TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-532-5p
miRNA Sequence: CAUGCCUUGAGUGUAGGACCGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000084chrX56408 5623 5461 4670 1979 26554 6047 --12439
NM_000259chr1545239 4465 1227 391 13893 16135 11409
NM_000332chr666753 5926 2447 1387 245 217 12708 1547 11425
NM_000337chr575930 5131 4684 4569 4544 4255 491 --11065 --
NM_000430chr1773563 3482 3382 3233 3159 292 266 ------
NM_000439chr552306 1665 675 334 203 --12428 --
NM_000486chr1292977 2875 2627 2197 2189 1118 1109 291 52 1866 ----
NM_000555chrX117539 5681 5674 5421 5367 5198 5055 2541 1563 720 489 12109 47454 7108 5436 5342 --
NM_000719chr12106392 5315 4728 2482 2437 2237 2070 1050 239 176 --35253 1825 1506 --
NM_000806chr5--11503 11614 --
NM_000814chr1574019 3859 3390 1530 1328 1318 932 1589 ----
NM_000826chr472642 1832 1773 671 566 239 36 ------
NM_000875chr15127011 6797 6712 6321 5459 5404 5345 4259 2078 1814 1536 647 --12431 --
NM_000877chr272006 587 517 413 369 221 181 --22915 560 --
NM_000901chr442123 1568 881 432 ----1751
NM_000958chr5----1464 1514
NM_000965chr32838 506 11045 ----
NM_001001323chr1222563 2198 ----12414
NM_001001436chr161325 --1585 --
NM_001001481chr812690 --22481 743 --
NM_001001664chr252682 2506 1494 959 515 12601 --1914
NM_001001701chr432121 2110 824 --21609 861 11457
NM_001002243chr2------1145
NM_001003652chr1847826 7782 2090 1625 1258 27186 1058 16662
NM_001003712chr1263086 2690 1278 1187 991 135 --12608 --
NM_001004065chr973954 2721 1449 1083 933 901 538 --11496 --
NM_001005473chr566014 4550 1386 1380 799 647 15961 --158
NM_001006610chr164983 240 120 61 --1932 --
NM_001008239chr1853413 3206 1493 750 713 --42612 760 482 437 --
NM_001008408chr775286 5095 4787 4309 4292 2092 689 14636 24475 4221 24905 1250
NM_001008495chr822060 565 11501 ----
NM_001008925chr453354 2779 813 764 108 --11189 --
NM_001009993chr2124162 3785 3718 3373 3005 1689 1585 1329 1151 1049 1021 931 13203 24376 3365 --
NM_001010867chr1226456 6388 6142 5964 5821 5794 5509 5503 4978 4837 4575 4549 4414 4203 2680 2207 1666 1263 1125 702 579 516 --24753 845 12527
NM_001011537chr31618 --1745 12232
NM_001011666chr735257 5014 402 1371 25912 68 --
NM_001014797chr10197636 7330 7191 7013 6986 6734 6570 6306 6167 6160 6099 5771 5143 5031 3125 2629 2363 1845 1134 15118 27568 930 --
NM_001015877chrX------12926
NM_001024855chr321317 710 ----1195
NM_001025100chr1863693 3471 2913 2527 1535 1026 ----12656
NM_001025580chrX44168 920 788 524 --14252 --
NM_001029858chr62919 121 --184 --
NM_001029859chr1162055 1552 994 796 631 88 12431 168 --
NM_001031679chr12102613 1419 1333 1280 992 884 858 814 724 104 1590 1395 --
NM_001031812chr552216 2121 1838 1487 1459 ------
NM_001033087chr2051202 566 478 243 95 1636 12756 --
NM_001037954chr1152710 1033 447 441 319 13298 --1786
NM_001040159chr4----11079 --
NM_001042440chr521876 1457 ----12033
NM_001042555chr1264330 3840 3160 1519 816 622 13356 23406 676 13815
NM_001042599chr2107746 6988 6692 6617 6007 5073 2775 1866 1419 280 27555 4921 ----
NM_001042603chr1232111 929 720 --11578 1328
NM_001069chr6----1167 --
NM_001167chrX176195 6151 6062 5746 5618 5386 5316 5275 5221 4743 4435 4403 4397 4359 4202 993 933 --11698 --
