TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-539-5p
miRNA Sequence: GGAGAAAUUAUCCUUGGUGUGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_003496chr74857 805 671 289 ------
NM_003498chr1662639 2501 2061 1008 791 381 22425 2250 ----
NM_003503chr12821 259 1843 1920 --
NM_003505chr751857 756 610 330 286 21302 337 ----
NM_003506chr861205 1175 888 508 456 227 21114 952 1356 --
NM_003507chr2132057 1995 1982 1949 1838 1803 1561 1329 738 595 324 103 92 21681 750 ----
NM_003557chr181560 1434 1376 538 522 440 355 90 31440 1073 303 ----
NM_003559chr1763859 3115 2410 1286 354 241 ------
NM_003563chr1721059 424 ----1437
NM_003566chr12143344 2269 2215 1150 969 864 746 644 500 360 301 209 172 47 33241 2127 759 23493 732 11130
NM_003569chr63532 518 128 --1484 --
NM_003574chr18195656 5118 5104 4615 4178 3994 3978 3851 3636 2249 1324 1125 1050 729 692 283 106 39 26 34393 4065 545 44516 4159 508 471 24750 2144
NM_003576chr1382872 2835 2704 1968 837 451 39 31 1758 --1777
NM_003580chr8151 --1592 --
NM_003581chr22951 665 ----1880
NM_003582chr1141 ------
NM_003583chr12173763 3441 3414 3249 3088 3080 2855 2693 2420 2397 1470 1438 1337 1256 1071 793 783 33554 3427 454 ----
NM_003587chr6181 ------
NM_003589chr1381370 1364 1299 391 230 198 185 76 11379 1592 --
NM_003590chr2133977 3481 3139 2985 2938 2849 1427 1320 1233 745 699 631 262 --21498 472 11113
NM_003591chr101276 ------
NM_003592chr73491 448 413 ------
NM_003597chr2112298 1901 1752 1722 837 469 418 364 313 160 33 --11794 --
NM_003601chr41187 ------
NM_003603chr462116 2067 1971 1810 680 660 ----11394
NM_003607chr1134125 4081 4070 3516 3292 3242 3059 2974 1585 1476 1066 910 653 13030 12661 --
NM_003615chr3193993 3850 3819 3694 3628 3544 3462 3311 3050 2979 2653 2568 2488 1263 979 768 603 493 363 2532 294 13001 13901
NM_003618chr251137 1124 973 466 242 --21014 962 --
NM_003620chr1721024 26 1726 --1850
NM_003622chr12142599 2548 2419 2243 2093 1853 1749 974 966 650 626 488 214 43 --1499 11612
NM_003626chr1161373 1347 1280 1235 1071 408 2256 206 11003 --
NM_003628chr22134 32 ------
NM_003629chr152297 1327 1256 826 38 32304 2276 587 ----
NM_003630chr63603 470 173 --1591 --
NM_003631chr1010894 812 787 774 765 659 642 327 226 218 1242 1262 --
NM_003632chr172865 816 ------
NM_003633chr582612 2560 2385 859 806 563 203 69 32570 1653 944 11755 --
NM_003644chr17135581 5441 5082 4400 2174 2105 1861 1698 1602 1474 1356 1348 507 24907 546 11854 16303
NM_003645chr151251 ----1192
NM_003646chr111599 ------
NM_003651chr124587 525 500 411 1534 1212 --
NM_003657chr20--1828 ----
NM_003658chr113850 721 547 ----1761
NM_003659chr281102 991 984 813 383 157 110 36 11163 ----
NM_003663chr3163368 3349 3154 2619 2436 2174 1313 1222 873 847 814 775 764 433 270 76 12525 1921 23273 2673
NM_003670chr351418 1352 1346 1167 1070 ------
NM_003671chr9123480 3428 3416 3397 2805 2498 1244 946 940 849 738 110 11366 ----
NM_003672chr12548 273 11601 2782 49 --
NM_003675chr101420 --1193 --
NM_003676chr14789 707 622 59 ------
NM_003677chr12102002 1885 835 798 761 742 735 608 600 420 ------
NM_003679chr173011 3005 2401 1321 1189 1161 323 13451 23124 36 1802
NM_003685chr193930 206 48 ------
NM_003688chrX1279 ------
NM_003692chr94709 267 105 95 1384 ----
NM_003701chr1341063 919 435 51 2956 731 1702 --
NM_003702chr82780 721 ------
NM_003711chr52247 82 ------
NM_003713chr161662 1556 1463 1398 701 117 ------
NM_003714chr563039 2483 2456 625 612 553 150 23091 858 12436
NM_003718chr73548 115 31 --1433 --
NM_003722chr392641 2555 2542 2485 1956 1796 1790 442 366 1661 1694 2288 118
NM_003725chr121107 --2439 308 --
NM_003741chr31293 --1399 --
NM_003743chr25787 690 285 193 80 11771 4903 868 258 70 --
NM_003744chr1411262 1378 ----
NM_003749chr1362238 2218 2178 2062 1674 101 --22266 335 1654
NM_003750chr103966 826 700 ------
NM_003759chr4134173 4041 2826 2790 1109 1086 1008 913 874 863 749 215 110 31636 1269 159 21101 812 14293
NM_003760chr13517 266 48 --1787 --
NM_003762chr11577 1107 21446 233 --
NM_003763chr20113080 2946 2599 2550 711 484 409 395 356 278 195 --12472 --
NM_003764chr63754 661 545 1596 2722 650 --
NM_003769chr124112 103 31 22 ----1227
NM_003772chr1141308 1185 383 71 ------
NM_003774chr12173396 3338 3328 3308 3150 2994 2507 2440 2431 2416 2406 2395 2387 2211 2174 499 486 11188 22325 450 --
NM_003778chr3--2196 141 1124 --
NM_003780chr1--1467 ----
NM_003783chr14956 459 139 130 --11055 --
NM_003784chr185704 593 256 241 223 1623 1112 --
NM_003787chr18101730 1700 1497 1484 1453 1266 1214 1189 532 491 41412 1152 550 514 1429 11387
NM_003794chr361081 1006 892 430 310 127 --1364 --
NM_003796chr191606 --1576 --
NM_003797chr111209 ------
NM_003799chr1884493 4463 3934 800 721 649 409 227 14201 32810 752 83 24290 435
NM_003800chr6102280 2001 1581 1531 634 616 488 387 124 66 12039 ----
NM_003809chr172487 469 ------
NM_003812chr21269 ------
NM_003816chr851393 1114 282 74 61 21168 1046 --1469
NM_003818chr204347 313 253 136 1851 --1985
NM_003819chr11246 ------
NM_003821chr83585 204 153 ------
NM_003822chr183210 3162 2840 2463 2447 1128 881 827 33169 3094 918 ----
NM_003825chr1551572 1393 1165 614 369 1211 11141 1984
NM_003829chr941206 772 137 80 1145 1187 --
NM_003831chr1881718 1639 1569 646 610 574 305 161 1453 ----
NM_003842chr872141 2133 1977 1970 565 189 48 --11960 --
NM_003846chr14619 312 233 197 1318 ----
NM_003850chr132215 83 ------
NM_003858chr142644 558 ----1484
NM_003861chr1472651 2586 2309 2024 1977 658 601 1579 22708 2569 --
NM_003862chr53336 107 76 ------
NM_003864chr4--156 ----
NM_003872chr24869 691 433 67 22899 643 1345 --
NM_003873chr10112371 2267 2243 1823 1795 969 947 603 593 519 208 1128 ----
NM_003877chr1241023 927 822 688 1959 ----
NM_003878chr8--1197 ----
NM_003883chr51583 --136 --
NM_003884chr381706 1520 1274 1247 714 520 382 194 11739 ----
NM_003885chr17132672 2662 2313 2305 1924 1911 1026 1010 780 616 592 376 43 22418 141 22499 715 --
NM_003887chr231605 446 152 21928 1632 11837 --
NM_003888chr1561596 1234 640 364 180 57 --21713 523 1481
NM_003895chr213773 542 521 1597 21529 214 --
NM_003899chr1372082 1779 1746 635 541 340 296 --22611 2474 12308
NM_003901chr1072579 2462 2074 1780 1711 1043 854 32376 666 461 --1653
NM_003902chr13830 586 188 1300 ----
NM_003908chr2051385 1104 898 323 115 --1439 --
NM_003909chr8103026 2756 2318 2095 1884 1050 1018 679 528 118 1750 12996 12551
NM_003913chr6184322 4245 3976 3525 3403 3358 3255 2993 2689 1692 1559 1378 1306 1239 1132 935 691 658 53982 3654 1571 990 764 44166 1112 151 95 --
NM_003914chr131179 ------
NM_003916chrX51062 953 570 260 149 11339 --21328 1012
NM_003919chr72193 174 --166 --
NM_003921chr1141802 1571 1556 1495 1371 1315 1131 728 718 591 334 223 144 23 --1217 --
NM_003922chr152306 285 --1177 --
NM_003924chr471653 1598 1545 1507 1401 1309 1139 1119 11537 --
NM_003927chr1881113 1024 771 717 687 677 410 160 ------
NM_003929chr161499 1478 580 551 515 170 --2423 349 --
NM_003931chr63203 143 98 1497 ----
NM_003932chr22101849 1806 1611 1595 1470 1362 1227 770 489 319 1730 1296 --
NM_003934chr9111163 1154 1104 1092 1060 902 875 509 351 205 191 1919 31175 477 147 --
NM_003939chr1063271 1494 899 688 643 311 23896 2724 13099 13506
NM_003941chr7131862 1730 1713 1675 1627 916 753 743 701 439 364 115 30 32109 535 382 --1256
NM_003942chr113505 171 154 ------
NM_003947chr351357 1341 1053 431 413 ----1858
NM_003948chr462237 1973 1645 654 585 460 12400 12619 12284
NM_003953chr162899 2867 2847 870 661 265 52893 2798 2201 2190 576 ----
NM_003956chr105461 419 372 153 86 ------
NM_003957chr112761 746 11099 ----
NM_003966chr5377786 7608 7243 7173 6921 6630 6528 6418 6412 6328 6227 6015 5297 5240 5090 5040 3041 2963 2856 2755 2744 2728 2721 2709 2650 2341 2290 2153 2041 1994 1654 1208 1146 641 389 330 74 35857 5764 1426 1257 11032
NM_003968chr3179 --1443 --
NM_003972chr104417 367 68 47 --1894 --
NM_003980chr651301 380 335 238 45 --3911 577 271 --
NM_003983chr16124395 4384 4345 3709 3346 3288 3176 1300 922 723 684 399 23696 2875 24456 451 --
NM_003987chr1052263 1591 1566 1467 389 ------
NM_003988chr1052340 1668 1643 1544 466 ------
NM_003989chr1052199 1527 1502 1403 325 ------
NM_003990chr1052199 1527 1502 1403 325 ------
NM_003994chr1274118 3367 3280 3110 1683 1570 1319 13850 32684 1723 462 11365
NM_003998chr43666 479 161 --1496 --
NM_004001chr15569 448 440 414 122 --1456 --
NM_004006chrX162573 2301 2175 2160 2131 2041 2020 1935 1747 966 760 753 737 561 226 184 1914 31737 846 342 --
