TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-539-3p
miRNA Sequence: AUCAUACAAGGACAAUUUCUUU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000176chr563808 3302 2778 1378 1289 1247 --23620 332 23506 670
NM_000202chrX23055 2652 12985 13891 23820 622
NM_000337chr5116630 5368 4372 4245 2406 2107 1829 1262 156 128 112 14551 ----
NM_000809chr458726 7564 7557 7225 1498 16192 27567 6678 1659
NM_000831chr1104182 2482 2422 2377 2235 2221 2064 1968 1946 638 --11973 16278
NM_000912chr873535 3321 2445 1170 518 493 486 1747 --1801
NM_001002860chr1444299 4137 4108 1716 --11518 24572 3926
NM_001003652chr1888617 8604 7791 1702 1692 469 384 65 12646 --12733
NM_001003679chr131541 1462 1374 1446 22047 222 12167
NM_001004317chr644340 2982 892 259 --33911 1555 234 23167 498
NM_001005473chr564496 4485 2401 2002 1983 1936 --34463 736 406 12179
NM_001008220chr5163356 3126 2908 2825 2803 1566 1554 1522 1431 1360 1310 1295 1255 1238 1196 1103 --23916 2911 --
NM_001008408chr7106400 6348 5384 5154 5139 4285 2206 1762 1555 557 --16362 16305
NM_001009899chr365483 4545 1197 1183 1173 96 26418 1227 --14535
NM_001013620chr1266376 6120 5956 5883 2406 295 --26127 673 17454
NM_001018067chr185031 3793 3781 3738 967 957 855 507 1325 24877 3329 1971
NM_001018068chr185031 3793 3781 3738 967 957 855 507 1325 24877 3329 1971
NM_001018069chr185031 3793 3781 3738 967 957 855 507 1325 24877 3329 1971
NM_001018074chr563808 3302 2778 1378 1289 1247 --23620 332 23506 670
NM_001018075chr563808 3302 2778 1378 1289 1247 --23620 332 23506 670
NM_001018076chr563808 3302 2778 1378 1289 1247 --23620 332 23506 670
NM_001018077chr563808 3302 2778 1378 1289 1247 --23620 332 23506 670
NM_001024094chr563808 3302 2778 1378 1289 1247 --23620 332 23506 670
NM_001024855chr32576 168 ----31592 1192 174
NM_001024948chr122579 734 21108 207 32833 1068 30 22910 254
NM_001025079chr373186 1289 1276 1268 1020 572 473 --1561 23192 1316
NM_001039618chr1165552 4776 4614 3828 809 365 14090 21037 372 13870
NM_001040110chr731482 287 271 1305 21485 298 2415 390
NM_001042603chr12125345 4967 4961 4585 4354 3981 3858 3646 1874 1593 1510 1437 14629 12082 23650 1514
NM_001257chr162375 359 --1364 21115 1062
NM_001364chr1124072 807 24123 208 14077 2593 151
NM_001777chr373186 1289 1276 1268 1020 572 473 --1561 23192 1316
NM_002006chr465756 4318 4122 3691 1353 749 15806 14323 15548
NM_002092chr454939 4668 1463 1142 500 15095 --24998 976
NM_002310chr566269 4790 4583 2476 2351 656 --26272 4117 22228 1628
NM_002737chr1776400 4559 4432 1850 1767 1757 1540 35610 5236 749 --26688 6406
NM_004432chr922321 1603 --11627 21682 848
NM_005011chr731482 287 271 1305 21485 298 2415 390
NM_005056chr12135589 5211 5205 4829 4598 4225 4102 3890 2118 1837 1754 1681 94 14873 --23894 1758
NM_005095chr112071 --11654 21852 1625
NM_005121chr1753416 2965 1238 1210 705 --11231 22783 399
NM_005197chr1455688 5573 5063 4846 1685 --25066 1802 25927 5231
NM_005238chr1162250 2237 2229 2217 1086 825 ----43569 2241 2223 829
NM_005359chr1865740 5713 2139 1265 1082 651 26252 1594 35716 5209 1669 1266
NM_005901chr1888617 8604 7791 1702 1692 469 384 65 12646 --12733
NM_006047chr2063238 2819 2626 709 512 189 12595 12589 13119
NM_006298chr662451 2274 2156 2142 2091 483 --12626 1468
NM_006650chr5163356 3126 2908 2825 2803 1566 1554 1522 1431 1360 1310 1295 1255 1238 1196 1103 --23916 2911 --
NM_007038chr2145384 4191 2374 796 --56062 5530 4397 945 803 --
NM_013255chr768837 8422 6211 5532 1147 543 11910 26190 1184 38703 7052 1286
NM_013261chr463344 1314 363 337 308 300 ----23721 2575
