TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-525-3p
miRNA Sequence: GAAGGCGCUUCCCUUUAGAGCG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000018chr171117 --137 --
NM_000033chrX1906 --1940 --
NM_000044chrX1282 --194 --
NM_000052chrX43079 2942 1252 1148 ----1528
NM_000161chr141757 --1719 --
NM_000168chr722703 1225 ----12873
NM_000176chr512392 126 1497 --
NM_000177chr9----139 --
NM_000182chr2----1142 --
NM_000192chr12------11552
NM_000208chr1974712 4554 2986 1622 1524 1337 47 ------
NM_000214chr20--11315 1432 --
NM_000217chr1231692 1270 92 14745 11657 --
NM_000248chr3--1491 ----
NM_000252chrX1281 --1144 --
NM_000254chr13360 180 21 ----167
NM_000259chr1522018 1315 24904 4871 24671 4015 --
NM_000399chr10--1913 1864 --
NM_000408chr222439 108 --13180 --
NM_000430chr171370 --12555 --
NM_000445chr82947 105 --1264 --
NM_000461chr334029 3173 1615 11478 ----
NM_000462chr152728 163 --11429 --
NM_000484chr212828 124 ------
NM_000503chr81146 ------
NM_000540chr19------142
NM_000641chr19------1157
NM_000665chr7----1185 --
NM_000701chr1----1238 --
NM_000719chr1256412 282 242 189 71 --1111 --
NM_000728chr11----1386 --
NM_000814chr1531194 693 361 --13825 --
NM_000817chr2137 ------
NM_000824chr4------1803
NM_000826chr4------1194
NM_000828chrX------1173
NM_000829chr1122312 1917 ----127
NM_000901chr42639 229 21977 30 1961 --
NM_000912chr812629 --13539 --
NM_000917chr101397 1386 --1841
NM_000966chr121155 --1753 --
NM_001001395chr12----1843 --
NM_001001419chr511449 --34681 1901 1070 --
NM_001001481chr8----1565 --
NM_001001586chr1----2462 127 --
NM_001001664chr233734 2619 1140 --33174 2772 270 --
NM_001001669chr51326 --12454 12153
NM_001001852chr225636 629 369 138 40 --1147 --
NM_001002233chr831551 602 74 --2823 226 --
NM_001002257chr2--13324 --13146
NM_001002860chr1443617 1228 988 26 --14390 --
NM_001002909chr1762116 1838 1648 1385 547 430 --11430 --
NM_001002919chr2----146 --
NM_001003698chr621632 50 ----2759 224
NM_001003712chr1211400 --23020 2790 --
NM_001003800chr943610 1241 1137 783 --22722 1475 --
NM_001004065chr943080 2929 2498 944 --126 --
NM_001004720chr21996 ------
NM_001005360chr192805 164 --1577 --
NM_001005473chr525414 4941 --16493 --
NM_001005505chr331390 454 52 184 1150 --
NM_001005781chr2----1485 --
NM_001005849chr17----1578 --
NM_001005861chr3138 ----1128
NM_001006665chr11290 --1163 --
NM_001006944chr11----1695 --
NM_001007067chr81436 ------
NM_001007553chr11873 1412 --1235
NM_001008392chr323221 1060 --1404 --
NM_001008393chr412789 ----1869
NM_001008408chr755426 4697 4110 4026 1621 12318 --11162
NM_001008410chr252235 2171 2153 1755 600 --1844 --
NM_001008493chr11654 ------
NM_001008701chr1912836 --12689 --
NM_001010888chrX54235 4100 3450 3263 131 23679 155 --199
NM_001010924chr102780 439 ------
NM_001010942chr1211063 --1519 --
NM_001010971chr11978 ------
NM_001010984chr11747 11963 11713 --
NM_001012329chr142174 850 607 315 --1571 --
NM_001012514chr211046 ------
NM_001012644chr20----163 1220
NM_001012755chrX23627 1647 --11775 --
NM_001013031chr1042781 2400 1100 1081 12984 12221 --
NM_001013438chr3----1368 --
NM_001014283chr13----11468 --
NM_001015053chr17--1402 1371 --
NM_001015877chrX--12551 12445 12194
NM_001015880chr1031548 1515 1160 ----11604
NM_001017368chr1712303 ----129
NM_001017371chr2--1147 ----
NM_001017396chr211374 11438 1827 --
NM_001017405chr4162 1682 ----
NM_001017415chr1----1518 --
NM_001017424chr11246 ----1480
NM_001017926chr8----11148 --
NM_001017973chr51250 --1263 --
NM_001017998chr9263 35 --1871 --
NM_001018078chr91600 --2176 77 --
NM_001018100chr15------1631
NM_001020818chr1931497 1227 89 ----1689
NM_001024666chrX----1645 --
NM_001024808chr1242215 761 409 368 --1424 --
NM_001025266chr314918 2261 165 ----
NM_001025580chrX43665 3477 453 326 --1872 --
NM_001029998chr4------1145
NM_001030007chr161529 --13655 12441
NM_001031681chr171708 ----1459
NM_001031738chr2--1384 ----
NM_001032730chr1----137 --
NM_001033081chr141910 1758 1421 751 --1234 --
NM_001033117chr334874 3544 1198 13809 23910 3586 --
NM_001033506chr111158 ------
NM_001033518chr732729 1902 289 --11004 --
NM_001033602chr1342413 2351 635 463 --1568 --
NM_001034850chr511497 --11546 --