NM_001177chr1232406 746 526 12090 11946 1243
NM_001204chr277730 6231 5782 5000 4962 2937 566 --24774 805 --
NM_001259chr766392 6276 5382 4204 1582 541 --24274 4014 --
NM_001304chr1753543 3433 3008 2870 392 --12452 --
NM_001396chr2142807 357 224 125 12746 1997 --
NM_001455chr664104 3800 3390 1253 1173 1079 24013 1509 ----
NM_001616chr21703 ----1590
NM_001742chr7----11561 --
NM_001830chrX73420 3330 1211 406 255 185 130 11020 ----
NM_001854chr111247 --11234 --
NM_001903chr51777 ----1850
NM_001918chr1147953 7684 7178 7043 5751 3661 2935 2540 2408 1806 1021 479 300 130 --17225 13395
NM_002009chr1521928 1122 ----1414
NM_002025chrX99266 8793 8411 3495 2802 2352 2255 714 181 --27112 1015 15920
NM_002040chr2142648 2352 717 233 --21287 964 21134 803
NM_002126chr1743111 2829 2809 233 1109 13642 --
NM_002214chr754413 4240 1439 1304 1053 --15674 --
NM_002270chr535044 874 612 1741 --14714
NM_002336chr1253829 3500 1484 726 102 --23314 335 --
NM_002657chr2043014 2790 234 82 --11011 13848
NM_002719chr1411620 ------
NM_002731chr162705 1235 1031 801 179 62 --12721 --
NM_003026chr921306 1206 ----11054
NM_003108chr2126958 6943 5125 4897 4533 2544 2514 2404 1399 443 396 298 25017 970 1906 --
NM_003205chr1511472 --12245 --
NM_003380chr10----1237 --
NM_003410chrX1349 --22655 2243 --
NM_003472chr621434 1386 ----1337
NM_003489chr2132606 2164 698 1290 --12459
NM_003507chr271481 773 766 734 416 267 54 ------
NM_003567chr1----1376 --
NM_003579chr1----1182 --
NM_003583chr1233350 3268 1422 --33182 2965 2847 --
NM_003644chr17135845 5695 5653 5500 5187 4754 4052 2595 2573 2454 2415 1527 1021 11126 16570 --
NM_003705chr21810 ----1556
NM_003722chr352251 1717 934 512 379 --12621 --
NM_003749chr1371817 959 927 470 208 169 158 ----12044
NM_003758chr1521504 596 --1421 11112
NM_003760chr11170 ------
NM_003822chr1------1153
NM_003895chr213883 464 64 --21956 437 --
NM_004060chr52814 258 ----1481
NM_004200chr11112671 2519 2474 1272 702 620 467 427 355 332 218 ------
NM_004331chr862376 661 640 531 471 172 ------
NM_004342chr742345 1922 1655 867 --1546 --
NM_004405chr2----11014 --
NM_004438chr212027 --13193 13069
NM_004459chr17----1761 --
NM_004499chr5----1461 --
NM_004537chr121272 ----1552
NM_004586chrX64446 3508 1667 1623 1531 1173 --35165 4900 3763 35011 4819 4404
NM_004654chrY11199 ----1243
NM_004736chr152242 1672 696 477 328 ------
NM_004745chr886639 5792 5474 5439 5108 5047 4438 427 --11961 --
NM_004748chr1583537 3190 3138 1099 810 493 483 477 11612 1803 --
NM_004845chrX53896 3839 3547 1619 928 ----11426
NM_004852chr181413001 12264 12239 12101 12082 11030 9751 9172 4272 4226 4203 4074 3871 2128 --112550 111823
NM_004921chr11952 ------
NM_004956chr764431 4189 4117 3314 2957 435 --23616 547 --
NM_004985chr1293627 3501 3432 3258 3246 1115 719 637 485 ----130
NM_004992chrX138425 7938 7803 7711 7682 7507 2986 2159 1933 1731 790 485 46 --23106 1532 --
NM_005121chr1752631 1432 1135 1066 785 ----11439
NM_005160chr2266311 6209 6071 4536 4414 75 --35574 1097 672 --
NM_005296chrX----1307 1133
NM_005466chr14----1566 --
NM_005504chr1221772 531 11438 26535 4913 12563