NM_004007chrX162573 2301 2175 2160 2131 2041 2020 1935 1747 966 760 753 737 561 226 184 1914 31737 846 342 --
NM_004009chrX162573 2301 2175 2160 2131 2041 2020 1935 1747 966 760 753 737 561 226 184 1914 31737 846 342 --
NM_004010chrX162573 2301 2175 2160 2131 2041 2020 1935 1747 966 760 753 737 561 226 184 1914 31737 846 342 --
NM_004011chrX162573 2301 2175 2160 2131 2041 2020 1935 1747 966 760 753 737 561 226 184 1914 31737 846 342 --
NM_004012chrX162573 2301 2175 2160 2131 2041 2020 1935 1747 966 760 753 737 561 226 184 1914 31737 846 342 --
NM_004013chrX162573 2301 2175 2160 2131 2041 2020 1935 1747 966 760 753 737 561 226 184 1914 31737 846 342 --
NM_004014chrX162573 2301 2175 2160 2131 2041 2020 1935 1747 966 760 753 737 561 226 184 1914 31737 846 342 --
NM_004015chrX162573 2301 2175 2160 2131 2041 2020 1935 1747 966 760 753 737 561 226 184 1914 31737 846 342 --
NM_004016chrX162487 2215 2089 2074 2045 1955 1934 1849 1661 880 674 667 651 475 140 98 1828 31651 760 256 --
NM_004017chrX162573 2301 2175 2160 2131 2041 2020 1935 1747 966 760 753 737 561 226 184 1914 31737 846 342 --
NM_004018chrX162487 2215 2089 2074 2045 1955 1934 1849 1661 880 674 667 651 475 140 98 1828 31651 760 256 --
NM_004020chrX162573 2301 2175 2160 2131 2041 2020 1935 1747 966 760 753 737 561 226 184 1914 31737 846 342 --
NM_004021chrX162487 2215 2089 2074 2045 1955 1934 1849 1661 880 674 667 651 475 140 98 1828 31651 760 256 --
NM_004022chrX162487 2215 2089 2074 2045 1955 1934 1849 1661 880 674 667 651 475 140 98 1828 31651 760 256 --
NM_004023chrX162487 2215 2089 2074 2045 1955 1934 1849 1661 880 674 667 651 475 140 98 1828 31651 760 256 --
NM_004028chr18134102 3838 2960 2873 2549 1374 1322 1283 1272 1241 977 897 216 12815 1611 --
NM_004035chr17204979 4811 4480 4205 4196 3827 3676 3517 3383 3373 3366 3208 2028 1160 1075 1063 920 522 383 73 24849 1165 1600 11030
NM_004036chr23622 580 49 ------
NM_004040chr251269 1212 1165 1129 1121 ------
NM_004050chr1452727 2683 2461 2395 2378 ----12433
NM_004061chr53594 161 43 1265 ----
NM_004063chr85958 771 309 301 96 --1143 --
NM_004064chr1271272 1130 906 863 527 431 227 ----1957
NM_004067chr751227 1169 1024 458 429 11000 --175
NM_004071chr23213 104 58 --1267 --
NM_004077chr1231186 1097 536 ------
NM_004079chr1122959 2854 2780 2720 2288 1967 1820 1812 1149 665 461 48 --163 --
NM_004080chr761481 1321 1113 547 265 240 11030 11020 11060
NM_004081chrY61882 1734 1654 580 566 357 ----11474
NM_004085chrX2194 153 1281 ----
NM_004086chr14----2637 629 --
NM_004087chr391757 1508 615 569 519 317 81 45 22 31605 464 140 --1211
NM_004093chr1353281 3131 2403 2310 1113 12862 ----
NM_004094chr14132913 2517 2218 1870 959 842 835 807 409 285 210 117 110 ----22844 2351
NM_004096chr1082109 1895 1798 1390 1367 730 646 248 --1184 --
NM_004100chr662388 2210 1645 824 54 29 12372 31857 1834 554 --
NM_004103chr83767 718 712 2806 752 ----
NM_004105chr221075 856 ----1907
NM_004109chr1171924 1624 1616 806 251 175 44 1257 --161
NM_004113chr361783 1402 769 735 616 508 --12015 --
NM_004114chrX2503 456 1258 1794 --
NM_004117chr671662 1624 1534 819 743 500 280 --21730 409 11696
NM_004124chr14143152 3128 2671 2348 2297 2175 1433 1405 1396 701 629 579 265 232 ------
NM_004128chr132476 135 1164 1122 --
NM_004133chr892642 2602 2431 2317 1910 1832 630 236 138 22541 493 22032 743 --
NM_004136chr1593286 3051 3022 2908 2730 2639 2198 1183 966 11286 22881 909 1985
NM_004157chr32780 772 ------
NM_004161chr231506 1031 507 123 --11514
NM_004162chr32163 125 --31001 466 325 1266
NM_004169chr175829 777 756 154 130 2239 145 1869 --
NM_004170chr931467 496 388 2603 328 ----
NM_004171chr11389439 9031 8664 8149 7858 7737 7642 7618 7394 7365 7336 7175 7146 6881 6701 6584 6578 6423 6316 6190 6001 5847 5833 2832 2603 2516 2344 2317 2117 2108 1830 1785 1429 940 914 298 106 78 89542 9452 8250 7085 3181 2441 1684 218 89196 8240 8204 6548 5898 3518 2804 2706 --
NM_004172chr591724 1634 1561 1323 774 472 311 206 24 ----21931 1307
NM_004175chr223176 105 34 ------
NM_004180chr25607 581 396 161 131 --1532 --
NM_004187chrX21202 1116 --11337 --
NM_004200chr1153249 2888 348 242 160 --23194 2224 --
NM_004202chrY1595 153 ----
NM_004205chr11157 ------
NM_004208chrX171 ------
NM_004225chr841492 1252 599 462 ----1571
NM_004227chr753001 2951 2847 2583 596 12939 1512 11137
NM_004229chrX102171 2019 1906 1873 1776 1735 1543 1528 694 388 1323 ----
NM_004232chr18143849 3722 3567 3473 3382 2849 2819 1476 1359 932 863 609 597 324 --53839 1176 1062 911 652 --
NM_004233chr621455 647 1278 --11065
NM_004235chr93736 638 52 ------
NM_004241chr103714 290 23 ------
NM_004242chr63321 92 64 ----1310
NM_004244chr124440 427 373 98 1378 ----
NM_004249chr4----1109 --
NM_004252chr174501 463 119 60 --1134 --
NM_004261chr141001 670 319 195 3941 823 809 11020 1930
NM_004272chr562037 1886 1638 790 482 296 21653 1528 41813 1279 1262 777 1472
NM_004274chr14113189 2535 2468 2237 2204 1251 847 694 448 318 176 22989 2907 --1759
NM_004277chr661684 1482 1225 578 147 85 11540 ----
NM_004279chr74849 733 519 348 11522 2536 306 --
NM_004280chr62185 125 ------
NM_004281chr102407 174 ------
NM_004282chr62562 204 1654 ----
NM_004285chr1126441 6416 6402 6236 5989 5853 5378 3954 2123 1808 1778 782 --11694 1961
NM_004286chr2251999 650 634 391 248 11758 12302 --
NM_004290chr591252 1198 1123 1070 1021 505 298 181 38 ------
NM_004291chr51294 ------
NM_004293chr9103789 3307 3162 3008 2549 1249 978 773 544 421 33794 1394 315 11341 --
NM_004296chr1423328 1421 11510 23984 1504 --
NM_004301chr32134 106 ------
NM_004311chr10112984 2814 1972 1056 1044 924 848 640 476 337 89 --22780 1256 1199
NM_004316chr1241181 1085 729 82 21107 445 ----
NM_004319chr193017 2722 2548 2536 1083 556 286 87 78 --1234 --
NM_004323chr972168 2087 2024 1713 831 295 194 --22491 84 --
NM_004326chr171114 991 975 759 402 234 220 11252 ----
NM_004327chr2272419 2045 1771 875 591 570 334 ------
NM_004329chr1031355 1340 111 11241 ----
NM_004330chr156925 459 382 361 91 58 1126 1186 --
NM_004331chr8121942 1865 1751 1736 1689 896 881 874 825 804 748 455 22557 2126 32087 1829 889 22390 855
NM_004337chr8102316 2260 1976 1947 1913 684 290 262 135 49 31634 1524 788 --1279
NM_004338chr1896747 5631 5517 4699 4496 1630 870 445 139 65436 4969 4951 4838 1263 1014 27033 993 16644
NM_004341chr2----1234 --
NM_004342chr742318 617 409 220 32309 1620 558 21981 643 1121
NM_004346chr451545 1506 1437 495 345 11446 21395 1021 --
NM_004349chr841126 1056 913 230 --11265 11034
NM_004352chr16--1436 ----
NM_004354chr44613 584 575 308 1828 1235 --
NM_004360chr1692010 1951 1637 1487 779 629 408 222 98 41795 1643 331 72 11854 1205
NM_004362chr4199 2764 667 --1722
NM_004368chr197851 843 418 371 321 159 57 187 ----
NM_004370chr672178 1552 1510 1456 782 647 58 12053 --22200 2070
NM_004371chr12977 139 11206 ----
NM_004379chr241234 1106 705 103 --197 11501
NM_004380chr1682518 1013 730 645 489 357 242 158 ----1863
NM_004383chr151122 --1407 --
NM_004384chr5122249 2142 1884 1819 1756 1606 1524 1473 730 410 178 164 1416 11578 11951
NM_004385chr52682 105 --1242 --
NM_004386chr1922311 1652 --1802 --
NM_004389chr24724 625 70 30 ------
NM_004392chr1392648 2462 2252 1983 1971 1772 555 324 169 2695 573 12575 --
NM_004393chr382022 1579 617 535 400 266 217 211 1641 ----
NM_004395chr51180 1718 ----
NM_004396chr17--134 ----
NM_004397chr11164168 4045 3352 3344 2993 2888 2830 2747 1187 1053 1010 673 667 546 532 138 23552 89 1761 --
NM_004402chr161639 1564 1325 322 163 85 ----21680 456
NM_004405chr24925 699 403 232 ------
NM_004407chr45966 874 750 720 366 --1120 --
NM_004415chr64754 596 296 274 ------
NM_004423chr322671 1094 --1767 12181
NM_004426chr1291976 1966 1633 1231 534 497 425 214 195 1697 11769 --
NM_004428chr12787 728 ------
NM_004429chrX61450 1369 565 391 145 121 11465 1543 --
NM_004430chr882656 2437 2320 2181 2068 1901 1879 1851 22046 721 32780 2518 1065 --
NM_004431chr15844 811 787 746 102 ------
NM_004432chr992390 1911 891 664 492 411 404 391 152 22418 2052 1306 21944 1578
NM_004433chr141291 679 630 521 ------
NM_004434chr1441780 1299 1203 77 ----11433
NM_004436chr11220 1669 ----
NM_004437chr1143388 3013 2953 2920 2464 1251 1044 1028 985 867 652 631 202 141 33209 1240 490 23266 3055 --
NM_004438chr273147 3004 2721 2466 923 673 448 1226 13198 12220
NM_004440chr641995 1847 707 693 --21662 1620 --
NM_004441chr351193 1065 495 409 385 --11272 1171
