_001438chr153541 2688 1056 1028 954 13501 12360 --
NM_001451chr1641328 1279 1178 1035 11208 ----
NM_001455chr654888 4762 4274 1293 608 14934 13399 1132
NM_001465chr552148 1731 1345 868 569 ------
NM_001497chr942810 774 720 584 --11905 --
NM_001498chr651373 882 458 446 367 21027 305 ----
NM_001514chr11205 ------
NM_001527chr674222 1676 1445 1350 1074 352 143 61728 1552 1424 1359 1238 313 11342 --
NM_001546chr63985 384 228 ----1364
NM_001560chrX52673 2285 2066 483 364 --2339 330 --
NM_001584chr1131148 769 430 2211 111 ----
NM_001614chr171597 ------
NM_001650chr1863550 2894 1342 1285 1016 929 23567 935 13337 --
NM_001655chr1122017 522 12128 --1388
NM_001656chr571813 1761 1500 1358 628 172 31 ----11681
NM_001656chr571813 1761 1500 1358 628 172 31 ----11681
NM_001660chr34734 684 132 74 ------
NM_001663chr1462260 1690 1049 947 213 169 ----1337
NM_001675chr22174 ------
NM_001704chr62610 417 1235 ----
NM_001706chr36804 786 690 666 372 351 ------
NM_001709chr1192577 2536 2262 886 667 588 562 553 54 --12612 12288
NM_001717chr1531497 1382 1230 ------
NM_001722chr82246 63 ------
NM_001730chr1351526 1373 1313 1280 132 21436 554 ----
NM_001743chr23517 458 61 167 ----
NM_001755chr163527 503 446 ------
NM_001759chr1284465 4292 3400 3356 2041 1661 1333 71 --179 --
NM_001769chr123341 72 59 ------
NM_001792chr184974 384 337 250 --190 --
NM_001830chrX63741 3186 2688 1578 1357 493 1360 11218 --
NM_001854chr141292 998 388 64 11491 2577 149 --
NM_001858chr6124999 4282 4211 4195 3890 3547 3534 3521 1465 751 662 343 ----13161
NM_001893chr171375 ------
NM_001894chr2231195 1044 1022 ----11145
NM_001918chr1139199 9184 8984 8706 8473 8449 2231 1896 1258 1225 954 254 106 35870 1738 1399 ----
NM_001932chr174733 698 306 167 --1278 --
NM_001938chr151726 640 629 598 88 ------
NM_001949chr6103246 2828 2804 2789 2783 2704 2376 2226 991 769 43168 3028 2728 751 43088 2141 2018 794 12761
NM_001957chr482099 2066 1977 1701 1446 869 792 438 --12262 --
NM_001964chr531088 1058 779 --11107 --
NM_001968chr45824 740 673 649 157 1682 1853 --
NM_001981chr152053 1941 1723 1491 908 1757 --11580
NM_001987chr1264171 2711 1370 330 324 318 --22725 758 14112
NM_002009chr1562717 2591 2554 2409 2152 947 --22738 828 --
NM_002015chr13132602 1262 1219 951 903 859 834 709 693 684 465 363 332 23347 424 1660 12545
NM_002024chrX62149 1753 750 744 289 70 11393 ----
NM_002025chrX189194 9148 9137 8093 6270 6106 5753 3368 3306 2991 2933 2693 1789 1160 660 467 258 130 --48171 7908 7208 2957 18498
NM_002035chr1833969 2761 396 32900 2491 959 33707 528 234 --
NM_002039chr43627 617 359 --1170 --
NM_002040chr2193178 2704 2622 2540 2495 2419 1275 1011 909 33129 3019 2810 13110 --
NM_002068chr191667 ------
NM_002072chr931017 914 146 ------
NM_002074chr161671 459 420 388 260 248 --1510 --
NM_002078chr31568 ------
NM_002114chr62170 149 --1113 --
NM_002126chr1753263 2935 1452 1122 979 11110 ----
NM_002128chr1392569 2386 2281 1842 1688 957 598 419 140 11968 ----
NM_002137chr722228 604 42171 2110 340 181 --1298
NM_002140chr941181 1161 1112 751 1458 1352 11016
NM_002146chr1741383 1347 1100 945 --1401 --
NM_002158chr2103840 3748 3244 2754 2632 1276 784 629 509 481 23174 225 22918 1011 --
NM_002163chr1631261 1123 408 1957 1822 --
NM_002165chr201391 --1323 --
NM_002167chr11411 ------
NM_002182chr332739 967 670 12766 ----
NM_002210chr273268 3258 3163 2727 749 595 422 43508 2786 2768 2290 13458 --
NM_002214chr795624 5336 5218 5039 4660 4193 1331 865 665 15363 --14857
NM_002221chr172825 2650 2575 2253 2165 2137 202 --1129 --
NM_002223chr1232746 1131 348 1423 ----
NM_002230chr1711098 ------
NM_002239chr221070 901 ------
NM_002245chr12623 476 ------
NM_002253chr441378 1238 989 446 --11363 --
NM_002264chr3104655 4641 4450 3283 3076 1500 1372 776 748 704 13440 34959 1971 965 25053 2027
NM_002267chr1342425 1656 982 112 22446 2244 --11552
NM_002270chr5125648 5635 4931 4749 3854 3743 3512 2136 2111 1417 1041 984 13603 25128 225 --
NM_002271chr1332163 914 71 12276 ----
NM_002291chr72147 117 ------
NM_002293chr122396 845 12795 ----
NM_002296chr151715 1284 657 563 87 1631 ----
NM_002310chr576050 5965 4075 1712 1453 569 351 25406 833 11821 1234
NM_002336chr1273609 1140 1027 540 241 226 157 45080 4972 1547 1249 ----
NM_002349chr241422 1410 1153 240 21222 1068 11311 --
NM_002355chr1231419 1351 171 ------
NM_002356chr652702 2656 1058 350 157 31086 882 542 ----
NM_002359chr1764308 1630 1183 701 253 199 14284 1960 --
NM_002360chr732636 2500 2333 ------
NM_002375chr341891 1481 1433 770 ------
NM_002380chr82387 26 1260 1743 1871
NM_002382chr1431167 1144 979 ----1430
NM_002397chr541606 839 748 739 1136 ----
NM_002398chr231549 1349 1227 11277 ----
NM_002408chr142744 659 --1310 --
NM_002479chr13701 666 552 1575 ----
NM_002480chr126490 372 200 179 156 146 ------
NM_002481chr197875 7653 6447 5989 5847 5084 2740 1823 322 ----17815
NM_002482chr15661 281 194 79 40 ------
NM_002500chr231244 452 441 11250 ----
NM_002501chr1933994 2906 2563 ------
NM_002508chr151963 1845 1793 1628 488 ------
NM_002514chr82883 333 11164 1301 --
NM_002518chr261242 1144 1011 1002 486 104 11224 1403 --
NM_002522chr17103655 3182 3140 3120 1409 1335 497 441 147 66 1609 ----
NM_002547chrX54051 3444 3157 1332 95 13142 2198 79 --
NM_002577chr3104049 4036 3933 3254 2825 2656 1608 1346 787 308 --1541 1868
NM_002581chr923810 3477 11125 ----
NM_002582chr162952 160 ------
NM_002595chr1271820 1650 1374 758 442 272 193 21535 1400 ----
NM_002609chr521845 1534 ------
NM_002641chrX61467 1407 1401 760 635 87 31942 814 37 ----
NM_002646chr141713 1560 516 469 --12080 --
NM_002655chr8145094 5064 4955 4678 4159 3399 1852 1741 1392 729 336 208 180 108 1419 13756 --
NM_002657chr2013855 23697 3274 13564 23752 2431
NM_002662chr322144 2073 11558 --1301
NM_002687chr1461264 1015 998 893 829 361 1179 1847 --
NM_002699chr141414 1275 1215 78 --11466 --
NM_002709chr282974 2644 2425 2336 1083 718 399 393 11386 11225 --
NM_002713chr131080 1002 994 --1982 --
NM_002719chr1442422 2380 1995 475 11894 --11668
NM_002721chr93500 380 363 ------
NM_002731chr143083 2024 1064 325 32612 1124 1071 ----
NM_002734chr1732259 2203 1812 --42055 1733 423 244 --
NM_002736chr761770 849 806 596 473 74 --1231 --
NM_002737chr17136648 6613 6462 6398 6196 6145 5431 4847 4280 4274 1362 1198 956 --11755 1707
NM_002748chr1531070 886 49 --127 --
NM_002752chr52547 225 ------
NM_002793chr6176 ------
NM_002821chr66793 787 781 773 764 635 ------
NM_002824chr121472 ------
NM_002825chr71147 --184 --
NM_002833chr1521614 1533 ------
NM_002834chr1253398 3370 3295 3228 710 14074 ----
NM_002838chr16789 351 287 183 121 58 ----1243
NM_002846chr21561 ------
NM_002848chr1231142 1070 364 11025 11225 1110
NM_002851chr72697 672 ------
NM_002858chr121236 1208 ------
NM_002868chr1242375 2369 2304 542 --1273 --
NM_002874chr942397 2234 717 455 12404 11841 2827 437
NM_002886chr3103892 3750 3621 3357 1500 1273 939 933 775 756 11589 --11004
NM_002892chr1461400 1270 1178 473 298 245 11305 ----
NM_002906chr1152342 2137 2034 1562 825 --11828 --
NM_002912chr65929 861 745 679 349 ------
NM_002918chr1921123 993 1735 ----
NM_002941chr351642 1321 1089 1071 1025 ------
NM_002957chr943500 3202 1505 368 12524 122 --
NM_002959chr154461 1511 1491 288 282 11723 34401 1210 819 --
NM_002966chr11196 ------
NM_002968chr162964 146 ------
NM_002973chr12196 --1538 --
NM_002982chr172370 93 1342 ----
NM_002983chr171362 ------
NM_002993chr42993 701 ------
NM_002998chr882161 1742 859 454 378 334 89 82 12188 1551 --
NM_003003chr171217 ------
NM_003016chr1771591 1504 1455 1330 1297 1274 732 ----11941
NM_003017chr621413 78 ------
NM_003027chr153358 161 116 ------
NM_003030chr381735 1729 1723 1714 1606 1587 1469 256 ----11807
NM_003036chr13979 942 291 1142 ----
NM_003043chr344175 4122 212 190 34298 3101 114 1309 --
NM_003045chr1365016 4742 4482 3379 1859 1224 11652 13770 --
NM_003070chr92701 646 1195 ----
NM_003074chr362184 1749 1743 795 358 174 22157 595 ----
NM_003076chr1221593 650 ------
NM_003099chr15136558 6541 4786 2518 2485 2281 2255 2212 1742 1565 916 846 516 12169 12128 34351 2468 1201
NM_003106chr33842 819 269 1899 ----
NM_003107chr622443 474 11746 12330 --
NM_003108chr2156877 6855 6559 6481 5555 5137 4606 1539 1469 1426 1216 1183 977 611 265 47139 5280 844 353 15319 --
NM_003112chr7123262 3232 3058 2883 2555 2379 2206 2133 2081 2003 1989 370 22123 917 11961 --
NM_003113chr21137 ------
NM_003131chr632309 2268 1403 ------
NM_003133chr151000 930 384 291 23 1131 ----
NM_003137chr641559 805 799 787 ----12236
NM_003146chr111371 ------
NM_003150chr1732342 337 305 --1107 --
NM_003157chr31669 1739 --2640 223
NM_003162chr231121 1003 101 ------
NM_003178chr342178 2142 1839 831 22243 1921 ----
NM_003189chr122312 1359 31341 1285 231 23306 753 12772
NM_003198chr11257 --1102 1278
NM_003200chr194863 831 645 378 1628 ----
NM_003202chr521845 1357 --1480 --
NM_003205chr1542223 830 559 252 11644 1676 --
NM_003206chr61316 ------
NM_003211chr1251414 1196 431 205 191 1554 ----
NM_003215chr43558 501 58 ------
NM_003223chr165863 857 789 704 653 ----1836
NM_003246chr1531995 1907 307 ------
NM_003247chr641624 1394 1385 1379 11848 ----
NM_003253chr212702 161 --11654 --
NM_003257chr151973 41258 986 260 199 11054 1251
NM_003262chr3105305 5258 4577 4406 4371 3910 900 611 524 89 --21303 969 --
NM_003272chr11263 ------
NM_003290chr192145 81 ------
NM_003304chr351458 594 513 506 239 1340 ----
NM_003318chr61303 ----1291
NM_003326chr142675 2234 1827 1796 ----22537 271
NM_003338chr1071925 1874 1603 652 420 399 204 ------
NM_003340chr42891 126 1872 ----
NM_003342chr1763111 2656 692 683 544 533 12933 ----
NM_003347chr2231651 1487 220 11790 ----
NM_003359chr431119 270 106 122 ----
NM_003371chr951882 1869 1854 1653 1637 31844 1691 820 ----
NM_003372chrX2935 693 ------
NM_003379chr63922 748 734 --1440 --
NM_003392chr374334 2903 1727 1419 1176 819 227 ------
NM_003400chr26662 625 619 263 185 139 2694 94 ----
NM_003403chr142608 561 1243 181 --
NM_003406chr831373 658 87 1607 ----
NM_003410chrX32096 652 24 43106 2397 2345 1016 --12921
NM_003411chrY4688 615 559 462 1240 1679 --
NM_003412chr362906 2286 1943 654 540 352 23117 2792 1594 --
NM_003413chrX41977 1583 1261 485 4804 635 599 582 --11652
NM_003418chr32740 224 ------
NM_003423chr1952299 1971 1877 871 418 1512 22532 1951 --
NM_003430chr1911464 --11585 --
NM_003436chr192905 334 --1755 --
NM_003442chr113848 672 161 ------
NM_003453chr135688 649 504 486 109 1253 ----
NM_003462chr111767 ----2655 93
NM_003463chr683150 2304 1317 1206 956 875 805 243 --1620 --
NM_003468chr2114325 4239 4223 4123 4014 3770 3349 650 632 277 54 1271 22741 844 --
NM_003470chr1621819 447 11303 ----
NM_003472chr631225 581 251 ------
NM_003474chr1032351 2023 73 ------
NM_003478chr1162811 1020 420 279 219 71 23096 2329 ----
NM_003482chr1252684 2566 2427 1925 835 11809 --12238
NM_003483chr1242957 2812 2630 2141 12007 11881 2886 202
NM_003489chr2183412 2803 2479 2296 2275 1336 714 576 12572 --13105
NM_003503chr131297 1169 374 1450 --160
NM_003505chr731909 1888 301 1290 ----
NM_003506chr871314 1121 962 932 903 891 37 171 11351 --
NM_003507chr241997 1870 1318 443 31953 1936 1903 ----
NM_003559chr1722420 350 --13998 1570
NM_003566chr1283267 2604 2347 1388 916 739 618 418 1176 --23312 460
NM_003574chr18115662 5575 4988 4733 4253 4045 3540 1929 1916 626 110 25086 5045 25376 287 11680
NM_003583chr1273095 3054 2823 1280 218 160 115 43541 3418 3132 707 --12526
NM_003590chr2123590 3483 3402 2750 1562 1267 1257 930 685 597 375 256 13861 23693 1190 --
NM_003596chr72540 412 ------
NM_003597chr281501 1494 1421 888 845 338 212 192 12186 21975 1509 --