NM_005578chr324599 2030 14979 23321 748 11509
NM_005596chr966108 2308 2289 1204 874 204 15803 35577 1023 1012 --
NM_005746chr7----12598 --
NM_005776chr14----1775 --
NM_005857chr131220 964 485 ----2331 216
NM_005906chr631711 1507 135 ----11521
NM_005924chr73422 265 123 ------
NM_005941chr823956 3645 11331 11249 23489 3171
NM_005977chr13------1849
NM_006003chr191230 ------
NM_006016chr62723 675 ----12133
NM_006275chr2031717 775 589 --21598 704 --
NM_006379chr711469 ----11758
NM_006380chr1763781 3491 3252 3017 912 417 --11341 --
NM_006393chr1044332 3092 719 443 --24022 623 --
NM_006504chr1022047 449 --12625 --
NM_006534chr2053170 2420 1261 178 87 ------
NM_006544chr1464428 4159 2242 1699 1490 312 1848 --14646
NM_006570chr9----1362 --
NM_006599chr16107058 5466 5179 2332 2266 1803 1123 983 596 477 12727 ----
NM_006777chrX22098 242 --32755 2737 2173 --
NM_006873chr221189 261 13326 13279 --
NM_006885chr1653703 3676 2947 1137 265 13937 --11271
NM_006912chr162355 2206 2038 1985 756 579 --12298 --
NM_007011chr15106371 6216 5213 4805 4516 2577 2505 1726 612 224 15388 ----
NM_007013chr82871 754 ------
NM_007137chrX85249 4992 4862 4844 4304 3949 1648 403 11226 12082 --
NM_007150chrX32075 1919 605 --11743 11965
NM_007173chr1131603 546 485 ----1228
NM_007212chr111918 --12172 11478
NM_007249chr13118598 7685 6116 3329 1240 917 839 544 245 166 144 11251 29367 100 --
NM_007358chr1--11585 1186 --
NM_012193chr1175102 5005 3380 1952 1573 1455 1306 --2758 655 --
NM_012199chr174402 4161 4033 3990 3869 3577 709 --11657 --
NM_012207chr101784 ------
NM_012464chr432872 2675 2307 --1236 12687
NM_012465chr1062820 2805 2705 2366 1249 859 2410 144 31239 691 543 11195
NM_013255chr736566 3187 1079 18151 45561 5454 1641 1145 --
NM_013386chr131548 1340 689 --11681 --
NM_013943chr112839 --12201 1145
NM_014011chr26712 674 616 583 292 280 ----1519
NM_014048chr16104677 3307 3269 2088 1723 1685 1499 1018 504 391 21332 708 24734 4651 --
NM_014154chr311386 ----166
NM_014272chr15----1147 --
NM_014317chr10----1237 --
NM_014382chr341484 1166 270 63 11231 2685 428 --
NM_014423chr555238 5152 4908 4049 2253 --14415 --
NM_014515chr12----1724 --
NM_014577chr22------1621
NM_014584chr14--11525 --171
NM_014670chr21430 ----11464
NM_014729chr842134 1872 1593 78 --11846 --
NM_014810chr162888 2354 1453 833 825 669 1356 ----
NM_014840chr1262828 2408 2374 992 932 708 --23230 3219 --
NM_014841chr61850 ----1862
NM_014877chr1797138 6259 6179 6045 5814 2681 1540 1364 64 27446 643 1629 --
NM_014904chr1012518 23663 516 --1871
NM_014906chr1721024 69 12637 1943 --
NM_014912chr1032517 446 61 --22162 1031 13012
NM_015032chr1312736 12852 11984 --
NM_015087chr1352632 2084 1005 979 345 --12155 --
NM_015090chr1105638 5490 5313 5148 5058 4297 2295 1587 1434 1023 24563 1111 45449 4911 4118 1837 --
NM_015156chr1423081 59 ----1127
NM_015170chr83857 758 454 --11475 1287
NM_015199chr362487 926 413 389 163 64 --11110 --
NM_015265chr252363 2284 1831 762 699 ----11824
NM_015271chr432966 2875 470 --31067 987 330 --
NM_015275chr123510 271 136 --21427 754 --
NM_015299chr1493231 3162 2978 2822 1224 1110 512 332 101 --13069 --
NM_015378chr152371 2231 1002 183 86 --31147 462 224 --