NM_004442chr151124 1116 633 355 251 --21587 586 --
NM_004444chr72582 568 --1546 --
NM_004447chr1261167 983 968 871 206 174 11106 2227 94 --
NM_004449chr2121164 934 1587 ----
NM_004451chr111619 ------
NM_004454chr372138 1965 1955 1932 806 660 247 11836 ----
NM_004456chr71206 ----1234
NM_004457chr251632 1594 1082 622 135 --1254 11373
NM_004458chrX92529 2459 2392 2307 2229 2138 1812 844 749 11789 ----
NM_004459chr1791898 1740 1508 1428 1334 1257 795 550 454 41599 1562 1500 459 ----
NM_004462chr85663 654 439 86 53 1424 ----
NM_004464chr4164206 3861 3705 3670 3621 3469 3447 3343 3229 3220 3084 1529 602 360 354 49 54252 3329 1535 462 431 53244 2949 891 568 309 13289
NM_004469chrX277 35 ------
NM_004472chr53658 574 55 2669 474 ----
NM_004481chr132564 2547 648 32473 736 81 1977 --
NM_004482chr27932 891 773 762 721 617 174 3779 674 43 2596 126 --
NM_004483chr161490 1201 ----
NM_004484chrX2304 89 174 1350 --
NM_004494chr141039 990 884 811 ----11082
NM_004496chr1481255 1196 946 918 406 307 235 124 21164 952 11152 1137
NM_004498chr15157 1351 ----
NM_004499chr5--1357 ----
NM_004500chr1481455 1423 1322 695 627 596 497 229 11526 31673 775 40 173
NM_004501chr174087 3189 944 535 171 146 66 1562 43585 992 719 34 2772 358
NM_004502chr171173 1207 ----
NM_004504chr283089 2824 2793 2766 2755 2043 1055 978 22718 2485 62670 2191 925 855 496 295 --
NM_004505chr1772026 1761 1384 1318 551 527 425 21283 1271 11682 1517
NM_004514chr17103092 2952 2456 2432 2163 926 834 820 483 439 12351 ----
NM_004516chr1951272 1177 845 413 252 3510 238 106 ----
NM_004520chr54757 589 569 506 --1744 --
NM_004521chr102369 352 ------
NM_004523chr1061592 1289 1269 1231 521 29 --31508 569 450 --
NM_004525chr251094 948 461 174 54 --1110 --
NM_004528chr1172 ------
NM_004529chr971367 1294 1148 1088 1033 563 76 --21257 163 --
NM_004535chr2061580 1473 1382 1342 1180 245 ------
NM_004537chr1281448 1324 1296 1209 1067 437 394 364 21356 581 11494 --
NM_004538chrX6736 690 678 309 285 134 1797 ----
NM_004540chr213868 776 605 --192 --
NM_004543chr23351 145 108 --1254 --
NM_004549chr1171568 1554 1533 1356 1190 567 46 170 ----
NM_004561chr1181773 1276 1153 732 696 647 200 192 11287 ----
NM_004566chr1062326 2178 1802 1664 357 35 --22301 1756 --
NM_004569chr141644 ------
NM_004571chr21123428 3401 2944 2637 2311 2144 845 658 609 573 217 67 ------
NM_004575chr451559 1506 1256 553 51 21630 191 --1413
NM_004578chr14872 610 367 89 1909 1238 --
NM_004580chr1531676 1608 1567 --1185 11149
NM_004583chr172749 724 --1132 --
NM_004586chrX135151 5042 4840 4305 4148 3991 2169 1848 1803 846 500 487 323 54774 4332 3814 1108 711 35115 1990 1947 13691
NM_004588chr1194022 3905 3450 2923 2797 2692 2617 2595 918 13179 ----
NM_004593chr35873 301 270 236 61 1688 ----
NM_004596chr19--1219 ----
NM_004598chr5153324 3016 2919 2859 2560 2478 1223 1143 1075 1046 1000 939 788 483 226 23106 534 1282 1760
NM_004599chr223685 677 568 --143 --
NM_004600chr161506 1492 1102 981 966 606 31146 580 369 ----
NM_004602chr2091436 1360 1154 935 929 600 560 336 82 --11297 --
NM_004607chr52206 66 ------
NM_004612chr9164805 4798 4550 3954 3724 3384 3347 3243 1466 1173 1113 1085 828 762 249 32 23778 480 44340 3814 1023 159 --
NM_004614chr1642446 1807 1716 650 --11734 11937
NM_004615chrX3882 797 749 ------
NM_004619chr161687 1396 276 255 228 116 22239 509 21931 237 --
NM_004620chr113561 485 177 1207 1146 --
NM_004622chr2102472 2187 1982 1911 1711 1565 810 289 271 198 21499 119 ----
NM_004626chr113525 474 457 ------
NM_004630chr1151142 1043 482 438 255 --11130 --
NM_004631chr161330 900 564 205 127 86 --21228 1032 --
NM_004635chr32943 758 ------
NM_004637chr361291 1207 1152 998 987 406 ------
NM_004640chr62168 151 ------
NM_004643chr148834 805 738 724 581 570 546 117 1692 ----
NM_004654chrY7979 953 947 549 461 335 63 11120 ----
NM_004660chrY42163 2080 1755 710 --11492 1752
NM_004663chr1581557 1455 1244 1165 1052 603 564 512 21205 192 1120 --
NM_004666chr641314 1298 217 113 11400 ----
NM_004670chr1051687 624 451 56 21 1459 --1296
NM_004671chr18148 ------
NM_004685chr13103019 2536 2251 2021 1975 1086 947 555 542 477 1368 31105 865 779 --
NM_004687chr1731742 663 274 21658 1459 --1594
NM_004689chr141343 ------
NM_004690chr62730 715 ----2809 668
NM_004696chr17864 838 795 649 303 294 126 ------
NM_004698chr11213 ------
NM_004703chr1752340 2236 1975 723 294 --21828 954 1866
NM_004705chr113845 734 722 126 ----
NM_004709chrX21694 229 11571 2449 255 1344
NM_004713chr144751 552 261 156 ------
NM_004717chr731174 532 371 --11382 --
NM_004718chr23441 106 78 159 ----
NM_004719chr1292709 2138 1934 1895 643 516 468 417 120 --11981 --
NM_004721chr31284 --1353 --
NM_004723chr131029 730 692 ----1974
NM_004725chr1081499 1243 1203 1105 1008 394 285 153 --11321 --
NM_004726chrX165304 5237 4296 3869 3725 3713 3586 2004 1996 1784 1768 1673 1570 747 143 53 45683 5458 4945 3892 23484 1658 --
NM_004730chr551977 1944 1879 1602 323 1412 21986 527 --
NM_004731chr1241712 1682 549 396 21841 57 --11887
NM_004733chr31174 --1546 --
NM_004734chr13143113 2957 2896 2802 2779 2712 2305 2284 2157 683 653 509 355 161 33118 2427 690 11043 1480
NM_004736chr182125 1854 1838 1813 783 448 424 171 2623 561 11415 12248
NM_004738chr2022211 908 22558 746 11970 --
NM_004741chr103336 235 55 ------
NM_004742chr321581 356 --11542 --
NM_004744chr4123755 3747 3681 3587 2762 2750 1070 1058 1022 702 450 314 63731 2800 2735 1335 935 512 13763 11499
NM_004745chr8146810 6671 5857 5198 4866 4316 2663 1554 893 860 819 352 346 80 36687 6497 5736 76960 5451 1966 1390 1101 827 277 36593 2394 2366
NM_004748chr15203975 3808 3797 3488 3392 3384 2941 2897 2781 2744 2573 1638 756 607 539 250 195 61 43 25 --32839 1311 1235 --
NM_004755chr141823 1130 21086 487 --
NM_004757chr48702 621 583 533 274 242 176 97 ------
NM_004759chr131621 1600 688 144 11632 --
NM_004760chr7112432 2216 2097 1976 964 619 566 311 266 222 32 41612 977 537 428 12487 1661
NM_004762chr1741854 451 281 148 ------
NM_004764chr126586 533 235 139 53 30 1213 ----
NM_004768chr131153 732 349 11071 --165
NM_004772chr571386 1359 1250 1153 1116 614 74 1394 ----
NM_004774chr17113125 2879 2839 2683 2146 1997 1116 805 354 347 336 23087 548 12322 11955
NM_004775chr18122360 2330 2198 2121 2027 1787 893 678 653 442 276 105 32236 2180 611 11534 11913
NM_004776chr20103312 3222 2412 2031 1210 1148 1122 860 508 62 23340 2679 ----
NM_004779chr541117 1080 823 360 --21339 904 --
NM_004781chr141278 642 132 105 --11492 --
NM_004781chr141278 642 132 105 --11492 --
NM_004785chr162492 370 ------
NM_004787chr42148 123 ------
NM_004788chr1192054 1908 910 736 579 375 103 91 65 11755 1350 --
NM_004789chr91372 --2358 31 --
NM_004791chr133126 119 34 --2545 250 --
NM_004792chr21156 ------
NM_004794chrX146 ------
NM_004795chr1381736 1687 1547 642 369 339 248 126 21809 1416 11508 1428
NM_004796chr14112382 2264 2205 2044 1696 1667 1655 1599 622 438 43 22397 2217 11839 --
NM_004797chr3123687 3605 3574 3439 3268 3227 3211 3195 2754 2521 930 922 13658 13448 11393
NM_004801chr241567 1161 978 277 21059 176 ----
NM_004804chr23497 447 262 --21875 234 --
NM_004808chr1071066 452 390 315 263 165 59 42715 2251 398 291 1587 --
NM_004815chr1224877 4835 4153 4135 4097 4071 4058 3690 3561 3208 1910 1886 1851 1663 1468 1200 674 555 415 369 262 227 33761 776 739 --1533
NM_004818chr12--159 ----
NM_004820chr82120 78 --168 --
NM_004821chr55636 610 593 585 195 --1538 --
NM_004824chr671359 1251 942 920 484 302 294 --1391 11483
NM_004830chr64801 784 341 190 --2841 711 --
NM_004834chr273415 2805 2728 1327 953 867 655 23104 198 2700 500 --
NM_004835chr32325 170 ------
NM_004835chr32325 170 ------
NM_004836chr22337 110 ----1855
NM_004837chr151703 1336 420 380 330 11099 ----
NM_004840chrX72066 1880 1817 1716 816 228 143 1235 ----
NM_004841chr161064 1042 977 799 471 307 ------
NM_004842chr661614 1485 1479 663 551 100 31727 1449 671 11146 31456 1421 1122
NM_004849chr671605 1344 1047 1039 588 472 330 11285 21384 1169 --
NM_004850chr231292 1286 532 --11130 --
NM_004856chr151378 --152 1414
NM_004857chr14184693 3940 3920 3898 3878 3304 3234 2915 2908 1888 1835 1655 1646 1473 1057 1024 1011 425 44698 3490 3374 1460 24081 3107 173
NM_004859chr1762684 696 569 263 248 135 --12403 --
NM_004860chr171393 ----1559
NM_004863chr14135188 4618 4488 4455 4094 3761 3742 3733 3370 3340 1213 1206 627 44495 3536 1374 238 23544 648 23688 3578
NM_004865chr62369 319 1417 ----