NM_003602chr72413 367 --1359 --
NM_003603chr421543 1520 --11387 --
NM_003615chr3103662 3648 3605 2802 1270 1003 834 483 403 344 22940 141 1758 --
NM_003617chr164930 4174 3800 3235 3136 1528 34872 1637 834 ----
NM_003618chr22981 152 --1224 1115
NM_003629chr163458 2325 957 854 581 266 41344 763 468 118 --1947
NM_003631chr107947 879 817 770 266 214 119 ------
NM_003633chr532311 764 581 12547 ----
NM_003637chr11278 ----11298
NM_003659chr231202 302 153 ------
NM_003672chr151904 1692 694 479 446 ------
NM_003686chr11261 ------
NM_003716chr31863 ------
NM_003722chr362722 2418 2006 1968 1854 1756 --11776 --
NM_003741chr31380 ------
NM_003743chr241868 1463 189 165 21874 289 --1203
NM_003749chr131234 --12141 11841
NM_003772chr1141047 411 183 170 31192 831 40 175 --
NM_003778chr33713 132 42 1702 ----
NM_003794chr331083 933 920 1896 ----
NM_003850chr132219 182 ----1543
NM_003861chr1452730 2455 403 297 126 22796 1862 1922 --
NM_003862chr51109 ------
NM_003872chr243027 1931 305 292 1298 --1777
NM_003873chr1072465 2361 2343 1989 1944 981 759 22238 2188 1321 --
NM_003883chr51586 ------
NM_003885chr1752674 2564 2371 2210 70 12587 ----
NM_003895chr212812 655 ----12052
NM_003900chr51339 ------
NM_003902chr13334 99 55 ----1282
NM_003908chr2011348 ------
NM_003913chr694082 3724 3573 1371 1318 1297 946 816 178 43773 1283 1118 1017 1614 --
NM_003934chr95928 327 207 193 110 161 ----
NM_003941chr752475 1805 1671 1565 117 1246 1931 --
NM_003966chr5117789 7729 7079 6811 6408 5756 2685 2665 2659 2292 1650 46941 6897 3113 2067 12022 17145
NM_003988chr1032393 2346 1631 ------
NM_004019chrX1363 ------
NM_004035chr1754474 3678 1187 1048 61 1256 ----
NM_004064chr1221219 1171 21277 1181 ----
NM_004071chr22216 77 ----189
NM_004086chr142556 191 ------
NM_004093chr1363143 3042 2922 2647 2606 332 13095 ----
NM_004096chr1072111 1967 1573 1505 853 719 342 32019 1925 1588 ----
NM_004100chr651969 1916 677 564 484 12252 --1746
NM_004114chrX41120 881 809 418 ------
NM_004124chr1463555 3146 2568 2517 1027 138 23107 924 --1188
NM_004136chr1583121 2912 2664 2389 2365 1051 304 52 1286 ----
NM_004161chr261638 1433 1282 530 372 303 --1218 --
NM_004171chr11119651 9513 6689 6658 6096 5828 2503 2111 1763 1103 893 17002 38302 8067 6141 18346
NM_004172chr511429 --12026 --
NM_004177chr1141811 1800 1389 129 --11870 --
NM_004180chr2----1248 1509
NM_004185chr11581 ------
NM_004187chrX21120 151 ------
NM_004209chr1611094 ------
NM_004229chrX62126 1534 1477 1370 358 179 ------
NM_004232chr1843755 2465 1518 867 33819 3626 1372 --13210
NM_004237chr54906 721 331 150 1229 ----
NM_004241chr103737 559 232 2508 257 2767 122 --
NM_004269chr92420 372 ------
NM_004272chr561563 1462 596 451 418 350 11517 ----
NM_004286chr2252843 2455 2166 961 251 ------
NM_004293chr943803 2384 775 678 --23873 3510 --
NM_004301chr3287 33 ------
NM_004302chr1232906 2811 537 ------
NM_004316chr122773 731 1889 ----
NM_004327chr223910 612 593 1999 ----
NM_004329chr1031192 995 429 ----1443
NM_004330chr1551199 1050 746 461 140 21094 469 ----
NM_004331chr842691 2263 601 297 22425 938 12638 --
NM_004342chr752069 1934 634 379 75 ------
NM_004346chr441521 548 386 35 21467 526 11154 --
NM_004352chr163477 460 166 ------
NM_004365chr5159 ------
NM_004370chr662026 1587 703 581 570 417 1608 ----
NM_004389chr2172 ------
NM_004392chr1392515 2291 1847 1802 1671 1039 899 317 114 22345 218 ----
NM_004396chr171195 ------
NM_004397chr1154306 4215 4048 450 191 --43700 3241 845 80 1996
NM_004426chr121504 ------
NM_004429chrX61428 1382 1365 1359 381 114 --1103 1470
NM_004430chr892610 2501 2451 2291 2237 1995 1881 1109 268 --11037 --
NM_004431chr12771 585 --1593 --
NM_004432chr932394 1812 1523 3958 895 526 52410 1624 844 425 357 191
NM_004437chr142498 1306 1207 576 1288 --13007
NM_004438chr233175 3007 384 13268 ----
NM_004440chr661893 1607 597 451 428 286 21966 713 --21975 1572
NM_004444chr73856 577 564 --1606 --
NM_004450chr142104 77 ------
NM_004454chr352131 808 764 736 74 11669 ----
NM_004456chr71192 ------
NM_004457chr231610 1580 1393 21231 338 11096 --
NM_004458chrX52634 2609 2566 2292 75 2987 288 ----
NM_004459chr1772037 1785 1664 1461 804 257 165 1772 ----
NM_004472chr53578 550 78 ------
NM_004474chr12886 658 ------
NM_004480chr143522 516 510 2740 650 ----
NM_004482chr23859 296 288 1809 --1901
NM_004486chr911025 ------
NM_004501chr154145 3626 3013 681 163 14122 2317 135 1903
NM_004504chr263031 1205 1165 884 642 315 52855 2797 2218 876 332 ----
NM_004514chr1783033 1141 1008 849 823 590 561 555 --1839 --
NM_004523chr1031201 1186 1165 --1475 --
NM_004529chr931298 1090 79 ------
NM_004535chr2071496 1431 1354 1116 500 349 247 11400 ----
NM_004566chr1022546 348 ----12308
NM_004582chr11101 ------
NM_004583chr171734 ------
NM_004586chrX65217 4835 4206 1805 451 359 25439 463 ----
NM_004594chr161942 ------
NM_004598chr573350 2909 2814 805 212 181 67 ------
NM_004612chr994843 4234 4063 4015 3217 1004 788 770 575 23739 3638 --24736 1281
NM_004617chr31170 ------
NM_004622chr252095 916 653 625 203 31926 1584 342 ----
NM_004627chr215654 636 519 121 79 1603 ----
NM_004637chr331097 531 349 ------
NM_004654chrY31377 440 338 1205 ----
NM_004660chrY42104 2092 1518 580 21759 278 ----
NM_004663chr1531386 552 90 31514 568 72 11528 --
NM_004687chr1721689 1590 ------
NM_004689chr142357 305 ------
NM_004705chr112903 866 --1609 --
NM_004719chr1292822 2672 2516 1834 1140 723 657 649 144 22068 1907 11081 --
NM_004721chr32286 94 --1307 --
NM_004723chr141043 698 686 675 ------
NM_004725chr1041368 1259 1010 288 21476 315 11389 --
NM_004736chr182150 1977 1970 1915 1423 1405 791 427 --11952 --
NM_004739chr112595 564 ------
NM_004741chr104638 338 303 179 ----1448
NM_004742chr371654 1646 1597 658 244 208 38 11585 ----
NM_004745chr886661 5691 2374 1550 1115 1095 339 201 15445 ----
NM_004747chr1011402 --21599 149 11287
NM_004748chr1593729 3637 3551 3388 2847 2719 2709 1670 1059 12725 13331 --
NM_004756chr1921543 1416 ------
NM_004760chr772391 1854 884 300 284 142 132 11959 ----
NM_004762chr1741973 1895 1873 1624 --11585 --
NM_004774chr1741069 461 311 218 23069 593 ----
NM_004775chr1872288 2200 2005 1994 846 587 337 ------
NM_004776chr2093314 3305 3277 2393 2325 2127 2120 2103 1225 ------
NM_004798chr2053620 3608 3380 989 899 11249 ----
NM_004807chr222635 2066 ------
NM_004808chr1073227 2259 1292 676 628 213 158 11272 ----
NM_004815chr1143563 3498 3177 1215 890 770 497 462 443 193 129 95 46 27 23725 67 --14370
NM_004824chr631253 296 207 ------
NM_004830chr62331 192 1818 ----
NM_004834chr2113148 2681 2623 2119 2073 1177 869 823 804 651 601 1508 ----
NM_004836chr24605 223 216 114 ------
NM_004852chr182113695 13569 13031 11941 11829 10858 10117 9647 8816 8639 5181 5175 4794 4356 3545 3516 2906 2201 2063 1973 183 311529 10786 9936 413931 11971 4965 3388 13789
NM_004857chr1434096 1649 63 54592 4247 3698 490 477 --14647
NM_004863chr1485269 5098 3863 3453 3255 1959 1906 1441 21951 160 --162
NM_004866chr554835 4775 4678 3056 511 23327 1688 14479 --
NM_004867chrX2472 460 ------
NM_004872chr11173 ------
NM_004874chr82488 411 ------
NM_004888chr91165 ----1437
NM_004898chr462737 1990 960 750 699 600 ------
NM_004902chr202701 111 ----2838 568
NM_004926chr1451218 1209 720 390 283 31824 1364 1302 21789 1467 --
NM_004927chr1141463 579 436 276 ------
NM_004930chr13651 641 251 1661 ----
NM_004946chr51418 ------
NM_004947chr342473 2389 2263 2134 12235 ----
NM_004956chr753891 1638 1497 96 77 11334 ----
NM_004958chr13919 100 45 ------
NM_004960chr162105 37 170 ----
NM_004973chr691735 1717 1487 1396 1117 545 263 173 142 2320 43 ----
NM_004985chr12114495 4327 4308 4278 3664 3595 3445 3314 1188 546 53 14486 13621 --
NM_004992chrX148445 8352 8282 7430 7117 7054 5396 5374 5293 3298 2411 1373 1242 1106 26206 3347 18378 --
NM_004999chr684337 4148 2781 1747 1633 1189 861 765 11352 11067 1998
NM_005023chr571109 1097 1091 510 210 187 34 ------
NM_005027chr1911197 ------
NM_005032chrX21006 758 ------
NM_005065chr1474286 3998 3907 3628 1603 1322 1098 23896 677 15106 --
NM_005066chr13754 44 36 1132 ----
NM_005076chr11142 ------
NM_005077chr93464 445 437 --1375 --
NM_005086chr1231405 1237 396 ------
NM_005095chr162262 2177 1815 1607 781 270 ------
NM_005109chr341828 1716 567 513 12339 32545 1911 486 --
NM_005116chr2064364 4236 2936 2801 1108 87 34328 1224 1032 --13065
NM_005120chrX1172 ------
NM_005121chr1783431 3318 2669 2623 2597 2533 905 646 3619 280 100 ----
NM_005124chr65884 747 730 677 325 --2311 74 --
NM_005130chr42139 101 ------
NM_005141chr4148 ------
NM_005147chr1611126 ----1943
NM_005156chr985313 3800 1679 1448 1138 990 365 160 45147 5013 4331 1884 14309 --
NM_005160chr22106613 5651 5354 5287 4945 4303 1527 1388 1382 452 12160 15205 26342 2212
NM_005171chr1231251 1182 25 1988 1208 --
NM_005180chr1041620 1491 1423 118 41678 1385 658 395 ----
NM_005188chr11138359 8011 7608 7187 6503 5463 3212 2777 2631 2547 2088 1707 1494 13043 ----
NM_005194chr203484 456 181 ------
NM_005203chr103170 141 38 ------
NM_005204chr103949 802 697 3876 768 749 ----
NM_005207chr2293714 1120 741 575 556 500 312 178 30 ------
NM_005222chr71955 --1946 --
NM_005229chrX1484 ------
NM_005233chr362574 2378 1951 546 427 355 1212 12301 --
NM_005238chr1193473 2913 2860 2826 2663 2633 2605 2194 588 ------
NM_005239chr2162057 1498 1305 737 727 455 12021 1798 --
NM_005257chr1851429 1300 1151 331 66 1998 ----
NM_005259chr231509 1453 355 21440 978 ----
NM_005271chr10----1995 11209
NM_005277chr451865 1818 621 506 149 21740 584 31956 1838 1468 --
NM_005284chr62490 434 ------
NM_005313chr1561011 984 479 284 226 204 1941 --126
NM_005318chr2241085 870 289 231 ----11267
NM_005328chr83774 520 232 ------
NM_005329chr1622267 2142 12290 ----
NM_005339chr464252 4010 3191 1189 568 331 11606 ----
NM_005342chrX42349 1849 1031 798 2407 339 ----
NM_005354chr192598 588 1633 ----
NM_005359chr18135356 4980 4800 2550 2248 1849 1817 1436 1112 1034 851 423 92 --46464 6080 4184 1204 --
NM_005375chr63939 865 108 ------
NM_005384chr92240 65 ------
NM_005388chr931271 75 67 --1102 1679
NM_005392chr961905 1519 1490 1471 1455 1355 11431 ----
NM_005398chr1031214 1197 452 ------
NM_005399chr1103928 3811 3765 3014 1770 1374 1311 813 735 658 24263 3059 --13033
NM_005400chr262958 2938 1967 1937 1212 636 --1661 12778
NM_005402chr71715 ------
NM_005406chr182471 444 11603 ----
NM_005431chr71391 --1643 --
NM_005433chr1812641 ----12475
NM_005436chr1083451 3435 3200 3096 3052 1235 1213 882 21408 341 13288 23001 2606
NM_005437chr1021473 440 --31260 274 83 11014
NM_005460chr51529 ------
NM_005488chr221739 ------
NM_005491chrX21419 1384 11357 --11365
NM_005493chr63619 593 117 --2772 313 --
NM_005502chr963213 3056 3047 2891 1034 323 1555 21103 195 12728
NM_005504chr12136651 6521 6481 6448 5879 5343 4851 4128 2238 782 371 292 118 26336 818 21581 690 16316
NM_005506chr432147 1098 267 3930 695 302 1390 12478
NM_005509chr541334 1204 677 277 31499 1449 348 ----
NM_005515chr72660 557 ------
NM_005522chr72924 525 ----11010
NM_005537chr133942 164 68 ------
NM_005542chr761516 1450 1267 1229 653 364 21831 1417 11404 --
NM_005573chr53458 274 191 3520 475 166 ----
NM_005578chr363949 1881 1865 1072 539 214 45095 4872 1801 1409 ----
NM_005595chr11862 ----2832 208
NM_005596chr9136275 6047 5933 5854 5167 4750 4281 3997 3981 2011 1944 1621 356 34501 4383 4035 15083 --
NM_005599chr141493 1460 1238 1101 --11223 --
NM_005607chr82697 189 --1735 --
NM_005611chr163839 431 382 ------
NM_005626chr1142 ------
NM_005631chr721089 677 ------
NM_005639chr1251773 1676 594 319 311 ------
NM_005644chr11342 1332 --1378
NM_005647chrX73159 3127 3105 3056 548 489 427 --11078 1513