NM_001034954chr1032594 2451 2412 ------
NM_001035534chr941399 1322 584 490 11496 21409 95 --
NM_001035chr1------1469
NM_001037132chr711952 --1839 --
NM_001037283chr73479 378 188 ------
NM_001037334chr182323 284 1432 --12270
NM_001037339chr11195 --1404 --
NM_001039479chr1411823 --12295 --
NM_001039490chr111539 --1146 --
NM_001039550chr2----152 --
NM_001039577chr124432 3919 --21709 32 --
NM_001039840chrX15330 1321 24172 55 --
NM_001039937chr131693 --11233 --
NM_001040057chr721283 299 --1536 --
NM_001040113chr16----1876 --
NM_001040159chr4----1979 --
NM_001040181chr3----1958 --
NM_001040429chr1342894 2869 1232 1159 ------
NM_001040624chr82782 146 --1131 --
NM_001040633chr7------1359
NM_001040712chr912461 ------
NM_001042368chr9--1201 2209 77 --
NM_001042404chr12691 237 ------
NM_001042481chr1412694 11777 --1259
NM_001042533chr3------22203 1269
NM_001042555chr122559 237 24626 889 ----
NM_001042603chr1254656 3523 3465 3407 968 ----14237
NM_001042604chr314032 --11444 --
NM_001042663chr121223 1043 --1155 --
NM_001043318chr1483917 3621 3449 3399 3328 2904 1327 1321 ------
NM_001046chr531957 403 46 --1336 --
NM_001084chr7----141 --
NM_001099678chr336434 6082 1924 ----25116 693
NM_001106chr336388 2028 337 --27208 2798 --
NM_001116chr16----1255 --
NM_001130chr19----1885 --
NM_001135chr15194 --1279 --
NM_001149chr10--21068 416 ----
NM_001157chr102468 200 ----1656
NM_001219chr71862 ------
NM_001232chr12294 173 --11031 --
NM_001304chr17----23711 2434 --
NM_001315chr62775 86 ----1611
NM_001319chr192744 143 1877 ----
NM_001332chr531565 476 396 11369 ----
NM_001338chr211789 --1290 --
NM_001356chrX----1315 --
NM_001364chr1143588 3580 3007 1439 11673 ----
NM_001365chr172759 555 ------
NM_001406chr172495 360 ------
NM_001433chr171776 --1119 --
NM_001448chrX21427 353 1522 ----
NM_001497chr932767 1827 222 --21850 1693 12096
NM_001543chr543790 3748 1565 659 --11936 --
NM_001621chr71549 ----1805
NM_001650chr1823333 1338 ------
NM_001654chrX1322 --1332 --
NM_001665chr112492 129 --3145 62 54 183
NM_001693chr8----11042 --
NM_001706chr3198 --1836 --
NM_001753chr731431 623 561 3715 584 264 1661 --
NM_001759chr1285203 4780 3995 3496 2038 1597 1530 197 13816 --14735
NM_001792chr181381 --1245 --
NM_001845chr13----1331 1125
NM_001859chr91665 13887 1850 --
NM_001901chr6----1674 --
NM_001914chr181101 --1328 --
NM_001914chr181101 --1328 --
NM_001935chr2----11025 --
NM_001949chr622028 339 --1424 --
NM_001964chr51767 --2791 775 11165
NM_001966chr3----11493 --
NM_001968chr41154 ------
NM_001980chr1232230 392 161 ------
NM_001982chr12166 --2359 50 --
NM_002024chrX----1550 --
NM_002025chrX68959 8673 3216 2887 2736 2117 1826 ----
NM_002069chr71634 --11684 --
NM_002070chr32329 109 --1668 --
NM_002084chr51295 --1662 --
NM_002086chr1752031 1821 1659 528 481 ------
NM_002094chr16170 ------
NM_002114chr6----1196 --
NM_002126chr172578 249 23149 2701 1944 12738
NM_002135chr122362 177 --158 --
NM_002137chr721762 245 --12003 --
NM_002146chr17----1917 --
NM_002193chr2----1401 --
NM_002196chr20----136 --
NM_002198chr5----2757 686 --
NM_002204chr17----11353 --
NM_002206chr12------1346
NM_002211chr101940 --21101 242 --
NM_002226chr141649 --1804 --
NM_002234chr12------1684
NM_002235chr1221606 1332 ------
NM_002265chr17----1853 --
NM_002267chr13----11850 --
NM_002268chr31318 --11619 --
NM_002270chr542237 1849 1397 570 ------
NM_002293chr1--12687 32667 1687 66 --
NM_002294chrX1306 --1441 --
NM_002473chr2211040 ----11303
NM_002501chr1954090 1590 1556 1113 350 13409 13448 11539
NM_002508chr11388 ----1803
NM_002519chr1111198 --11100 --
NM_002546chr8------1302
NM_002553chr7----1350 --
NM_002556chr11--22124 182 11620 --
NM_002569chr152596 530 --11293 --
NM_002587chr5275 21 --1398 --
NM_002590chr131455 ----1103
NM_002632chr141237 --1181 --
NM_002633chr11508 --1451 --
NM_002645chr1122738 2155 12838 12330 1622
NM_002648chr61830 --21196 447 --
NM_002655chr834054 3681 75 ------
NM_002668chrX----1126 --
NM_002719chr1431841 1755 1664 1393 1951 11805
NM_002742chr142554 73 1624 1288 --
NM_002745chr2274505 4445 3518 1352 1308 601 96 --23598 1013 --
NM_002764chrX----1854 --
NM_002819chr1941501 968 349 265 21344 957 --1336