NM_004866chr5194979 4705 3863 3541 3467 3364 3312 3210 1890 1713 1696 1683 1433 939 542 407 243 74 45 44017 1751 1062 182 21649 708 34506 3072 611
NM_004867chrX5574 483 455 257 229 2598 466 ----
NM_004869chr1871168 1093 559 340 301 55 41 --1585 --
NM_004871chr17104354 4263 3733 3596 3582 3437 3114 389 367 176 12899 32978 2956 204 13144
NM_004873chr14123122 3098 3020 2958 2932 2619 2453 1990 1982 1193 555 391 1468 13065 --
NM_004874chr81409 ------
NM_004879chr115649 302 239 202 149 ------
NM_004884chr1561363 1341 1218 431 115 68 1419 1290 --
NM_004888chr96883 689 388 371 295 248 1302 1829 1216
NM_004891chr21223 ------
NM_004893chr51466 ------
NM_004896chr1061215 1036 503 342 207 193 --11289 --
NM_004897chr105927 781 594 142 113 3757 731 629 1828 1181
NM_004898chr452848 2295 817 692 252 1824 --1891
NM_004902chr204799 758 562 37 ------
NM_004904chr7276517 5997 5864 5489 5466 5043 4410 4336 4322 4281 4260 4085 2616 2534 2527 2030 1961 1788 1500 1338 1140 675 608 233 129 72 58 45416 1152 629 509 35403 4709 2575 14181
NM_004906chr66693 560 536 270 149 134 ------
NM_004912chr771413 1376 1293 1141 591 512 55 ----171
NM_004915chr214846 801 744 516 ------
NM_004922chr101224 --11003 11022
NM_004924chr1931091 1043 1030 ------
NM_004926chr1471785 1489 1359 1323 1314 676 304 11866 11779 --
NM_004929chr851048 445 433 156 84 --11243 --
NM_004932chr54531 198 192 155 11293 21413 58 --
NM_004937chr1782542 1972 926 673 592 507 344 243 ------
NM_004938chr971236 1193 1041 431 351 150 95 --1772 1419
NM_004947chr382575 1689 1602 704 276 251 234 218 --22385 685 --
NM_004949chr18111968 1794 1643 1634 1453 726 408 398 313 280 153 ----1392
NM_004952chr11692 1928 ----
NM_004954chr111289 ------
NM_004956chr784514 3874 3669 1018 888 106 86 46 --43682 2853 2787 1838 --
NM_004958chr12917 33 ------
NM_004961chrX41364 1200 571 113 --1378 --
NM_004964chr14579 546 407 46 1379 182 --
NM_004965chr214205 150 117 67 ------
NM_004966chr102990 168 2215 154 --1382
NM_004967chr42461 179 1407 ----
NM_004969chr102194 90 --1229 --
NM_004972chr931008 823 168 2293 236 2798 465 --
NM_004973chr6111577 1256 1222 1158 1066 549 414 355 308 118 37 ------
NM_004976chr11115153 4238 4193 4186 3690 3591 3567 3559 3410 1517 1353 --25194 1455 --
NM_004979chrX41052 971 67 39 --1206 --
NM_004985chr12224493 4323 4276 3932 3735 3698 3684 3678 3250 3231 3157 3080 2963 1702 1284 895 788 599 254 173 100 51 21194 23 44201 3792 1584 299 24237 4221
NM_004992chrX157239 7227 7125 7017 6728 6168 5773 5586 5477 5426 3077 3059 1233 1214 118 1191 17047 --
NM_004992chrX157239 7227 7125 7017 6728 6168 5773 5586 5477 5426 3077 3059 1233 1214 118 1191 17047 --
NM_004993chr1471270 987 552 539 363 345 243 --1296 1419
NM_004995chr1421529 1490 ------
NM_004996chr1641660 1632 1326 541 --11787 --
NM_004998chr153893 648 403 2850 729 ----
NM_004999chr6114470 4389 2805 1660 1241 1063 924 859 658 527 493 44258 3746 334 269 44434 3221 1292 195 14240
NM_005006chr231028 795 359 --2786 81 --
NM_005010chr722028 693 21478 203 21759 32 11902
NM_005011chr741705 1690 163 48 11365 ----
NM_005016chr124361 149 120 70 --1257 1330
NM_005020chr73597 555 454 ------
NM_005021chr63146 132 68 1156 2319 104 --
NM_005022chr172223 83 ------
NM_005023chr541384 1024 485 241 1947 ----
NM_005027chr1951086 424 209 199 151 --1110 --
NM_005028chr1092361 2248 2117 2086 1901 1585 832 596 203 ----1788
NM_005032chrX1926 --1304 --
NM_005036chr22118367 7103 6636 6574 6326 6075 5322 1653 1610 1508 1442 57024 5393 3183 3175 1493 58122 7395 5963 3007 2866 25436 2935
NM_005044chrX134462 4274 3901 3781 3722 3620 3415 3260 2921 1711 1354 483 123 32847 1338 504 13675 1491
NM_005045chr74863 847 789 21 1835 ----
NM_005054chr261789 1770 1732 1311 1236 644 --1341 --
NM_005056chr12185608 5284 5139 5019 4768 4530 4365 4251 3816 2192 2178 1867 1745 1548 1397 1364 1258 770 25315 2163 35380 4504 1442 13810
NM_005057chr111776 31798 1235 29 ----
NM_005063chr10123818 3758 3556 3243 2891 2613 2452 1451 1388 825 814 676 23130 28 1198 1848
NM_005065chr14175339 5321 5039 4985 4389 4211 4117 3722 3449 2162 2014 1974 1517 1448 1132 312 251 35344 1195 602 35273 1998 944 23471 2068
NM_005066chr14577 294 215 190 --2772 208 --
NM_005067chr31972 ------
NM_005068chr621408 443 ------
NM_005069chr2151600 1258 1194 567 546 ----11683
NM_005076chr154157 3610 3144 1050 199 24232 2642 13799 --
NM_005077chr91443 ------
NM_005078chr1561872 1563 1550 1469 1448 335 --11317 --
NM_005086chr1251571 179 168 137 129 --1159 --
NM_005087chr31782 ------
NM_005088chrX5891 751 696 344 181 ------
NM_005093chr2095271 5237 4522 4452 4007 3766 1537 1529 800 1712 11254 --
NM_005095chr162124 1681 1605 1470 889 299 12186 21497 245 --
NM_005099chr161221 1092 1084 947 939 534 ----11312
NM_005102chr21892 2798 330 --1290
NM_005105chr182044 2024 682 489 440 431 272 151 11982 2552 265 --
NM_005109chr392571 2564 2524 2035 1969 1703 929 580 480 11841 ----
NM_005112chr431035 411 81 1869 174 --
NM_005113chr143189 80 38 --1507 --
NM_005114chr44536 490 458 282 1206 1169 --
NM_005116chr2074576 4473 4379 4277 3362 3162 374 11509 23524 3442 --
NM_005119chr161226 999 988 896 447 314 2888 256 ----
NM_005121chr17133691 3425 3409 3028 2881 2871 2792 2379 2323 1365 1327 613 262 32893 2738 1040 --31153 486 175
NM_005124chr64930 743 681 139 1640 ----
NM_005126chr372261 2019 1950 1918 1569 1444 639 2675 278 1847 --
NM_005128chr213694 659 612 1641 2652 509 --
NM_005134chr181352 1668 --1229
NM_005135chr15113664 3591 2910 2904 2698 2517 2394 1257 1077 658 499 23631 36 2741 513 --
NM_005141chr43171 72 46 ------
NM_005146chr11164 ------
NM_005151chr1852089 839 719 230 59 22130 328 4953 449 313 249 --
NM_005154chr152635 501 1538 1566 --
NM_005156chr9245023 4785 4556 4518 4100 3741 3699 3665 3641 3475 3285 1675 1644 1593 1445 1229 1144 944 930 585 352 215 192 151 73959 1533 1418 1379 1180 605 265 43784 3451 1623 598 21511 1046
NM_005157chr921966 1910 1359 11564 --
NM_005160chr22256264 5983 5938 5634 5505 5446 5279 4942 4832 4745 4719 4239 2586 2427 2419 2305 2232 2027 1363 1149 1109 532 447 279 211 15383 25474 4770 --
NM_005163chr141931 --188 --
NM_005164chr1272605 2498 1856 1701 1664 663 591 --1968 12340
NM_005166chr191235 ------
NM_005168chr281758 1682 1372 1287 1173 697 384 328 --1495 --
NM_005171chr1271132 1036 891 856 419 326 23 ------
NM_005178chr191421 --1403 --
NM_005180chr10101645 1601 1550 1336 1270 1097 269 238 215 114 --1501 --
NM_005181chr85716 630 334 303 252 1779 4734 688 651 103 --
NM_005188chr11228354 8341 7987 7832 7616 7151 7126 7107 6910 5453 3335 3282 3229 3140 3039 1751 1642 1326 1224 1138 835 590 48312 8275 2790 1623 46300 6032 5487 2163 12579
NM_005190chr671087 1011 786 419 151 135 104 ----1286
NM_005194chr202507 179 ------
NM_005197chr14336178 5906 5744 5718 5377 5338 5242 4991 4860 4804 4491 4455 4447 4405 4012 2177 1737 1532 1490 1484 1475 1463 1455 1443 1420 1238 1073 986 723 199 125 92 63 --45562 4472 4373 3785 15893
NM_005201chr32949 36 1925 ----
NM_005202chr172112 2094 1990 893 195 172 146 ----11724
NM_005203chr10156 ------
NM_005204chr102789 695 ----1212
NM_005206chr173413 264 183 1209 1981 --
NM_005207chr2273688 3255 747 739 494 421 76 32886 2688 2323 ----
NM_005214chr241118 1047 203 83 ----1427
NM_005222chr76907 389 346 231 208 174 1259 ----
NM_005224chr194570 549 540 441 ----1246
NM_005227chr11507 ------
NM_005229chrX61252 961 838 399 354 279 ----21302 412
NM_005230chr121426 ----1501
NM_005231chr1151406 1375 975 273 89 11279 ----
NM_005233chr3162620 2594 2413 2019 1999 1930 1855 808 782 771 646 621 571 431 394 206 11781 12182 --
NM_005235chr2387855 7585 7573 7560 7492 7357 7280 7216 6818 6475 6416 6303 6162 5971 5892 5141 2974 2925 2694 2668 2662 2375 1908 1789 1776 1586 1387 1187 1114 887 711 698 549 533 342 317 214 67 47033 5649 5566 651 45441 5016 2081 223 2879 838
NM_005238chr11123321 2911 2655 2577 2334 2192 2174 1198 600 308 113 92 32435 1042 607 11163 --
NM_005241chr341410 1315 1265 450 1948 11066 --
NM_005243chr22145 ----1138
NM_005244chr201565 ------
NM_005245chr42544 493 1773 --1628
NM_005249chr143705 110 85 --1827 --
NM_005250chr161671 11926 1683 --
NM_005252chr145694 683 538 310 304 ------
NM_005254chr1551226 1185 953 523 506 11371 2978 452 21241 329
NM_005256chr112391 160 1797 --1246
NM_005257chr1861191 1080 902 884 309 141 1553 1381 --
NM_005259chr241548 1415 1179 1016 --1344 11496
NM_005261chr87822 795 750 719 415 267 170 1998 1343 2955 653