NM_005652chr1621174 255 ----11094
NM_005656chr2131513 1129 588 ------
NM_005663chr43508 495 208 ------
NM_005665chr194224 1845 1650 1623 1444 1038 953 808 665 13750 ----
NM_005667chr2176 ------
NM_005668chr5114577 4505 4082 3906 2919 2824 1824 1315 827 680 529 14613 24393 2840 --
NM_005688chr341362 1126 416 216 --11197 --
NM_005704chr12953 944 11104 --11116
NM_005716chr191611 ------
NM_005717chr151281 1271 1061 332 322 21293 1200 ----
NM_005721chr231002 272 68 1914 ----
NM_005724chr151670 ------
NM_005731chr21127 ------
NM_005737chr262902 2447 2099 2061 750 256 12341 1726 --
NM_005746chr782646 2476 2148 2035 541 496 371 71 11780 ----
NM_005748chr1252868 2429 1163 628 538 12208 ----
NM_005751chr75474 436 167 77 69 152 ----
NM_005754chr561176 1033 926 208 137 119 --1914 --
NM_005759chr274530 4315 4115 3038 1124 627 200 24587 4428 44304 3641 1810 1395 --
NM_005765chrX4770 135 123 51 ------
NM_005780chr134999 926 683 179 1976 1761 --
NM_005782chr171196 ------
NM_005786chr183250 141 95 --1967 --
NM_005797chr1141753 1676 609 601 ------
NM_005813chr222305 250 42588 2425 2324 2237 22195 74 --
NM_005828chr1774769 4615 1804 1641 1596 546 38 --1480 15077
NM_005832chr371348 1173 1151 1072 945 200 28 31298 586 83 --1938
NM_005839chr18911 894 792 687 678 363 333 41 1708 ----
NM_005841chr48958 764 278 265 78 72 66 60 ------
NM_005864chr144233 196 182 78 ------
NM_005871chr1041069 919 680 236 3912 788 323 ----
NM_005875chr33401 295 41 ----1357
NM_005880chr1681637 1572 1405 656 559 547 360 306 --1382 --
NM_005885chr561257 1116 579 566 204 49 1642 ----
NM_005895chr1294166 3270 3028 1451 1052 718 581 540 108 ------
NM_005898chr1152757 2538 2438 1957 1268 1806 ----
NM_005902chr1544574 1505 1111 585 --13677 14472
NM_005906chr671679 1640 1547 1146 503 428 422 11463 --11471
NM_005911chr24962 531 203 157 1448 1298 --
NM_005924chr711137 --21131 901 11171
NM_005927chr531160 1120 1099 --11036 --
NM_005935chr4135212 4971 4565 4013 3956 3816 3649 3642 3593 2128 1536 948 455 11677 --15086
NM_005937chr1784128 3849 3798 3326 2785 2774 1528 693 --14110 1224
NM_005941chr884142 4091 1630 590 534 233 223 42 1987 13302 --
NM_005955chr185449 5401 4129 3628 2011 1879 833 556 14074 23503 378 --
NM_005963chr17169 ------
NM_005966chr282239 1934 1900 1728 1592 587 400 317 22360 2133 1413 --
NM_005985chr203772 754 286 ------
NM_005986chr1372566 992 631 485 351 255 94 2818 586 ----
NM_005996chr1281493 1336 1328 1155 1034 521 458 57 ------
NM_005999chr141114 1108 1036 978 41546 1490 363 58 --1266
NM_006016chr661723 1631 1590 1516 495 41 11934 ----
NM_006035chr14----2975 110 11258
NM_006037chr2144788 4757 4429 4372 4071 3566 3493 3373 1717 1705 1536 1424 704 672 ------
NM_006047chr20113517 2390 2296 2213 1022 662 620 578 452 434 306 52841 2635 2605 601 257 22991 2586 --
NM_006060chr793753 3230 3202 3184 3156 2964 1048 144 137 1126 ----
NM_006079chr64797 693 204 193 ------
NM_006080chr752458 2217 742 472 451 ------
NM_006089chrX51833 1409 499 157 86 --11602 --
NM_006094chr862409 2318 1737 956 864 842 21606 964 ----
NM_006100chr3148 ------
NM_006106chr11103443 3363 2822 780 735 726 714 704 689 424 --11033 --
NM_006108chr1132003 1897 567 --11665 --
NM_006121chr122398 365 ------
NM_006133chr1112374 ------
NM_006135chr161477 1398 1374 1306 1294 174 --1380 --
NM_006154chr1562311 1803 1078 656 524 316 22355 398 22393 2042 12013
NM_006161chr52658 610 ------
NM_006164chr2140 ------
NM_006166chr1232657 306 229 21600 348 1103 --
NM_006186chr221115 975 2918 892 11164 --
NM_006202chr1941578 1537 1497 1479 11602 ----
NM_006216chr24675 668 528 96 --1521 --
NM_006237chr1332269 1960 1908 --11624 --
NM_006241chr372408 1949 1889 699 689 671 274 1255 1569 --
NM_006251chr5133297 2979 2736 2609 2306 2106 1347 1270 969 526 502 413 193 32709 2407 75 ----
NM_006252chr1137381 7044 5260 2906 2720 2349 1803 1368 1318 1228 1011 739 546 27401 2264 11247 --
NM_006255chr1441138 1113 961 791 ------
NM_006256chr192557 2482 2101 1091 1037 895 680 515 103 12357 --12211
NM_006265chr851479 1464 1194 203 101 21397 1277 ----
NM_006267chr241908 1792 1606 672 --11757 1564
NM_006275chr2072507 1530 923 637 552 348 132 1252 1200 --
NM_006282chr2084622 4514 4411 4360 3417 3204 3027 1905 34582 4531 967 --1119
NM_006283chr854133 4123 3042 1730 734 44919 386 341 283 23630 3279 --
NM_006307chrX2325 247 1102 ----
NM_006309chr32104 63 --1126 --
NM_006315chr494055 3895 3873 3500 2812 2773 1621 1205 130 14282 13855 14359
NM_006328chr112633 180 ------
NM_006347chr11189 ------
NM_006352chr1102041 1951 1897 1625 1579 832 826 362 355 301 ------
NM_006363chr204599 236 164 151 ------
NM_006364chr1461257 898 809 310 156 111 1917 ----
NM_006366chr621253 985 --1204 --
NM_006371chr365286 4548 4039 661 379 55 13776 13784 --
NM_006375chrX41420 558 375 364 ----11350
NM_006380chr1773945 3893 3665 3614 3291 3055 268 44349 4320 1311 1259 12998 --
NM_006393chr1074543 4160 3563 2886 2873 614 293 13098 23684 213 14205
NM_006401chr9163 ----1363
NM_006403chr64377 289 262 91 174 11693 --
NM_006415chr941284 1210 843 315 ------
NM_006420chr20103046 3001 2863 2822 2786 2579 778 561 554 486 32835 379 331 ----
NM_006427chr141130 ------
NM_006445chr171163 ------
NM_006451chr52737 141 ------
NM_006454chr411180 ------
NM_006472chr141297 1201 823 46 1370 1510 --
NM_006475chr131535 ------
NM_006494chr191136 ------
NM_006496chr161688 1461 1278 731 508 149 11713 ----
NM_006504chr1052963 2735 2478 1815 117 21051 51 22888 107 --
NM_006526chr2072064 1965 1853 1636 556 265 193 --21946 1563 --
NM_006527chr41761 ------
NM_006530chr123432 346 150 ------
NM_006532chr1952031 1806 1756 1738 381 ------
NM_006534chr2063107 1304 1136 1023 478 309 21057 970 12585 --
NM_006538chr244065 2730 380 277 3744 660 369 1986 --
NM_006544chr1475081 4466 3987 3888 1886 1834 759 55587 4473 4001 1746 120 32399 2258 1730 --
NM_006546chr1776035 5562 5180 2403 1718 1677 1199 16300 15476 --
NM_006547chr752050 1730 1701 1505 280 22000 1511 ----
NM_006559chr141142 1125 908 258 --11096 --
NM_006571chr82243 32 1119 ----
NM_006572chr1793412 2929 2736 1138 1020 1008 161 62 35 33512 3143 469 --11304
NM_006574chr31291 ------
NM_006577chr241241 1046 406 312 1367 ----
NM_006587chr451598 1516 1433 404 243 11134 ----
NM_006595chr1161806 1334 1304 1259 495 265 42070 1826 1433 211 1191 --
NM_006599chr16168243 8089 7608 6849 6115 5624 3249 3063 2085 2003 1969 1727 1706 1685 1655 373 32486 2098 1692 16945 --
NM_006602chr203858 790 576 1159 2817 336 --
NM_006609chr262954 2241 2031 891 450 411 ------
NM_006614chr3103613 3595 3466 3002 2789 2698 2533 1088 982 684 13168 21279 1069 --
NM_006618chr151477 996 490 225 200 11564 ----
NM_006621chr121979 669 ------
NM_006624chr104741 454 159 59 32093 1934 1531 ----
NM_006626chr991947 1930 1877 1665 877 697 115 101 33 32368 2329 78 1946 --
NM_006628chr15124594 4572 4564 4418 3603 2945 1181 1005 850 709 654 491 2722 412 1344 --
NM_006640chr1711874 ------
NM_006646chr1373024 2918 2035 1982 1894 447 104 1345 12491 --
NM_006653chr61349 ------
NM_006700chr123802 626 139 ------
NM_006710chr241018 210 164 72 --1749 --
NM_006717chr972714 1325 978 180 140 53 29 1719 23148 499 --
NM_006726chr43933 808 144 --11054 --
NM_006729chrX55569 4249 4125 3907 2238 54859 2208 2050 251 150 ----
NM_006734chr691578 1444 495 314 296 242 133 54 48 --11539 1328
NM_006735chr72345 309 ------
NM_006750chr16127937 7476 5419 5334 5324 5306 2788 2682 2116 1319 773 385 17386 11155 28093 6520
NM_006754chr731139 394 102 ----1819
NM_006756chr871537 1430 1407 1331 1110 993 125 21517 51 ----
NM_006761chr173794 764 691 ------
NM_006775chr653103 2669 2173 2136 1104 ------
NM_006777chrX52742 1818 424 136 28 ------
NM_006788chr1872125 1783 1688 1524 1358 1341 261 --11800 --
NM_006809chr203843 769 319 ----1809
NM_006813chr63707 273 228 1166 1660 --
NM_006823chr83973 496 240 21326 1184 ----
NM_006827chr1473382 3072 2974 2653 842 627 400 11282 13006 --
NM_006838chr1261846 1267 1261 1208 279 45 --1654 --
NM_006857chr23218 68 61 ------
NM_006861chr121124 ------
NM_006873chr253165 3106 2840 772 191 22768 862 ----
NM_006885chr16164168 4061 3851 3240 2968 2901 2895 2889 2685 1495 1429 948 930 600 581 524 12594 21349 1304 --
NM_006888chr1423357 2708 22507 1343 1353 1914
NM_006892chr2021245 1215 11322 ----
NM_006897chr121423 ------
NM_006902chr153184 2970 2230 714 400 --12172 --
NM_006910chr16155 ------
NM_006915chrX72498 2215 2062 1879 525 244 76 12568 --1552
NM_006920chr261925 1777 802 727 678 418 1455 ----
NM_006938chr183907 879 47 ------
NM_006940chr1261775 1294 728 439 408 400 ----1506
NM_006942chr171191 ------
NM_006948chr2162441 2319 1604 889 826 152 128 --11788
NM_006951chr103782 772 103 ------
NM_006963chr1041277 479 465 308 2471 355 ----
NM_006981chr932703 2434 1071 --1377 --
NM_007005chr951203 542 536 295 65 11559 ----
NM_007006chr1683272 3212 3115 2960 2552 2416 704 229 23504 433 ----
NM_007007chr12114722 4704 4111 4089 3825 3331 3303 3103 1718 1638 331 44692 4482 3706 1112 ----
NM_007010chr1771579 1364 1230 1221 686 652 176 --1569 --
NM_007011chr15106883 6641 6574 6278 2482 2350 1361 1148 388 186 ------
NM_007038chr21126094 5527 4809 4675 4302 3910 2118 1529 1359 1089 1057 1039 26043 389 15008 25567 5395
NM_007039chr1442189 1891 861 511 22085 1915 3901 484 440 --
NM_007040chr1931074 1059 775 ------
NM_007050chr2085974 5810 2429 2249 705 321 309 60 18062 11127 1765
NM_007106chr1362573 1905 1817 973 212 37 21999 892 ----
NM_007125chrY5503 472 323 222 68 ------
NM_007137chrX84594 4404 3991 3766 3492 3483 778 463 --14026 --
NM_007146chr1732386 1920 1858 ----11139
NM_007174chr1252401 1892 410 276 246 ------
NM_007175chr873291 3284 3219 2741 2662 2579 601 23394 232 23553 3321 --
NM_007190chr1071111 1024 957 931 822 735 332 ----1918
NM_007212chr141944 1774 1708 780 31798 1688 1557 11812 11901
NM_007217chr31158 ------
NM_007231chrX42250 1787 920 73 1271 ----
NM_007235chr122425 69 ------
NM_007249chr13159464 9390 9346 8174 8011 7772 2381 2182 1947 1679 1616 688 667 321 287 17982 38387 7678 6970 --
NM_007276chr72438 377 1946 11055 --
NM_007285chr162203 148 1113 ----
NM_007331chr462558 2247 1949 854 728 467 22490 2075 ----
NM_007345chr1862073 1869 1787 1524 1461 206 151 32216 1589 332 --
NM_007349chr71373 ------
NM_007353chr742501 2479 1936 1021 ------
NM_007359chr1751693 1539 1146 445 377 11721 ----
NM_007373chr1041812 1462 511 355 ------
NM_007375chr152034 1093 1025 468 194 12167 11840 --
NM_012081chr541496 917 886 878 13561 ----
NM_012090chr131199 1167 990 3519 454 150 ----
NM_012096chr363765 3682 3352 3087 2278 780 33520 2524 1141 13502 --
NM_012110chr42270 119 ------
NM_012115chr62623 569 ------
NM_012137chr122782 2171 ----22720 2098
NM_012158chr1331788 1753 93 31145 718 453 1665 --
NM_012160chr64418 111 73 38 ------
NM_012164chr9107447 7247 6385 5384 5327 2624 1370 901 661 233 37030 6977 1574 27134 4921 --
NM_012175chr112793 275 2888 775 1180 1824
NM_012177chr61542 ----1494
NM_012193chr11125457 5434 5027 4741 4382 4260 3906 1890 1884 1024 775 601 --21750 555 15094
NM_012207chr102930 78 ------
NM_012215chr1031708 1321 628 2717 547 3701 668 604 --
NM_012223chr261228 1044 989 462 430 61 ----142
NM_012233chr231193 945 790 --1241 --
NM_012238chr1051678 1557 690 319 283 ----1436
NM_012244chr1421834 110 11682 ----
NM_012245chr141307 ----177
NM_012247chr106968 945 897 875 640 29 2983 130 ----
NM_012249chr233499 3402 2974 13383 ----
NM_012259chr641250 1180 1066 186 ----11409
NM_012262chr1125258 5035 4519 4367 4122 3460 3201 1650 1516 461 110 58 2790 469 24690 4002 --
NM_012281chr732364 787 452 ----1232
NM_012286chrX4529 401 52 28 ------
