TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-525-5p
miRNA Sequence: CUCCAGAGGGAUGCACUUUCU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr521536 753 1139 ----
NM_000084chrX106179 5942 5054 5048 4556 2257 2187 2048 622 95 1954 24447 1368 24427 164
NM_000088chr1711140 ----1131
NM_000091chr21183 12015 --22589 1991
NM_000109chrX42394 1947 1868 1833 --12323 --
NM_000111chr7------1129
NM_000125chr693619 3526 2856 2837 2796 2756 2650 1183 691 --11634 12596
NM_000141chr1041251 1129 1039 206 ----11345
NM_000165chr631687 1357 397 11400 ----
NM_000228chr1------1373
NM_000245chr732120 825 265 ------
NM_000252chrX--2580 220 1404 --
NM_000259chr1545855 4145 1703 1080 16022 13910 24441 167
NM_000264chr942421 2262 2050 236 12725 ----
NM_000266chrX2210 26 ----3756 377 178
NM_000314chr1022592 615 12571 1551 12280
NM_000318chr842291 2245 2002 332 ----1342
NM_000330chrX52058 1668 1618 1428 645 11651 ----
NM_000332chr696409 6373 6190 5936 4915 2877 2662 2246 1201 1578 14365 --
NM_000333chr331153 1098 714 --21052 75 --
NM_000346chr1731883 1496 371 --186 --
NM_000368chr994427 4387 4203 3317 3061 1649 693 662 166 --1136 --
NM_000369chr14----1155 11858
NM_000393chr232135 1506 648 11342 ----
NM_000411chr2153112 2561 870 444 166 22790 51 12734 1186
NM_000430chr1753352 3012 2593 1446 117 --21300 40 13005
NM_000437chr12699 186 21488 227 1690 --
NM_000474chr7----192 --
NM_000478chr12229 194 1672 --1165
NM_000493chr61820 ------
NM_000522chr71870 1366 ----
NM_000525chr1121286 159 21548 587 21073 333 --
NM_000533chrX41519 469 445 405 --1168 --
NM_000538chr1311744 ------
NM_000539chr321278 217 1305 --11024
NM_000555chrX64860 2456 1910 755 553 234 35268 2910 728 36891 449 181 --
NM_000572chr13648 337 66 ----2963 75
NM_000573chr131952 321 284 1698 ----
NM_000615chr1162838 2162 2039 1000 751 630 1957 12763 --
NM_000618chr1246037 5463 4862 4192 15083 --181
NM_000633chr1884583 4342 4064 3960 3477 3299 814 454 34777 3317 1089 24489 1401 31754 874 296
NM_000721chr141073 807 633 391 ------
NM_000767chr19----11499 --
NM_000809chr499323 7003 6661 6459 2691 1990 1577 1256 432 37522 3663 2011 --29243 1555
NM_000813chr522055 659 24882 303 11233 15488
NM_000814chr1563731 3666 3467 1591 1390 562 13310 ----
NM_000828chrX------1660
NM_000829chr111106 1260 1559 --
NM_000833chr16157 ------
NM_000838chr612247 ----1242
NM_000844chr331115 187 78 ----1738
NM_000870chr531364 569 270 11581 11150 11609
NM_000875chr1586552 5968 5539 5454 5155 4574 4542 1819 36688 6517 2256 46955 6671 6009 1527 35383 4362 1964
NM_000880chr8------1901
NM_000885chr22659 97 11399 12017 --
NM_000891chr1763550 3521 2920 2408 1294 1061 13022 23544 640 122
NM_000899chr1263391 3098 2961 2834 1582 103 23476 478 23229 2824 --
NM_000908chr5----1608 --
NM_000944chr432367 2294 1773 --1124 --
NM_000945chr2----11710 11657
NM_001001323chr121703 1274 22517 389 --
NM_001001395chr1242818 1788 846 282 ------
NM_001001396chr133968 1329 627 --23506 2928 13450
NM_001001484chr1021955 619 ------
NM_001001521chr2------1260
NM_001001548chr7156 1408 ----
NM_001001557chr82782 522 11452 21824 335 --
NM_001001664chr242807 1406 1143 1021 13022 13092 11070
NM_001001668chr1974042 3642 3524 3267 979 598 91 ----13495
NM_001001787chr13199 135 118 ------
NM_001001890chr2143807 3226 721 659 --11177 --
NM_001001938chr993446 3167 2707 1578 961 572 377 327 259 54132 3423 2630 1654 1244 24117 334 --
NM_001001995chrX41666 1438 655 256 --1500 --
NM_001002006chr22682 339 1146 --1122
NM_001002762chr102635 76 12523 --12913
NM_001002814chr873880 3861 3826 3305 2779 2720 933 12986 23135 2827 --
NM_001002843chr15--41035 876 416 48 11209 --
NM_001002860chr1444215 3760 1175 753 13229 12952 14178
NM_001002909chr1742101 1744 510 379 ------
NM_001003681chr2231529 319 90 --12010 --
NM_001003688chr421041 340 ----126
NM_001003698chr631684 317 82 ------
NM_001003805chr14------171
NM_001003940chr1563798 3729 3326 2963 2462 691 147 --43745 3621 1211 341
NM_001004065chr933933 1043 29 33869 3310 2852 2341 190 13108
NM_001004317chr634404 3747 3525 34375 3981 691 24442 607 --
NM_001004329chr1231143 444 54 --1109 --
NM_001004419chr1254151 3809 3795 1409 1376 11002 1524 --
NM_001005266chr151192 ------
NM_001005336chr91595 ------
NM_001005366chr122172 50 ------
NM_001005386chr231884 853 136 12422 --11755
NM_001005417chr12494 170 --1216 --
NM_001005463chr1011775 11851 --12343
NM_001005473chr566413 5141 5038 4604 4090 678 26116 2652 ----
NM_001005476chr2------1630
NM_001005611chrX----1367 --
NM_001005739chr2166 --1270 1249
NM_001005861chr3--1333 1267 1794
NM_001006115chr341727 783 774 114 32615 1903 1848 42709 2360 2051 435 --
NM_001006600chr51296 32182 1501 582 ----
NM_001006638chr1721139 384 11240 129 --
NM_001006684chrX1151 --1591 --
NM_001007027chr11------184
NM_001007156chr1561747 1603 1469 1447 1258 783 --190 1685
NM_001007226chr1721111 228 ------
NM_001007255chr1------1120
NM_001007271chr102870 90 ------
NM_001007277chr112849 279 ------
NM_001007559chr181797 2273 110 ----
NM_001008220chr562863 2608 963 526 509 390 11048 --11039
NM_001008222chrX61359 1140 875 427 345 118 ------
NM_001008239chr1842452 2358 806 746 --23738 1516 --
NM_001008392chr353443 2822 2738 2304 46 32892 2336 698 13033 22767 39
NM_001008410chr211947 --22158 22 12189
NM_001008539chr855100 5067 4466 1884 142 --11254 11284
NM_001008564chr131547 11387 --1131
NM_001008567chr91371 --1280 --
NM_001008701chr1972879 2158 2148 1231 810 790 64 --12806 --
NM_001008738chr532808 2665 2153 --12763 --
NM_001008744chr1441562 567 538 314 2332 220 ----
NM_001008777chr17--1448 --1214
NM_001008925chr423116 2979 1433 1658 --
NM_001009899chr366071 5636 5549 5251 5053 4593 16452 14774 13954
NM_001010888chrX44406 4027 3874 1594 24207 3824 11498 --
NM_001010908chr102653 574 ------
NM_001010924chr101196 1345 --11064
NM_001010984chr141830 1678 762 74 22575 2399 ----
NM_001011553chr71302 ----1348
NM_001011666chr756284 1991 1181 244 223 ------
NM_001012279chr6----1481 --
NM_001012755chrX84887 4366 3502 3315 3250 1778 1023 75 ----22000 352
NM_001012968chrX3940 532 522 22516 2303 ----
NM_001013031chr1042563 886 497 185 1327 --11179
NM_001013438chr3151 2619 279 ----
NM_001013635chr124983 433 169 40 --1259 --
NM_001013642chr13358 307 183 --1191 --
NM_001013843chr151153 ----1794
NM_001014380chr1365406 3986 1953 1458 462 26 23707 84 --15109
NM_001014797chr10127874 7350 7310 7157 5059 3165 2876 2799 2674 2608 2261 1668 34968 2371 312 25139 1544 --
NM_001015053chr1741616 1051 445 332 --124 --
NM_001015877chrX52535 2248 986 687 302 1225 ----
NM_001015880chr10------11373
NM_001015881chrX11235 --1196 --
NM_001017368chr1741004 586 437 55 --31864 1775 515 1691
NM_001017369chr43274 100 74 ------
NM_001017395chr382748 1052 868 524 475 403 287 35 ----13291
NM_001017423chr101135 --1781 --
NM_001017424chr121229 322 1158 11443 --
NM_001017926chr811821 --11185 --
NM_001017989chr192848 42 --21276 1059 1286
NM_001018025chrX------1258
NM_001018050chr2243472 3238 2718 318 ----11388
NM_001018054chr11908 --158 --
NM_001018056chr9----1204 --
NM_001018065chr9105589 5508 5224 5060 4358 4001 2251 1458 297 105 ------
NM_001020658chr11650 ----11701
NM_001023560chr61384 2885 433 1169 --
NM_001023587chr34811 444 170 143 1452 2956 51 1964
NM_001024845chr12695 340 --3871 254 187 --
NM_001024956chr1132210 1797 780 31348 706 122 54156 4056 3850 1845 617 13946
NM_001025076chr1055049 4211 1987 1577 1520 21460 235 --16258