NM_002833chr151408 ----1245
NM_002834chr1253892 3367 2948 778 554 ------
NM_002835chr7--2214 151 1652 --
NM_002843chr1112685 --1523 --
NM_002851chr7----1168 --
NM_002857chr12858 510 --21847 365 --
NM_002886chr3--11803 11049 --
NM_002894chr18----1178 --
NM_002895chr20----2844 216 --
NM_002918chr19----1300 1218
NM_002956chr1211257 --1533 --
NM_002976chr2----1506 --
NM_003010chr1721884 465 12290 ----
NM_003015chr102501 481 --134 --
NM_003020chr15------1464
NM_003029chr1----1436 --
NM_003036chr11120 1112 11156 --
NM_003045chr1311326 --14582 --
NM_003048chr212047 --1270 --
NM_003051chr1------1285
NM_003060chr5----11296 --
NM_003061chr101253 --1237 --
NM_003068chr8----1849 1446
NM_003074chr331653 1455 134 --11840 --
NM_003104chr15----1293 1163
NM_003174chr102308 284 --1698 --
NM_003185chr20148 ------
NM_003189chr162574 2263 2222 1222 691 386 --1552 --
NM_003204chr1721676 100 --11183 --
NM_003211chr12----11435 --
NM_003214chr6------1179
NM_003221chr623185 2999 ------
NM_003223chr16----1831 --
NM_003234chr3----1955 --
NM_003239chr141772 ------
NM_003247chr6----1167 --
NM_003262chr334046 3597 1567 33635 1173 976 ----
NM_003274chr2121979 659 --2567 404 --
NM_003275chr921136 25 --11181 --
NM_003288chr201995 ----11249
NM_003298chr363957 2186 2162 1941 1453 205 --15160 --
NM_003320chr1122828 621 --14120 13149
NM_003342chr1743062 3048 2669 2464 --12565 --
NM_003380chr10----187 --
NM_003413chrX1576 1386 ----
NM_003452chr9----1661 --
NM_003468chr243945 1635 847 221 ----13004
NM_003498chr16----1256 --
NM_003502chr16----1439 --
NM_003566chr121496 ----13304
NM_003575chr721460 1175 --11273 1460
NM_003583chr1213220 --12819 --
NM_003586chr161612 ------
NM_003590chr212626 --33699 3588 1510 --
NM_003621chr11------2486 398
NM_003625chr12----143 --
NM_003658chr111253 --1579 --
NM_003701chr1321048 772 --1807 --
NM_003741chr3----1103 --
NM_003749chr132932 877 ------
NM_003795chr61105 ------
NM_003861chr1442637 2323 464 346 --12849 --
NM_003870chr1522096 1852 ------
NM_003872chr252718 864 752 631 430 ------
NM_003873chr1011940 11691 1754 --
NM_003895chr211769 ----11672
NM_003913chr632638 1634 730 --1747 --
NM_003940chr3141 ------
NM_003955chr1711082 ------
NM_004036chr23686 657 185 ------
NM_004100chr612117 ----22662 657
NM_004124chr14----1797 --
NM_004171chr1189522 9475 8055 6361 2375 1036 841 430 1651 11372 --
NM_004238chr21101 ------
NM_004274chr1422723 231 --1746 --
NM_004283chr19----2669 342 --
NM_004339chr2141315 1229 469 171 ----11945
NM_004356chr112470 439 ------
NM_004364chr1941011 854 185 123 --3988 347 290 --
NM_004383chr152616 527 ------
NM_004385chr5----162 --
NM_004397chr1123460 1592 ----1462
NM_004405chr21283 --1316 --
NM_004414chr21----11173 --
NM_004427chr13767 403 36 ------
NM_004429chrX----21209 206 --
NM_004430chr87872 807 480 285 266 256 41 --1204 --
NM_004433chr121602 268 --21552 667 --
NM_004447chr12----11101 --
NM_004475chr17----21055 369 1102
NM_004559chr11257 ------
NM_004560chr91310 ------
NM_004561chr1131271 319 277 --21407 133 --
NM_004571chr2112393 11022 23096 135 --
NM_004580chr15--1344 --1237
NM_004588chr1133656 1269 832 --33863 3670 3351 --
NM_004612chr954620 4537 4101 824 619 --13132 --
NM_004620chr112431 230 --148 --
NM_004622chr2168 1717 --1111
NM_004643chr141733 ------
NM_004656chr321065 831 ------
NM_004673chr1--11197 1515 --
NM_004685chr131436 1958 ----
NM_004706chr19----1305 --
NM_004709chrX21820 499 --1168 --
NM_004759chr162098 2089 2061 1371 778 351 --1503 --
NM_004774chr171766 ------
NM_004781chr121546 387 --2208 146 1444
NM_004788chr11----22538 2049 --
NM_004789chr9------1312
NM_004801chr2----1416 --
NM_004852chr18714201 13897 10315 9957 4961 3784 1976 --19485 --
NM_004863chr1434123 3440 3318 --1436 --
NM_004869chr1811586 --11434 --
NM_004898chr442332 2291 362 242 ------
NM_004907chr192672 186 --1237 --
NM_004924chr191223 --1402 --
NM_004926chr1421770 296 --1375 --
NM_004938chr91427 ------
NM_004998chr15----1383 --
NM_005009chr161362 ------
NM_005063chr1033735 3422 171 ----12941
NM_005110chr5----1142 --
NM_005156chr945381 4243 1780 1772 --14072 11058
NM_005186chr11----2474 101 --
NM_005188chr11137886 7460 6768 6186 5582 5350 5049 2865 2682 2502 2237 1332 961 16079 27192 6246 --