NM_012287chr384537 4424 4004 3728 3632 3355 3177 1046 --13504 14294
NM_012288chr665714 5585 5073 4508 4275 3576 --13743 --
NM_012290chr251516 1288 573 296 169 1141 ----
NM_012297chr472407 2344 1791 937 866 391 335 1570 --11694
NM_012300chr552444 2343 2043 979 951 --12400 --
NM_012307chr182820 759 ------
NM_012309chr11114648 4547 4366 4149 3931 3746 3308 3265 3228 3183 1593 23098 1808 24458 1765 --
NM_012311chr103218 203 100 ----1229
NM_012322chr73454 323 31 1150 ----
NM_012323chr2211585 ------
NM_012325chr2051568 1550 1362 1296 76 ------
NM_012328chr741466 1277 1190 911 ------
NM_012330chr104589 487 468 431 ------
NM_012333chr161322 1223 479 445 59 40 11149 ----
NM_012338chr731211 1202 1091 ------
NM_012342chr101362 ------
NM_012343chr521050 230 ----11108
NM_012345chr1331288 671 396 31655 775 104 1251 --
NM_012347chr642931 1944 1130 1093 12291 --22890 2209
NM_012388chr1573007 2954 2935 2044 2023 634 430 12449 --1677
NM_012395chr773215 2902 2607 2176 786 300 288 22895 2466 1840 --
NM_012426chr162362 44 ------
NM_012428chr153974 802 252 1385 ----
NM_012431chr733047 2876 2565 63314 3305 3276 3236 1323 1088 ----
NM_012434chr661553 1378 1198 1177 1171 1162 11633 --11693
NM_012463chr1241827 1138 672 664 31438 1150 171 ----
NM_012464chr442189 905 510 270 12536 2439 142 --
NM_012473chr221474 ------
NM_012479chr732598 2460 1840 --12590 --
NM_012482chr14615 170 145 45 ------
NM_013231chr1464353 3992 3937 1191 1081 115 24120 213 ----
NM_013233chr211082 ------
NM_013255chr7128869 8186 7818 7048 6289 5719 5530 2582 2055 1814 1180 1049 17613 17103 38784 1984 1109
NM_013262chr631327 1009 432 2478 401 ----
NM_013283chr53860 212 84 ------
NM_013293chr72581 140 ----1261
NM_013302chr16124594 4168 3863 3835 3302 1729 1050 740 629 591 283 267 ------
NM_013313chr2252907 2851 2792 2713 301 32871 2806 40 12198 --
NM_013354chr821133 975 11463 ----
NM_013372chr1552640 2519 1214 943 335 2591 236 22585 328 --
NM_013390chr941579 1554 303 207 2274 214 11425 --
NM_013446chr751283 1073 1061 1047 1027 21430 232 11277 --
NM_013448chr143571 247 186 1560 ----
NM_013450chr241159 982 933 203 11092 1393 --
NM_013451chr102471 82 1385 ----
NM_013943chr172585 2516 2367 1325 1272 1015 875 22699 454 1602 --
NM_013995chrX102502 2432 2419 2343 1949 1734 606 469 424 401 --22411 821 --
NM_014012chr201470 ------
NM_014016chr31378 --11613 --
NM_014021chr1103299 2963 2707 2451 2376 2216 1363 761 492 340 32821 2624 2321 1968 13262
NM_014023chr1042453 462 317 193 190 22834 119 --
NM_014028chr642518 1308 1257 1137 ----1598
NM_014033chr1262345 2255 2157 605 441 302 12299 ----
NM_014043chr331634 1616 1458 1423 ----
NM_014048chr1685302 5238 4817 3391 1583 1548 811 785 44141 3612 1530 605 15109 14348
NM_014065chr32154 147 ------
NM_014112chr8125397 5314 4801 3678 2067 2056 1914 1686 736 714 679 138 14890 22044 1039 11196
NM_014117chr1632003 1821 1693 --1650 --
NM_014141chr785101 4558 4257 4001 3823 3813 296 274 --14394 15302
NM_014149chr73904 614 322 ------
NM_014154chr331449 1430 175 11486 21440 425 --
NM_014155chr11107543 7039 6516 5327 5170 2026 1823 1428 813 297 77172 7160 6794 6282 1899 718 280 36929 6204 6147 17277
NM_014159chr31417 ----1474
NM_014181chr272729 1977 481 475 469 463 456 2255 245 ----
NM_014220chr33648 206 188 178 187 --
NM_014226chr14----1279 1272
NM_014240chr353570 3431 2647 1114 974 --1570 --
NM_014243chr441413 675 321 175 --11850 --
NM_014246chr2262195 2150 2004 1753 537 483 ------
NM_014264chr42605 46 1464 ----
NM_014267chr112755 297 2303 190 288 23 --
NM_014279chr91729 --1961 --
NM_014280chr14336 291 163 123 ------
NM_014283chr171311 1072 555 442 374 334 36 11285 11010 --
NM_014296chr33999 255 217 ------
NM_014315chr141152 ------
NM_014319chr1251508 1382 389 87 64 --1574 --
NM_014325chr1282152 2069 1932 1806 773 555 474 439 --1450 --
NM_014331chr4137797 7672 7595 6794 6640 5362 4969 2924 2329 1864 1301 1207 1033 1372 12820 --
NM_014338chr2221044 398 ------
NM_014342chr1141388 916 290 148 2979 370 --1326
NM_014345chr65998 853 797 282 246 --1828 --
NM_014368chr942136 2094 487 463 12076 --12122
NM_014372chr1159 ----11582
NM_014382chr341190 1154 635 534 31641 597 220 11769 --
NM_014395chr451929 1397 1387 1356 299 21998 1448 ----
NM_014398chr34678 516 407 188 11849 --11402
NM_014409chr131151 1144 1099 ----11030
NM_014415chr31147 ------
NM_014417chr192942 929 ------
NM_014421chr441851 1636 1582 244 1527 12061 12093
NM_014423chr5105445 5205 5181 4998 3859 3722 1884 1712 866 456 25560 4173 25600 1795 --
NM_014456chr1051820 1744 468 343 184 1259 ----
NM_014458chr12306 227 1312 21309 67 --
NM_014498chr33353 301 130 ------
NM_014552chr241491 1468 1264 1023 ------
NM_014554chr1252300 1718 1645 169 50 --12029 --
NM_014572chr1361619 1180 501 351 275 97 ----11249
NM_014577chr223820 742 58 1305 ----
NM_014584chr1431358 1329 1136 1122 ----
NM_014585chr231052 896 60 ----11253
NM_014586chr2184543 4476 3459 3087 3080 1756 1265 643 14571 14346 --
NM_014587chr1621551 1380 --11353 11320
NM_014602chr31288 ------
NM_014604chr171660 ------
NM_014607chr282112 1964 851 781 747 570 552 323 ------
NM_014614chr221192 1084 11018 11062 --
NM_014615chr1683424 3074 2629 1358 975 915 889 818 ----11378
NM_014620chr121533 ------
NM_014636chr964365 4268 2754 2730 1665 452 13200 ----
NM_014663chr121065 392 ------
NM_014667chr3102442 2126 1959 1925 1839 917 618 593 161 149 --21527 365 --
NM_014670chr221610 557 1441 11289 11604
NM_014674chr363713 3343 1303 1295 1000 528 13937 ----
NM_014679chr112466 235 11212 --21018 272
NM_014682chr842259 2103 2061 559 42206 2139 2091 274 12122 --
NM_014683chr1741693 1448 821 173 21490 632 1221 11994
NM_014701chr1573367 3338 2101 1348 1224 646 129 33087 2730 232 ----
NM_014702chr683081 2704 2678 2120 836 461 307 261 22992 2418 22777 416 --
NM_014705chr751587 1453 1330 546 261 21791 623 11722 --
NM_014706chr1231143 352 257 1874 ----
NM_014707chr752252 2231 1971 1799 664 ----11426
NM_014711chr1651984 1812 1801 804 647 1279 11368 --
NM_014712chr161244 ------
NM_014713chr26503 343 182 174 115 43 ----1522
NM_014720chr102141 132 11309 21434 240 --
NM_014729chr872182 1532 741 729 705 646 462 1412 167 --
NM_014730chr1274340 4229 1561 767 612 492 297 --35289 989 217 --
NM_014746chr284276 4216 4191 3988 3564 3281 3145 771 24418 4311 33663 1495 628 --
NM_014751chr842107 2073 408 98 1200 --1299
NM_014752chr1171910 1667 1463 635 463 288 121 11222 ----
NM_014755chr244271 4099 1079 559 12598 13613 --
NM_014757chr542086 576 563 438 --12105 --
NM_014774chr173148 2972 2397 2261 2118 2065 716 1443 ----
NM_014779chr34951 934 773 433 ----1891
NM_014787chr142257 2179 1813 848 32227 2186 958 11909 --
NM_014795chr241185 897 884 206 11388 --11361
NM_014802chr1251136 761 712 176 58 ----1270
NM_014803chr1072550 2453 2004 1956 1801 975 728 1449 12416 --
NM_014807chr111643 ------
NM_014811chr92253 186 1198 ----
NM_014813chr12572 548 ------
NM_014819chr561819 1655 1638 520 315 236 12350 12315 1910
NM_014820chr341768 1484 1277 115 12059 ----
NM_014822chr41579 --1621 --
NM_014824chr1152003 1810 1601 794 188 ------
NM_014827chr161697 1606 1564 1222 353 196 11105 ----
NM_014829chr562343 2285 2260 2221 512 417 ------
NM_014830chr1273819 2920 2793 1543 1516 1510 1112 13830 11091 --
NM_014835chr2032240 2193 1614 ------
NM_014839chr142497 2322 1876 644 22476 2191 1575 --
NM_014840chr1243414 3397 3373 2322 ------
NM_014841chr64998 951 558 230 125 21340 943 --
NM_014844chr1454150 1165 1067 466 314 11684 ----
NM_014847chr13493 476 198 ------
NM_014848chr1542758 2708 2588 706 1168 1927 22350 126
NM_014873chr153896 1652 1575 1370 686 14741 14671 --
NM_014877chr17157730 7609 6948 6566 6239 6072 5904 5668 5531 2950 1730 649 245 100 47 23078 890 27554 2958 --
NM_014893chrY82212 1671 1620 950 866 827 677 101 ----1601
NM_014897chr1752767 2631 2443 2205 585 --2530 370 --
NM_014899chr552432 2198 2060 761 413 23164 2845 22798 2684 --
NM_014903chr1262310 2243 474 370 357 319 12212 1435 12321
NM_014906chr1753915 3502 2933 2659 915 --13399 --
NM_014912chr10113319 2974 2965 2733 2679 2614 2325 1137 628 348 244 22740 781 13141 13412
NM_014917chr15847 827 766 749 698 ------
NM_014918chr1581597 1124 1061 578 569 410 403 62 11524 11137 --
NM_014920chr693417 3262 2699 2614 938 635 624 261 202 ----1305
NM_014936chr692614 2369 2262 1081 787 492 437 156 140 32444 430 397 ----
NM_014943chr841004 435 317 300 ------
NM_014946chr293053 2944 2916 2848 1173 1138 312 194 126 12701 ----
NM_014962chr2092698 2568 2445 1117 1102 1038 1005 912 303 32432 2059 106 1228 --
NM_014969chr11951 --1989 --
NM_014974chr1051801 1227 562 328 109 --1675 --
NM_014978chr1071856 1668 1554 1538 1174 209 102 ----31582 480 334
NM_014989chr661597 476 441 432 423 415 21443 1385 ----
NM_014991chr493042 2998 2974 2855 2406 2151 2107 1189 1083 --22836 2629 12255
NM_014992chr141650 ------
NM_014999chr1261554 1158 403 238 228 217 1179 --11401
NM_015000chr1232201 2110 214 --12630 --
NM_015001chr13981 815 314 --1798 --
NM_015002chr1222270 884 1274 1327 1763
NM_015018chr6191 ------
NM_015020chr1653778 3000 2546 108 89 13904 ----
NM_015025chr282737 2681 2574 2523 960 591 507 199 11095 12671 --
NM_015026chr1293994 3480 3319 3176 2968 1039 950 472 306 32992 2928 1063 14072 --
NM_015032chr1382803 2316 2209 2033 1065 420 414 157 12165 22026 523 --
NM_015035chr2046622 6313 5960 1853 --36079 546 535 --
NM_015039chr194329 3919 3313 3229 3117 557 503 485 44 --44050 2799 1626 977 --
NM_015040chr293095 3089 2728 2169 2089 716 631 425 404 23186 2869 22602 2233 --
NM_015042chr1533391 3175 1206 --23533 1384 --
NM_015046chr942691 2447 315 103 22511 93 12456 --
NM_015049chr263288 3259 2575 2228 701 664 1962 13275 --
NM_015056chr2142608 2562 2419 36 22379 95 ----
NM_015059chr1553831 2641 654 626 327 ------
NM_015074chr174882 4282 3612 3568 1657 422 361 24822 465 24627 760 171
NM_015090chr146241 6069 5605 4167 --44666 2440 1330 376 25404 4179
NM_015092chr1643874 3725 3360 3110 34547 3556 3245 14635 --
NM_015093chr641627 726 518 95 31821 1369 384 --11847
NM_015094chr2294563 4457 4424 3369 3354 1029 888 630 310 ------
NM_015097chr391542 817 797 527 442 287 281 141 126 21900 1741 ----
NM_015100chr162032 1586 401 357 335 166 1255 11981 11670
NM_015102chr12360 168 ------
NM_015110chr942515 1890 1736 37 11742 ----
NM_015124chr2232465 2390 2055 --12530 --
NM_015132chr731349 445 33 1580 1742 --
NM_015137chr882264 2050 2038 2023 1840 916 480 402 2972 34 ----
NM_015138chr1562526 1052 558 277 265 170 12809 21936 656 --
NM_015141chr352462 2197 2046 2035 522 ----11807
NM_015144chr1653952 3809 1283 1093 441 13867 12645 --
NM_015147chr243318 3043 2751 521 ------
NM_015150chr31695 ------
NM_015155chr1083311 3246 2396 2106 1330 1126 966 749 ------
NM_015156chr14103221 2978 2611 2563 1584 1561 1431 1315 1108 460 13976 1401 --
NM_015158chr93665 617 258 --1756 --
NM_015176chr141201 466 450 212 ------
NM_015178chr822724 458 ------
NM_015186chr92469 50 ------
NM_015187chr41270 ------
NM_015192chr2052971 2493 2465 2276 237 32952 2818 1986 ----
NM_015199chr351011 981 836 585 480 22537 1181 1240 --
NM_015215chr152252 1172 1135 1126 566 33054 3039 2231 ----
NM_015236chr411441 ------
NM_015251chr162217 143 42280 2228 2134 2078 21562 127 --
NM_015268chr32742 467 ------
NM_015270chr1231779 430 418 ----12395
NM_015271chr494192 4024 4006 3753 3671 3363 2792 2697 643 ------
NM_015275chr1221373 331 32094 1440 325 ----
NM_015277chr1861300 744 685 669 563 460 11244 ----
NM_015278chr61749 ------
NM_015282chr253003 2891 2665 1965 1871 --22750 401 --
NM_015291chr153476 3459 3200 3158 148 --11007 11415
NM_015293chr61707 ------
NM_015294chr1751153 1130 969 947 264 ----1217
