TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-532-3p
miRNA Sequence: CCUCCCACACCCAAGGCUUGCA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001004304chr1221176 272 13126 32446 1182 26 22762 1170
NM_001033117chr394176 3876 3858 3741 3522 760 721 563 121 2857 586 --13102
NM_003483chr122148 118 --1946 22636 135
NM_004834chr242822 1332 628 609 1618 1673 22383 1339
NM_005188chr1187961 6387 6284 3181 1983 1246 123 46 27908 1537 33247 950 757 --
NM_005910chr1773375 2917 1338 1098 522 384 187 31038 645 367 64029 3081 1090 709 589 414 2757 596
NM_006546chr17126557 5379 5086 4104 2304 2088 1913 1900 1111 1074 314 89 36550 5485 5433 26080 4373 11382
NM_014747chr195716 5459 5362 4385 4218 1419 1130 355 35 --12330 25318 2121
NM_015375chr194450 4075 3930 3506 3097 1909 1166 898 732 1630 11559 11256
NM_020699chr1115123 5108 5102 3949 3942 3930 1769 1595 1470 1194 652 14652 25159 606 22057 1776
NM_025248chr1772991 2326 2278 2044 1055 1000 751 32927 974 837 12199 32441 2191 439
NM_031417chr1951996 1054 997 678 400 22546 671 21063 684 --
NM_133264chr1773793 3597 3546 2891 2399 1068 555 --1448 33553 891 382
NM_144973chr1275371 5318 3929 1672 708 330 323 14163 --12041
NM_152470chr18123973 3644 2954 2829 2557 1543 1529 1316 1294 999 672 299 23061 1553 12544 --