NM_005189chr1762391 1677 797 689 442 204 --22322 1847 --
NM_005221chr7----1217 --
NM_005230chr12--1567 ----
NM_005238chr1112533 22818 619 ----
NM_005244chr20152 ----1612
NM_005254chr15----1870 --
NM_005257chr182880 204 --1119 --
NM_005312chr922166 2095 1607 --1925
NM_005327chr4166 --2257 44 --
NM_005357chr192205 45 ----181
NM_005378chr21738 ------
NM_005406chr181278 ------
NM_005418chr111138 --132 --
NM_005437chr101282 --1990 --
NM_005455chr121587 221 ----1639
NM_005475chr1232879 2826 2239 ----1875
NM_005488chr221643 --1735 --
NM_005502chr911190 --1191 --
NM_005578chr334095 3256 946 1125 --14173
NM_005596chr935685 5297 4911 1430 11489 --
NM_005598chr111356 --1674 --
NM_005627chr6--1259 1359 --
NM_005634chrX3445 111 79 ------
NM_005665chr134218 3645 165 --24924 4381 --
NM_005668chr53947 903 801 --12800 --
NM_005688chr3196 11294 ----
NM_005697chr15144 ----172
NM_005704chr121020 79 --11112 --
NM_005730chr1273455 2917 2719 680 629 468 94 11444 158 --
NM_005754chr51979 1947 1802 --
NM_005786chr18----1423 --
NM_005845chr13------1268
NM_005853chr161604 --1511 --
NM_005857chr131435 1251 1178 --11453 --
NM_005909chr514007 1943 11173 --
NM_005911chr2----11414 --
NM_005933chr1132788 831 473 --12225 --
NM_005964chr1711519 ----11133
NM_005967chr12----1684 --
NM_005984chr22----1355 --
NM_006011chr1584182 3981 3689 3409 3068 1139 1059 1048 13350 14004 --
NM_006016chr6------21659 658
NM_006022chr131361 --1302 --
NM_006037chr233757 3225 3048 1740 1676 13855
NM_006047chr2013492 11293 ----
NM_006106chr1143232 3019 2254 1156 11362 22938 1030 --
NM_006160chr1731319 206 36 ------
NM_006162chr1811558 1618 --21409 406
NM_006185chr11----2178 85 --
NM_006190chr2----1221 --
NM_006224chr1732291 356 264 --12506 --
NM_006242chr20148 --11965 --
NM_006252chr11204 16899 16172 --
NM_006256chr11614 1351 12265 --
NM_006275chr20--1501 12419 --
NM_006277chr21480 --1213 --
NM_006282chr2042968 1647 1336 741 --1232 1802
NM_006289chr91114 ------
NM_006320chr4------1724
NM_006352chr111374 11598 ----
NM_006371chr385065 4855 4771 3814 3753 612 457 168 14216 11545 --
NM_006373chr1721421 1112 ------
NM_006390chr1221636 684 --1361 --
NM_006393chr1013967 11616 13457 --
NM_006415chr9----11223 --
NM_006420chr201677 ------
NM_006449chr2----1659 --
NM_006454chr452160 1880 1243 794 635 ------
NM_006460chr17----1632 --
NM_006467chr51272 ------
NM_006496chr111254 --21685 1566 --
NM_006521chrX2938 71 --11419 --
NM_006538chr223756 1365 1471 1725 --
NM_006546chr1745472 4758 4332 2428 12633 24781 4210 14794
NM_006599chr1638049 2449 2131 --25615 5038 --
NM_006626chr911004 1616 12302 --
NM_006633chr51718 --1157 --
NM_006640chr1731852 1552 1182 --2697 632 --
NM_006698chr2021222 547 --1123 --
NM_006734chr6----1246 --
NM_006738chr1554277 947 517 490 365 13341 33739 2899 1744 --
NM_006750chr1687207 7042 5889 5546 2400 2238 2194 666 --2859 107 --
NM_006754chr71277 11212 1157 --
NM_006763chr121888 1739 --1212 --
NM_006769chr1----130 --
NM_006775chr622517 85 1136 --11160
NM_006788chr1841455 532 399 320 --1462 --
NM_006809chr202919 642 ------
NM_006838chr12----11911 --
NM_006892chr20----11365 --
NM_006896chr71222 --149 --
NM_006901chr15----1205 --
NM_006902chr123029 810 ----21076 595
NM_006939chr1441055 890 358 207 ------
NM_006946chr113580 386 379 ------
NM_006981chr912826 --12874 --
NM_007005chr9----11257 --
NM_007045chr6----1110 --
NM_007054chr51948 --13781 --
NM_007067chr1711070 --11355 --
NM_007085chr3--11951 11926 1935
NM_007144chr171308 ------
NM_007146chr17----11862 --
NM_007150chrX21974 1634 11395 --1232
NM_007162chr62418 154 --1600 --
NM_007214chr6----1163 --
NM_007217chr3152 1256 ----
NM_007236chr152371 160 ----12440
NM_007238chr2074720 4316 4258 3876 3463 3325 71 --11909 --
NM_007241chr17----1145 --
NM_007271chr611153 --11268 --
NM_007327chr92865 140 --21111 223 --
NM_007331chr422539 1002 ------
NM_007359chr1731089 474 161 11559 11535 --
NM_007375chr131954 1780 1715 --1670 --
NM_012110chr4----155 --
NM_012166chr911046 ------
NM_012193chr1124251 1443 21692 1568 21131 598 --
NM_012199chr144075 4050 2919 122 --1779 --
NM_012214chr244862 2566 2441 1412 --16352 --
NM_012231chr1----11583 --