NM_005264chr103911 142 134 ------
NM_005273chr72341 322 ------
NM_005277chr471802 1748 1607 1435 1298 574 310 21419 1362 11642 2357 241
NM_005279chr26780 333 249 206 145 119 --1808 --
NM_005281chr13717 623 344 ------
NM_005284chr62432 362 ------
NM_005295chr71269 ------
NM_005296chrX5779 419 373 311 36 21033 784 149 --
NM_005302chr72298 177 --175 --
NM_005313chr1561122 935 477 393 279 147 1161 ----
NM_005316chr1181056 957 941 861 820 788 434 421 ------
NM_005318chr2281171 1163 868 853 814 417 70 62 --1168 --
NM_005324chr1742153 632 551 254 21588 415 ----
NM_005327chr43662 291 220 ------
NM_005328chr84733 697 246 208 --1785 --
NM_005329chr16102304 2276 2239 2194 2129 1974 1790 950 935 425 11579 --12152
NM_005333chrX7956 917 496 247 208 123 36 2357 346 1766 --
NM_005339chr4174287 4267 3982 3539 3361 3189 2893 1677 1482 1429 1334 1133 1121 904 718 219 67 32900 883 226 74305 3898 921 812 773 663 88 --
NM_005342chrX112651 2596 2540 883 851 793 646 571 328 317 238 22840 1883 ----
NM_005349chr42605 91 2615 249 ----
NM_005358chr1371674 1597 1506 582 527 285 177 21517 756 11485 11588
NM_005359chr18266524 6196 5752 5006 4992 4856 4388 4363 4263 4097 2491 2024 1894 1774 1519 1443 1352 1346 1337 1032 857 779 622 559 181 175 25759 5103 45344 5055 4162 823 --
NM_005369chrX3601 592 156 1677 1278 --
NM_005370chr1951208 1163 1145 1139 874 1182 2881 221 --
NM_005373chr131679 235 193 11248 11403 11438
NM_005375chr691007 848 798 417 390 328 268 191 106 ------
NM_005376chr131107 1080 906 ------
NM_005378chr23755 742 50 --1826 --
NM_005384chr91238 ------
NM_005385chr372538 2501 2380 765 352 241 193 12152 12416 --
NM_005387chr112713 220 --1585 --
NM_005388chr991624 1504 1340 1304 1290 1280 475 469 65 21616 402 --129
NM_005392chr941779 1208 1177 617 1206 --11480
NM_005397chr783640 3598 3346 3120 3065 2961 2834 1445 23986 712 1147 --
NM_005398chr1031156 497 232 1252 11030 --
NM_005399chr1124424 3826 3623 3374 1424 1081 988 972 811 471 266 54 23783 903 1332 --
NM_005400chr2132965 2929 2796 2674 2668 2640 2591 2258 2248 2192 1977 1216 1021 ------
NM_005401chr11184 ------
NM_005402chr771414 1369 1361 1162 587 280 265 21427 23 --11603
NM_005406chr1861633 1522 1293 260 134 89 21541 1027 ----
NM_005407chr1421001 97 1250 1197 --
NM_005409chr451100 1071 414 350 257 1773 11003 --
NM_005410chr56592 556 307 244 187 62 ------
NM_005424chr11111 ------
NM_005429chr43342 299 287 --1241 --
NM_005433chr18132616 2448 2222 2116 2048 1782 764 528 486 458 318 312 157 2677 555 12259 --
NM_005436chr10184145 3483 3470 3446 3432 3414 3227 3050 2808 1512 1389 1258 1211 817 568 371 299 203 31628 1219 1188 ----
NM_005437chr1061373 1268 1105 557 436 88 21034 287 ----
NM_005439chr122521 70 ------
NM_005443chr43573 470 435 --178 --
NM_005455chr181879 1533 1495 1432 1326 1221 399 160 --11316 11158
NM_005458chr982445 2315 2219 1945 1704 965 948 936 --22417 213 11993
NM_005461chr2091961 1701 1655 1593 1571 1472 745 696 678 ------
NM_005465chr182055 1633 1555 1475 817 618 400 354 12048 --11597
NM_005475chr1283215 2949 2890 2497 2050 2007 665 204 22965 345 1591 12263
NM_005487chr2242146 1484 256 109 11638 11566 --
NM_005493chr62786 88 1612 ----
NM_005494chr73472 200 71 1425 ----
NM_005497chr17135819 5437 4869 4861 4108 2432 1792 1620 1571 1487 982 662 607 11316 --11078
NM_005499chr191569 ------
NM_005502chr9133254 3167 3112 2983 2800 2552 2484 2452 2412 1290 1239 1148 972 21157 513 12139 12157
NM_005504chr12246619 5957 5914 5866 5689 5364 5341 5190 4749 4691 4375 4290 4253 2442 2402 2271 2121 1479 1449 786 546 452 368 149 14495 55603 4551 2247 1623 90 15049
NM_005506chr462925 2755 2439 2153 678 522 --21017 863 12426
NM_005509chr541193 747 736 104 2666 284 21707 322 11697
NM_005513chr381479 1288 561 532 425 417 242 27 1522 11462 --
NM_005519chr101516 ------
NM_005520chr54493 282 205 176 ------
NM_005522chr741349 1257 106 85 ------
NM_005526chr81286 ------
NM_005530chr1571360 525 386 311 194 115 100 21220 133 ----
NM_005536chr831090 454 294 1137 2965 383 11033
NM_005537chr133427 378 100 --1266 --
NM_005539chr101564 --11106 --
NM_005541chr21993 21191 1075 ----
NM_005542chr751940 1780 1709 1245 450 187 ----
NM_005544chr21784 ------
NM_005546chr582249 2234 2049 1902 922 475 371 359 12141 ----
NM_005561chr1361003 847 829 823 369 48 1101 ----
NM_005562chr141683 1518 1138 679 --11307 --
NM_005563chr17751 702 672 589 199 79 24 --1233 --
NM_005573chr57661 499 469 288 261 113 90 ----1718
NM_005575chr55850 683 641 632 602 1708 2558 256 1155
NM_005576chr153297 233 197 ------
NM_005578chr3245155 4984 4867 4821 4791 4775 4532 4414 4364 3910 3718 3662 3593 3398 3373 1662 1651 1447 999 950 533 361 236 150 65112 4673 3899 1940 1624 332 44109 852 805 711 21975 1437
NM_005581chr191323 ------
NM_005591chr11112486 2344 2023 1727 971 921 704 692 439 248 125 ----1877
NM_005593chr123608 509 194 --2432 106 --
NM_005595chr14940 867 860 139 1689 --1178
NM_005596chr9246175 6093 5949 5745 5524 5442 5177 5164 5156 4951 4799 4663 4084 4008 2463 2332 2084 2038 1988 1772 1660 1604 590 149 25812 1794 25917 1360 --
NM_005599chr131520 1053 998 21537 1448 1431 --
NM_005602chr381156 1134 1067 943 889 307 257 223 1928 ----
NM_005603chr1871970 1807 1556 1348 1255 739 47 11426 31954 1858 1571 --
NM_005604chr6112450 2400 2336 2279 1766 1742 945 682 581 575 109 --22368 2292 --
NM_005607chr85919 796 789 248 186 3673 202 149 1713 --
NM_005610chr12214 41 1311 2591 283 --
NM_005611chr165980 463 256 202 80 ----11329
NM_005613chr162151 2039 1596 867 496 227 12053 11362 --
NM_005614chr721050 93 ----2272 234
NM_005618chr63550 425 32 --1644 1448
NM_005625chr861052 790 760 444 342 254 --1982 --
NM_005626chr14442 357 205 103 ------
NM_005627chr63683 677 204 1742 ----
NM_005629chrX2169 162 ------
NM_005632chr161981 ------
NM_005637chr1871928 1785 1431 1312 685 368 210 ------
NM_005638chrX41509 1480 1196 288 21661 1300 1247 --
NM_005639chr121303 --21705 91 --
NM_005644chr12117 83 ------
NM_005647chrX53200 1023 1002 842 418 4869 823 700 566 13316 --
NM_005648chr8--173 ----
NM_005650chr2241196 1105 1088 359 ------
NM_005655chr831220 473 252 --21302 1090 1207
NM_005662chr8--1342 ----
NM_005665chr1184929 4880 4714 4424 4294 4204 3567 3465 3103 1978 1621 1486 835 828 671 662 351 276 24337 844 --11301
NM_005668chr5154388 3691 3580 3494 3439 3246 3201 1715 1652 1243 1148 960 833 824 624 64644 4568 4355 2813 1830 1287 21771 1167 34494 1765 1446
NM_005685chr72112 101 ------
NM_005688chr33414 100 30 21025 954 ----
NM_005707chr1541336 1330 1257 1196 1196 ----
NM_005711chr53783 437 249 1107 11026 --
NM_005715chr682734 2496 2247 2159 1782 670 629 192 --12350 --
NM_005717chr13849 346 101 1127 ----
NM_005718chr31246 ------
NM_005721chr241073 1029 858 196 --1797 1717
NM_005722chr282361 2262 685 618 612 249 164 40 12512 ----
NM_005724chr151176 ----1821
NM_005725chr152349 882 765 227 76 1390 31630 1584 436 --
NM_005730chr1283614 3294 3284 3256 3063 826 729 540 --11053 --
NM_005733chr52253 206 ------
NM_005734chr114707 666 267 96 ----1762
NM_005736chr10160 --11058 --
NM_005737chr2102851 2554 2263 2254 2188 2053 2018 1785 1134 143 --21853 381 12282
NM_005738chr761782 1352 536 522 510 40 22017 1459 ----
NM_005742chr22532 32 1313 2272 56 --
NM_005746chr792696 2551 2455 1904 1000 824 443 369 133 11807 11954 1918
NM_005748chr12123479 2899 2545 2297 2203 1255 1161 1138 888 614 598 347 23245 460 --31073 642 23
NM_005749chr174589 261 78 54 2552 61 --1151
NM_005751chr71434 1350 ----
NM_005752chr164988 877 262 86 1276 1165 --
NM_005754chr561249 1235 1132 1038 464 299 11142 --1384
NM_005756chrX41492 1438 449 196 1210 11470 --
NM_005759chr2144752 3890 3855 3846 3629 3573 3400 3079 1876 620 530 505 450 241 21866 328 54548 3995 3514 1797 356 --
NM_005765chrX2727 155 ------
NM_005766chr134492 370 348 57 1499 ----
NM_005768chr123718 669 572 ------
NM_005776chr142156 137 ------
NM_005777chr3--1110 ----
NM_005779chr5103146 3035 2952 2924 1426 795 722 361 317 26 --23398 2503 13197
NM_005786chr1851055 1027 989 963 416 21268 129 1183 --
NM_005789chr1762085 2044 1376 460 341 240 21532 179 11322 --
NM_005795chr2112853 2744 2714 2497 2355 2228 1054 988 889 824 576 ----22383 882
NM_005797chr11121769 1662 1545 1379 1301 1123 599 527 521 477 278 77 1239 51591 1366 574 383 55 --
NM_005798chr13245023 4673 4628 4622 4485 4457 4414 4397 4334 4137 4046 3645 3376 3356 3293 3246 1816 1296 928 895 876 539 530 27 23749 2113 25183 3577 15050