NM_015308chr113870 43 26 1158 1839 --
NM_015313chr1174713 4700 3978 3363 3115 432 399 1200 --13818
NM_015315chr573446 2903 2463 2457 2451 2445 881 --1128 13440
NM_015317chr262275 1818 1801 832 826 55 31139 305 144 32793 2349 1795 --
NM_015318chr1931828 1468 1460 11774 ----
NM_015323chr641669 1610 1499 1398 21645 185 ----
NM_015326chr152855 2643 1899 871 626 --12925 1566
NM_015329chr1952934 2926 2750 2294 1832 32873 2810 2801 ----
NM_015331chr12613 607 1637 ----
NM_015335chr1262434 2078 1648 811 620 597 21816 636 ----
NM_015336chr12102473 2301 2201 2096 1974 1846 713 640 586 274 12680 ----
NM_015342chr51121 ------
NM_015344chr841521 1503 629 242 1848 11873 --
NM_015349chr6122983 2881 2602 2381 1927 982 965 510 499 300 287 166 22946 2922 12910 --
NM_015352chr2033930 2618 1297 13808 ----
NM_015355chr1772008 1839 1463 1298 778 144 78 ----1360
NM_015358chr2151128 1100 974 518 75 1252 1337 --
NM_015359chr852640 2415 2177 2066 1898 32948 674 155 1852 --
NM_015378chr142836 2501 1861 290 32842 324 179 --12467
NM_015384chr51122 ------
NM_015396chr32430 210 11235 --1309
NM_015397chr921844 188 ------
NM_015409chr1252713 2624 1866 1845 1827 12603 --22698 331
NM_015429chr341108 730 273 86 ----1929
NM_015435chr841436 1412 1111 246 ------
NM_015441chr11116 ------
NM_015443chr1751468 1429 605 178 167 21369 1116 ----
NM_015455chr593792 2525 1577 1256 1227 1059 647 635 493 21036 423 13173 --
NM_015458chr8114487 3685 3249 3229 1828 1812 1762 1720 1208 470 282 55112 5082 4630 4623 954 ----
NM_015463chr21226 ----1793
NM_015477chr153967 788 691 11019 ----
NM_015484chr12622 187 1231 1242 --
NM_015496chr82264 213 ------
NM_015497chr1521126 821 1778 ----
NM_015507chrX----129 1460
NM_015515chr171266 ------
NM_015523chr111257 ----1195
NM_015534chr131034 1010 893 1391 ----
NM_015542chr104955 938 932 858 1222 ----
NM_015550chr723534 839 23502 1173 22510 1095 1931
NM_015553chr665168 4480 3774 1596 971 238 14544 23252 1361 --
NM_015554chr1582907 2878 2426 1819 831 799 781 107 12185 --12785
NM_015556chr141178 ------
NM_015560chr362895 2575 1136 312 213 65 --22813 2379 --
NM_015565chr2142298 2117 1388 484 1319 1267 1187
NM_015568chr202923 438 13769 14099 23608 1086
NM_015569chr1104629 4569 4537 4204 3958 3507 1469 1331 686 242 32993 955 942 14224 11776
NM_015570chr72233 165 11599 1463 --
NM_015576chr382668 2541 2525 2128 551 363 300 31 --22957 2467 --
NM_015577chr531796 1687 1602 --146 11804
NM_015578chr1982002 1800 1473 1287 804 540 134 127 11500 1652 --
NM_015642chr32128 122 ------
NM_015678chr1331556 1472 107 1469 41360 1216 431 165 --
NM_015680chr22655 534 --1633 --
NM_015681chr171120 ------
NM_015691chrX72923 2892 2885 2039 2005 414 91 1119 ----
NM_015711chr191767 ------
NM_015713chr873560 3316 3278 3100 2909 2793 198 --1554 13139
NM_015879chr1876728 6225 2797 2770 2260 1419 594 38515 7961 1874 16540 --
NM_015886chr855344 2143 1347 1249 99 24983 539 33502 1889 133 --
NM_015888chr161011 974 661 410 403 66 43314 3172 810 733 ----
NM_015891chr642084 624 175 122 ------
NM_015898chr191300 ------
NM_015902chr84891 759 638 47 --2693 331 --
NM_015906chr164401 3751 1584 1506 1477 968 54250 3098 1427 1081 979 ----
NM_015908chr7176 ------
NM_015912chr862509 2503 779 455 217 154 ----12218
NM_015964chr161360 ------
NM_016009chr154044 3782 1500 833 674 24788 461 140 --
NM_016021chr662712 2262 2106 593 520 96 1291 --1628
NM_016037chr13952 731 248 1103 ----
NM_016045chr2051838 1422 1186 665 470 31494 1452 632 11581 1673
NM_016061chr231684 1362 172 --11146 --
NM_016072chr124671 610 550 273 1526 11883 --
NM_016076chr172689 2419 2036 1104 491 481 91 1148 1376 1192
NM_016078chr1761123 1031 990 888 106 24 ------
NM_016083chr643273 2966 2418 1382 1424 13766 1334
NM_016090chr1141070 903 319 74 ------
NM_016094chr32613 558 ------
NM_016100chr201361 ------
NM_016101chr1641262 92 64 50 ----1211
NM_016107chr541273 429 396 288 1486 ----
NM_016131chr282201 2144 1595 610 550 504 368 102 ------
NM_016132chr15133372 3364 3358 3271 3150 3135 3129 2902 1323 1027 973 315 166 --13105 --
NM_016133chr23530 386 23 ----11605
NM_016169chr1043101 3000 2042 512 33211 3139 2055 12099 --
NM_016179chr132225 177 ------
NM_016201chr352201 2097 1751 1662 642 11952 ----
NM_016206chr3249010 8682 8382 8237 7879 7556 7379 7371 7361 6458 6400 6241 6117 5968 3411 3270 3102 1815 1216 600 402 379 286 250 12444 15883 26335 2182
NM_016216chr33721 36 25 ------
NM_016224chr662174 1726 1488 832 460 187 --21714 821 --
NM_016230chr63495 174 81 149 ----
NM_016231chr1731529 663 317 1641 11692 --
NM_016248chr1383898 3625 3619 2824 1234 1179 1046 312 33939 1421 181 22436 146 --
NM_016271chr1852127 1638 1458 908 626 41996 1544 704 276 128 --
NM_016272chr2252796 2668 2249 1855 1078 12273 12038 --
NM_016277chr671543 1529 1500 1310 1215 1163 1149 1244 ----
NM_016279chr51504 --1461 2379 163
NM_016287chr172025 1911 1726 1593 1291 705 362 ------
NM_016289chr262180 2070 817 771 356 138 --21839 216 --
NM_016308chr182078 1930 1852 1328 559 438 412 283 --11335 --
NM_016315chr271618 1562 1535 1413 1203 318 43 1248 ----
NM_016322chr943119 760 479 338 42075 2003 1283 1019 ----
NM_016352chr7121454 1398 1392 1381 1287 1265 1223 1186 946 236 111 33 ------
NM_016353chr872162 2047 1809 1556 803 691 622 ------
NM_016374chr171463 1432 1338 1299 1163 431 365 11622 --11153
NM_016396chr1572798 2511 2412 701 612 391 100 ------
NM_016424chr176795 497 469 219 205 72 1276 ----
NM_016436chr2092551 2480 1961 1087 1066 1008 973 640 602 11019 ----
NM_016441chr282358 2135 2068 1904 1699 901 868 76 11788 ----
NM_016451chr112281 72 ------
NM_016525chr91870 ------
NM_016530chr15103832 2998 2857 2846 2540 1654 1355 730 381 355 22530 812 ----
NM_016531chr464127 3702 3674 2569 1157 792 32740 1236 1044 2846 591 --
NM_016545chr16901 867 832 808 227 220 ------
NM_016577chr354157 2743 1657 353 347 1363 21193 1179 --
NM_016588chr61316 ------
NM_016604chr531276 1036 887 ------
NM_016617chr1352103 1796 1691 146 56 --12136 --
NM_016620chr141276 424 402 221 ------
NM_016626chr1831602 1466 1459 ------
NM_016831chr192310 2082 1848 1621 952 774 359 223 185 12327 ----
NM_016952chr1194008 3922 3530 3198 1337 1327 1312 443 122 13552 33353 1570 856 --
NM_017415chr573710 3140 2933 1457 1085 591 259 --11750 11176
NM_017420chr1443548 811 399 198 --13441 13407
NM_017423chr431661 267 237 --31905 688 218 12055
NM_017426chr45633 517 511 453 424 3693 461 30 ----
NM_017437chr1452159 1996 1984 638 82 22306 89 ----
NM_017443chr951434 1256 1093 574 278 21519 1284 11553 --
NM_017444chr831805 757 464 11309 11667 --
NM_017508chr1192466 2375 2206 2169 2018 541 304 183 87 --12047 --
NM_017516chr114872 730 321 247 ------
NM_017544chrX2403 206 123 --1906
NM_017548chr341928 1454 807 796 1653 ----
NM_017551chr1052664 2337 2315 2082 249 --11035 1242
NM_017580chr1052395 2341 1706 486 399 1212 ----
NM_017594chr942610 2197 1209 981 33076 2981 2373 13007 --
NM_017599chr1251859 575 447 435 240 --11428 --
NM_017610chr1532115 347 336 12149 11537 11494
NM_017628chr4135108 4846 4835 4035 3628 3283 1731 1648 1635 1628 1124 1062 60 21045 26 23835 220 15117
NM_017632chr43306 93 60 ------
NM_017633chr683907 3601 3451 3028 2979 2806 2616 111 23939 3401 12868 --
NM_017637chr9219439 9416 9271 9249 9065 8167 7569 6988 6755 3779 3454 3124 3053 2510 2426 2195 1892 1819 1667 1566 590 57549 3663 2547 2033 473 ----
NM_017640chr61180 ------
NM_017643chr1742671 2465 578 211 1244 13088 --
NM_017644chr3145223 5123 4810 4683 4348 3979 3833 3475 3367 1557 1339 473 369 201 52058 2008 1828 844 261 25069 90 1251
NM_017650chr795982 5811 5285 4768 4292 1919 1746 1342 301 --25727 2287 --
NM_017655chr121373 314 --1351 21169 573
NM_017658chr1494621 4494 4438 4414 4236 1747 1042 680 137 22896 1669 11254 13954
NM_017664chr1371052 919 903 800 735 308 166 1984 ----
NM_017672chr1551337 1210 1152 966 286 --1260 --
NM_017693chr1331655 1607 1592 ------
NM_017709chr1104148 3765 3331 3214 3154 1471 1053 1047 895 520 --23393 144 13584
NM_017724chr34744 190 104 63 1561 1126 --
NM_017736chr1692963 2773 2008 1082 879 511 455 392 101 31178 1169 465 13068 12703
NM_017738chr931207 1132 436 ------
NM_017741chr432627 1808 616 --12827 --
NM_017744chr142257 2004 1997 1990 ------
NM_017753chr961031 971 756 300 140 129 1292 1878 --
NM_017758chr1791488 1199 148 113 106 99 81 75 61 --11309 --
NM_017762chr1552303 1907 368 270 191 --12410 --
NM_017769chr1472779 2664 2263 890 487 452 180 22739 341 --12625
NM_017770chr642884 2788 361 125 1965 12969 --
NM_017778chr841123 298 90 63 21535 591 --11091
NM_017779chr131822 406 222 ------
NM_017780chr82853 758 1318 --1834
NM_017784chr341181 1172 78 43 1783 11215 --
NM_017798chr205963 457 393 220 163 ------
NM_017811chr963098 3068 2763 1006 1000 696 12488 1605 11988
NM_017813chr8155655 5622 5515 5191 4774 4679 4535 2119 2111 1502 997 964 690 665 382 24554 265 1190 32260 1242 797
NM_017824chr1081761 1711 1065 739 549 353 264 203 ------
NM_017848chrX44040 3341 529 456 1731 1658 --
NM_017857chr111624 --1680 --
NM_017893chr1011268 ------
NM_017896chr2063327 2513 2446 773 691 443 1491 23431 161 12691
NM_017913chr93174 100 36 1143 ----
NM_017944chr1163123 3038 2092 1049 832 573 --1966 --
NM_017946chr72259 99 ----1986
NM_017987chr1031875 1713 529 11390 --1451
NM_017994chr792742 999 587 580 572 561 483 465 153 12785 ----
NM_017998chr981263 1182 1123 1025 1003 997 362 249 11088 ----
NM_018011chr134585 89 83 77 1104 147 --
NM_018013chr652963 2902 2005 1998 1991 ------
NM_018032chr162857 313 ------
NM_018043chr1111390 ------
NM_018045chr133082 3034 999 --12737 12996
NM_018046chr531621 697 489 ----11879
NM_018047chr52928 330 ------
NM_018048chr1281990 1791 1542 1320 282 227 110 25 ------
NM_018056chr11128 --1121 --
NM_018061chr151413 1378 380 353 320 --11258 1155
NM_018084chr263271 2830 2794 2600 1046 477 23355 2815 12312 --
NM_018105chr82891 169 1175 --11102
NM_018121chr1082661 2635 2600 2472 2232 1185 1127 346 ----12153
NM_018126chr441515 1458 1368 510 21468 1288 ----
NM_018133chr371816 1646 1640 1523 1470 862 388 11807 2486 313 --
NM_018157chr1263238 2260 2032 883 586 521 1171 ----
NM_018159chrX51698 642 604 467 231 1385 ----
NM_018164chr12147 ------
NM_018181chr18131725 1638 1339 1298 1268 1244 583 367 301 245 233 199 59 ----11533
NM_018184chr361982 1833 1384 1375 874 720 ------
NM_018192chr321044 70 ------
NM_018200chr1562580 2418 1980 1969 1901 1029 22557 2007 11927 1687
NM_018211chr11733 ----11661
NM_018214chr651224 506 467 277 271 31110 907 234 ----
NM_018222chr1111901 ------
NM_018227chr4103159 2916 2139 1283 1058 953 942 611 393 257 32458 2258 841 --12204
NM_018241chr42158 67 ------
NM_018243chr473746 3684 3145 1575 1284 1212 495 ----13381
NM_018247chr662958 2936 2650 516 378 137 ----22967 2422
NM_018254chr142180 913 842 294 12148 ----
NM_018256chr21158 ------
NM_018263chr241854 700 463 266 1223 --1215
NM_018287chr1021255 183 --11225 --
NM_018293chr362967 2851 2406 2073 891 706 22038 515 21901 815 --
NM_018321chr5148 ------
NM_018323chr481293 1239 1224 608 577 232 220 160 11794 ----
NM_018351chr1274688 4679 4050 1780 878 503 140 11024 24657 1875 1378
NM_018354chr202230 204 ------
NM_018362chr11164066 3969 3911 3771 3562 3339 3168 3162 3155 2702 2675 2648 1298 1140 524 263 53671 2496 1449 1399 813 ----
NM_018364chr184028 3996 3502 3412 2702 1223 802 608 --11489 14070
NM_018365chr153189 114 67 ------
NM_018370chr1252284 2063 332 322 302 1416 --22174 1537
NM_018374chr7125278 4376 4232 4223 3700 3417 1857 1787 1603 1277 555 189 25247 683 1693 --
NM_018383chr251424 1400 1385 621 369 2583 236 1549 --
NM_018387chr91372 1116 --1516
NM_018394chr321600 345 2371 109 --11400