NM_012247chr103977 748 165 --1410 --
NM_012249chr2--22590 1391 --12422
NM_012262chr123689 393 11816 14242 --
NM_012264chr2221541 112 ------
NM_012288chr654301 3948 3712 765 154 1328 21302 1226 14323
NM_012297chr41411 --1899 --
NM_012301chr7--1407 ----
NM_012309chr1133616 1046 295 13982 24853 4735 --
NM_012334chr531317 355 167 33618 1089 249 --24510 300
NM_012339chr101134 --1496 --
NM_012388chr1562951 1135 1018 417 380 143 ----186
NM_012434chr6----2607 67 --
NM_013232chr5------1387
NM_013233chr211339 ------
NM_013279chr112868 709 21916 1651 --1693
NM_013281chr20----11320 --
NM_013351chr17----1258 --
NM_013411chr12870 696 --1846 --
NM_013449chr1212907 ------
NM_013960chr83567 515 146 ------
NM_014011chr24564 478 171 39 ------
NM_014016chr33170 105 74 --11292 --
NM_014034chr6----11229 --
NM_014055chr121227 ------
NM_014253chrX42485 1698 424 130 --12405 --
NM_014283chr121305 492 --1370 --
NM_014319chr1211751 ----11493
NM_014320chr6----1140 --
NM_014342chr111142 --192 --
NM_014415chr3----11354 --
NM_014423chr525178 4719 ----11423
NM_014445chr311546 --1194 11652
NM_014562chr2297 86 ------
NM_014587chr1651517 1469 1286 299 108 --11308 --
NM_014613chr523013 2075 --11015 --
NM_014634chr2232532 2486 1164 13040 --1948
NM_014647chr16--11676 1588 --
NM_014661chr1033336 1487 1284 13011 31346 499 282 --
NM_014674chr353500 3108 2957 1292 1240 12740 1894 11117
NM_014686chr1952400 2366 2174 1593 232 --12480 --
NM_014730chr1274505 4336 3791 3334 2116 1635 737 --24670 3641 --
NM_014750chr14----1220 --
NM_014752chr11----21820 639 --
NM_014754chr82321 36 --1805 --
NM_014755chr2195 --54147 2930 2872 1061 165 --
NM_014757chr512043 11875 11538 --
NM_014767chr1063619 3551 3086 2510 1101 777 --12931 --
NM_014770chr122313 154 ------
NM_014824chr11----1178 --
NM_014838chr2212277 ----1157
NM_014844chr1474145 2919 1342 1298 1064 218 39 ------
NM_014848chr1512742 --12449 --
NM_014913chr181280 ------
NM_014918chr1521294 174 ----11442
NM_014926chr3----1235 --
NM_014991chr41625 --1765 --
NM_015033chr952968 1287 840 750 355 --1368 --
NM_015042chr1554241 3764 3529 3306 2848 --1876 --
NM_015044chr16----1401 1671
NM_015086chr1211236 --11540 --
NM_015156chr1451428 1249 1073 723 498 1157 1854 --
NM_015157chr11--11081 1790 --
NM_015158chr92199 94 ----1827
NM_015163chr1411291 ------
NM_015191chr111634 --11044 --
NM_015192chr2032845 2792 2484 --12470 --
NM_015206chr15--13628 1912 --
NM_015215chr112721 1815 12092 --
NM_015251chr163889 235 139 22323 2016 ----
NM_015254chr882225 831 557 507 316 310 290 211 22775 2296 22930 402 --
NM_015265chr262502 2476 2307 556 311 230 ------
NM_015310chr867993 3305 2885 1843 706 434 --16740 --
NM_015347chr1232793 2211 952 22225 2024 ----
NM_015459chr11----1337 --
NM_015460chr31629 1209 158 --
NM_015470chr21105 --1911 --
NM_015481chr123762 437 221 ------
NM_015488chr241759 1747 1522 1503 1465 11470 --
NM_015516chr1111185 --1294 --
NM_015526chr1911033 ------
NM_015527chr16----1808 --
NM_015541chr3------1376
NM_015554chr1521988 251 12927 --11895
NM_015567chr13----1113 --
NM_015568chr2022998 1252 --11631 --
NM_015576chr3--22969 743 ----
NM_015608chr10----139 --
NM_015627chr151801 1567 1459 1374 205 --11175 --
NM_015635chr952011 1897 1749 739 179 ------
NM_015651chr94859 221 166 120 --31691 1437 339 --
NM_015652chr101275 ------
NM_015872chr111375 ----11738
NM_015980chr5------11566
NM_015995chr1575028 4963 4944 4498 686 457 397 2595 302 11728 --
NM_016006chr3----1174 --
NM_016016chr17----175 --
NM_016081chr43716 251 183 21490 768 1535 --
NM_016087chr7----1692 --
NM_016131chr22766 478 ----1515
NM_016133chr2----1481 --
NM_016224chr61522 ------
NM_016271chr1811635 ------
NM_016279chr51375 ------
NM_016297chr2------1991
NM_016308chr1----1287 --
NM_016353chr8199 ------
NM_016422chr1111098 --12771 --
NM_016424chr1731403 531 248 ------
NM_016526chr1122033 534 --2759 54 --
NM_016623chr81406 ------
NM_017413chrX32529 2223 662 21965 654 11005 --
NM_017420chr14----23110 987 13610
NM_017423chr41544 --1271 --
NM_017433chr10----1561 --
NM_017514chrX----1172 1817
NM_017540chr522559 989 --22078 2017 --
NM_017544chrX----1718 --
NM_017546chr2----1875 --
NM_017551chr1032320 655 413 12178 12669 --