NM_005802chr94756 643 325 134 ------
NM_005806chr2141265 1098 980 465 ------
NM_005808chr393458 3151 2750 2455 1367 937 798 762 684 1236 1438 --
NM_005813chr292624 2500 2401 2392 1977 989 918 587 256 2547 261 1311 --
NM_005819chr183451 2835 2463 1263 1088 608 373 129 13470 23425 3178 2566 487
NM_005822chr651983 1950 1876 819 51 21721 240 ----
NM_005826chr11450 --2624 170 --
NM_005828chr17104692 4250 3775 3750 3741 3415 937 507 444 233 1724 44981 4830 4657 543 --
NM_005832chr391478 1106 504 496 418 253 231 51 26 31273 555 426 11050 1378
NM_005835chr63471 195 35 ------
NM_005836chr8147 --1471 --
NM_005839chr18970 921 904 790 700 368 358 287 1390 ----
NM_005840chrX246660 6576 6520 6186 5997 5952 5768 4802 3070 2698 2180 1436 1350 912 762 706 678 633 620 583 571 563 396 32 76899 6051 6003 2688 923 605 181 57566 7204 6964 5812 3007 17268
NM_005841chr431001 762 84 --2149 95 --
NM_005842chr13138 1596 ----
NM_005843chr271936 1855 1475 1324 1234 87 21 41592 513 503 180 2572 264 11927
NM_005850chr11145 --1162 --
NM_005853chr161413 --165 --
NM_005857chr16987 981 577 556 42 32 1603 1564 1173
NM_005859chr551560 1146 1000 513 181 1524 ----
NM_005862chr35812 676 376 298 270 1940 1723 --
NM_005863chr1071260 384 282 247 213 139 68 1559 11422 --
NM_005868chr792300 2190 2037 2031 960 706 610 533 257 1185 2557 505 12023
NM_005870chr1311041 --132 --
NM_005871chr1051044 917 784 686 669 1186 4856 847 432 66 --
NM_005872chr12353 199 ------
NM_005875chr32408 291 --129 --
NM_005880chr1691415 1271 1226 1061 612 569 316 295 34 ------
NM_005885chr541597 1559 1478 454 1625 21072 74 --
NM_005895chr12124182 4127 3603 3518 3475 3166 3034 3026 2859 2569 723 84 1395 ----
NM_005896chr23648 533 214 2283 158 3756 640 65 1777
NM_005898chr1173166 2729 2317 2199 951 785 192 22684 2214 22248 1242 --
NM_005899chr173445 349 91 1229 2329 298 --
NM_005900chr461192 1092 1008 797 788 777 1823 ----
NM_005901chr18318589 8578 8493 8421 8240 8171 7697 7547 7306 7190 6553 6308 6194 6132 6002 5972 5407 3452 3118 3007 2989 2879 2796 1732 1569 1163 1049 753 740 464 361 56605 6316 5370 2459 1786 88085 7987 7448 5909 2846 2633 1499 547 17954
NM_005902chr1584064 3966 3193 3163 1653 1225 1010 113 23578 713 24508 3260 14032
NM_005903chr5164884 4474 4401 4395 3980 3759 3664 3265 1657 1650 1002 824 686 429 300 113 44996 4121 2063 1792 54659 4167 4084 3653 2030 13216
NM_005904chr1841504 1472 1440 138 --21135 1052 --
NM_005906chr651545 1450 1150 536 89 1181 ----
NM_005907chr63635 437 347 31669 1563 1284 ----
NM_005909chr593855 3585 3371 2830 2804 2711 1367 987 571 43378 3285 3256 525 13777 1162
NM_005911chr241429 1179 1171 513 ------
NM_005920chr1103914 3395 2970 2946 2901 1382 844 272 178 107 13793 13766 --
NM_005922chr6--1488 ----
NM_005923chr64568 276 194 185 ------
NM_005924chr71928 21095 140 1979 --
NM_005927chr571118 897 813 397 354 293 82 165 1172 1914
NM_005933chr1172531 2132 1912 1111 726 676 223 11866 22068 341 --
NM_005935chr4194920 4802 4707 4701 4529 4239 4137 3923 3824 3675 3360 2091 1764 1525 466 421 303 297 40 24812 1389 33850 1382 1082 14260
NM_005937chr1783859 3317 1643 1614 1580 1514 504 460 14013 11501 --
NM_005941chr8152937 1687 1641 1341 1318 1161 812 441 433 425 417 374 338 230 23 --21230 711 13607
NM_005944chr32957 784 21218 1084 ----
NM_005953chr161102 ------
NM_005955chr1145406 5154 5143 4965 4855 4533 4341 3784 3671 2035 2017 903 770 138 34866 4839 3955 24607 3624 44881 4650 4150 1816
NM_005962chr1082312 1964 1796 891 546 325 276 243 ------
NM_005962chr1082312 1964 1796 891 546 325 276 243 ------
NM_005964chr1731480 1466 1450 --11039 --
NM_005966chr242184 2062 1653 603 12233 12315 --
NM_005968chr192195 50 ------
NM_005977chr1311028 2868 328 1129 --
NM_005982chr14192 ------
NM_005986chr13122605 2358 2259 2096 2054 2041 830 805 732 616 297 243 21786 953 22061 641 1939
NM_005989chr711509 1233 --129
NM_005994chr17--1724 ----
NM_005999chr181523 1106 1034 975 402 345 322 235 --1443 1177
NM_006007chr9114480 4467 4457 4409 4147 3822 3331 2999 1676 1585 389 --187 1861
NM_006010chr33248 226 83 ------
NM_006011chr1574045 3966 3608 3239 3182 1199 110 14159 ----
NM_006015chr141254 1113 1083 153 11185 ----
NM_006016chr6102253 2106 2065 1720 1690 1586 1445 517 421 263 --1888 12156
NM_006024chr73866 634 369 ----1928
NM_006029chr14151 1636 --1534
NM_006033chr1882350 2090 2032 1744 1605 821 706 604 1315 32277 828 593 --
NM_006036chr292516 2493 2415 2291 1974 1954 1938 390 114 2581 559 11643 --
NM_006037chr2164731 4695 3644 3501 3470 3392 3121 2978 1916 1715 1703 1672 1644 1534 702 484 44771 1549 1355 645 34327 3806 1595 --
NM_006041chr171100 ------
NM_006047chr20123334 3141 2759 2737 2529 2388 2220 1214 686 631 492 471 32575 2143 1405 12781 --
NM_006048chr151210 1192 463 419 345 ------
NM_006054chr1151523 1468 1055 528 139 11313 ----
NM_006067chr1651021 948 885 740 63 ------
NM_006070chr31114 ------
NM_006076chr732018 918 88 1278 ----
NM_006079chr68810 795 712 697 686 300 266 183 ------
NM_006080chr762670 1027 955 773 287 186 189 23021 887 --
NM_006089chrX71711 1424 1267 1261 1169 674 164 2760 489 3587 442 72 --
NM_006090chr13759 734 652 1690 ----
NM_006091chr1571744 1728 1502 1393 1376 1241 45 ------
NM_006094chr871754 954 930 741 642 152 46 1421 ----
NM_006095chr4154426 4163 4086 3776 3483 3287 3183 2916 1523 1387 911 825 554 487 205 64359 3937 2804 1619 1569 276 23518 855 1800
NM_006100chr33148 60 46 ------
NM_006106chr11103422 3360 2399 2213 1355 1259 1243 1014 553 410 13427 1237 --
NM_006107chr173523 409 54 ------
NM_006108chr1162398 2111 2000 1703 935 108 22231 2045 21749 728 --
NM_006110chr16------199
NM_006134chr2161576 1564 1374 638 124 114 --21489 161 1170
NM_006135chr131372 1310 230 --11004 --
NM_006136chr751304 1210 921 465 358 21003 241 11338 1171
NM_006139chr242820 2305 2229 2155 22621 323 1132 --
NM_006141chr1652664 2048 1956 879 865 --173 --
NM_006145chr194782 731 184 55 ------
NM_006147chr1298 56 1197 1473 --
NM_006148chr1752983 2954 2641 2596 221 32294 719 508 ----
NM_006152chr12135 ------
NM_006153chr35668 555 230 137 104 --1429 --
NM_006154chr15152924 2696 2645 2389 2309 2225 2148 1005 997 983 854 745 596 559 165 2791 364 11919 11100
NM_006157chr111332 ------
NM_006158chr861679 1539 1147 566 525 440 ------
NM_006160chr1751629 1366 624 466 27 ------
NM_006162chr1821785 470 11699 ----
NM_006164chr21398 ------
NM_006166chr1282589 1882 1672 726 563 526 492 227 51808 1613 812 318 177 ----
NM_006180chr981904 1775 520 309 276 261 244 213 ----11971
NM_006183chr121563 --1136 --
NM_006186chr261260 1240 1207 1171 1078 120 1821 11158 --
NM_006187chr1252949 1021 944 925 851 --12831 --
NM_006190chr22948 332 11001 2837 102 --
NM_006191chr123691 637 386 ------
NM_006194chr1431325 887 182 --1167 --
NM_006197chr882040 1967 1831 1765 838 755 241 214 22257 808 1137 --
NM_006202chr1991557 1528 491 472 269 245 154 148 139 --11241 --
NM_006203chr5145383 4902 4554 4299 4257 4097 3815 3490 1269 1229 942 670 581 337 24495 176 24426 3977 12005
NM_006204chr101213 ------
NM_006206chr4102720 2652 2594 2486 2197 1157 1112 893 801 510 22100 2087 ----
NM_006209chr83438 155 48 ------
NM_006212chr1144991 4889 4820 4593 3881 3581 1469 1353 1180 1108 947 839 651 485 23436 1844 21326 426 14638
NM_006216chr23666 152 94 1113 ----
NM_006226chr231380 1155 66 153 ----
NM_006232chr31221 1242 ----
NM_006237chr1362145 2130 2113 1958 369 53 --1695 --
NM_006238chr652012 310 279 261 236 2342 223 ----
NM_006241chr3111969 1846 1840 1729 1620 903 818 617 564 544 392 1599 12419 --
NM_006242chr2031593 1471 626 --2789 757 --
NM_006243chr11113 --1360 1963
NM_006246chr141503 ------
NM_006251chr5123167 2961 2729 2704 2666 2605 2289 1283 1191 1015 669 264 12988 2661 23 12854
NM_006252chr1217269 6756 6541 6234 6228 6016 5342 5303 4841 4750 2797 1788 1538 1388 1258 1163 819 648 532 259 61 57583 7156 2999 793 619 46813 6371 6089 2860 36046 5254 2746
NM_006254chr3--1353 ----
NM_006256chr162732 2098 2018 675 537 292 ------
NM_006257chr10--182 ----
NM_006258chr1041433 596 433 45 ------
NM_006259chr45968 694 296 276 77 1228 ----
NM_006264chr42457 174 1505 135 --
NM_006265chr861449 1310 322 138 125 99 ------
NM_006267chr21632 --21787 748 --
NM_006273chr171432 2149 71 ----
NM_006275chr2042382 1745 708 369 21649 769 11793 --
NM_006278chr11----1580 --
NM_006279chr12571 369 ------
NM_006281chr871144 1063 921 887 778 436 78 ------
NM_006281chr871144 1063 921 887 778 436 78 ------