NM_001025233chr1232659 2652 234 --1460 --
NM_001025252chr832691 2539 2533 2514 334 ----
NM_001025580chrX43893 3054 1469 781 23396 3083 --11523
NM_001029863chr652689 2494 2041 1976 758 12679 21163 357 1790
NM_001030007chr1683581 3413 3340 2873 2848 2578 326 212 ----153
NM_001030055chr1494708 4246 3969 3609 3362 1059 439 388 33 --11079 --
NM_001031684chr231375 1186 122 11387 1443 --
NM_001031695chr2285023 4559 4044 3671 3480 1693 518 498 23880 679 34017 1979 765 --
NM_001031804chr1653779 3440 1320 804 505 14281 11461 --
NM_001031812chr511993 ------
NM_001032280chr621638 638 ------
NM_001032283chr1221022 885 --1187 1238
NM_001032363chr122042 262 11399 21544 669 1185
NM_001032367chr151255 1191 --179
NM_001033057chr3--1231 ----
NM_001033059chr611523 2825 526 --11446
NM_001033081chr151596 1200 237 228 109 51916 1630 1575 1440 1310 31433 687 420 11485
NM_001033117chr364791 4688 3431 1637 1512 457 31119 584 120 24293 3647 14441
NM_001033506chr111416 ------
NM_001033518chr742748 1964 1922 1897 ----22608 589
NM_001033557chr221357 511 ------
NM_001033575chr2162 1362 ----
NM_001033602chr1322591 1831 ----1640
NM_001033925chr102514 145 21934 122 1525 --
NM_001034837chr5--1247 --1127
NM_001034850chr531654 1617 1411 --1580 --
NM_001034954chr1031989 962 861 32051 878 246 1751 12674
NM_001037164chr721429 43 21480 550 ----
NM_001037334chr181707 1118 2957 191 1662
NM_001037582chr421479 55 ------
NM_001037954chr1142698 1313 1088 218 32409 2157 337 21379 722 --
NM_001038702chr51920 1366 2162 140 --
NM_001038707chr152215 2156 1718 336 176 1876 22198 1449 --
NM_001039350chr731725 1509 1337 11708 ----
NM_001039465chr14184 1120 1396 --
NM_001039538chr232719 1404 876 --22917 2813 --
NM_001039570chr2264095 4082 3683 1390 1313 736 14678 24477 3634 --
NM_001039590chrX1994 11342 1861 --
NM_001039618chr1165081 3698 1651 1165 619 484 32363 2170 398 14110 --
NM_001039711chr15843 362 334 66 23 --150 --
NM_001039716chr1170 149 1360 --
NM_001039840chrX34632 4557 4411 22163 67 ----
NM_001039877chr19----1890 --
NM_001040002chr1751293 1176 941 508 372 1272 --1406
NM_001040057chr71329 1112 11518 1226
NM_001040110chr711332 2190 153 --1100
NM_001040135chr71725 ------
NM_001040151chr111730 --1602 24513 3275
NM_001040152chr754192 3572 1459 145 136 14312 11305 --
NM_001040260chr42914 195 11007 3785 371 182 1361
NM_001040272chr9----11945 --
NM_001040450chr1522683 740 ----12351
NM_001040455chr1151294 1218 487 445 291 --11123 --
NM_001040624chr812084 21944 896 1477 22494 660
NM_001040653chr351785 1679 831 94 65 1132 1243 --
NM_001040876chr4------1106
NM_001042410chr2------1177
NM_001042475chr6------1209
NM_001042533chr342244 1037 758 348 12691 --1319
NM_001042537chrX2766 499 12016 12330 --
NM_001042555chr1254248 1599 860 811 294 22926 1005 24611 4435 --
NM_001042599chr286477 6050 5671 4995 2729 2644 1130 70 17302 --15370
NM_001042601chr332207 896 710 --22510 634 1917
NM_001042603chr1255371 4780 4622 3581 209 15313 23943 1090 --
NM_001042632chr2072519 1941 1915 839 513 367 315 --1324 --
NM_001042681chr162161 2093 1984 1759 1023 198 1431 ----
NM_001043318chr1431479 1296 111 13628 21470 872 --
NM_001043351chr142102 1993 1985 862 1386 1617 1216
NM_001049chr1452295 2129 2114 747 246 --21862 773 12358
NM_001077628chr1178 ------
NM_001095chr1241939 1555 1500 1209 1402 21923 394 11815
NM_001100108chr1138079 7441 6941 6089 5449 5409 5377 5366 5195 2948 2935 1673 376 46980 5295 2838 2441 15910 11799
NM_001106chr3199366 7501 7393 7319 7046 6879 6613 2942 2745 2177 1852 1725 1687 1676 1135 797 623 318 184 59538 8811 2080 667 76 57929 3808 2807 2666 2207 19080
NM_001123chr10----1573 --
NM_001146chr842122 2033 927 161 1309 --1419
NM_001187chr21----1131 --
NM_001206chr932789 450 128 22749 1150 ----
NM_001215chr1--1113 --1372
NM_001222chr1031810 442 394 --166 1512
NM_001259chr796263 4711 4619 3999 2515 1012 621 127 103 21715 808 ----
NM_001270chr5126 ----1929
NM_001290chr41282 ------
NM_001292chr151409 ------
NM_001304chr1783689 3537 3203 3077 2787 2716 268 111 ----11099
NM_001362chr142746 344 --1693 --
NM_001364chr1163828 3741 3676 3079 1680 220 11001 21638 503 14197
NM_001379chr192201 29 ------
NM_001390chr1863626 3245 1354 1345 1071 725 ----22512 1458
NM_001408chr121463 1388 --1225 1431
NM_001419chr1924095 468 1980 33686 3280 282 1149
NM_001429chr22----11054 --
NM_001447chr551278 1247 1208 909 404 ------
NM_001453chr621654 1594 ------
NM_001491chr662173 2127 2055 462 210 202 22568 799 ----
NM_001495chr851199 828 813 498 241 --4419 356 305 160 --
NM_001498chr631290 150 114 --1277 --
NM_001526chr6------1140
NM_001616chr21289 ----22920 157
NM_001659chr1232516 2320 693 --2916 288 12634
NM_001663chr1411767 12410 1117 --
NM_001664chr31382 1691 --1858
NM_001668chr142286 2258 1401 139 2879 370 11768 1505
NM_001678chr1761363 1307 1264 670 465 277 --11245 --
NM_001693chr821255 374 ------
NM_001703chr1------168
NM_001709chr1141764 874 794 646 ------
NM_001742chr731632 666 175 --1390 --
NM_001743chr2----1228 --
NM_001759chr12105321 4718 4536 3344 1890 1124 1111 1094 1077 61 --11268 14051
NM_001806chr1952487 1160 827 726 496 42130 904 267 132 --12988
NM_001834chr5167 ----1315
NM_001854chr12555 276 ------
NM_001859chr973597 3047 2981 2446 1410 821 547 12950 13570 --
NM_001860chr911172 1827 11072 --
NM_001897chr15----4927 918 790 322 --
NM_001905chr11861 --179 --
NM_001939chrX63134 1498 926 665 519 447 23421 687 1132 21162 797
NM_001945chr551367 1183 1140 307 208 11359 ----
NM_001946chr121984 3859 466 368 --1191
NM_001981chr132076 674 241 1321 ----
NM_002015chr1362974 2596 2502 2468 2336 959 32445 785 633 ----
NM_002017chr111398 --150 21219 1181
NM_002025chrX178452 7656 7603 7242 6960 6954 6891 6788 6236 3423 3338 3152 2375 1763 1371 1070 103 26113 881 46854 6175 2975 2441 --
NM_002069chr711602 1117 1638 1366
NM_002088chr192357 139 --2377 170 --
NM_002099chr411675 ------
NM_002107chr11331 ------
NM_002131chr651346 1301 935 401 118 149 2970 354 --
NM_002148chr22673 161 ----1702
NM_002160chr91573 ------
NM_002207chr31711 171 1227 1485
NM_002233chr11----1458 --
NM_002247chr1051764 1732 1719 399 232 --1529 1669
NM_002264chr341666 1298 1063 768 54938 4056 1634 792 164 1256 11872
NM_002267chr1322064 382 ----1352
NM_002270chr575597 3814 2185 1761 1567 883 216 ------
NM_002271chr1372324 2308 2230 1798 1497 526 124 12267 12417 --
NM_002293chr131940 741 718 ------
NM_002334chr1162043 1812 1791 704 582 564 1521 ----
NM_002336chr1274882 3353 1183 634 601 356 68 --24126 1806 --
NM_002351chrX21320 1262 11643 ----
NM_002355chr12----11278 --
NM_002356chr622578 81 --12830 --
NM_002359chr1794097 3785 3617 3283 2989 2707 1618 1530 1210 13364 23327 2743 13404
NM_002375chr352069 1609 629 501 376 --11518 --
NM_002398chr211464 --1417 --
NM_002399chr15------1546
NM_002430chr2252359 1971 1611 890 834 1521 21643 932 --
NM_002442chr1251652 586 357 296 267 --11364 --
NM_002448chr4----1544 1693
NM_002493chr91214 176 ----
NM_002500chr2183 ----1158
NM_002501chr1954001 2621 1520 1189 380 --23490 1252 --
NM_002505chr641290 626 598 425 11148 --11515
NM_002515chr1411704 --11433 --
NM_002519chr111399 2603 378 ----
NM_002522chr173981 461 396 23871 3102 1888 23467 404
NM_002556chr1132014 857 705 --11933 --
NM_002577chr363867 3631 1600 1564 874 339 1919 ----
NM_002581chr985223 4663 1982 1545 1199 568 389 55 35160 3491 1301 ----
NM_002585chr11149 ------
NM_002591chr20------1481
NM_002641chrX31831 330 304 ------
NM_002645chr1122239 1238 23158 209 --125