NM_017596chr144020 3871 3600 3120 --11487 --
NM_017644chr314030 14359 23591 130 14487
NM_017686chr1------1986
NM_017728chr17----11140 --
NM_017736chr16----12575 --
NM_017741chr452221 936 799 552 86 --12746 --
NM_017744chr11438 --12206 --
NM_017755chr5----1517 --
NM_017762chr1512413 --1652 --
NM_017772chr621624 32 1404 ----
NM_017778chr831327 1169 1018 --11289 --
NM_017784chr3----11177 --
NM_017799chr1431675 1576 1373 --11691 --
NM_017813chr825721 942 15203 15627 13885
NM_017831chr1814128 11159 14259 --
NM_017851chr154912 430 382 155 ----144
NM_017896chr2012339 11343 12603 --
NM_017902chr1065743 5238 4172 2205 612 432 ----35150 4093 1301
NM_017905chr134532 266 54 37 ------
NM_017966chr1121363 227 --11280 --
NM_018023chr331528 1352 298 ------
NM_018061chr1----1150 --
NM_018071chr141228 --1191 --
NM_018120chr8----1505 --
NM_018121chr1022489 962 --22836 2632 --
NM_018179chr12------1635
NM_018201chr922365 912 ----1741
NM_018202chr12280 61 --1694 --
NM_018206chr16----186 --
NM_018214chr61881 ----1158
NM_018226chr22282 80 --150 --
NM_018243chr453017 2726 1496 645 300 13782 ----
NM_018290chr4------1296
NM_018323chr4--2736 466 11539 --
NM_018361chr814076 22556 1299 1935 --
NM_018364chr143398 3237 1091 347 --12569 --
NM_018439chr1822149 407 --1317 --
NM_018482chr83828 172 53 ----1210
NM_018660chr862373 2318 2248 2042 865 817 --13003 --
NM_018715chr142240 1990 914 526 ------
NM_018898chr5----12200 --
NM_018953chr122638 70 --2143 57 --
NM_018970chr71541 1822 ----
NM_018979chr1212570 --22588 909 --
NM_019042chr711153 --1966 --
NM_019045chrX----1313 --
NM_019046chr101682 --1348 --
NM_019074chr15----1393 --
NM_019114chr9150 11863 139 --
NM_019594chr931356 1115 449 11447 ----
NM_019605chr1------1682
NM_020116chr4----1469 --
NM_020151chr221685 1485 --2509 367 --
NM_020159chr4------1395
NM_020179chr111163 ------
NM_020180chr1841375 1255 407 213 ------
NM_020182chr2042330 2221 960 59 --11135 --
NM_020231chr3----1676 --
NM_020246chr7----1257 --
NM_020336chr2012559 --13463 --
NM_020340chr611655 ----1863
NM_020360chr171534 ----1566
NM_020403chr13----11192 --
NM_020431chr1442618 1094 960 934 --12745 --
NM_020443chr175931 5765 5267 2483 1492 1446 1305 12307 12518 --
NM_020458chr21835 --3562 228 195 --
NM_020640chr33695 629 428 --12031 --
NM_020673chr2057373 7277 6533 5432 1098 16450 17315 11879
NM_020699chr164700 3860 1359 832 98 86 --13814 --
NM_020702chr91702 --11816 1749
NM_020708chr2032343 1894 457 --11001 --
NM_020713chr2043061 2719 2158 1240 ------
NM_020718chr1686158 5510 4975 4140 2059 1978 1149 1052 1187 ----
NM_020728chr732305 2229 2179 ----12556
NM_020747chr5--2939 94 --154
NM_020750chr61965 ------
NM_020752chr1042756 2366 1157 980 ------
NM_020764chr162910 77 ------
NM_020772chr1758036 5536 2250 1962 549 12271 16448 --
NM_020774chr1865641 4471 2397 1565 974 773 --24762 3928 --
NM_020796chr512267 --12816 --
NM_020832chr1----1498 --
NM_020839chr3----11221 --
NM_020845chr1232283 1711 781 ------
NM_020850chr1643190 2280 976 875 --22924 255 12407
NM_020854chr18178 --1499 --
NM_020856chr1921269 544 ------
NM_020870chr4----1221 --
NM_020898chr12----1681 --
NM_020918chr10----21236 141 --
NM_020958chr14----1379 --
NM_021012chr1752556 2356 2041 1142 781 ----11027
NM_021020chr843340 3135 2250 407 --12288 --
NM_021033chr1322810 988 12644 ----
NM_021079chr1723025 2600 --11066 --
NM_021155chr1943021 1071 862 212 --12354 --
NM_021158chr201846 --1100 --
NM_021161chr14------183
NM_021190chr1----11053 1307
NM_021198chr251248 1069 538 364 132 --41461 1095 402 213 --
NM_021202chr201591 --12326 --
NM_021205chr152232 2033 1974 478 157 ----12820
NM_021220chr20----1349 --
NM_021808chr121228 --1261 --
NM_021813chr611461 15339 ----
NM_021938chr19------1269
NM_021943chr62703 203 --1489 --
NM_021958chr1--1320 ----
NM_021961chr1197424 6974 6714 6442 5096 4942 2763 2439 1361 16345 25884 5006 14661
NM_022044chr22145 --198 --
NM_022049chr11175 1386 1401 --
NM_022055chr2----187 --
NM_022060chr1411370 --1911 --
NM_022066chr17----2738 388 --
NM_022075chr13968 351 154 ----1387
NM_022123chr141195 --1109 --
NM_022133chr8----11161 --
NM_022152chr211090 --11111 --