NM_014423chr5103825 3574 3534 2241 1256 1196 1078 952 703 648 ----13544
NM_014992chr145258 235 210 148 138 ----1128
NM_015271chr434194 3732 646 ----23977 3766
NM_015317chr221022 58 ----32843 2829 62
NM_015397chr96747 489 472 456 424 414 --3463 431 87 --
NM_015458chr875257 4967 1942 1391 938 922 630 14103 14946 21701 154
NM_015569chr194242 4206 3310 3243 3232 3225 1471 1334 96 --34251 3937 3272 --
NM_015640chr185031 3793 3781 3738 967 957 855 507 1325 24877 3329 1971
NM_015886chr844887 1593 364 340 23983 1106 14016 21309 372
NM_016083chr643414 1090 1068 551 11078 23276 1071 12971
NM_016507chr1762955 2389 2383 2371 771 406 --22394 2376 12520
NM_017447chr2154133 4023 3356 1709 956 11668 13480 24163 508
NM_017644chr343585 1078 352 340 24285 316 14351 11994
NM_017650chr7105342 5162 5140 4722 1862 1619 815 491 321 136 15782 --24865 4796
NM_017813chr895577 5461 4751 3903 2277 2270 1504 1033 644 --24305 1266 --
NM_017848chrX91732 1577 1036 1014 936 912 889 881 837 ----1875
NM_017902chr10185145 4707 3880 3715 1727 1039 953 935 913 874 864 852 562 357 337 329 299 264 14578 ----
NM_018157chr1282671 2570 2370 1285 1165 940 928 588 --2945 361 --
NM_018403chr354036 3700 3418 2670 804 24016 1072 13813 21614 808
NM_018440chr868641 7718 7638 5583 3093 2359 ----22886 322
NM_020718chr1676493 6472 2421 1569 148 140 122 --21092 133 11573
NM_020772chr17107801 7775 7213 6760 6334 3134 3112 2238 1452 1335 36545 1602 301 26879 3151 --
NM_020844chr897428 6986 6941 5247 5133 5110 4812 1456 1292 16098 --12634
NM_020951chr1972393 880 741 715 675 491 135 12051 3744 729 680 --
NM_021061chr83641 562 541 --11804 2581 475
NM_021072chr521607 921 --12573 32480 2363 760
NM_021813chr6105384 5112 4808 4545 4457 4444 4428 4398 3643 2248 13869 --12121
NM_022781chr983165 2475 528 453 419 244 203 81 --63339 494 468 446 273 137 --
NM_024744chr231995 389 381 --11844 22345 375
NM_024900chr481825 1465 714 705 697 648 577 562 --11796 --
NM_024900chr481825 1465 714 705 697 648 577 562 --11796 --
NM_024947chr3108110 6491 6436 3711 3625 3041 2687 2147 1825 1373 35861 549 472 16439 19340
NM_025090chr1715606 376 358 349 280 271 242 213 186 160 146 120 109 76 65 --1114 --
NM_032505chr342459 2313 2038 878 ----22218 2136
NM_032968chrX63934 2804 1634 1415 872 343 --24177 2798 14009
NM_032969chrX63934 2804 1634 1415 872 343 --24177 2798 14009
NM_032973chrY53926 2799 1415 872 343 --24169 2793 14001
NM_033181chr643414 1090 1068 551 11078 23276 1071 12971
NM_033224chr748079 6958 6123 4949 1958 32081 1641 983 17486
NM_053043chr7106400 6348 5384 5154 5139 4285 2206 1762 1555 557 --16362 16305
NM_138459chr662591 1114 682 611 202 162 --12621 32769 2669 208
NM_152774chr762637 2479 2260 2001 726 716 --12008 1720
NM_152838chr2063238 2819 2626 709 512 189 12595 12589 13119
NM_153607chr512635 --1645 2995 987
NM_173531chr1943188 2373 1248 338 --11192 22379 330
NM_182493chr1685353 5283 5223 5048 1975 1780 1472 423 35116 4667 220 25320 1477 --
NM_182920chr36187 135 123 115 104 86 --1107 11125
NM_194328chr983165 2475 528 453 419 244 203 81 --63339 494 468 446 273 137 --
NM_194329chr983165 2475 528 453 419 244 203 81 --63339 494 468 446 273 137 --
NM_194330chr983165 2475 528 453 419 244 203 81 --63339 494 468 446 273 137 --
NM_194332chr983165 2475 528 453 419 244 203 81 --63339 494 468 446 273 137 --
NM_198560chr383669 2778 1257 1248 1237 1227 1212 1206 13484 ----
NM_198793chr373182 1285 1272 1264 1016 568 469 --1557 23188 1312
NM_206855chr695385 4799 4534 2206 2120 1283 1272 606 429 1782 25124 4364 --
NM_213589chr295316 1203 667 313 205 199 175 132 98 --23977 3789 --