NM_002655chr864872 4187 4041 3429 1975 1248 ----21357 171
NM_002657chr2053617 2660 2613 1096 402 13540 43682 3469 827 320 13399
NM_002660chr201263 --1203 174
NM_002699chr121358 1347 --192 --
NM_002718chr352667 2386 1962 640 155 1423 ----
NM_002720chr16135 ------
NM_002737chr1756467 4139 2420 2194 2045 26673 5790 14077 2806 424
NM_002738chr1641128 795 466 162 ------
NM_002745chr2294341 3244 3201 2885 1215 891 296 145 131 --11697 --
NM_002750chr10175 ------
NM_002752chr5------1371
NM_002763chr1----151 --
NM_002764chrX1207 1734 1896 --
NM_002815chr17----126 --
NM_002828chr182344 333 ------
NM_002840chr111016 --21383 471 --
NM_002848chr121189 --11136 --
NM_002857chr13930 392 49 12033 ----
NM_002868chr1252333 2215 918 875 837 --1214 --
NM_002869chr1121384 45 12030 --1770
NM_002874chr932113 1834 1606 170 --12310
NM_002892chr1421117 1084 ------
NM_002906chr1132381 1776 1587 1929 ----
NM_002938chr421665 1377 1327 21988 219 --
NM_002956chr1221083 948 ------
NM_002957chr9113789 3283 2949 1455 1302 1133 757 427 117 111 36 13473 13346 12896
NM_002971chr311024 ----1407
NM_002998chr842149 790 616 111 ----21500 483
NM_003010chr1722218 469 1908 --12344
NM_003030chr321787 281 ------
NM_003043chr333840 1608 1014 --13463 --
NM_003048chr242635 2391 2074 118 11981 11101 --
NM_003069chrX2595 257 ----1118
NM_003079chr172679 129 --1205 --
NM_003108chr232048 654 317 35518 4791 477 ----
NM_003112chr722872 657 4871 483 243 63 ----
NM_003130chr7------1183
NM_003131chr631758 1439 916 --12125 --
NM_003146chr111379 ----1418
NM_003152chr1721067 978 11254 --129
NM_003178chr32873 298 ------
NM_003221chr673574 3438 1632 1573 1356 748 228 1551 23957 3285 2317 97
NM_003239chr142796 657 21050 155 1713 --
NM_003246chr1531556 655 243 161 ----
NM_003274chr212409 78 21850 696 ----
NM_003288chr2021587 310 ------
NM_003292chr121443 656 --1219 --
NM_003304chr321503 1413 ------
NM_003339chr531318 644 296 ------
NM_003340chr411046 --1187 --
NM_003348chr1231588 215 131 21360 636 ----
NM_003367chr193456 438 375 ------
NM_003380chr10--1123 --1316
NM_003385chr2------1881
NM_003406chr821562 426 11241 1571 --
NM_003410chrX11117 21912 790 1635 --
NM_003411chrY21474 737 21533 1334 ----
NM_003418chr31683 ------
NM_003432chr52488 231 ------
NM_003458chr393714 3374 3033 2925 2743 2567 2474 1326 1111 12633 43084 588 90 64 --
NM_003468chr223553 309 --21258 961 --
NM_003469chr21485 ------
NM_003477chr112505 254 ------
NM_003478chr1153320 3148 2978 92 41 22573 2339 ----
NM_003489chr2173291 3076 2927 2843 2151 967 25 --1851 11241
NM_003507chr231500 758 201 2637 172 11990 --
NM_003508chr7------1307
NM_003566chr1232875 701 92 1138 1279 --
NM_003569chr61487 1728 1157 --
NM_003597chr241839 1786 1630 308 21965 553 12111 --
NM_003603chr41609 --11425 --
NM_003617chr134968 4081 4024 14379 1165 --
NM_003629chr143213 2563 424 31 21318 336 ----
NM_003633chr542388 2361 2159 821 ------
NM_003688chrX--1283 --1267
NM_003705chr2------1600
NM_003737chr112365 351 --1426 --
NM_003743chr23327 313 123 1763 ----
NM_003749chr1342240 784 537 106 1130 ----
NM_003750chr102892 793 2370 209 ----
NM_003796chr191116 ----1581
NM_003798chr9------127
NM_003800chr622184 712 2585 360 ----
NM_003861chr1432278 452 446 22631 2477 11855 --
NM_003872chr262796 2681 1199 849 348 273 ----180
NM_003873chr1021776 839 1335 1389 --
NM_003884chr321546 592 ----11185
NM_003885chr175860 396 378 345 240 --1161 --
NM_003888chr152450 281 --11676 --
NM_003934chr921156 243 ----1232
NM_003939chr1043060 2976 2940 992 --13870 1572
NM_003947chr31104 1456 --11236
NM_003958chr641300 496 358 61 23154 1437 12798 --
NM_004050chr1422195 1009 --1711 2915 399
NM_004077chr121528 --1360 --
NM_004079chr142784 2282 877 742 ------
NM_004093chr132833 586 11981 11105 22724 2670
NM_004094chr1422657 1060 21219 413 ----
NM_004117chr61745 1119 ----
NM_004124chr1483544 3306 3130 2893 2522 2241 1058 523 13156 ----
NM_004180chr21137 ------
NM_004200chr1122957 2550 ----22379 214
NM_004205chr111163 --1371 1521
NM_004227chr743003 2740 2566 1942 --12406 --
NM_004277chr611227 1155 ----
NM_004296chr1463860 3434 903 810 394 376 23989 2570 33496 2977 2731 --
NM_004302chr1232728 2602 2317 --22722 2581 12485
NM_004311chr1011946 21925 752 32794 2170 614 --
NM_004316chr1211078 ----143
NM_004326chr15966 878 851 458 131 --1345 --
NM_004331chr821832 1726 12289 1588 1921
NM_004337chr821840 87 ------
NM_004376chr1031357 1211 482 --1342 --
NM_004389chr22679 102 ------
NM_004392chr132966 930 12284 ----
NM_004393chr33892 195 159 --11880 --
NM_004412chr1063692 2309 1539 1212 134 86 46024 6004 5977 2218 ----
NM_004426chr1221635 1233 11583 1199 --
NM_004430chr822197 1799 ------
NM_004431chr11737 ----1853
NM_004438chr253149 2749 2584 948 677 2767 364 ----
NM_004440chr6--11999 1477 --
NM_004441chr331336 1067 864 ------
NM_004442chr121207 1118 --1596 31455 544 373
NM_004454chr332151 1950 122 2783 251 1142 --
NM_004460chr21188 --1234 --
NM_004480chr141692 ------
NM_004494chr12363 50 --1372 11279
NM_004501chr153645 3383 2687 1644 1150 --12524 11406
NM_004529chr931151 1002 955 11076 ----
NM_004554chr141606 11511 21437 375 --
NM_004588chr1143127 2927 1166 921 13849 --23367 209
NM_004598chr543280 625 593 230 33261 792 135 ----
NM_004635chr31183 --1952 1768
NM_004643chr142751 186 --1239 --
NM_004663chr1551576 1012 606 500 237 ------
NM_004685chr1342826 2336 1981 561 11900 --11181
NM_004705chr11--142 --1252
NM_004709chrX21322 145 ------
NM_004727chr1522002 611 ----11737
NM_004730chr531740 1604 182 11961 1238 --
NM_004744chr41115 --22691 1580 --
NM_004745chr815183 45338 5142 4765 1856 1315 15132
NM_004748chr1564147 1364 965 831 675 236 43680 901 842 332 ----
NM_004760chr73843 679 68 12507 1435 --
NM_004766chr3----183 --
NM_004768chr11244 ------
NM_004774chr1763078 2899 2194 517 507 197 ------
NM_004787chr4------129
NM_004789chr9----1341 --
NM_004798chr2063538 3445 2884 2565 600 528 12534 1431 1193
NM_004801chr221544 593 ------
NM_004824chr62349 305 1367 ----
NM_004834chr222612 2083 11015 1660 --
NM_004849chr61286 11427 --11127
NM_004852chr181212850 12520 12212 10284 9519 9212 4867 3350 3114 1259 822 806 412614 4701 2825 1855 312185 9991 4581 11529
NM_004865chr6--1446 1149 --
NM_004897chr102690 155 --1149 --
NM_004906chr6------1205
NM_004921chr131949 1912 1720 1160 2530 486 --
NM_004922chr103871 293 149 --3990 331 113 --
NM_004924chr1921045 227 --21062 929 --
NM_004926chr1431680 1666 216 ------
NM_004956chr783954 3257 3019 2952 1520 1437 685 679 1846 --1820
NM_004979chrX5980 900 850 816 398 --1418 --
NM_004981chr221114 ------
NM_004992chrX57009 6943 6730 5806 650 48037 5159 2792 2373 16472 15881
NM_005020chr73522 195 106 --1224 --
NM_005057chr121333 1206 --153 --
NM_005065chr1465263 4811 4039 3536 1833 858 45385 4132 509 261 --1694
NM_005066chr1--1177 ----
NM_005095chr15679 651 393 374 202 --2810 362 --
NM_005114chr42539 45 ------
NM_005124chr61889 2819 124 1963 --
NM_005137chr2231988 815 680 2402 31 4847 777 464 228 1615
NM_005157chr91664 --31587 1380 375 --
NM_005160chr2285912 5783 5508 4545 4396 1901 874 228 11453 16774 1554
NM_005206chr1711222 1513 ----
NM_005221chr71312 ------
NM_005225chr2021024 485 196 2411 147 --
NM_005238chr1142877 966 901 270 1427 22985 2970 11377
NM_005281chr14779 705 615 114 1684 ----
NM_005284chr6155 ----1114
NM_005316chr11------164
NM_005336chr242226 2031 725 295 21818 1421 --12220
NM_005342chrX62598 1915 1064 925 319 192 ------
NM_005380chr121254 95 --162 --