NM_006282chr2074724 4661 3407 3210 3202 996 311 14345 ----
NM_006283chr8124963 4415 4153 3939 3669 3241 3096 1210 1147 1073 408 380 23579 3086 24637 1344 --
NM_006291chr1422003 1325 ------
NM_006298chr652843 2728 1112 610 542 22988 995 1631 --
NM_006299chr63242 87 79 1198 ----
NM_006300chr1952337 2234 1783 500 453 22342 1586 32313 216 107 --
NM_006305chr151201 ------
NM_006310chr1741289 1177 434 382 11188 ----
NM_006311chr17164 ------
NM_006312chr121684 1613 ----
NM_006313chr1241606 1221 1206 304 11052 --1690
NM_006315chr4134024 3871 3844 3192 2937 2801 1651 1497 1473 1247 1240 853 722 22945 1059 23428 3361 --
NM_006317chr53780 619 239 ----1668
NM_006320chr46754 327 321 314 299 252 ------
NM_006321chr362260 2183 1624 182 161 153 --12115 --
NM_006322chr133825 630 603 1841 1337 --
NM_006328chr111621 1112 ----
NM_006330chr891659 1160 1099 647 629 451 300 182 86 21651 257 21531 1362 11346
NM_006333chr21448 1104 1252 --
NM_006334chr92222 99 ------
NM_006335chr13757 391 142 --122 --
NM_006336chr961536 1332 1275 1227 230 189 ------
NM_006345chr421030 376 1335 2945 515 --
NM_006346chr134356 187 98 54 1475 ----
NM_006350chr5184 ------
NM_006352chr1142066 1922 1892 1880 1832 1794 1623 1555 823 505 482 433 333 214 11931 ----
NM_006353chr651452 1044 1013 881 60 ----1921
NM_006359chrX132359 2326 2317 2243 2233 1733 1001 896 677 496 485 363 302 1309 12472 --
NM_006360chr11121 ------
NM_006364chr148903 513 481 426 347 108 67 58 1829 1448 --
NM_006366chr631178 393 147 2849 463 1935 11293
NM_006369chr13125 116 98 1440 ----
NM_006371chr3105291 5201 4643 4404 4377 3558 774 688 666 385 3617 514 214 1816 --
NM_006372chr62441 187 1198 ----
NM_006375chrX61786 1384 616 380 327 75 --11761 --
NM_006378chr981279 1029 522 479 463 180 153 68 --11410 --
NM_006379chr772193 1775 1717 1671 934 263 161 12068 ----
NM_006380chr17134243 4210 4079 3962 3611 3440 3312 2884 1516 1254 1129 902 523 33831 3453 3024 12691 --
NM_006386chr22132462 1985 1864 1855 1658 1544 504 380 186 104 96 88 72 1526 3788 283 125 2459 326
NM_006390chr1261667 1189 675 436 413 394 31366 620 580 1704 --
NM_006391chr113327 240 233 ------
NM_006393chr10124157 3669 3561 3278 3201 2937 1482 1305 1270 1242 866 291 14109 13176 1608
NM_006399chr14----1299 --
NM_006401chr93474 428 334 1396 ----
NM_006403chr681847 1831 1773 1371 1129 372 185 89 ----11721
NM_006404chr201125 ----1538
NM_006405chr14140 --1229 --
NM_006413chr1061147 1096 974 484 466 303 --1244 --
NM_006415chr971293 1189 1114 996 972 217 175 1291 1910 --
NM_006416chr62684 566 --2671 646 --
NM_006420chr20103365 3183 2817 2657 2651 2583 2338 580 236 56 12361 32490 2260 251 12154
NM_006421chr82924 482 11126 2827 91 --
NM_006424chr421943 1772 ----11561
NM_006434chr1072969 2874 2832 2534 873 855 29 12257 23191 3175 1428
NM_006449chr281992 1758 1602 790 650 631 524 135 --11545 --
NM_006451chr53913 892 325 21034 725 ----
NM_006457chr4143163 3133 2991 2590 1630 1557 1110 1052 1005 978 878 833 208 71 31530 1516 924 43780 2958 2703 930 12620
NM_006460chr1791792 641 534 450 402 279 238 213 172 --11489 --
NM_006463chr21178 --1598 --
NM_006464chr2124629 4576 4475 3805 3238 2986 1270 935 802 447 116 76 11876 11695 14613
NM_006466chr2021073 144 1701 ----
NM_006467chr582219 939 450 375 283 101 77 27 11539 22074 1875 11506
NM_006469chr131406 1200 469 21293 409 11441 --
NM_006471chr182286 62 1262 ----
NM_006474chr1111976 1894 1880 1641 1633 1489 1404 1263 1252 661 53 ------
NM_006475chr134579 520 484 150 1241 --1612
NM_006479chr125980 922 643 399 245 --1384 --
NM_006482chr12173763 3441 3414 3249 3088 3080 2855 2693 2420 2397 1470 1438 1337 1256 1071 793 783 33554 3427 454 ----
NM_006489chr1451793 1765 247 190 90 ------
NM_006495chr173312 104 53 ------
NM_006496chr141774 698 360 328 1372 1408 1251
NM_006497chr171233 ------
NM_006502chr63348 111 38 ------
NM_006504chr10102822 2629 2575 2158 2095 1158 1088 441 225 24 --31908 1027 103 1255
NM_006516chr151102 560 262 239 126 ------
NM_006517chrX61494 875 779 596 215 73 --21969 637 --
NM_006520chrX91702 1671 1561 597 580 557 499 456 436 ------
NM_006526chr20132062 2010 1904 1869 1669 1594 1448 882 820 788 494 464 315 --31887 1399 283 --
NM_006534chr20143447 3201 2802 2375 2332 1271 1044 964 950 828 560 408 321 195 22633 2261 12511 --
NM_006536chr14986 884 646 137 --1388 --
NM_006537chr151236 ------
NM_006538chr2114166 2898 2811 1662 1519 1358 718 570 499 481 192 42776 2767 1288 335 23277 1294 --
NM_006540chr841524 1292 463 390 11545 ----
NM_006544chr14256065 5755 5735 5710 5078 4410 4257 3845 2355 2269 2209 2142 2107 2085 1848 1569 1458 1362 1345 1315 1072 912 561 500 208 35977 3804 1062 36119 4763 4278 22118 699
NM_006546chr17206617 6224 6105 5828 5792 5729 5331 4834 4639 4456 4385 2643 2394 1800 1716 1705 1215 902 487 409 15365 45646 4595 2286 393 11845
NM_006547chr7111885 1865 1760 1696 1626 1606 1495 711 553 481 126 32140 1852 1766 ----
NM_006548chr371393 1385 1277 1202 532 514 370 ------
NM_006549chr1292949 2775 2137 1099 748 720 580 572 140 --52793 2338 2053 2021 698 22260 863
NM_006554chr22293 222 --1303 --
NM_006557chr941600 622 393 41 11662 11123 --
NM_006558chr82386 67 ------
NM_006559chr14396 253 231 116 1977 154 --
NM_006561chr10216167 6154 5982 5923 5905 4531 4182 4040 3956 3880 3820 1921 1891 1525 1388 1130 1054 998 447 329 131 55881 4658 582 335 42 25291 1287 66204 6141 6086 5376 1670 532
NM_006565chr1631101 843 81 --168 11193
NM_006572chr17103426 3138 2940 2795 2332 2185 1222 588 580 143 1745 23467 1052 --
NM_006575chr1441146 1133 549 311 1999 --11356
NM_006577chr291315 1239 1228 1132 453 284 247 188 81 11017 ----
NM_006587chr471485 1431 1234 1202 1167 1053 464 3410 177 164 21263 189 11045
NM_006595chr1171989 1948 1396 1332 1285 606 254 21861 580 11416 --
NM_006599chr16318262 8087 8001 7994 7883 7568 7408 6906 6755 6397 6151 5911 5745 5381 5198 5141 5121 4991 3046 2783 2763 2083 1950 1778 1755 1734 1606 1538 814 679 389 67071 1746 881 653 511 465 97812 7063 5951 5149 2503 1674 1137 1078 1040 15064
NM_006601chr124921 840 767 321 ----1132
NM_006603chrX52032 1918 1711 607 398 31718 582 220 198 --
NM_006609chr292883 2831 2514 2035 509 233 197 178 75 32960 2500 1846 22284 130 --
NM_006614chr3163545 3463 3217 2944 2920 2561 1463 1291 1105 1015 823 704 650 642 359 160 2850 624 --11165
NM_006618chr181475 1390 522 498 464 206 188 123 31323 1112 474 31329 145 63 --
NM_006620chr6103663 3582 2950 1414 935 876 814 457 356 26 33905 737 414 11144 13011
NM_006621chr1131993 1662 1616 1604 1595 1353 735 687 277 267 103 79 58 1131 2785 628 1384
NM_006624chr1041751 562 427 273 51696 591 567 433 182 1600 --
NM_006625chr11396 ------
NM_006625chr11396 ------
NM_006625chr11396 ------
NM_006626chr9122682 2561 2345 2324 2226 2099 1999 805 660 569 458 422 32138 1063 107 31980 1790 836 12035
NM_006628chr1594695 3991 3786 3763 3601 1307 1173 1034 718 13280 31805 386 45 34433 4038 1289
NM_006629chr1872296 2181 1058 970 852 639 602 22263 1050 ----
NM_006633chr53728 113 67 ------
NM_006636chr281052 1008 952 818 793 777 151 80 ------
NM_006644chr135690 568 461 94 44 ------
NM_006646chr13103013 2916 2727 2588 2308 1971 537 524 468 440 --42550 2480 2320 1868 --
NM_006648chr91119 ------
NM_006654chr12194531 4423 4404 4061 3862 3855 3800 3559 3341 3149 1838 1773 1566 973 855 777 281 113 77 14344 34166 3970 3948 --
NM_006658chr781010 863 826 294 217 197 92 80 ------
NM_006667chrX51127 434 285 242 28 1411 ----
NM_006670chr63633 222 158 ----1257
NM_006675chr1282720 2541 2271 2201 2194 976 626 575 --1606 --
NM_006680chr111106 ------
NM_006691chr11101179 1054 1027 1021 994 788 782 430 401 40 1980 ----
NM_006693chr74845 603 584 176 ------
NM_006698chr2041254 1215 907 497 1551 1444 --
NM_006699chr182504 2433 2420 2350 1889 693 654 452 11750 32740 873 635 11765
NM_006700chr121103 --1120 --
NM_006703chr64372 365 357 179 ------
NM_006704chr131323 --1452 1385
NM_006708chr62333 233 1404 21195 533 1978
NM_006716chr741221 427 87 56 11335 ----
NM_006717chr9143356 3258 3154 2727 2720 2302 2273 2172 2122 2089 997 802 528 200 22877 2535 22918 2418 --
NM_006718chr62842 778 --2384 23 --
NM_006720chr10174672 4545 4484 4271 4058 3994 3698 3654 1774 1226 1130 1060 1027 494 297 290 208 24832 3580 34293 3675 3251 --
NM_006721chr104679 334 267 99 ------
NM_006722chr3152985 2836 2411 1217 1015 895 889 870 835 711 339 310 151 83 44 33084 738 116 32894 2476 2137 11996
NM_006724chr6--1488 ----