NM_022166chr1686364 5729 5288 2100 1752 1672 1474 183 --11853 16187
NM_022365chr10------1107
NM_022371chr1131 ----1275
NM_022459chr1335658 2079 951 1895 1313 --
NM_022463chr1721259 1172 --1133 --
NM_022483chr5--11252 --11211
NM_022658chr12----11131 --
NM_022719chr2222888 1542 13381 ----
NM_022749chr821321 294 ------
NM_022753chr142760 2228 774 630 12439 ----
NM_022764chr1611803 11701 ----
NM_022776chr31496 ----11317
NM_022825chrX2275 211 ------
NM_022842chr332716 579 22 --1428 --
NM_022893chr212092 12838 1730 --
NM_022894chr2--1278 1622 --
NM_022898chr1424004 3974 --23503 1603 --
NM_023010chrX----176 --
NM_023012chr12------1795
NM_024007chr51735 12102 --1540
NM_024034chr201267 --1990 --
NM_024092chr112792 362 ------
NM_024328chr142535 70 ------
NM_024496chr14----1821 --
NM_024503chr1----1166 --
NM_024528chrX----1117 --
NM_024539chrX------11017
NM_024607chr873965 3346 3114 2901 1735 1104 818 --24378 227 --
NM_024613chr82169 134 ----1493
NM_024646chr12430 221 13804 23263 3069 --
NM_024667chr1221443 1378 ------
NM_024704chr201163 --138 --
NM_024779chr121347 --1282 --
NM_024835chr17----155 --
NM_024884chr1433935 699 467 ------
NM_024920chr4----1982 --
NM_024926chr7----1240 --
NM_024944chr2111243 ------
NM_024979chr1321518 115 ------
NM_024989chr248124 2991 2827 845 11232 26780 1925 --
NM_025074chr432733 2699 2471 ------
NM_025083chr151707 160 ----
NM_025181chr2193 1260 1634 --
NM_025201chr1511416 11668 12079 --
NM_025204chr221770 --1372 --
NM_025251chr82206 154 --1288 --
NM_030576chr1711741 --1312 --
NM_030625chr10127 ----11836
NM_030661chr71497 --1454 --
NM_030791chr141409 --1751 --
NM_030802chr172568 195 --143 --
NM_030805chr211107 21178 510 1236 --
NM_030806chr176520 6355 6242 6220 6084 2538 2049 38286 5946 2849 27694 2505 --
NM_030935chr71334 --126 --
NM_030958chr8----171 --
NM_031307chr11----1265 --
NM_031426chr9--1162 ----
NM_031435chr12------1195
NM_031445chr222686 870 --12895 --
NM_031458chr3----1164 --
NM_031904chr1141418 736 459 309 --1420 12062
NM_031934chr17------1332
NM_031942chr2126 --1951 --
NM_032102chr1142035 834 695 412 ------
NM_032109chr51284 --11323 --
NM_032121chrX--1362 --22701 162
NM_032139chr19----11089 --
NM_032144chr2--11127 138 --
NM_032199chr101623 --13293 --
NM_032228chr11--1347 12678 --
NM_032229chr13----11145 174
NM_032256chr121187 --1312 --
NM_032312chr2----1136 --
NM_032431chr111733 ------
NM_032449chr112632 --2806 662 --
NM_032457chr412812 --12670 --
NM_032458chrX--12881 12775 12524
NM_032491chr12----2975 284 --
NM_032539chrX----1546 --
NM_032557chr4----1767 --
NM_032575chr161598 --11925 --
NM_032802chr151169 --1194 --
NM_032804chr1031842 403 271 --11595 --
NM_032810chr10----11242 --
NM_032900chr1053772 2523 1375 990 970 --1190 --
NM_032927chr41119 --1513 --
NM_032932chr1775919 5527 5351 5105 3912 2105 575 --15409 --
NM_033049chr321208 237 --11289 --
NM_033087chr9------1325
NM_033118chr201312 --1865 --
NM_033129chr2021961 189 11634 21568 260 --
NM_033200chr22----1431 190
NM_033226chr161678 ------
NM_033238chr15----21903 471 --
NM_033259chr31619 --1795 --
NM_033260chr61713 1305 --1130
NM_033274chr543155 2543 794 162 --13592 --
NM_033285chr831547 1069 182 --14168 --
NM_033389chr1753372 3177 1668 542 414 --14535 --
NM_033656chr2121854 1287 ----1879
NM_044472chr1----1108 --
NM_052848chr1921528 1497 1351 ----
NM_052876chr1952732 2102 611 505 215 --1477 12304
NM_052880chr221116 ------
NM_052905chr21182 ------
NM_052964chr4142 --184 --
NM_053025chr311685 --11139 --
NM_057175chr41120 ----12452
NM_058172chr421429 147 1503 --1556
NM_080670chr5----1111 --
NM_080671chr231924 1663 196 --12100 --
NM_080836chr2063502 3277 1507 1192 937 847 ------
NM_080867chr1434412 3903 3648 --11868 --
NM_080872chr833932 2803 73 ------
NM_130459chr921172 263 ------
NM_130847chr1145672 5332 3600 2327 ----15839
NM_133171chr201274 --175 --
NM_133264chr1743825 2409 1162 286 12694 1307 --
NM_133265chrX23650 3548 ------
NM_133443chr1642096 862 173 145 --21964 157 --
NM_133445chr913147 --1823 --
NM_133452chr19146 --1349 --
NM_133465chr9----1298 --
NM_133496chr134394 3807 3420 --1604 --
NM_138357chr1021231 48 --11454 --
NM_138401chr19----1257 --
NM_138473chr12114877 4815 4506 4069 3980 3629 3137 1924 358 235 187 24155 530 14526 --