NM_005399chr133770 1701 56 33234 3194 3133 23561 1616 --
NM_005400chr272976 2895 2493 2142 2124 597 264 21156 1110 12277 1574
NM_005417chr2061774 1411 1394 1328 164 143 1486 21924 1275 1285
NM_005436chr1054008 2790 1242 90 80 23850 3539 13838 --
NM_005455chr161686 1199 1146 464 77 63 ------
NM_005465chr111669 ----1292
NM_005475chr1232892 1316 897 32384 2228 138 --12055
NM_005479chr104567 442 201 94 31459 188 103 1520 11060
NM_005517chr131343 453 34 ------
NM_005522chr73229 166 126 1302 ----
NM_005544chr2--11008 --1977
NM_005546chr522360 1534 12053 11633 1934
NM_005573chr5----1560 --
NM_005574chr11286 24 --1516 --
NM_005575chr51180 1300 1120 --
NM_005584chr131518 ------
NM_005596chr946264 4933 4778 2065 ----16194
NM_005599chr12287 158 1425 ----
NM_005603chr181543 11354 11958 --
NM_005604chr62947 727 22390 879 ----
NM_005668chr531690 1123 554 1538 ----
NM_005684chr1146 169 ----
NM_005725chr122053 1619 1231 --1675
NM_005730chr1273478 3409 3001 2629 2541 1245 471 33618 2822 544 22804 1284 13068
NM_005737chr262825 2700 1981 1086 799 509 --1605 12754
NM_005754chr531045 491 72 11253 ----
NM_005783chr22465 220 2424 210 ----
NM_005786chr182975 815 --1115 --
NM_005789chr1721691 242 ------
NM_005813chr232259 1027 635 12575 ----
NM_005839chr11672 2843 645 --1868
NM_005842chr13----1539 --
NM_005843chr2--21820 683 ----
NM_005862chr31273 128 ----
NM_005885chr521535 323 --166 --
NM_005906chr621386 1356 21098 103 ----
NM_005909chr533919 1516 443 1262 ----
NM_005920chr173580 3342 1223 753 677 348 189 --1202 33411 1304 742
NM_005927chr51300 2875 495 ----
NM_005935chr434728 3269 1783 --14822 --
NM_005937chr1762790 1348 1116 937 668 287 12834 1949 --
NM_005941chr843097 1508 1233 376 1608 1567 --
NM_005955chr165274 5156 5044 4621 1318 1026 25509 1243 11057 33409 184 27
NM_005966chr2------128
NM_005977chr13----1832 --
NM_005990chr542501 2304 2195 962 ----12755
NM_006037chr294710 4378 4061 3738 3575 3360 3354 693 276 ------
NM_006047chr2082920 2889 2447 1257 1217 1096 824 209 23338 3325 --12378
NM_006076chr763122 2420 2067 617 63 37 11992 ----
NM_006079chr61562 ------
NM_006080chr7--11903 1777 --
NM_006107chr17--158 1436 --
NM_006122chr1542232 1891 793 265 ----32792 880 486
NM_006133chr1141643 1552 560 306 1944 1929 --
NM_006135chr13577 551 405 ------
NM_006139chr222296 863 1306 165 --
NM_006145chr192353 57 ------
NM_006148chr1742905 1958 908 186 --31146 252 227 --
NM_006177chr144947 755 192 101 ------
NM_006185chr111580 ------
NM_006190chr2--2693 285 1241 --
NM_006194chr141334 ------
NM_006197chr832242 298 174 2687 325 ----
NM_006206chr431135 240 33 --2410 46 12017
NM_006212chr1115171 4908 3995 3775 3663 1905 1739 1733 717 624 269 13852 35205 1011 510 11727
NM_006237chr1361895 1798 876 655 320 91 --21642 909 --
NM_006243chr11118 ------
NM_006246chr143966 856 192 11221 1474 11033
NM_006251chr542565 1038 473 420 1117 --13136
NM_006259chr4------1103
NM_006281chr83462 71 33 ------
NM_006282chr2054590 1265 630 54 43 34418 2922 345 14770 14393
NM_006288chr111202 ----11227
NM_006306chrX83873 3720 3687 1227 837 204 171 30 44940 3787 3734 1098 45850 4797 815 61 --
NM_006327chr10169 ------
NM_006357chr2----1131 --
NM_006393chr1023972 219 31189 1168 280 1164 23258 366
NM_006431chr12----128 --
NM_006494chr192316 288 --4896 888 784 233 --
NM_006496chr111587 21725 1227 ----
NM_006517chrX22199 1895 22339 231 1289 1261
NM_006521chrX21242 902 --11329 --
NM_006534chr2043424 2876 2224 275 ------
NM_006540chr831090 445 66 ----11059
NM_006546chr1786546 6210 5818 5142 4760 4058 2157 1910 --14649 --
NM_006547chr742006 1809 828 719 ------
NM_006599chr1686255 5916 5713 5202 5157 1920 1411 939 11956 38155 1877 674 16291
NM_006618chr121430 480 1283 --1340
NM_006622chr5----1185 --
NM_006624chr1022083 1823 ------
NM_006633chr5139 --1258 1780
NM_006699chr132650 2247 308 11082 1658 1376
NM_006729chrX64789 4741 3507 1066 599 473 1517 11346 --
NM_006750chr1687892 7808 7339 6949 6348 5771 5731 862 27636 2307 ----
NM_006756chr821139 27 ------
NM_006761chr17------163
NM_006763chr131812 1783 669 --1216 --
NM_006772chr651729 1478 1460 1121 532 ------
NM_006775chr643026 2475 2152 1065 1980 13097 --
NM_006777chrX82803 2497 2422 2319 2180 778 654 34 1471 1694 11796
NM_006788chr1841408 1393 438 22 12084 --1431
NM_006805chr511518 21170 472 ----
NM_006815chr1221137 898 --1384 --
NM_006838chr1271651 1550 557 474 378 307 145 ----11245
NM_006868chr1853061 2814 2778 1959 508 ----1481
NM_006885chr161666 1279 1315 --
NM_006888chr1423440 3134 12360 1715 --
NM_006902chr123033 2604 23019 2843 22596 2142 1363
NM_006931chr1242146 2052 1744 487 --21497 870 --
NM_006943chr2052960 2354 1120 952 553 --22073 400 1884
NM_006948chr2142022 286 279 195 11923 ----
NM_006951chr101726 2119 27 1244 --
NM_006990chr141900 800 675 403 22239 987 12536 --
NM_006997chr102331 21 --1477 --
NM_006999chr511341 ----12095
NM_007005chr91619 1570 ----
NM_007010chr1721405 726 1513 ----
NM_007011chr1576673 5299 4223 1857 1845 1291 924 66015 4633 1969 1504 743 675 35420 4273 907 142
NM_007014chr161224 21621 201 ----
NM_007073chr654199 3494 3077 1163 1139 13857 --13261
NM_007137chrX84952 4869 4474 3852 1544 1261 819 617 --11991 14685
NM_007157chrX42650 2097 137 66 1165 --12861
NM_007159chr311709 1587 ----
NM_007189chr751032 434 428 367 229 139 1575 --
NM_007195chr1863632 3072 1489 1180 829 155 13211 23538 2574 --
NM_007236chr153798 467 163 ----22141 617
NM_007238chr2053893 3801 1522 1112 568 --24635 4246 --
NM_007249chr1368581 7808 7628 2764 1832 385 25796 3608 --29429 3699
NM_007285chr161331 ------
NM_007345chr182633 393 ----12358
NM_007347chr1543176 2688 2598 1192 ----1434
NM_007373chr1021575 721 ------
NM_012069chrX42303 2211 902 59 1794 --22556 1082
NM_012074chr142397 50 1924 123 --
NM_012081chr542385 410 185 95 22760 743 ----
NM_012092chr2--1140 1233 --
NM_012101chr114838 826 323 89 ----21110 1048
NM_012104chr1153541 3485 3353 2485 60 12503 11038 --
NM_012156chr2072986 2659 2518 2245 623 74 29 11336 43165 2554 2333 1096 --
NM_012158chr13--11740 --11686
NM_012193chr1175243 4966 4375 3835 3685 3337 57 31948 1802 961 --23890 195
NM_012199chr194417 4146 4040 3787 3674 3229 1551 1111 829 23878 1297 14484 --
NM_012214chr255283 4026 2486 2182 1296 26124 1812 --26093 564
NM_012215chr1021930 1713 ------
NM_012223chr22452 118 11099 --11120
NM_012232chr1721752 788 ----1719
NM_012233chr21436 ------
NM_012234chr323041 1265 43476 2706 2673 588 ----
NM_012248chr162199 25 --1507 --
NM_012255chr20------1410
NM_012259chr631004 986 429 ------
NM_012281chr71848 12201 12437 --
NM_012285chr173511 130 29 --1123 --
NM_012287chr354303 4168 3824 3436 3109 24251 3097 13319 --
NM_012290chr2----1557 --
NM_012297chr442610 2181 873 132 --12016 183
NM_012300chr522155 378 12182 22213 555 --
NM_012307chr181697 ------
NM_012309chr11104946 4077 4024 3883 3751 1874 1510 1365 667 634 11630 11181 24640 1055
NM_012316chr1124963 4650 4301 4139 4025 1968 1801 1331 1077 1004 204 65 --45244 4423 1765 174 11364
NM_012325chr2041377 1022 1014 570 1484 11149 1514
NM_012328chr7----11095 --
NM_012330chr1041585 1398 711 278 --1266 --
NM_012333chr131501 1198 179 ------
NM_012347chr642521 2411 553 485 23023 718 ----
NM_012384chr2032316 2073 801 --1490 --
NM_012399chr222749 638 1600 11695 --
NM_012416chr9------1401
NM_012430chr3------1557
NM_012461chr142560 245 --1762 1495
NM_012479chr752426 2042 2036 1050 233 11985 ----
NM_013230chrY11724 21385 69 1601 --