NM_018403chr393971 3721 2559 1533 1253 1092 982 802 602 ------
NM_018427chr1671181 1158 1112 1054 375 286 176 21627 1274 21557 1305 --
NM_018434chr5161 --1146 --
NM_018439chr1852612 2555 1869 688 320 12114 ----
NM_018440chr8138697 8433 7994 7892 7802 3090 3052 2911 2785 2438 2313 1058 666 37499 6767 5459 25581 2179 11935
NM_018482chr842271 2130 2120 1036 ------
NM_018489chr131964 1738 691 ----22294 1909
NM_018490chr1141610 1551 566 323 21655 711 21842 1588 --
NM_018553chr1751542 1245 1225 715 279 ------
NM_018557chr241486 1349 184 56 --31444 462 291 --
NM_018569chr451562 1499 1010 383 255 190 ----
NM_018638chr1274316 1845 1715 1651 1249 1227 1208 14348 25218 4972 --
NM_018682chr71462 1208 1103 1638
NM_018691chr54968 868 332 232 11237 11130 11190
NM_018698chrX31491 576 560 31969 1471 1246 ----
NM_018704chr121942 144 --1540 --
NM_018717chr482928 2847 2381 2211 2161 2150 889 89 11143 12448 --
NM_018718chr731422 931 307 1362 22318 1747 --
NM_018719chr731419 236 135 --1117 --
NM_018834chr54921 203 113 48 --1238 1895
NM_018841chr163744 3608 2956 2630 1575 453 13430 1475 1994
NM_018898chr561921 1740 1607 1552 398 169 141 ----
NM_018945chr643597 3561 3436 2423 23478 915 ----
NM_018951chr74938 832 801 172 --1181 --
NM_018976chr1272023 1773 1133 818 597 441 156 12405 22782 1963 --
NM_018977chrX2971 933 ----11048
NM_018979chr1242657 2394 1783 223 --32612 2591 805 --
NM_018999chr1074440 4057 3874 3266 1897 1461 1207 24073 1535 --11239
NM_019004chr742160 1559 746 493 12242 2466 192 --
NM_019018chr52662 231 ----1623
NM_019035chr441651 358 206 24 ------
NM_019042chr761081 825 815 169 123 69 ----1108
NM_019044chr274726 4710 4427 4332 1276 584 311 ----11787
NM_019045chrX3813 235 225 ----1844
NM_019050chr472055 1899 1826 1661 731 504 398 31729 1711 685 --12189
NM_019057chr53320 309 303 --1289 --
NM_019066chr15287 73 --2279 150 1291
NM_019071chr74753 629 509 270 ----1519
NM_019072chr564203 3172 1661 1330 1243 295 ------
NM_019074chr153998 918 900 ------
NM_019084chr1032351 728 474 168 --140
NM_019094chr1283188 1403 1268 587 540 330 299 214 43853 2700 2650 2543 ----
NM_019116chr1673380 2747 1324 578 464 351 99 13606 --13395
NM_019117chrX43457 1359 990 138 ----11188
NM_019556chrX11080 ----11388
NM_019593chr2072425 2303 1231 957 908 883 857 13011 32230 945 474 --
NM_019600chr151200 ------
NM_019605chr13505 87 79 ------
NM_019610chr142186 1949 1675 1399 ------
NM_019843chr221357 ------
NM_020116chr451778 1406 1275 590 464 ------
NM_020122chr275972 5228 1952 1632 1224 895 790 --46056 952 739 545 --
NM_020135chr61115 ------
NM_020139chr431499 685 677 11839 11680 1181
NM_020154chr151191 ------
NM_020177chr553271 2559 2504 707 272 33061 341 204 ----
NM_020180chr1811155 ------
NM_020184chr242281 2257 2205 1741 12216 --1810
NM_020193chr112959 295 ------
NM_020198chr1721217 381 11573 --11292
NM_020228chr1182590 2292 2274 2008 1918 876 427 127 186 1311 11578
NM_020232chr181183 ------
NM_020242chr31452 ------
NM_020311chr22790 603 2762 651 --1639
NM_020317chr12309 230 ------
NM_020336chr2083820 3802 3627 3067 2673 2449 1489 730 2935 818 ----
NM_020337chr463054 2717 2710 774 398 209 1993 21210 219 --
NM_020338chr1043657 3241 1466 1091 13175 23484 3380 --
NM_020342chr262507 759 741 659 595 402 1646 1700 --
NM_020346chr1151713 1678 1503 1309 555 2223 37 11644 --
NM_020357chr381537 1400 1183 1175 1153 1143 516 210 ------
NM_020390chr384601 3291 3217 1839 1728 1306 1088 202 11592 --24874 746
NM_020403chr1381693 1416 660 648 562 408 396 194 21703 531 1125 11616
NM_020429chr743117 2857 688 167 22971 2899 ----
NM_020440chr163279 2994 2467 653 508 328 --11242 --
NM_020443chr1106476 6139 5903 5767 5721 5423 5357 5222 879 840 ------
NM_020451chr131812 1670 1511 ------
NM_020456chr1372277 1799 826 747 612 539 354 22307 184 --1573
NM_020463chr231468 1429 1335 ------
NM_020474chr1851937 1868 767 757 645 11497 ----
NM_020546chr522818 587 1629 ----
NM_020640chr332304 1869 926 11790 ----
NM_020651chr21318 1616 --21718 609
NM_020666chr53288 136 106 189 1254 --
NM_020672chr11593 ------
NM_020673chr20137777 7752 7619 7605 7598 7311 7066 6135 5804 5205 1772 1606 350 47134 5852 329 304 17376 16361
NM_020693chr111164 ------
NM_020699chr154902 3810 3642 3334 387 23628 468 14320 45401 4830 3307 937
NM_020718chr1686470 5722 5705 5515 4553 2139 1179 87 14347 16104 1540
NM_020726chr53612 465 123 --1547 --
NM_020734chr12143358 2748 2668 2342 1336 1303 1137 945 886 553 503 446 336 330 ------
NM_020740chr17129 ------
NM_020742chrX32670 891 119 ----1615
NM_020748chr1751874 1810 1642 1348 742 1590 --11592
NM_020755chr631513 1428 149 171 ----
NM_020772chr17188645 7842 7553 7525 7211 6924 6660 6646 6097 5967 3234 2934 2129 1982 1620 1332 661 288 27661 2379 37895 7797 2813 --
NM_020774chr18166199 6117 5425 5328 5149 4647 4410 3886 2158 1612 1435 1086 801 194 188 23 45379 4366 2250 315 --21301 350
NM_020783chr1852382 1605 915 468 105 62420 2406 1988 1486 701 541 --1794
NM_020791chr1731012 939 155 1140 ----
NM_020794chr151568 1419 257 251 239 11526 ----
NM_020796chr582618 2309 2177 2136 2040 1954 1106 405 12391 1892 --
NM_020801chr582672 2657 2106 1625 885 879 808 433 22529 2040 ----
NM_020803chr411725 ------
NM_020804chr622599 2445 ------
NM_020805chr1861914 1747 1707 1522 1511 753 1771 ----
NM_020809chr1162209 2152 1496 651 532 190 --179 --
NM_020825chr1643704 3095 2783 622 --12548 --
NM_020839chr331143 993 305 ------
NM_020856chr1931299 1168 140 --21462 236 --
NM_020858chr1542237 830 652 234 22144 2119 ----
NM_020859chr442964 1559 1292 543 1584 32749 576 233 --
NM_020872chr331729 713 471 11135 ----
NM_020873chr34813 607 110 87 ------
NM_020909chr254154 4019 3135 1436 96 12690 23302 2890 33561 3518 3475
NM_020921chr1453654 3358 2346 302 29 33486 3078 2753 13569 13179
NM_020935chr2134648 4615 4609 4541 3823 3618 3570 2988 849 758 629 513 242 74483 4106 3910 3422 3410 1377 664 ----
NM_020962chr1532282 2216 1773 1590 12224 1184
NM_020973chr43561 241 181 ------
NM_020988chr162935 893 --1252 21256 94
NM_021005chr1541040 900 426 256 1842 21132 919 --
NM_021033chr1383155 3128 3106 2921 2819 2300 1255 385 23427 596 ----
NM_021038chr383304 2536 2327 2154 1266 733 515 230 12160 1211 --
NM_021072chr522602 1836 ----12283
NM_021101chr342524 954 643 229 21797 1722 ----
NM_021109chrX1350 ----184
NM_021116chr768874 7370 7074 6597 5521 3416 17475 28470 8454 26646 3532
NM_021132chr1021312 341 ------
NM_021136chr144663 587 529 239 ------
NM_021140chrX3896 236 76 ----1401
NM_021144chr92449 375 ------
NM_021148chr782523 2119 999 825 394 356 324 314 --22244 1833 --
NM_021151chr731120 1071 328 1966 ----
NM_021155chr1962539 2211 1139 739 510 80 1881 12678 --
NM_021156chr2051094 955 833 435 70 ----11135
NM_021163chr743801 3584 2602 1014 32362 957 754 ----
NM_021168chr162657 326 --11621 --
NM_021180chr11777 ------
NM_021183chrX2623 524 62564 2536 2493 645 613 479 11955 11964
NM_021190chr161113 1003 432 229 104 98 1872 ----
NM_021191chr1232519 2021 327 11807 1602 11965
NM_021215chr2062381 2337 2245 2239 2095 32 1595 ----
NM_021218chr951018 722 700 658 115 1237 --134
NM_021229chr1231232 1122 945 ------
NM_021237chr31232 ------
NM_021238chr1232049 1856 1360 --12016 --
NM_021255chr1433419 955 706 44143 4015 313 82 33638 3021 1411 1242
NM_021629chr385065 4896 4719 2045 1523 1106 1086 826 34566 1434 390 2356 281 --
NM_021643chr261897 1872 1438 687 555 302 11488 11168 --
NM_021813chr6175824 5109 4560 4283 4277 4271 2341 2246 2231 1973 1960 814 808 802 792 774 570 14741 ----
NM_021818chr1421539 138 130 1103 --
NM_021914chr1472057 2051 1523 966 653 558 88 1518 12196 --
NM_021945chr643557 3066 2982 650 1562 11382 1739
NM_021961chr11177449 7369 7231 7153 6262 6189 6130 5965 5955 5246 5058 4771 4610 2712 2682 2617 656 56740 4976 4778 4575 1616 27469 6875 27263 513
NM_021964chr355608 2141 1662 1497 1287 15480 24966 741 14155
NM_022048chr15116165 5981 5914 4739 4638 4587 4579 1952 1903 745 407 26261 4913 ----
NM_022049chr141821 1679 512 231 ------
NM_022051chr12598 137 1461 1177 --
NM_022058chr251867 1761 1595 797 409 1335 11651 1788
NM_022059chr173961 294 274 1614 ----
NM_022143chr741580 1013 515 62 ------
NM_022166chr1656202 5866 4767 4047 2043 35910 3933 860 35716 2432 1477 --
NM_022343chr93342 303 279 1359 11381 --
NM_022369chr151545 ------
NM_022459chr13186130 6032 5691 5487 5098 4854 4788 4504 3914 2488 2449 2439 2429 1899 851 784 594 358 15389 22418 1564 --
NM_022465chr1263054 3025 2994 2657 2649 1869 12690 22848 95 --
NM_022473chr1583872 3659 3533 3301 3251 2883 1246 1185 1469 12795 24429 3157
NM_022474chr1462531 897 561 286 268 174 22688 1931 22766 651 --
NM_022477chr2041426 495 345 174 ------
NM_022482chr2031745 1723 592 ----11807
NM_022484chr751455 1076 128 89 69 ------
NM_022496chr123452 353 87 ------
NM_022566chr151423 ------
NM_022648chr264616 4503 4289 3669 1804 676 12840 ----
NM_022658chr1241306 1268 1055 434 11044 11343 --
NM_022728chr72686 199 ------
NM_022730chr231076 1038 332 ------
NM_022735chr151475 1401 1362 756 77 1129 ----
NM_022753chr162831 643 250 198 176 81 ------
NM_022756chr121514 360 21413 494 1504 11390
NM_022763chr362889 2782 1096 528 340 87 --1801 --
NM_022771chr1251053 975 327 172 36 ------
NM_022780chr24725 710 357 261 31545 396 28 ----
NM_022781chr963226 2716 2590 1007 269 241 ------
NM_022782chr12281 34 ------
NM_022893chr283175 3098 3021 2878 2644 2568 2431 1938 12856 ----
NM_022894chr261261 615 540 381 365 353 11228 ----
NM_022898chr14164791 4608 4562 4542 4485 4245 4143 3040 2926 1862 1393 666 605 539 336 314 33652 3068 246 ----
NM_022915chr23572 172 105 ------
NM_023016chr232495 2098 833 12901 ----
NM_023039chr5265 32 ------
NM_023076chr1652155 2116 2063 847 331 ----1390
NM_023927chr551218 1126 905 519 73 ------
NM_024007chr552757 2751 2248 1984 636 11088 ----
NM_024016chr173794 776 627 ------
NM_024019chr431043 759 723 ----1769
NM_024055chr52573 266 --1661 --
NM_024069chr191681 ------
NM_024086chr1793853 3352 1535 948 923 777 748 720 329 ------
NM_024091chr51215 ------
NM_024295chr842028 1911 1617 1545 12051 1837 --
NM_024297chr173591 546 519 ------
NM_024312chr1261661 1606 1572 1285 1110 137 11488 --2649 79
NM_024345chr995502 5442 4272 3823 2412 2124 1143 753 376 --32292 1137 350 1695
NM_024408chr193685 3647 3160 3088 2927 2746 2720 457 224 33625 2889 42 1534 --
NM_024491chr3257 50 ------
NM_024496chr146702 625 579 561 553 230 1638 ----
NM_024511chr453160 2258 1406 1391 486 12693 11165 --
NM_024519chr161272 ------
NM_024524chr352939 2882 2706 2528 2100 23035 424 1862 --
NM_024539chrX61287 1234 1163 1113 1100 1083 1964 ----
NM_024546chr136289 277 246 184 31 24 --1954 1215
NM_024548chr33183 124 102 11168 ----
NM_024556chr111383 ------
NM_024561chr1341420 1187 210 141 ------
NM_024613chr861862 1697 1639 714 233 91 11155 ----
NM_024624chr231435 1140 293 2350 44 11333 --
NM_024639chr632919 2435 2050 12321 12028 --
NM_024640chr14937 880 296 208 1976 ----
NM_024665chr3194470 4334 4254 3829 3820 3772 3453 3341 3232 3012 1335 1019 998 928 793 762 754 417 184 14131 ----
NM_024666chr1541749 1513 1148 251 ----11159
NM_024674chr142253 854 744 736 11242 12986 --
NM_024692chr231842 406 312 ----11524
NM_024721chr852591 2515 1824 907 665 1844 1954 --
NM_024749chr13715 513 493 ------
NM_024785chr231244 1189 1172 ------
NM_024792chr171186 ------
NM_024814chr72364 326 1277 ----
NM_024828chr931268 241 61 --11589 --
NM_024884chr1474430 4081 3500 1559 1464 1236 1092 13797 13062 11610
NM_024899chr184700 491 260 128 ------
NM_024900chr472069 1933 1891 1823 1479 879 491 22320 235 1185 --
NM_024913chr721317 1143 ----1498
NM_024920chr431412 1405 349 --2978 536 11375