NM_015564chr563396 3379 2688 1387 1344 1313 23573 2539 12633 --
NM_015635chr941373 714 121 24 --1422 --
NM_015850chr872385 1622 988 743 323 297 215 --12185 --
NM_015852chr743232 3216 2310 951 13205 ----
NM_015878chr822164 613 ----11692
NM_015906chr154343 4233 3900 3204 802 --12982 --
NM_016009chr153565 3539 3495 3032 1254 1378 --14333
NM_016132chr1523213 823 ----11113
NM_016271chr182673 143 ----11446
NM_016351chr71247 ----1488
NM_016396chr1511949 --21941 1868 1867
NM_016544chr273851 3407 3176 2784 1293 1091 944 ----13050
NM_017412chr831265 870 135 --1181 --
NM_017607chr19----1506 --
NM_017628chr464278 4239 4014 4007 3992 333 24533 545 11885 --
NM_017634chr841708 1370 690 319 1288 ----
NM_017637chr9119292 9144 8692 8302 8047 7370 7199 6918 6841 1224 952 --21442 1208 --
NM_017650chr795952 5482 4112 3837 3760 3731 1181 616 590 11194 ----
NM_017709chr154080 3729 1502 1257 85 ----14310
NM_017780chr8----1163 --
NM_017805chr19----1199 --
NM_017813chr865038 4926 4369 1152 875 248 12083 23897 2292 24825 1781
NM_018211chr121783 1738 --2647 582 12237
NM_018362chr11103853 3310 3258 2846 2800 1392 1212 1132 713 216 --11536 --
NM_018373chr1485340 4931 1461 1328 1239 1143 995 941 --21576 180 --
NM_018424chr921811 212 --31855 1358 1303 --
NM_018426chr6----1127 --
NM_018638chr1224781 1098 --11131 1237
NM_018947chr7104313 4179 4008 3504 3393 3369 3325 1248 469 447 --1557 14540
NM_019555chr31397 --1428 11451
NM_020116chr411466 ----1623
NM_020148chr1853031 2667 2121 1985 326 12314 12629 --
NM_020177chr533047 2217 1087 12851 11105 --
NM_020205chr173269 3189 3074 2872 1271 548 22 13119 ----
NM_020363chrY11766 ------
NM_020699chr185294 4941 4656 3982 3692 1710 1521 781 --14677 13383
NM_020760chr221855 1645 --11501 --
NM_020772chr17118472 8286 8153 7574 7419 5361 2754 2679 2049 393 180 --21480 684 --
NM_020794chr1----11178 1444
NM_020824chr10----1232 --
NM_020856chr1941361 1199 991 56 --11024 --
NM_021033chr1332729 1142 1072 --12404 1238
NM_021072chr532333 764 383 ------
NM_021097chr242450 518 208 181 --2990 201 12373
NM_021239chr1441343 1092 1078 1031 --1461 --
NM_021629chr393633 3366 3238 3194 1925 1899 1622 183 177 --14806 --
NM_021813chr675241 5069 4437 3605 1601 1241 47 --11487 --
NM_021914chr1422359 1589 ----12330
NM_021964chr365255 2565 2100 2068 1153 785 ----14793
NM_022133chr811507 ------
NM_022459chr1356226 3995 1986 1187 447 11371 12096 14680
NM_022763chr342245 2116 992 21 --1730 --
NM_022776chr31142 --31109 1041 546 --
NM_022840chr18--1938 11445 --
NM_022843chr131306 --2581 359 11374
NM_022894chr21517 ------
NM_022912chr21271 --12312 --
NM_023037chr133909 860 186 ------
NM_023943chr3----1217 --
NM_024315chr7----177 --
NM_024496chr14----1195 --
NM_024511chr463477 3084 3047 2713 2366 590 11283 ----
NM_024524chr322954 1286 --12746 13152
NM_024665chr344045 1841 1578 868 ----14111
NM_024721chr81868 ------
NM_024854chr1211447 ----11155
NM_024884chr1494366 4100 884 728 685 380 224 180 21 ------
NM_024947chr388818 8328 7577 6540 5996 3635 2996 61 2431 159 37797 7210 2296 --
NM_025054chr831434 397 24 --13987 --
NM_025208chr1132367 873 716 12135 --1177
NM_030627chr522585 1256 --23019 1400 12891
NM_030639chrX41410 1275 657 450 ----1337