NM_013231chr1434267 3271 1454 1991 13119 --
NM_013233chr21305 ------
NM_013263chr161127 ----1114
NM_013272chr151357 ------
NM_013277chr123820 698 311 11078 1914 --
NM_013279chr1152063 1781 871 546 399 ------
NM_013290chr171415 ------
NM_013323chr1731212 1125 826 1807 1936 --
NM_013372chr1542772 2684 1286 834 13018 --1611
NM_013433chr1951635 1384 1364 281 242 ----11581
NM_013444chrX1723 1373 ----
NM_013449chr1231163 367 227 --11189 --
NM_013943chr132134 1149 242 2812 446 --13268
NM_014001chr1741041 561 178 67 --11261 --
NM_014011chr22933 506 1718 1288 1452
NM_014015chr161103 --1792 --
NM_014021chr13658 250 123 --1188 11070
NM_014023chr1072881 1975 1919 971 940 930 598 22628 2437 22689 225 --
NM_014077chr192236 74 2157 86 ----
NM_014112chr855187 4731 4128 4075 1604 14486 14309 --
NM_014117chr1632085 1810 558 31849 1088 1075 --11789
NM_014141chr73999 595 587 --11094 --
NM_014181chr222802 85 162 12485 11135
NM_014191chr122847 778 --1743 --
NM_014231chr1231879 1534 612 --11705 --
NM_014240chr321500 740 23479 3065 1808 1313
NM_014243chr432061 554 393 ------
NM_014251chr71155 ------
NM_014268chr182198 53 ------
NM_014299chr1951513 1454 879 724 642 21633 410 3417 286 276 --
NM_014331chr457552 7252 1975 1383 97 17091 17541 --
NM_014363chr1331231 320 133 ------
NM_014368chr921489 862 41376 683 469 242 1760 11561
NM_014394chr104414 407 369 171 ------
NM_014423chr555532 5319 5099 3865 1597 14709 23492 2173 14694
NM_014470chr121228 ----1756
NM_014488chr112537 208 ------
NM_014491chr72881 155 ----1958
NM_014494chr1632279 1870 724 12270 1285 1870
NM_014515chr122970 704 2845 771 ----
NM_014562chr21318 ------
NM_014577chr223790 703 172 --1809 --
NM_014584chr14131 21066 535 ----
NM_014604chr171789 1760 1711 1182
NM_014612chr9159 ----1125
NM_014616chr323384 948 13351 --12416
NM_014636chr963193 2864 2782 1504 1435 1376 31419 744 40 1264 --
NM_014646chr184996 619 490 117 --12042 1890
NM_014665chr853681 392 313 285 134 --22301 354 --
NM_014667chr311727 22203 1584 --22152 649
NM_014674chr333608 3303 664 --23262 288 13814
NM_014717chr19129 ----1665
NM_014720chr1011627 1722 11506 --
NM_014729chr81231 ----21859 154
NM_014730chr1285195 3939 3766 2023 2011 1492 1065 570 1560 24201 1073 --
NM_014746chr263098 2845 1754 915 787 311 --11004 14285
NM_014747chr194961 4873 4784 4620 4599 3786 2230 225 91 25302 1129 --35098 3584 553
NM_014755chr233809 3115 433 14004 13371 --
NM_014757chr512333 --181 --
NM_014761chr1621074 1033 --1141 --
NM_014762chr152464 2373 2241 1863 194 22543 2108 21805 252 --
NM_014764chr122337 127 --1278 --
NM_014767chr1052458 2388 1355 982 515 12241 33128 2380 957 --
NM_014783chr15--1718 --11195
NM_014786chr114349 338 300 202 --11265 --
NM_014787chr152398 2043 2000 1920 264 12614 --12658
NM_014810chr153395 2461 504 394 99 --12787 13443
NM_014819chr522356 2071 1877 ----
NM_014820chr331737 1449 342 ----11679
NM_014827chr1--11535 1579 --
NM_014828chr1472395 1932 1707 1674 253 192 86 --12028 --
NM_014830chr1243409 3349 1487 647 13531 --11385
NM_014835chr2011823 11583 --11624
NM_014849chr131251 524 413 --1916 --
NM_014858chr12413 32 --21052 888 --
NM_014871chr12----1505 --
NM_014876chr2222069 391 ----11376
NM_014897chr1732803 2169 599 12127 ----
NM_014906chr1723898 1566 --11420 --
NM_014910chr19------1140
NM_014924chr1452382 2251 1069 900 810 199 1313 --
NM_014932chr351732 1264 449 412 137 ------
NM_014947chr132316 2057 248 12127 ----
NM_014949chr131015 820 102 --179 --
NM_014950chr14------1183
NM_014961chr411819 11657 12174 --
NM_014962chr2032583 346 324 1541 ----
NM_014982chr1444666 3916 2043 649 23333 931 14009 15216
NM_014988chr432284 2070 318 --22704 588 --
NM_014991chr432758 2378 994 1350 12506 --
NM_014992chr141195 1740 ----
NM_014994chr1551619 1578 1456 754 599 1309 22086 392 --
NM_014997chr752432 1811 1009 804 600 --32023 1062 971 --
NM_015001chr11278 --1410 --
NM_015025chr212273 ----1878
NM_015026chr1254708 3228 1147 909 780 ----14004
NM_015032chr1342935 2421 697 139 ----140
NM_015033chr922642 544 --23257 3192 12608
NM_015039chr1114085 4063 3222 2867 1660 1645 1561 425 386 347 308 11465 53124 1040 412 334 184 13348
NM_015042chr1523796 3167 11630 23888 1516 24315 3906
NM_015045chr1052239 1788 310 269 125 --12181 --
NM_015051chr932219 539 437 1726 11126 --
NM_015063chr1921114 898 1952 11134 --
NM_015071chr564890 4684 4658 1971 938 150 26142 1593 35373 1965 1153 --
NM_015072chr141207 ----1594
NM_015073chr1952097 2086 2023 1599 703 --31743 1504 1474 --
NM_015074chr174841 4795 4564 1557 1024 788 350 ------
NM_015076chr644159 3385 3316 987 --14437 --
NM_015077chr17134535 4249 3485 3452 3356 3066 3028 1890 1729 1026 729 286 182 --24507 3380 13602
NM_015084chr52994 852 ----11363
NM_015090chr166128 5321 5166 4082 949 716 1661 22202 553 25585 777
NM_015092chr1664348 3492 3029 1550 1128 972 24612 347 13567 --
NM_015097chr321940 564 --11889 194
NM_015100chr141841 1708 831 430 ------
NM_015111chr533724 1489 1141 11012 22633 1170 --
NM_015132chr751729 1439 1212 519 64 ------
NM_015144chr1623701 2740 1540 --21167 481
NM_015149chr151682 889 842 770 614 --1731 1604
NM_015156chr1422963 1460 2844 505 1100 1273
NM_015157chr113353 98 91 --11197 --
NM_015172chr111263 11455 --11482
NM_015176chr121119 639 1472 ----
NM_015185chrX62842 2287 2099 2031 863 656 ------
NM_015192chr202772 352 --11898 --
NM_015199chr342875 2581 2215 1197 1538 ----
NM_015215chr142937 1951 960 481 ----12035
NM_015265chr22558 160 12451 11941 --
NM_015267chr1241390 1357 887 677 11845 --1358
NM_015271chr484227 3278 2763 2723 1628 1199 667 620 --2961 577 1524
NM_015272chr1631811 1694 84 ----11686
NM_015275chr1221927 1808 ----1110
NM_015278chr622409 2241 12869 285 26 32783 2455 692
NM_015284chr13733 264 91 --1776 --
NM_015292chr121207 --1670 1581
NM_015299chr1483829 3771 3755 3732 2994 2888 532 139 11198 2390 121 12838
NM_015313chr1184495 4367 3984 3901 3226 1462 286 42 43910 3864 3714 1901 ----
NM_015315chr542365 524 479 323 31304 894 586 42714 1038 1000 492 --
NM_015317chr222727 668 11743 12142 --
NM_015328chr711139 32360 439 380 12030 1955
NM_015335chr1241832 581 543 25 32415 2275 449 1389 --
NM_015339chr203902 688 407 ------
NM_015346chr1451613 1404 557 223 102 ----1636
NM_015358chr212484 350 11192 ----
NM_015375chr1144822 4686 4151 4143 4029 3985 3965 3909 3188 1580 1494 729 626 271 31538 1375 447 24936 3997 --
NM_015393chr443454 3095 174 151 --13245 --
NM_015396chr311414 --1273 --
NM_015397chr94573 301 234 200 11644 11518 --
NM_015443chr171139 --21392 414 --
NM_015483chr731123 1016 259 ------
NM_015520chr3--1929 31893 433 322 --
NM_015678chr1321632 72 11589 ----
NM_015690chr2134 ------
NM_015726chr11429 --1102 11832
NM_015891chr621990 290 1430 ----
NM_015906chr164112 3013 1805 1744 1401 391 13110 --14766
NM_015912chr872229 2138 1947 1800 1740 160 25 ------
NM_015941chr8------1260
NM_015976chr1266 30 1118 ----
NM_015981chr51642 --22508 1281 --
NM_015995chr1564186 3982 2070 2045 882 521 24807 2123 35046 4972 328 15246
NM_016018chr82584 429 ------
NM_016045chr201543 --1343 --
NM_016076chr162707 2490 2172 2084 233 36 ----12562
NM_016081chr4----12185 1444
NM_016083chr663593 3050 1413 1047 774 271 ------
NM_016100chr20173 ------
NM_016131chr252328 2076 679 555 536 11986 ----
NM_016206chr357745 6419 2974 2063 1977 38892 6499 1074 28075 2657 18347
NM_016213chr15------173
NM_016221chr512195 1924 --12173
NM_016231chr1721682 70 21447 57 ----
NM_016257chr172649 2503 1413 1165 316 111 69 2729 660 1482 1579