NM_024947chr3219477 8870 8847 8705 8592 8220 8053 7671 7469 6983 6669 6308 5802 3821 3371 2858 1524 1460 1370 1216 642 12947 46125 1844 1832 1740 --
NM_024949chr474725 3885 3208 1462 581 78 71 34413 287 166 24904 380 --
NM_024953chr1272581 2354 2339 2326 2040 1103 625 1872 11755 --
NM_024989chr2157971 7115 6421 5910 5717 5696 5552 5358 5256 3025 2346 2171 2101 905 182 45832 5223 2151 149 27931 5051 --
NM_024993chr251541 1044 618 468 268 ------
NM_025009chr441954 1810 1473 717 --11666 11641
NM_025027chr192467 440 ------
NM_025054chr833866 3277 596 24160 1324 --1271
NM_025076chr2169 ------
NM_025107chr672285 2068 1607 338 238 187 23 ------
NM_025126chr122700 598 ------
NM_025132chr41301 ------
NM_025134chr1652466 1832 1674 971 250 12521 1955 --
NM_025138chr1311260 ------
NM_025154chr73562 32 22 11467 11451 --
NM_025160chr193504 3183 2963 2783 887 719 620 464 314 ------
NM_025164chr1151441 303 297 279 21 1251 12088 --
NM_025179chr164942 4867 4788 3577 850 434 ------
NM_025184chrX2744 145 1610 ----
NM_025191chr172870 2451 1355 1341 1141 1135 985 ------
NM_025195chr841617 1579 1250 271 --11542 --
NM_025222chr343011 1067 853 825 ------
NM_025234chr151122 ------
NM_025235chr1042182 2142 2048 418 2692 396 1702 1451
NM_025268chr141398 ------
NM_030627chr583995 3742 3446 3315 1048 494 161 100 14137 ----
NM_030629chr1641683 1676 1669 1518 --3331 312 242 --
NM_030647chr796276 6087 5906 5792 4820 4793 1212 277 96 36111 1001 734 ----
NM_030648chr485481 4088 4070 3759 3695 1362 1325 793 15553 ----
NM_030650chr2113930 3745 3554 3337 3207 2716 2631 1166 813 800 260 21120 1091 13548 --
NM_030661chr71653 ----11698
NM_030751chr1031802 1436 1291 1266 ----
NM_030756chr104109 88 41 29 --1260 --
NM_030762chr1241980 1922 1576 1498 11766 ----
NM_030777chr2072191 2179 2077 1938 1811 889 294 12358 ----
NM_030789chr201278 ------
NM_030806chr199412 8749 3413 2500 2486 1367 1323 994 219 28096 1021 26228 3251 --
NM_030817chr1252702 2526 1398 808 66 11460 ----
NM_030885chr352309 2277 2231 2139 1869 12287 --1231
NM_030912chr102163 146 --1860 --
NM_030920chr182098 1994 1476 739 698 584 514 62 11491 22028 1948 --
NM_030940chr951393 1201 1088 1007 227 ----11489
NM_030949chr641478 198 108 55 21433 75 ----
NM_030962chr1131481 1451 352 11549 21463 1285 11490
NM_030964chr543385 2349 1190 529 13697 23617 230 --
NM_031216chr1891969 1875 1589 1572 1435 749 629 499 180 --11525 1549
NM_031291chr44692 684 454 104 ------
NM_031296chr4102724 2329 1826 952 586 563 430 309 144 137 32341 2248 2058 ----
NM_031372chr46639 437 361 237 180 169 1102 ----
NM_031426chr932695 2153 121 ----1142
NM_031435chr12113459 3206 2921 2843 2684 1406 835 516 423 263 257 1126 23396 971 --
NM_031439chr851963 1696 1674 670 457 ------
NM_031442chrX53182 2889 2466 1148 742 12716 ----
NM_031453chr1042523 2303 757 416 22089 1848 11821 --
NM_031461chr832179 756 61 --1313 --
NM_031469chr653836 2864 2763 1565 1016 2954 903 24066 3394 1526
NM_031483chr2043450 3371 3347 590 ----12620
NM_031866chr101706 ------
NM_031954chr12102583 2286 2190 2173 2026 1166 990 666 338 319 1122 ----
NM_032021chr1121077 1068 --11105 11232
NM_032102chr1193012 2983 1202 1089 572 564 504 334 188 --12997 --
NM_032121chrX92553 2465 2345 2271 1960 810 641 298 95 12667 1461 --
NM_032124chr182241 126 1200 ----
NM_032128chr44673 658 370 279 11025 ----
NM_032142chr18396 83 47 ------
NM_032145chr651851 1824 1694 649 467 ----21870 55
NM_032153chr352744 2541 942 410 268 32566 2489 486 ----
NM_032160chr1894251 3779 3643 3483 3132 2762 310 228 213 --154 --
NM_032192chr173600 590 83 ----1755
NM_032199chr10123865 3775 3654 2728 2499 1437 1104 893 691 685 669 166 2738 284 22790 870 --
NM_032226chr94829 812 764 114 --151 --
NM_032228chr11123541 3501 3396 3070 2681 2619 2609 2575 2207 484 450 87 22687 2392 12918 --
NM_032256chr1251038 1032 391 170 75 ------
NM_032287chr2274212 3980 3683 3654 3638 1341 1117 11220 34164 3852 212 --
NM_032329chr254224 2867 2684 1763 982 --13777 14327
NM_032352chr1451443 585 422 365 124 1385 ----
NM_032354chr175985 978 931 776 197 ----1182
NM_032373chr10125922 5785 5587 5546 5315 1755 1736 1221 512 450 358 223 25687 4591 ----
NM_032410chr85396 226 188 162 96 --21215 274 1312
NM_032431chr112992 848 11040 ----
NM_032434chr241268 1199 434 100 21392 442 21356 629 --
NM_032440chr1092428 2348 2273 2150 2025 1913 1102 320 310 12919 1896 --
NM_032446chr582927 2605 2436 1162 1128 1013 619 174 ------
NM_032457chr463916 3880 3016 2547 2540 410 13707 ----
NM_032458chrX93393 3353 3265 2960 2812 2800 1339 759 145 31262 425 187 12287 --
NM_032505chr3102557 2437 2213 2132 1931 1795 1789 1751 958 490 2682 262 ----
NM_032511chr61155 ------
NM_032521chr2093110 2980 2655 2392 2318 786 664 655 247 13046 ----
NM_032532chr62653 237 2565 247 1450 --
NM_032536chr93619 263 235 ------
NM_032539chrX5332 314 302 88 76 --2738 534 --
NM_032554chr1231293 488 329 ------
NM_032564chr111991 ------
NM_032595chr1731547 1240 341 ------
NM_032603chr21735 ------
NM_032626chr163337 306 133 ------
NM_032632chr1451964 1779 1723 1255 272 12010 ----
NM_032682chr3103661 3393 3382 3141 3041 2232 1233 759 221 203 --1540 --
NM_032717chr44283 175 85 62 2750 245 1863 --
NM_032826chr763517 3474 1892 414 254 78 25478 4196 15129 --
NM_032828chr19114971 4905 4167 3449 3151 2989 1364 1205 1066 615 302 ----14686
NM_032832chr661672 1455 1434 1106 89 40 ----11521
NM_032833chr152652 2542 1877 1764 550 --22452 792 --
NM_032838chr1961278 1074 515 441 318 111 ----1956
NM_032842chr751355 1291 1122 1114 549 11467 ----
NM_032859chr1363827 3608 3526 700 567 40 43036 2637 834 792 23049 1408 --
NM_032873chr1164395 4358 3859 2862 1612 1138 --13470 14440
NM_032876chr1441650 1635 1418 308 1685 --11517
NM_032884chr14340 298 292 286 ------
NM_032932chr1755398 2421 1570 1200 470 12287 45735 5625 4168 227 --
NM_032968chrX144069 3466 3176 2955 2876 1091 954 870 625 566 505 483 420 290 31646 1596 94 ----
NM_032973chrY144061 3462 3171 2950 2871 1091 954 870 625 566 505 483 420 290 31640 1595 94 ----
NM_032982chr7112583 2336 2330 1922 1603 1038 723 659 442 345 327 12494 ----
NM_033030chr231508 528 510 --1338 --
NM_033055chr12962 210 ----1999
NM_033081chr2061460 1300 1038 511 355 131 ------
NM_033089chr2031513 1489 280 1553 ----
NM_033121chr1251617 1528 1515 1221 325 1734 --1413
NM_033129chr2011951 ------
NM_033224chr7107593 7492 6484 4982 3137 3081 2502 2137 1846 1798 18086 11638 --
NM_033225chr843134 2909 1149 1133 22941 2766 12400 --
NM_033274chr583555 3445 3095 2660 1290 1273 759 223 11020 12777 --
NM_033276chr121245 ------
NM_033285chr894347 4298 4071 3825 2783 1118 358 206 39 23440 3152 --14430
NM_033360chr12124616 4448 4429 4399 3785 3716 3566 3435 1309 667 174 133 14607 13742 --
NM_033389chr1774571 4006 3928 3918 3654 3644 1169 23544 43 --1419
NM_033426chr1442822 2657 1791 570 12732 ----
NM_033427chr72701 174 1147 ----
NM_033484chr52515 134 ----1579
NM_033505chr2135670 5415 5403 4370 2249 2070 1836 1800 1728 1274 1203 537 311 ----31746 1446 398
NM_033516chr941476 1283 373 345 ------
NM_033631chr143658 3588 3388 2562 ------
NM_033656chr21105973 4786 4538 1724 1606 1284 1158 1050 984 81 --25759 179 --
NM_052832chr892853 2801 2117 1858 978 771 348 291 184 1384 22991 847 --
NM_052867chr1341481 1071 1065 207 11514 ----
NM_052879chr1264067 3963 3426 3097 2546 267 21518 948 --12606
NM_052885chr1274345 4102 3578 3093 943 876 584 24573 4409 ----
NM_052886chr851994 1855 1417 321 79 21930 1607 1770 --
NM_052900chr821422 1371 31841 1746 1242 --11779
NM_052904chr631465 1221 1100 11436 1279 --
NM_052905chr241635 556 485 409 --1434 --
NM_052907chr1263958 3513 1226 727 710 106 --23579 967 --
NM_052917chr283304 3247 3141 3132 2919 1064 178 41 ------
NM_052918chr1063433 1258 1177 1168 476 111 --2786 92 --
NM_052927chr552157 2126 1995 1878 703 --1406 --
NM_052932chr1162421 2162 1588 696 523 398 1885 ----
NM_052937chr862239 1983 1742 1076 461 305 --1440 --
NM_052948chr19176 ----1121
NM_052962chr681699 1662 1500 1492 1203 571 143 96 1179 ----
NM_052965chr171335 1311 1030 1014 326 298 213 ------
NM_052966chr121186 387 --1172 13891
NM_053023chr1193263 3049 2235 2219 1315 1259 906 893 827 --32955 2802 42 --
NM_053024chr341475 584 467 202 --1131 --
NM_053042chr4113189 3159 3126 2862 2688 2646 2235 440 423 400 289 1544 ----
NM_053053chr131021 686 142 1951 ----
NM_053056chr1172936 2648 2135 2060 1056 978 889 ------
NM_053064chr1462873 2355 1921 1171 1138 810 1750 ----
NM_057175chr462543 2010 1816 1641 463 60 11021 ----
NM_057749chr831283 1172 336 2903 500 ----
NM_058182chr212495 135 ----1520
NM_080422chr181336 --1279 --
NM_080546chr982337 2280 2272 777 732 642 200 69 ------
NM_080616chr203465 458 90 ------
NM_080671chr232215 646 425 ----12231
NM_080743chr642590 2549 777 440 12472 ----
NM_080764chr2283317 3193 3150 1049 919 749 476 240 ----13208
NM_080832chrX51499 1487 1273 522 196 ----164
NM_080836chr20104759 4649 4496 4434 1597 1585 1297 695 389 159 ----14742
NM_080867chr1443730 1871 414 223 24139 544 24561 1392 --
NM_080872chr854065 4022 3606 1627 494 23254 2684 ----
NM_080874chr41221 21589 1204 --11259
NM_080927chr353384 3267 3122 3106 2063 1423 11179 1601
NM_080928chr74724 687 218 211 ------
NM_130386chr182534 488 --1481 --
NM_130809chr592647 2501 2389 2147 2138 771 626 440 337 23126 2456 32978 1152 966 --
NM_133264chr1772792 2413 1332 1272 838 569 563 23586 3045 11065 --
NM_133265chrX63060 2608 1040 985 848 431 13504 13647 --
NM_133329chr241609 1334 593 381 --11851 --
NM_133334chr4126337 5446 5101 4698 4504 4350 4221 4043 2053 1156 921 370 25282 354 ----
NM_133445chr922405 1521 73612 2757 2735 2391 2355 2335 77 --164
NM_133477chr452414 2047 1116 702 138 --21256 59 --
NM_133478chr232460 2412 2323 --1378 --
NM_133496chr1154099 3070 2912 2903 2894 2886 2812 1440 1073 671 557 306 300 286 220 13837 43435 1198 608 154 13297
NM_133646chr265577 5418 5261 5093 1227 328 24244 253 11780 --
NM_134428chr92305 270 ------
NM_138286chr19104122 3234 2897 2849 1732 1276 904 713 389 149 23665 3088 1428 --
NM_138288chr1442174 1395 241 215 1443 --1273
NM_138300chr131719 1579 257 11608 ----
NM_138316chr1041005 517 505 493 1127 1891 11032
NM_138340chr18126 --1167 --
NM_138375chr1821285 464 ------
NM_138423chr1542010 578 76 60 ------
NM_138426chr7112477 2383 2099 1983 1752 1706 998 759 360 283 177 ------
NM_138444chr1374857 4160 3949 3797 1792 1084 84 24332 1840 14120 --
NM_138459chr6103650 3552 3238 2664 2406 2257 908 405 341 200 ------
NM_138468chr276137 6128 5901 4674 4233 2515 509 36309 988 110 12530 --
NM_138473chr12155137 5091 5057 4464 4283 4062 3452 3357 2059 1825 1028 765 759 678 670 ----15178
NM_138479chr121433 311 ----11377
NM_138571chr61185 ------
NM_138572chr673158 3004 2507 998 861 519 384 12573 1952 13354
NM_138690chr19194 ------
NM_138715chr832077 1445 436 --11525 1375
NM_138731chr1473626 3425 1697 1363 1173 628 525 23864 255 34258 3179 2895 --
NM_138771chr781557 1551 1545 1036 962 475 287 274 ------
NM_138793chr172315 71 11809 ----
NM_138927chr212913 291 ------
NM_138957chr22161 ------
NM_138959chr1146731 6425 6397 5674 5626 5472 5317 1825 1608 597 519 512 439 216 --22262 1545 22311 1647
NM_139014chr672307 1777 1743 1661 1589 1576 686 12128 2257 44 --
NM_139015chr1241766 1744 1135 1113 ------
NM_139057chr1532823 2308 2134 --32595 1158 920 --
NM_139126chr64768 713 619 85 --1185 --
NM_139207chr1251810 867 801 421 85 1331 21413 706 --
NM_139242chr1521364 255 140 ----
NM_139283chr1292411 2044 1997 929 666 594 507 476 157 11693 --12207
NM_139321chr2064122 3948 3879 2968 2960 2576 11656 ----
NM_144571chr4166453 6414 5926 5466 5270 5054 4450 2681 2429 2283 2148 2093 1533 1145 682 151 36260 4503 2114 1142 12692