NM_138689chr111263 ------
NM_138782chr52822 795 --1763 --
NM_138799chr221276 685 31481 385 202 ----
NM_138959chr154998 1435 1419 503 323 32546 526 306 14795 --
NM_139207chr12----1409 --
NM_144579chr232066 1191 920 --12905 --
NM_144582chr242619 2607 2315 1015 1494 ----
NM_144599chr1545250 4692 4578 3940 13486 1664 --
NM_144607chr1741930 664 167 93 --163 --
NM_144628chr202674 148 1888 11202 --
NM_144664chr11--11826 1682 --
NM_144710chr2------11189
NM_144775chr1744654 1474 670 194 --13916 --
NM_145012chr101899 --1765 --
NM_145266chr5----1329 --
NM_145268chr7----2296 274 --
NM_145284chrX3817 338 280 11995 1938 --
NM_145303chr61490 --141 --
NM_145313chr102488 380 ----1417
NM_145648chr12------1175
NM_145798chr172816 769 --1340 --
NM_145805chr152496 97 ------
NM_145808chr722161 2155 1466 ----
NM_152247chr222300 229 ------
NM_152277chr5----1661 --
NM_152280chr133069 2731 2660 12622 ----
NM_152348chr172847 616 --1671 --
NM_152420chr91669 1620 1114 --
NM_152450chr1511964 ------
NM_152470chr1841393 574 539 81 13811 13253 --
NM_152536chr31414 --1866 --
NM_152594chr15----11477 --
NM_152660chr1----1811 --
NM_152678chr322085 929 --22677 468 --
NM_152695chrX32182 1645 819 ----12004
NM_152723chr11----11134 2228 54
NM_152744chr753154 3043 2754 821 325 12286 2942 923 --
NM_152758chr8----12104 --
NM_152787chrX32567 678 642 11527 1859 --
NM_152835chr1----12399 --
NM_152857chr6----11042 --
NM_152860chr1231263 1228 242 --11405 --
NM_152914chr1721334 862 --12732 --
NM_153020chr61343 ----11086
NM_153029chr1644126 4003 2999 585 2851 407 14139 --
NM_153226chr101432 ------
NM_153260chr15------11303
NM_153261chr1611152 --21320 467 --
NM_153262chr12677 565 13097 11197 --
NM_153367chr1033260 3199 1601 1729 13424 13940
NM_153371chr13----12336 --
NM_153605chr311362 --11613 --
NM_153607chr51471 --1604 --
NM_153689chr221816 478 --22290 633 --
NM_153712chr263206 2824 2814 1022 316 23 ----22591 343
NM_153757chr41893 --21057 883 --
NM_153810chr1023954 3689 --1602 --
NM_172020chr721400 585 --11283 --
NM_172037chr8----11299 --
NM_172069chr211675 --1439 --
NM_172071chr135924 2880 293 ------
NM_172240chr121508 --11264 --
NM_173078chrX----154 --
NM_173354chr2121774 1561 --21676 1390 --
NM_173468chr422154 1698 --1386 --
NM_173515chr6----148 --
NM_173552chr31428 --12464 --
NM_173576chr10----1258 --
NM_173582chr1114068 --21623 708 --
NM_173595chr1274588 4524 4200 3915 3287 2099 1226 ------
NM_173653chr31157 --11086 --
NM_173698chrX----1537 --
NM_173808chr12477 127 13568 1616 --
NM_174934chr1163623 3504 3120 1058 765 88 ----11245
NM_175630chr21310 --1734 --
NM_175839chr202252 77 --1269 --
NM_175854chr13----11077 --
NM_175884chr731406 183 21 --11461 --
NM_175902chr172131 49 ----1283
NM_178314chr122188 27 --1801 --
NM_178423chr7----11231 --
NM_178562chr73621 315 190 ------
NM_178815chr1041993 1110 556 273 --12496 --
NM_178818chr16--1391 ----
NM_178835chr41786 --1678 --
NM_178864chr112711 511 ------
NM_181358chr1--11677 13997 11632
NM_181670chr12172 --132 --
NM_181671chr171108 --1129 --
NM_181877chr1521303 286 --1449 --
NM_182540chrX--1177 ----
NM_182557chr1121780 1462 --32252 1890 596 --
NM_182663chr131563 528 111 --12185 --
NM_182760chr31145 --1750 --
NM_182765chr1012019 --161 --
NM_182830chr14----1823 --
NM_182920chr331024 580 298 ------
NM_182970chr2054036 3397 1700 1163 698 ------
NM_183057chr8160 ------
NM_194247chr223317 1652 ------
NM_194285chr11159 --12372 --
NM_194314chr131096 1013 515 11976 13913 --
NM_194318chr132633 21 --11748 --
NM_197941chr5--21992 888 42394 2058 1147 27 --
NM_198504chr3----1955 --
NM_198511chrX----1172 --
NM_198560chr373298 3172 3046 1321 1147 998 52 ------
NM_198904chr51721 ------
NM_198990chr7--13142 12912 --
NM_199320chr412715 12151 12921 --
NM_199344chr1----1102 --
NM_203290chr61171 ------
NM_203349chr1521583 1525 --1351 --
NM_206538chr193356 156 28 --1376 --
NM_206853chr614093 23861 3465 --1624
NM_206914chr1232146 2121 551 11467 181 --
NM_207313chr171767 1806 ----
NM_207325chr19------11675
NM_207346chr171278 --1262 --
NM_207411chr81252 --13120 --
NM_207647chr942486 701 360 32 --11983 --
NM_213589chr223807 1589 14725 25336 4429 --