NM_016263chr1933421 2737 191 --21358 745 1641
NM_016269chr4169 ------
NM_016281chr122927 780 --1291 --
NM_016282chr92376 142 1347 ----
NM_016284chr161109 1276 ----
NM_016302chr3------2309 62
NM_016320chr115773 754 328 276 69 1195 194 --
NM_016322chr92490 327 13241 --22752 2489
NM_016339chr1731254 1131 286 --11672 11355
NM_016376chr1743139 2785 1529 1195 --13787 23467 1187
NM_016396chr1551946 950 555 127 54 --12727 --
NM_016422chr1122380 982 43161 720 591 344 ----
NM_016424chr17--11563 11941 1256
NM_016436chr2032185 359 125 22718 735 ----
NM_016442chr521624 250 22028 241 ----
NM_016453chr31197 1187 --1678
NM_016532chr173978 931 283 1393 --21062 183
NM_016605chr522288 1728 12137 --1603
NM_016620chr111065 ------
NM_016628chr10----194 --
NM_016952chr1163437 3188 2847 2701 2688 1588 --12755 33591 1487 1293
NM_017412chr821064 369 ------
NM_017415chr593341 1548 1520 1038 1032 553 445 252 202 21576 515 ----
NM_017423chr432202 1601 317 ----12029
NM_017437chr14--21478 385 --11685
NM_017508chr1162500 2336 1698 709 640 326 --11659 --
NM_017542chr131522 405 285 21151 565 11733 --
NM_017544chrX2767 672 1942 ----
NM_017551chr1062700 2230 2165 974 553 496 1867 12617 --
NM_017588chr951831 1718 1589 1323 420 1528 21196 787 11341
NM_017589chr111112 ------
NM_017596chr183982 3787 1800 1193 1156 1102 904 538 33717 3188 3130 33958 775 673 --
NM_017602chrX5824 658 601 144 74 ----1800
NM_017610chr15--197 ----
NM_017633chr663928 3203 3036 2559 1567 1314 23799 2622 ----
NM_017637chr969322 8476 8147 6866 5704 2701 28803 7075 17829 18342
NM_017643chr1742114 1142 614 261 --1643 13009
NM_017644chr354664 3518 1891 1462 1086 13297 ----
NM_017709chr184199 3571 3406 3340 1590 1322 1026 992 11727 --13656
NM_017724chr32539 328 --1184 --
NM_017734chr12570 69 ------
NM_017736chr161854 1549 ----
NM_017742chr1841701 1691 1408 186 11268 ----
NM_017754chr674154 3513 3440 3250 1850 1648 472 --24351 3168 --
NM_017772chr631570 1222 145 1227 1169 1547
NM_017778chr82602 439 ------
NM_017780chr8------1604
NM_017845chr41780 --1282 --
NM_017848chrX124547 3773 3320 3283 3222 1683 1465 1408 549 357 204 193 21482 167 --33524 1556 285
NM_017851chr1521087 844 1388 ----
NM_017906chr6------1109
NM_017944chr1122975 2561 32931 2736 611 23027 1991 --
NM_017969chr21230 --158 --
NM_017982chr11435 --1422 --
NM_018013chr62479 103 12946 ----
NM_018045chr152831 2756 2615 2294 203 12655 22802 2774 12230
NM_018084chr232947 2498 828 32754 1323 1074 ----
NM_018112chr91164 ------
NM_018121chr1072316 2083 1034 912 850 797 726 12647 ----
NM_018128chr1741422 1173 958 439 ------
NM_018133chr31268 32180 1742 833 11438 --
NM_018164chr12------1248
NM_018200chr1522204 1893 12517 2498 437 --
NM_018206chr161602 --1639 --
NM_018243chr412935 33596 2548 1176 1303 --
NM_018246chr842026 723 538 337 ----1944
NM_018247chr633058 1960 1151 13147 --1908
NM_018266chr32896 314 ----1260
NM_018325chr941562 1157 1118 400 11259 ----
NM_018364chr121295 552 ----1294
NM_018375chr141644 1538 --11922
NM_018383chr23697 445 115 1322 134 --
NM_018425chr1012332 ----22094 988
NM_018448chr121947 ------
NM_018453chr141332 2290 242 ----
NM_018471chr22172 113 --1486 --
NM_018527chr131134 --2141 83 --
NM_018553chr1731644 697 209 ------
NM_018566chr133653 1920 1031 --156 --
NM_018638chr1244220 3837 2219 2104 ----12162
NM_018657chr32629 53 ------
NM_018691chr5159 1454 ----
NM_018704chr121319 175 ------
NM_018710chr83254 129 101 --163 --
NM_018712chr112525 176 11396 ----
NM_018715chr122009 600 ------
NM_018836chr11819 --1272 --
NM_018837chr201154 --1219 --
NM_018840chr201199 --1308 --
NM_018898chr51217 11759 ----
NM_018945chr642861 2812 2269 642 11113 1567 1123
NM_018952chr17----1568 --
NM_018959chr194765 492 158 136 1296 --1525
NM_019022chr1862883 2787 2207 892 409 170 --13126 --
NM_019063chr212026 ------
NM_019087chr521291 115 --1383 11148
NM_019096chr62148 58 ------
NM_019116chr16123642 3200 2926 2787 2469 2398 1429 1272 1221 791 421 406 193 --11008
NM_019117chrX22967 1284 1413 23010 2853 --
NM_019594chr921034 258 ------
NM_019600chr15------1790
NM_019845chr2----1338 1261
NM_019857chrX31271 1183 223 21648 668 ----
NM_020144chr72848 524 ------
NM_020150chr1011836 11752 140 --
NM_020182chr2043542 2522 1454 1137 13304 --23657 2730
NM_020199chr5--1277 2487 445 1132
NM_020205chr122609 1117 1538 ----
NM_020225chr4------181
NM_020310chr1732632 812 559 --2731 444 11857
NM_020337chr431070 679 649 33155 2656 2294 ----
NM_020338chr1042493 1387 1281 208 --22633 2369 22520 564
NM_020341chr2031900 1516 356 ----11375
NM_020346chr1111512 ------
NM_020348chr1031082 339 48 1266 22308 1772 2762 312
NM_020357chr311300 11123 189 --
NM_020381chr611425 1156 1525 --
NM_020423chr1178 ------
NM_020443chr1166949 6332 6241 5749 5066 4882 4383 2672 2651 2618 2498 1040 415 321 272 255 26787 1795 2989 670 --
NM_020458chr25565 453 376 331 318 11425 21961 232 11816
NM_020466chr645044 4814 1442 1384 --24566 4011 23831 1988
NM_020474chr181316 ------
NM_020546chr522588 329 21054 348 12900 --
NM_020640chr33878 430 205 1500 ----
NM_020644chr11------1996
NM_020647chr822168 214 1609 --21975 226
NM_020699chr1105370 5025 4410 4371 3668 1945 1811 1762 1566 1429 22088 1972 --1749
NM_020703chr1------1518
NM_020718chr1686295 5652 5054 4704 2601 2374 1730 1225 24755 2393 1327 --
NM_020726chr53423 393 33 ------
NM_020737chr6--1244 1300 --
NM_020748chr17--1699 1195 --
NM_020770chr1----21107 432 --
NM_020772chr1778316 7305 2797 2371 1708 1558 1242 46869 1231 834 705 1620 17278
NM_020774chr1864245 1544 1261 907 869 246 35849 5041 4733 15530 --
NM_020778chr15124986 4753 4332 3386 3246 1978 1868 1622 1516 814 206 174 14430 11157 31605 1533 1264
NM_020794chr121131 217 1982 ----
NM_020810chr1453302 2896 1424 1349 1296 ------
NM_020839chr311059 11450 11122 --
NM_020850chr1643093 2989 2492 23 --1344 --
NM_020853chr1221813 984 42114 1946 1864 253 11893 --
NM_020858chr1522389 139 ----11915
NM_020860chr421080 1021 ------
NM_020870chr431497 565 198 --1362 --
NM_020899chr1752212 1860 1571 846 521 --1603 --
NM_020921chr1433325 3315 1054 --1796 --
NM_020935chr284459 4364 4188 3086 1038 1021 394 186 187 --1717
NM_020940chr1022892 404 --12387 1380
NM_020962chr1542027 1551 1003 133 22202 597 22192 114 --
NM_020967chr2061017 938 804 311 263 80 1338 --11256
NM_021013chr173385 325 82 ----1337
NM_021079chr1783269 2061 1310 1281 1152 527 206 22 33224 2371 2182 32604 2114 927 --
NM_021083chrX83421 3314 3203 2713 2513 726 616 41 12289 --13500
NM_021090chr2284326 4012 4004 3707 1476 889 634 589 --24950 3242 193
NM_021097chr252837 2139 1912 515 498 12382 1770 --
NM_021106chr94749 707 621 271 --1117 --
NM_021116chr7128696 8647 6275 6094 5968 5865 2801 2115 1873 1309 701 607 29079 3258 38109 3240 23 38291 3636 532
NM_021132chr1011243 11029 ----
NM_021140chrX3970 431 313 ------
NM_021141chr22975 230 1300 ----
NM_021155chr1972193 1153 979 961 259 215 169 ----22557 69
NM_021167chr752687 2641 2374 2250 661 --12285 12423
NM_021183chrX1169 --173 --
NM_021194chr11300 1222 ----
NM_021238chr12--11720 ----
NM_021239chr141576 --11383 --
NM_021249chr1431710 1565 1241 ----1675
NM_021255chr1453136 3011 2914 834 544 --13459 --
NM_021627chr3--1778 1223 --
NM_021629chr353912 3226 948 667 39 1815 ----
NM_021637chrX21406 1247 --1210 --
NM_021648chr641929 764 686 125 22062 1059 1191 --
NM_021728chr141750 --1795 --
NM_021813chr645065 4367 1985 1175 --32224 1762 1623 --
NM_021938chr192298 292 ------