NM_144578chr1474870 4712 3781 3555 3484 812 675 34774 4133 1166 21077 736 --
NM_144582chr212594 ------
NM_144599chr1595350 4846 4368 4134 4082 2120 1857 1252 1018 25032 2011 --13521
NM_144628chr2063066 2820 2594 2557 2261 140 23089 2018 ----
NM_144632chr261847 1711 1656 1641 431 67 ------
NM_144635chr311251 ----11298
NM_144642chr32296 266 11018 1871 --
NM_144660chr101274 ------
NM_144664chr1172561 1676 768 739 726 363 352 41897 885 649 138 12614 12133
NM_144703chr2051131 1033 928 921 102 ----1325
NM_144710chr231264 356 336 ------
NM_144721chr442286 1105 191 174 21995 443 1827 --
NM_144778chr1362704 2454 2071 2029 1952 1801 11868 1797 --
NM_144963chr892584 2558 2442 2174 2084 1777 1688 808 376 ----12072
NM_144973chr1255348 4070 2128 1357 927 24081 1030 35184 1124 477 --
NM_144979chr46703 591 562 499 42 32 --2647 629 --
NM_144982chr121298 1696 2779 761 --
NM_145008chr111839 ------
NM_145049chr54979 852 385 377 2353 138 ----
NM_145058chr121474 ------
NM_145117chr1133137 2860 2835 --22948 2602 --
NM_145178chr101212 --1206 1374
NM_145239chr1611191 ------
NM_145257chr173776 3403 2859 2559 569 463 266 33694 469 138 --13090
NM_145284chrX62281 2199 1955 1561 526 412 32507 1905 170 ----
NM_145296chr191890 ------
NM_145307chr1064704 3757 3583 2958 2845 1458 31776 1119 599 ----
NM_145735chr1372780 2444 2381 2170 1949 1907 1724 22285 368 1143 --
NM_145753chr361543 1366 1345 1318 1120 431 2448 153 ----
NM_145756chr1811121 ----21396 1215
NM_145808chr763127 2475 2416 2012 1929 1140 22948 2182 23004 2107 --
NM_145891chr1631473 245 169 ------
NM_147128chr761384 1237 1166 422 399 305 1128 ----
NM_147156chr1051425 1376 1353 1180 1134 1551 1278 11444
NM_147189chr871803 1687 1465 890 824 708 593 --1100 --
NM_148894chr411124 --1226 --
NM_152261chr1262535 2130 2055 2020 1952 560 1683 11992 --
NM_152265chr141436 268 261 118 ------
NM_152296chr19178 ------
NM_152346chr171763 ------
NM_152384chr221991 1865 --11768 --
NM_152407chr582443 2279 1160 845 520 490 362 76 --11236 --
NM_152409chr563494 2924 2574 2438 497 202 2463 353 ----
NM_152417chr881317 1305 1007 523 467 165 80 53 1234 ----
NM_152424chrX53881 1819 1078 959 293 14699 11773 --
NM_152450chr1531634 1353 176 1537 ----
NM_152475chr1962741 2678 1945 640 482 470 --1525 --
NM_152493chr131328 1287 263 --11635 --
NM_152517chr22554 36 1425 1103 --
NM_152522chr24930 900 693 268 21054 52 ----
NM_152557chr761502 1364 322 263 256 249 ------
NM_152581chrX2595 362 ----1515
NM_152594chr1572273 1825 907 305 196 65 36 12052 ----
NM_152603chr193631 615 487 ------
NM_152608chr152587 1940 1852 319 193 11787 12119 --
NM_152622chr5133467 3434 2953 2670 2395 2312 1320 1240 1065 974 820 411 308 ------
NM_152624chr5106848 6432 5993 2884 2735 2674 2618 808 486 279 57437 7177 6765 5726 5055 15938 12040
NM_152641chr1282639 2212 1058 887 835 786 523 173 21066 626 ----
NM_152653chr33525 477 282 1129 ----
NM_152666chr11192 ------
NM_152682chr481754 1626 1505 1466 1444 1096 528 115 ------
NM_152695chrX3471 256 92 11781 ----
NM_152722chr1121805 1413 --11829 --
NM_152723chr112893 804 2914 827 ----
NM_152737chr652113 1855 1804 1769 1542 21827 1488 12033 --
NM_152744chr753608 3209 526 99 60 1191 1965 --
NM_152754chr753156 2741 2735 1480 61 31403 1192 978 ----
NM_152756chr5154285 4265 4107 3778 3411 3348 3263 1370 1243 1186 1172 1076 663 194 51 43728 1457 1143 541 --13281
NM_152758chr882955 2849 2520 2189 1188 1165 736 400 1261 ----
NM_152774chr742041 1999 947 402 2521 331 ----
NM_152787chrX63163 3152 2929 2815 645 613 32781 989 538 21027 134 --
NM_152835chr152639 2201 2195 963 123 1618 --1393
NM_152857chr621009 958 ------
NM_152890chr121024 792 1935 21007 511 --
NM_152903chr13102885 2869 2658 2221 2012 1981 1971 1095 497 91 12827 11087 --
NM_152995chr41266 ------
NM_153042chr641692 1168 646 564 21765 626 ----
NM_153183chrX31248 440 228 1381 ----
NM_153207chr1273917 3323 3283 3055 2806 587 546 22875 1109 ----
NM_153223chr521390 125 21578 196 --156
NM_153252chrX1383 ------
NM_153261chr1641583 1562 581 391 ------
NM_153354chr52951 717 1683 1237 1802
NM_153365chr432170 588 309 22097 2004 1991 --
NM_153367chr1063348 2921 2674 2509 1605 737 --13257 --
NM_153371chr1342084 636 330 81 22024 1994 --1218
NM_153456chr1396285 5939 5559 5356 4712 2455 1385 559 139 --14082 --
NM_153607chr592658 2616 2156 1938 909 713 641 413 42 11952 1600 --
NM_153685chr1221157 813 ------
NM_153686chr472495 1918 1852 1777 1597 503 33 2350 198 ----
NM_153713chr12251 79 ------
NM_153810chr10104697 4614 4125 3295 3210 3103 1597 507 378 369 33760 1518 153 1612 --
NM_153812chr152091 2031 2011 1585 863 12330 11493 --
NM_170606chr7111855 1767 1553 1499 1444 1398 1210 657 288 277 94 --1759 --
NM_170665chr122247 135 11124 13974 --
NM_172020chr711381 ------
NM_172071chr1207292 7261 7251 6747 6478 6468 6341 5947 5721 5163 2994 2507 2492 2363 2106 2021 1023 651 412 254 26862 4646 ----
NM_172244chr51232 ------
NM_172373chr1361352 1308 1242 443 174 138 2329 107 ----
NM_173078chrX3429 294 58 --1324 1332
NM_173083chr131215 1185 808 11316 ----
NM_173156chr1102194 2188 2181 2162 2152 2133 1881 1800 1740 1475 --11459 --
NM_173354chr2132019 1932 145 ------
NM_173468chr4135927 5332 5294 4616 4276 4080 2394 1849 1478 971 96 75 65 21903 567 ----
NM_173469chr1521490 1329 11548 --11208
NM_173475chr1661390 1225 1159 622 327 317 ------
NM_173511chr293845 3794 3744 3221 3109 1569 737 717 275 13532 11165 13154
NM_173527chr141763 ------
NM_173531chr1993753 3496 2773 2604 2385 2371 932 651 613 --12500 13277
NM_173554chr101229 ------
NM_173576chr1042268 1863 1599 1574 1865 ----
NM_173642chr178960 7627 7617 7196 5894 2586 819 37357 6771 3525 43104 924 577 167 1634
NM_173647chr23833 454 87 --11121 --
NM_173648chr211003 ------
NM_173698chrX61759 1696 1360 772 460 141 1417 ----
NM_173794chrX1496 ------
NM_173797chr531335 1228 877 21117 1008 ----
NM_173800chr551313 1124 308 106 61 --11092 178
NM_173808chr132743 1081 641 24237 279 --13413
NM_173822chr241965 867 382 144 1223 11584 --
NM_173827chr473210 2787 2521 2384 2295 1149 843 32311 648 507 ----
NM_173829chr5125884 5864 5804 5752 4963 4165 1687 979 964 668 266 235 25368 676 11159 --
NM_173854chr19818 795 621 482 410 390 297 170 60 ----1365
NM_174890chr103262 233 81 ------
NM_174911chr8123781 3678 3670 3546 3208 3184 2978 2943 1306 1150 823 431 13624 1888 --
NM_174916chr152716 351 11530 --1933
NM_174937chr102645 181 --1726 --
NM_175056chr352030 1824 604 425 107 ------
NM_175061chr742081 2006 690 176 1486 1160 --
NM_175709chr2243008 2885 2650 2210 ------
NM_175736chr1267200 6466 5327 2185 895 805 16889 17772 --
NM_175854chr1372740 2583 2312 2040 1886 574 269 12056 12646 --
NM_175856chr52597 116 ------
NM_175861chr12135868 5781 5623 4909 4619 4525 4458 1669 1080 1017 512 342 261 25124 3699 34474 1776 1372 --
NM_175907chr181560 12442 --12058
NM_175921chr543386 2967 718 632 ----11299
NM_176814chr771239 1137 1101 1086 406 310 43 21025 535 ----
NM_177538chr2138791 7464 6406 6266 5958 5799 5780 3062 3039 2540 272 243 118 58078 2384 2251 1673 131 13482 1100
NM_178011chr1062970 2708 2246 944 490 478 1466 --3899 189 42
NM_178140chr521949 439 1451 12611 --
NM_178313chr282214 1716 1680 1613 1594 1559 1368 201 ------
NM_178450chr51584 ------
NM_178496chr33411 405 212 21074 63 11034 --
NM_178509chr1743325 2986 2689 1573 21322 151 2545 516 2931 300
NM_178539chr122703 566 11582 21487 757 11874
NM_180989chr1342123 1900 559 550 11729 11762 11525
NM_181077chr1541502 896 746 122 21413 153 11535 1510
NM_181354chr831296 1121 324 --21655 1227 --
NM_181358chr183616 2879 2750 577 540 477 396 331 64057 3537 2924 1327 1229 234 22805 1110 --
NM_181504chr5103380 3252 3184 1547 1093 934 918 886 778 752 23215 509 ----
NM_181521chr16127213 5915 5707 5691 5643 5127 4632 4579 1338 864 591 104 22282 308 25792 2255 --
NM_181552chr72865 682 ------
NM_181581chr75872 795 730 701 70 ------
NM_181645chr112633 160 ----1710
NM_181672chrX31418 1372 609 ----1325
NM_181701chr952339 797 593 389 197 ------
NM_181706chr1161879 1591 928 792 180 67 ----1432
NM_181776chr551346 1184 1172 471 232 11831 ----
NM_181784chr232345 2071 395 12187 ----
NM_181836chr572522 2408 2148 1672 994 620 565 22534 178 11065 1689
NM_181873chr11167 ------
NM_182485chr4113273 3192 3074 2962 2810 2776 2673 2642 2532 2501 240 53733 1041 1022 970 208 13110 13361
NM_182488chr132784 625 ----1654
NM_182511chr184322 265 165 159 --11423 --
NM_182540chrX3790 600 206 ------
NM_182616chr153879 868 432 ------
NM_182691chr741329 1156 192 159 1335 2564 317 --
NM_182700chr751448 1372 1280 690 648 11973 11776 21254 167
NM_182705chr1742540 2275 533 508 12371 1196 23148 2710
NM_182765chr1082313 2275 2176 2031 1963 1636 1517 790 ------
NM_182830chr1451768 1584 884 370 250 ----164
NM_182944chr141391 ------
NM_183376chr1542474 2468 1606 717 --12595 --
NM_194071chr7155455 4945 4566 4242 4176 3370 1464 1439 1328 1298 1202 1151 894 880 64 15266 25399 4518 --
NM_194247chr2144478 4407 4058 3510 2985 2822 2753 1561 1168 753 632 504 394 290 34073 3034 689 --13559
NM_194250chr22450 392 --1342 --
NM_194272chr152965 752 --1910 --
NM_194282chr462147 1899 1890 1112 465 345 ----11935
NM_194291chr882941 2500 2442 1869 1207 1186 464 200 ------
NM_194314chr1125431 4868 4846 4662 1449 1415 1364 1010 966 800 633 73 23410 214 45634 3909 3681 1786 --
NM_194317chr232267 644 435 12748 --12730
NM_194318chr1382574 2241 2065 1793 805 630 610 406 ------
NM_194439chr431481 1066 231 ----1291
NM_194449chr183976 624 331 ------
NM_198074chr151154 1048 1022 995 196 2983 256 ----
NM_198243chr151960 --1259 1738
NM_198270chrX63273 3030 2952 2647 2406 1328 33335 3292 3283 13373 --
NM_198273chr543049 764 664 115 ------
NM_198281chr463310 2636 2529 1113 334 25 22744 2303 13247 --
NM_198401chr861253 1136 703 591 407 395 21632 655 21721 231 --
NM_198459chr12285 278 --1696 1855
NM_198463chr33423 277 178 1140 ----
NM_198465chrX43004 2919 607 245 22316 1024 --1238
NM_198504chr35895 882 842 824 636 ------
NM_198513chr82752 210 41530 1407 364 320 --11983
NM_198581chr2147052 7032 6914 5305 5171 4848 4614 3002 1805 1720 1606 1177 769 560 22522 64 17082 --
NM_198859chr364928 3324 1998 1396 645 452 45156 3659 2012 461 14011 --
NM_198935chr2083015 2632 2417 2275 2266 669 308 259 23161 2610 ----
NM_199000chr732334 2111 70 1355 ----
NM_199044chr162443 1258 900 876 711 406 11057 ----
NM_199051chr13336 287 55 1258 ----
NM_199320chr452926 2895 2134 491 178 32684 2571 168 --12366
NM_203301chr1431525 566 89 --1324 --
NM_203349chr1531546 78 48 ----22227 1629
NM_203371chr1171802 1780 742 562 200 194 182 --1680 --
NM_203390chr841792 1759 648 272 ------
NM_203394chr1242691 2598 1040 487 32483 2393 919 ----
NM_203406chr531057 1016 286 11807 1545 --
NM_203459chr142548 2404 2006 238 11602 1446 11914
NM_203463chr273769 3527 1852 621 407 267 238 21869 275 23792 191 --
NM_206853chr6113845 3705 3696 3331 3283 3067 1624 1473 991 726 645 24129 959 14096 --
NM_207043chr132017 1863 273 ------
NM_207311chr1211193 ------
NM_207325chr1921731 569 --1556 --
NM_207352chr482639 2419 2366 1868 846 680 371 174 ------
NM_207359chr321786 1432 11828 ----
NM_207396chr141426 564 426 260 ------
NM_207406chr4125789 5460 4669 2549 2280 1531 1515 1468 1421 1008 774 729 36339 5884 4510 25797 1284 --
NM_207469chr2041708 1667 1220 179 ------
NM_207517chr1521777 1557 11726 21852 1739 --
NM_207577chr1132749 2735 2333 ------
NM_212554chr1091431 1333 1326 1177 555 516 505 425 309 --11400 --
NM_212558chr953675 1438 1340 1016 974 1282 --14066
NM_213606chr1082677 2530 2319 2231 1742 348 210 127 --12650 --
NM_213609chr32430 416 --2874 292 --