NM_030647chr735491 5013 2338 25137 4155 11362 --
NM_030648chr485256 4466 4418 3675 3668 1879 1054 220 ------
NM_030762chr1221263 517 1138 --1596
NM_030780chr831170 431 38 --11503 167
NM_030784chr6----1355 --
NM_030791chr1461564 1437 1214 602 434 292 --21796 1653 --
NM_030817chr1263339 3288 2769 2634 988 109 --1428 --
NM_030938chr171180 --2819 186 --
NM_030939chr6--1416 ----
NM_032208chr242650 1450 894 203 --21103 665 --
NM_032229chr1321008 996 ----11066
NM_032291chr11265 --11784 11256
NM_032457chr443281 2976 536 502 13462 12876 --
NM_032458chrX------13256
NM_032558chr921237 372 --11329 --
NM_032784chr6------1979
NM_032828chr19114388 4273 3765 3390 3257 1776 1475 1337 665 474 409 --14340 --
NM_032859chr1333367 3184 998 ------
NM_033132chr13----22343 2044 --
NM_033133chr17103414 3282 3153 2382 2332 1427 894 412 405 219 --12681 --
NM_033224chr7106871 5258 5214 2301 2148 1662 1630 867 684 343 22633 855 26202 1556 --
NM_033259chr3----1744 --
NM_033389chr1794715 4339 3712 3521 1939 795 531 447 277 --34036 3594 337 --
NM_052867chr13------2302 156
NM_052927chr521505 112 --2359 181 --
NM_052978chr14----11822 --
NM_053023chr113974 226 22 12917 --13288
NM_080546chr941587 637 620 241 1475 ----
NM_080743chr622280 1834 22382 120 --183
NM_080836chr2074106 3424 3212 3030 1676 1652 911 ----1332
NM_080872chr863698 1503 1289 717 324 278 --22988 521 --
NM_133493chr634313 1617 305 13218 1288 13796
NM_138423chr1531902 1842 711 ----1196
NM_138468chr295862 4190 3903 3859 2369 2190 1541 1497 1407 --22254 1929 --
NM_138773chr51719 1168 --1162
NM_144571chr485807 2608 2443 1844 1715 1272 1214 377 12178 ----
NM_144664chr1132081 628 318 ------
NM_144967chrX2106 92 ------
NM_144979chr41225 --1115 --
NM_145263chr442082 1665 245 113 ------
NM_152253chr2264027 1521 1372 1248 941 473 --23258 952 --
NM_152374chr151429 459 146 104 50 ------
NM_152522chr2----1997 --
NM_152621chr4------161
NM_152641chr1231852 1134 806 --1981 12808
NM_152678chr31915 12196 52712 1946 713 553 229 12229
NM_152695chrX21520 267 ----1158
NM_152756chr523393 1162 --24314 1201 13056
NM_152758chr82897 282 --12509 --
NM_152787chrX23646 2948 1633 13892 13278
NM_153619chr1583483 2960 2953 2311 931 797 307 45 1486 ----
NM_173468chr445505 4980 912 468 --1573 14829
NM_173495chrX62158 2135 1864 1772 405 113 --12532 --
NM_173531chr1941258 868 852 297 13596 ----
NM_173851chr893781 3742 3338 1568 1551 1532 1352 1227 166 23563 2505 13175 --
NM_174921chr4----1410 --
NM_178123chr2------2926 168
NM_178566chr941871 557 271 118 ----11265
NM_181504chr584079 2974 2807 2556 1483 1321 537 404 ------
NM_182663chr111721 --11897 22009 691
NM_182765chr102292 231 --21625 425 1166
NM_194314chr175322 2018 1648 1585 786 717 700 --23536 2134 --
NM_194317chr231922 619 368 ----11069
NM_198443chr16----198 --
NM_198513chr831645 1275 241 ----1152
NM_198567chr52530 359 ----1213
NM_198581chr256687 5743 5607 5415 5115 25975 634 27075 528 --
NM_198715chr152243 2079 1838 1693 74 ------
NM_203459chr112049 ------
NM_203463chr274547 4405 3187 3175 1970 1936 196 11831 13623 --
NM_212558chr973784 3757 2948 2612 355 216 161 11428 ----
NM_213589chr224170 2165 23828 299 1381 --