NM_021947chr173913 388 138 ------
NM_021964chr376421 5828 2562 2533 2519 2122 1851 11472 14166 11064
NM_021965chr91922 ----1101
NM_021973chr4--1119 ----
NM_021999chr131289 1568 ----
NM_022048chr1555316 4572 4566 1927 94 11845 16027 --
NM_022062chr1141771 1659 736 279 --11506 --
NM_022093chr1--185 1914 2383 332
NM_022145chr5173 --1283 --
NM_022169chr11161 --1387 2513 174
NM_022340chr352700 1195 1175 811 25 11242 23662 947 --
NM_022462chr19133138 3077 2736 2672 2491 1489 1483 1385 1327 1309 1243 375 179 13048 43681 638 555 190 1217
NM_022463chr171206 11430 11599 --
NM_022465chr1242699 2220 2127 2107 1629 --22465 534
NM_022473chr1593829 3139 2739 2728 1625 1314 1252 1192 145 --1955 21651 238
NM_022474chr1432620 2381 545 ------
NM_022491chr1253481 2949 1395 848 36 13066 11064 --
NM_022574chr75793 787 759 701 659 --11863 --
NM_022658chr122379 155 --1171 --
NM_022719chr2253257 3106 975 549 265 --33622 576 487 13025
NM_022735chr141849 550 182 22 159 ----
NM_022758chr642251 880 246 52 1466 22623 79 1914
NM_022780chr2----11798 --
NM_022781chr943308 2994 2756 2436 23097 2856 ----
NM_022818chr1621349 636 ----1199
NM_022826chr21888 --1964 --
NM_022828chr521472 1326 21767 1638 --11398
NM_022831chr12506 428 ------
NM_022836chr111529 --1236 1576
NM_022893chr213091 --1552 --
NM_022898chr1464819 3690 1757 1450 1036 825 14582 13978 1839
NM_022918chr1131470 594 219 ------
NM_023002chr1931500 636 217 --1181 --
NM_023076chr1652188 2180 995 955 84 32819 2288 2200 ----
NM_024060chr111278 --158 --
NM_024076chr1941523 813 646 124 --162 --
NM_024090chr421730 1334 ----11406
NM_024308chr17179 --159 --
NM_024523chr72551 63 11093 21171 456 --
NM_024529chr1--126 --1417
NM_024541chr1081881 1705 1672 1398 1320 1172 517 441 11632 11267 --
NM_024551chr1242018 1943 1807 749 --12075 11030
NM_024565chr521606 1244 11636 ----
NM_024573chr61819 1948 ----
NM_024613chr851516 653 543 466 54 1457 ----
NM_024628chr321064 29 --1126 --
NM_024665chr354351 1045 698 328 262 ----14157
NM_024671chr16----1473 --
NM_024721chr811895 32658 625 262 ----
NM_024738chr1221471 158 11769 1401 --
NM_024742chr1641958 1871 697 183 ----21938 732
NM_024757chr92803 240 ------
NM_024761chr974915 4699 4054 3611 2014 444 252 14971 25042 452 122
NM_024785chr211461 11196 1193 --
NM_024792chr1731122 844 95 ----1287
NM_024841chr113876 650 352 --2408 283 1534
NM_024854chr121490 11523 1290 --
NM_024944chr2121275 38 ------
NM_024947chr369533 8917 8651 8467 6402 1199 27921 565 11240 --
NM_024969chr22661 318 1580 1735 --
NM_024989chr256306 2048 2001 1455 509 23147 1116 35544 3123 99 --
NM_025090chr1731298 585 326 --1939 11439
NM_025160chr122956 1535 3798 730 374 --11082
NM_025191chr143475 2147 367 157 12638 1315 --
NM_025201chr155720 636 312 177 33 21965 336 31887 1492 235 --
NM_025224chr2021801 577 11979 22012 571 1196
NM_025235chr1011621 11893 ----
NM_025248chr1732301 1138 774 ------
NM_030576chr1732619 2580 986 2956 196 22079 1914 --
NM_030625chr101402 12330 12150 1921
NM_030647chr7145776 5170 4381 2305 2126 1966 1835 1797 1473 1272 899 517 408 185 1399 35753 3977 34 --
NM_030648chr485493 5341 4973 4445 2156 649 513 259 23918 1471 11954 14729
NM_030758chr22----11474 --
NM_030767chr952618 2563 1866 1052 420 1801 1458 --
NM_030780chr811618 11496 ----
NM_030782chr52160 69 160 --1411
NM_030786chr11676 1336 174 --
NM_030791chr143698 642 246 11158 ----
NM_030806chr198836 8021 7242 6562 6276 2280 1468 1421 1150 29021 8523 39179 7263 502 --
NM_030917chr4168 ------
NM_030918chr184908 4700 4598 4390 3811 3769 1913 484 1355 23836 59 2989 472
NM_030939chr621188 933 --11144 --
NM_030964chr593359 3076 3068 2925 2756 2379 1028 407 200 --22690 907 --
NM_030981chr1151141 1014 980 142 113 --2901 857 1290
NM_031216chr1841864 1698 1514 805 21953 371 11630 --
NM_031231chr203262 230 61 --2550 52 --
NM_031283chr21861 --1104 --
NM_031407chrX----1360 --
NM_031432chr921005 891 --11204 11050
NM_031439chr841216 758 355 140 11294 --11910
NM_031444chr2252177 1997 1877 1839 410 --21761 1744 1742
NM_031445chr273265 2854 2625 2370 688 612 421 12906 ----
NM_031459chr141632 1550 1368 56 ----1191
NM_031483chr204950 523 449 367 22318 644 --21402 778
NM_031891chr181349 --1141 --
NM_031922chr62202 65 ------
NM_032017chr1--22127 1460 1292 1517
NM_032109chr511092 ------
NM_032153chr351848 1799 1714 1067 798 ----12779
NM_032174chr141401 1194 967 331 11509 ----
NM_032193chr1142072 366 181 113 ----161
NM_032217chr43509 285 42 --1256 --
NM_032228chr1133143 1396 403 1321 ----
NM_032329chr234391 3076 1639 44443 3023 1280 951 11525 1739
NM_032373chr1095878 5193 4716 4547 4440 3928 3755 2282 1704 ------
NM_032389chr1151107 1028 949 898 329 --1806 1430
NM_032413chr15175 --1140 --
NM_032433chr1931229 1041 620 1166 --1330
NM_032434chr241576 1213 1089 306 ----11178
NM_032452chr1451232 983 197 30 24 ------
NM_032458chrX62865 2578 2145 1316 1017 632 1555 ----
NM_032466chr81113 --11560 --
NM_032509chr841904 1795 628 166 22305 272 --11867
NM_032569chr1621489 88 11264 ----
NM_032581chr721605 754 --11579 --
NM_032595chr1711062 --1348 --
NM_032638chr351470 1207 1078 487 240 11005 1443 --
NM_032682chr332408 2338 107 ----13186
NM_032689chr1951133 1122 522 273 183 ------
NM_032812chr101140 ------
NM_032818chr952360 2307 2144 1841 215 ------
NM_032824chr2--1214 --1313
NM_032829chr1221031 325 1462 --11041
NM_032842chr711090 ----11331
NM_032859chr1372949 1193 798 715 625 535 355 ------
NM_032873chr1154307 3244 1193 717 36 23301 2775 3290 231 204 --
NM_032905chr1031195 1131 217 1906 ----
NM_032906chr41664 --1279 --
NM_032932chr17134816 4804 4685 4522 4182 2301 1926 1836 1453 991 541 488 112 16273 32149 1630 354 --
NM_032983chr713334 11276 1118 --
NM_033027chr32912 463 --31105 300 150 --
NM_033055chr1163 ------
NM_033081chr202469 107 --11117 --
NM_033121chr1221391 1194 ------
NM_033133chr1763392 2794 2787 2470 701 311 33309 2376 1061 41174 972 962 483 --
NM_033143chr433802 3768 1070 --23978 328 --
NM_033222chr9------1563
NM_033224chr747074 2678 952 482 15645 16585 15127
NM_033254chr31157 ------
NM_033259chr31721 --1836 --
NM_033285chr821754 1151 4850 745 599 231 ----
NM_033315chr1751982 1754 1568 1494 808 12142 ----
NM_033343chr13468 349 310 ------
NM_033386chr221754 --3357 171 130 31114 1077 974
NM_033389chr1773635 3625 3094 2947 953 195 122 ----14702
NM_033407chr11191 198 ----
NM_033505chr286386 6207 5540 5047 5019 4526 1313 161 36632 5969 390 15574 16405
NM_033549chr51986 ------
NM_033631chr183866 3707 2754 2412 2383 396 357 275 --12669 13415
NM_052857chr171447 1388 --1160
NM_052875chr1151706 1487 797 561 512 21862 1395 42178 609 254 156 --
NM_052879chr1233373 138 76 11264 --13172
NM_052905chr221876 1173 1453 11401 --
NM_052907chr1254206 4125 2925 1191 151 44232 4119 841 182 --1517
NM_052910chr1321897 1831 12158 --11919
NM_052928chr1741310 1262 406 107 ------
NM_053023chr1152094 2083 1300 885 429 22779 1093 2485 352 --
NM_053053chr121002 177 ------
NM_053064chr1412114 1120 12220 --
NM_057175chr421966 302 --134 1994
NM_058167chr1----2272 169 --
NM_058238chr221837 ----1307
NM_080616chr201154 1196 --1253
NM_080661chr111712 1339 --1292
NM_080743chr631822 966 115 12521 22299 148 --
NM_080867chr1475078 4111 3502 1931 1371 941 682 --178 --
NM_080872chr873935 3553 3435 3378 1435 393 254 12866 13422 --
NM_080874chr421276 290 --1190 --
NM_080927chr32676 473 --12372 --
NM_101395chr21----1455 --
NM_130847chr1175299 4974 4803 3652 2249 1797 569 14859 23667 1849 13681
NM_133264chr1743158 1460 884 517 13100 23595 176 1747
NM_133265chrX63551 3472 2693 1209 1013 707 1393 1689 22315 634
NM_133444chr1941761 1542 1411 1102 --31676 464 61 --
NM_133468chr741836 1682 1591 764 --1438 --
NM_133496chr154430 3207 2880 1095 46 23362 401 24471 2799 14360
NM_134424chr1211168 --1221 149
NM_138287chr341683 1653 655 162 11705 22551 643 --
NM_138333chr932328 893 539 --1173 --
NM_138346chr1------189
NM_138357chr1021397 240 11846 1667 --
NM_138459chr693670 2479 728 701 668 660 638 630 374 22961 1451 --11046
NM_138468chr276160 5278 2222 2182 1395 1018 596 24302 481 15778 1343
NM_138701chr7------1198
NM_138782chr5----12312 --
NM_138799chr221866 342 ------
NM_138927chr2111077 ----11053
NM_138969chr84468 309 133 99 --3964 911 441 11214
NM_139207chr1232240 1385 1378 1253 ----
NM_139279chr243558 1119 1111 541 22841 2411 12714 --
NM_139280chr173510 416 125 --195 --
NM_139283chr1242163 2093 1850 1817 --22353 562 --
NM_139321chr2063980 3930 2831 1663 1607 1551 --12851 13938
NM_144571chr4126917 5920 5711 5590 4485 4378 2790 1664 1295 673 650 471 25741 2784 25936 2172 --
NM_144582chr2112462 2327 2299 2243 2196 1945 1788 1601 850 582 295 --42516 544 360 129 1833
NM_144590chr1062751 2628 2200 1020 972 654 1145 ----
NM_144632chr211875 ----32058 1859 1493
NM_144633chr331477 247 77 ------
NM_144635chr341167 1075 827 162 --1242 --
NM_144660chr101289 ------
NM_144691chr194155 122 110 94 --1485 --
NM_144721chr422646 2474 12635 2116 107 --
NM_144726chr521208 920 --2776 37 --
NM_144778chr1321834 134 12352 ----
NM_144963chr851994 1937 947 708 390 --1892 --
NM_144982chr121592 ------
NM_145049chr5------1361
NM_145117chr1163231 2177 2083 1322 971 547 --1863 --
NM_145166chr362715 2681 2639 1843 958 841 22781 263 11923 12211
NM_145185chr192663 477 --21876 289 --
NM_145239chr1611120 1278 1391 1297
NM_145246chr10------2164 123
NM_145307chr1053796 3678 3633 3067 1320 1474 --23662 760
NM_145349chr173491 315 151 --1131 12123
NM_145735chr1341841 522 400 314 2955 878 1553 --
NM_145808chr732379 1032 174 1704 1622 --
NM_145858chr21------169
NM_145912chr22114689 4281 4154 4056 3214 1639 1600 1483 705 615 556 13895 13624 14421
NM_147156chr102542 324 1345 ----
NM_152253chr2273773 3304 2722 1347 1330 460 310 --1995 33889 3097 2850
NM_152263chr174870 4046 3871 996 694 519 26 12353 177 --
NM_152265chr11608 --21145 543 --
NM_152267chr2241993 879 868 659 21813 392 31840 640 38 22050 154
NM_152277chr531501 1352 530 1693 12038 --
NM_152280chr153214 3014 2827 2210 525 22760 1325 1752 11118
NM_152287chr1642153 1838 826 532 12473 32015 436 416 1165
NM_152296chr193322 316 85 ------
NM_152344chr1721399 1233 1256 ----
NM_152380chr131491 130 74 1585 ----
NM_152390chr21121 ------
NM_152424chrX114738 4673 4243 4172 4142 3781 2896 1318 1249 730 112 ------
NM_152441chr123515 191 77 ------
NM_152470chr1843257 2951 2602 1338 23972 3117 24119 2654 --
NM_152493chr131154 488 195 1330 ----
NM_152554chr62587 245 ------
NM_152586chr10197 ------
NM_152600chr19------1338
NM_152622chr511230 23519 2566 ----
NM_152667chr202384 282 --1556 --
NM_152713chr111223 ------
NM_152731chr61438 ----1274
NM_152758chr832454 1099 844 --11927 22154 53
NM_152787chrX22843 681 32935 1440 916 --1428
NM_152835chr1--32343 2138 294 11824 --
NM_152996chr11211 11764 ----
NM_153020chr6--1212 ----
NM_153035chr143030 2739 2329 437 32807 2459 2178 12798 --
NM_153040chr15--1144 132 --
NM_153184chr3--2751 567 11439 1510
NM_153207chr1243569 3024 2983 1586 23229 3077 ----
NM_153257chr1921195 399 --1885 --
NM_153367chr1052942 2849 865 331 221 43188 2829 2572 1015 1783 --
NM_153371chr1352284 963 824 319 65 11783 --11913
NM_153456chr1376111 6049 5824 1707 1673 932 120 --11586 --
NM_153619chr1523627 1377 ----23153 893
NM_153686chr442400 2117 944 903 12408 ----
NM_153810chr1055038 4829 4215 3926 3270 11935 34574 4511 2012 --
NM_170662chr3------1613
NM_170711chr194941 668 334 312 --1128 1701
NM_172071chr197427 7032 6673 5763 2542 2409 2392 2209 1401 1581 37181 5470 287 12457
NM_172240chr1211293 11148 1342 --
NM_173074chr2168 --1103 --
NM_173359chr321740 1246 147 31306 1187 718 --
NM_173475chr1631608 1500 1488 176 11645 11769
NM_173510chr2232822 2320 834 22886 2829 ----
NM_173511chr283261 1365 1303 916 723 549 488 83 2138 31 1254 13611
NM_173546chr31656 ------
NM_173552chr322183 1871 22059 91 1215 --
NM_173564chr72718 249 ------
NM_173576chr1032155 1833 730 ----11734
NM_173582chr1145132 4223 1625 1274 13921 15774 13868
NM_173595chr1245300 5250 4413 471 34163 3884 186 24228 491 --
NM_173642chr1108973 8595 6465 3123 2792 2500 1367 732 117 73 45775 3554 3514 2130 --18553
NM_173654chr331768 535 296 11502 1670 12368
NM_173822chr241463 853 522 375 --1492 --
NM_173824chr31183 ------
NM_173827chr443355 1298 218 184 2892 806 1582 12947
NM_174887chr17------1365
NM_175061chr7--1145 ----
NM_175607chr3------21048 198
NM_175747chr621117 863 ----1404
NM_175854chr1332678 1693 1054 12017 ----
NM_175873chr5--1494 11196 1563
NM_175884chr721464 1167 1357 ----
NM_176812chr203590 554 286 ------
NM_176816chr51580 ------
NM_176880chr192159 143 ------
NM_177424chr131556 616 394 ----31648 793 149
NM_177968chr231935 1895 1365 ------
NM_178126chr171262 --11426 --
NM_178191chr131586 1336 1188 --11144 --
NM_178313chr221565 1481 1547 22051 46 --
NM_178314chr12----170 --
NM_178423chr7----1164 --
NM_178502chr121208 1593 ----
NM_178526chr1931910 501 53 ------
NM_178557chr431390 675 187 11746 ----
NM_181054chr142851 177 --1133 --
NM_181358chr144193 3514 2784 2597 --34175 3395 156 --
NM_181504chr543243 1084 562 242 1672 32743 384 122 23440 55
NM_181552chr71744 ------
NM_181672chrX51889 641 593 351 51 21548 251 ----
NM_181704chr2111168 --128 --
NM_181803chr20------125
NM_181836chr531787 1023 289 ----1197
NM_181844chr1781591 1455 1280 1270 706 698 357 108 21397 629 --1658
NM_182528chr2------1114
NM_182540chrX------1709
NM_182569chr171499 ------
NM_182691chr71443 2937 230 ----
NM_182700chr731887 1768 1516 --11921 --
NM_182757chr663077 3047 2595 2509 2237 234 2884 842 13310 --
NM_182830chr1422284 523 ----1290
NM_194247chr243175 1671 1532 1303 11392 13693 --
NM_194314chr185671 5538 4448 1805 714 185 173 30 12228 1575 24779 945
NM_198081chr622401 333 32338 846 506 1874 1463
NM_198098chr721643 397 --11835 --
NM_198270chrX33024 1297 813 12797 1384 --
NM_198273chr512481 22237 46 ----
NM_198465chrX32454 2008 283 12243 1274 --
NM_198511chrX11497 ----21622 108
NM_198513chr811858 ------
NM_198568chr6----11203 --
NM_198584chr822113 2004 22339 2293 ----
NM_198859chr355058 4320 1331 968 327 24363 3346 --1213
NM_198904chr531914 1773 174 22092 695 ----
NM_199000chr721604 536 1202 ----
NM_199044chr142217 941 927 614 ----12592
NM_199262chr1751777 1694 572 566 395 11746 22201 174 --
NM_199334chr17----1500 1537
NM_199351chr13547 131 95 --121 1574
NM_203298chr10------1131
NM_203301chr14------11401
NM_203394chr1212409 1270 ----
NM_203463chr244552 3775 3069 1194 34751 1232 855 --13693
NM_207015chr31311 ------
NM_207303chr10--21457 1296 11448 1258
NM_207371chr102515 180 --1104 --
NM_207406chr465941 5718 5334 1788 1232 896 45830 2053 1725 195 1648 46101 5528 5412 1166
NM_207411chr843267 3199 2652 2449 1545 1256 1689
NM_207422chrX31409 404 235 --1119 --
NM_207435chr12292 86 1743 ----
NM_207442chr142751 242 1995 --2218 54
NM_212464chr1542036 1826 1535 418 ------
NM_212467chr1582613 2403 2112 1058 887 532 296 197 ----21840 1806
NM_212554chr10--159 146 --