NM_006726chr451115 462 229 142 116 --21081 428 --
NM_006727chr53536 524 110 1117 ----
NM_006729chrX185028 4830 4540 4441 4121 4112 3946 3929 3574 3533 2094 1851 1831 1441 1126 924 791 107 14601 33665 1255 904 35139 1422 1407
NM_006731chr9175670 5490 4825 4819 4798 4514 4292 2145 1881 1774 1710 1554 1073 972 953 831 646 24628 1190 55843 3755 1958 1397 29 33955 1843 539
NM_006732chr1971939 1908 1796 1421 760 712 202 --11399 --
NM_006734chr66515 426 281 251 59 44 21297 520 1343 --
NM_006735chr75342 307 298 95 86 ------
NM_006738chr1594604 4558 3445 3432 3426 3282 3208 3153 3011 14546 11198 1630
NM_006745chr481118 1018 1000 975 918 425 304 161 ------
NM_006749chr851262 1242 1036 967 434 --11108 11284
NM_006750chr16277816 7742 6648 6459 6315 6049 5729 5466 5411 5190 5097 4903 3231 3183 3162 2303 2122 2114 1959 1350 835 771 758 361 328 305 274 46586 6072 2727 314 36735 5447 2956 16256
NM_006751chr221037 929 3912 720 305 5889 331 236 93 38 1160
NM_006754chr741217 509 239 82 31162 986 261 ----
NM_006756chr8101457 1355 1305 1129 1019 615 385 310 224 101 1283 2606 275 11315
NM_006759chr21119 144 ----
NM_006763chr161635 611 592 516 120 89 --1525 11446
NM_006764chr33408 103 50 --1475 --
NM_006766chr8152650 2352 2239 2073 2037 1842 1679 955 728 669 404 305 202 144 88 52328 2213 1758 1709 1059 1125 --
NM_006772chr661726 1699 1639 1291 1103 398 --11094 1520
NM_006773chr2151559 1531 1427 1419 1291 1098 1076 620 442 350 242 202 175 76 50 21434 606 1460 --
NM_006775chr6143041 2833 2667 2609 2588 2234 1121 1111 1060 976 799 682 406 202 --12787 12557
NM_006777chrX82442 2269 2223 1811 976 768 147 134 1396 22688 1182 --
NM_006778chr631637 1627 388 --21950 1922 --
NM_006784chr14604 363 355 38 130 1191 --
NM_006785chr183837 467 339 --21641 685 11724
NM_006788chr1871614 1565 1544 1382 1339 324 258 1362 ----
NM_006790chr52379 63 ------
NM_006791chr154651 180 171 47 2633 191 ----
NM_006800chrX2639 542 1572 ----
NM_006801chr194563 542 475 267 1531 ----
NM_006803chr891905 1822 1525 1384 1366 569 359 281 125 141 --148
NM_006805chr56664 548 508 495 255 225 ------
NM_006806chr211127 1156 ----
NM_006807chr1751302 1171 842 384 128 ------
NM_006808chr91160 --155 --
NM_006811chr202835 234 ------
NM_006813chr61721 3784 675 358 138 --
NM_006815chr12101018 970 956 882 544 470 425 121 86 78 --2291 204 --
NM_006818chr11332 1649 2643 176 --
NM_006820chr1124307 4008 3945 3549 3423 3087 2854 2790 1713 1190 957 231 34253 3664 1352 24273 519 --
NM_006825chr122386 69 --197 144
NM_006827chr14163380 3206 2853 2843 2811 2651 2235 1303 1278 974 963 649 468 398 338 115 33395 908 785 13311 11022
NM_006831chr111418 --1269 --
NM_006838chr1251604 1173 681 613 216 ------
NM_003496chr74857 805 671 289 ------
NM_003498chr1662639 2501 2061 1008 791 381 22425 2250 ----
NM_003503chr12821 259 1843 1920 --
NM_003505chr751857 756 610 330 286 21302 337 ----
NM_003506chr861205 1175 888 508 456 227 21114 952 1356 --
NM_003507chr2132057 1995 1982 1949 1838 1803 1561 1329 738 595 324 103 92 21681 750 ----
NM_003557chr181560 1434 1376 538 522 440 355 90 31440 1073 303 ----
NM_003559chr1763859 3115 2410 1286 354 241 ------
NM_003563chr1721059 424 ----1437
NM_003566chr12143344 2269 2215 1150 969 864 746 644 500 360 301 209 172 47 33241 2127 759 23493 732 11130
NM_003569chr63532 518 128 --1484 --
NM_003574chr18195656 5118 5104 4615 4178 3994 3978 3851 3636 2249 1324 1125 1050 729 692 283 106 39 26 34393 4065 545 44516 4159 508 471 24750 2144
NM_003576chr1382872 2835 2704 1968 837 451 39 31 1758 --1777
NM_003580chr8151 --1592 --
NM_003581chr22951 665 ----1880
NM_003582chr1141 ------
NM_003583chr12173763 3441 3414 3249 3088 3080 2855 2693 2420 2397 1470 1438 1337 1256 1071 793 783 33554 3427 454 ----
NM_003587chr6181 ------
NM_003589chr1381370 1364 1299 391 230 198 185 76 11379 1592 --
NM_003590chr2133977 3481 3139 2985 2938 2849 1427 1320 1233 745 699 631 262 --21498 472 11113
NM_003591chr101276 ------
NM_003592chr73491 448 413 ------
NM_003597chr2112298 1901 1752 1722 837 469 418 364 313 160 33 --11794 --
NM_003601chr41187 ------
NM_003603chr462116 2067 1971 1810 680 660 ----11394
NM_003607chr1134125 4081 4070 3516 3292 3242 3059 2974 1585 1476 1066 910 653 13030 12661 --
NM_003615chr3193993 3850 3819 3694 3628 3544 3462 3311 3050 2979 2653 2568 2488 1263 979 768 603 493 363 2532 294 13001 13901
NM_003618chr251137 1124 973 466 242 --21014 962 --
NM_003620chr1721024 26 1726 --1850
NM_003622chr12142599 2548 2419 2243 2093 1853 1749 974 966 650 626 488 214 43 --1499 11612
NM_003626chr1161373 1347 1280 1235 1071 408 2256 206 11003 --
NM_003628chr22134 32 ------
NM_003629chr152297 1327 1256 826 38 32304 2276 587 ----
NM_003630chr63603 470 173 --1591 --
NM_003631chr1010894 812 787 774 765 659 642 327 226 218 1242 1262 --
NM_003632chr172865 816 ------
NM_003633chr582612 2560 2385 859 806 563 203 69 32570 1653 944 11755 --
NM_003644chr17135581 5441 5082 4400 2174 2105 1861 1698 1602 1474 1356 1348 507 24907 546 11854 16303
NM_003645chr151251 ----1192
NM_003646chr111599 ------
NM_003651chr124587 525 500 411 1534 1212 --
NM_003657chr20--1828 ----
NM_003658chr113850 721 547 ----1761
NM_003659chr281102 991 984 813 383 157 110 36 11163 ----
NM_003663chr3163368 3349 3154 2619 2436 2174 1313 1222 873 847 814 775 764 433 270 76 12525 1921 23273 2673
NM_003670chr351418 1352 1346 1167 1070 ------
NM_003671chr9123480 3428 3416 3397 2805 2498 1244 946 940 849 738 110 11366 ----
NM_003672chr12548 273 11601 2782 49 --
NM_003675chr101420 --1193 --
NM_003676chr14789 707 622 59 ------
NM_003677chr12102002 1885 835 798 761 742 735 608 600 420 ------
NM_003679chr173011 3005 2401 1321 1189 1161 323 13451 23124 36 1802
NM_003685chr193930 206 48 ------
NM_003688chrX1279 ------
NM_003692chr94709 267 105 95 1384 ----
NM_003701chr1341063 919 435 51 2956 731 1702 --
NM_003702chr82780 721 ------
NM_003711chr52247 82 ------
NM_003713chr161662 1556 1463 1398 701 117 ------
NM_003714chr563039 2483 2456 625 612 553 150 23091 858 12436
NM_003718chr73548 115 31 --1433 --
NM_003722chr392641 2555 2542 2485 1956 1796 1790 442 366 1661 1694 2288 118
NM_003725chr121107 --2439 308 --
NM_003741chr31293 --1399 --
NM_003743chr25787 690 285 193 80 11771 4903 868 258 70 --
NM_003744chr1411262 1378 ----
NM_003749chr1362238 2218 2178 2062 1674 101 --22266 335 1654
NM_003750chr103966 826 700 ------
NM_003759chr4134173 4041 2826 2790 1109 1086 1008 913 874 863 749 215 110 31636 1269 159 21101 812 14293
NM_003760chr13517 266 48 --1787 --
NM_003762chr11577 1107 21446 233 --
NM_003763chr20113080 2946 2599 2550 711 484 409 395 356 278 195 --12472 --
NM_003764chr63754 661 545 1596 2722 650 --
NM_003769chr124112 103 31 22 ----1227
NM_003772chr1141308 1185 383 71 ------
NM_003774chr12173396 3338 3328 3308 3150 2994 2507 2440 2431 2416 2406 2395 2387 2211 2174 499 486 11188 22325 450 --
NM_003778chr3--2196 141 1124 --
NM_003780chr1--1467 ----
NM_003783chr14956 459 139 130 --11055 --
NM_003784chr185704 593 256 241 223 1623 1112 --
NM_003787chr18101730 1700 1497 1484 1453 1266 1214 1189 532 491 41412 1152 550 514 1429 11387
NM_003794chr361081 1006 892 430 310 127 --1364 --
NM_003796chr191606 --1576 --
NM_003797chr111209 ------
NM_003799chr1884493 4463 3934 800 721 649 409 227 14201 32810 752 83 24290 435
NM_003800chr6102280 2001 1581 1531 634 616 488 387 124 66 12039 ----
NM_003809chr172487 469 ------
NM_003812chr21269 ------
NM_003816chr851393 1114 282 74 61 21168 1046 --1469
NM_003818chr204347 313 253 136 1851 --1985
NM_003819chr11246 ------
NM_003821chr83585 204 153 ------
NM_003822chr183210 3162 2840 2463 2447 1128 881 827 33169 3094 918 ----
NM_003825chr1551572 1393 1165 614 369 1211 11141 1984
NM_003829chr941206 772 137 80 1145 1187 --
NM_003831chr1881718 1639 1569 646 610 574 305 161 1453 ----
NM_003842chr872141 2133 1977 1970 565 189 48 --11960 --
NM_003846chr14619 312 233 197 1318 ----
NM_003850chr132215 83 ------
NM_003858chr142644 558 ----1484
NM_003861chr1472651 2586 2309 2024 1977 658 601 1579 22708 2569 --
NM_003862chr53336 107 76 ------
NM_003864chr4--156 ----
NM_003872chr24869 691 433 67 22899 643 1345 --
NM_003873chr10112371 2267 2243 1823 1795 969 947 603 593 519 208 1128 ----
NM_003877chr1241023 927 822 688 1959 ----
NM_003878chr8--1197 ----
NM_003883chr51583 --136 --
NM_003884chr381706 1520 1274 1247 714 520 382 194 11739 ----
NM_003885chr17132672 2662 2313 2305 1924 1911 1026 1010 780 616 592 376 43 22418 141 22499 715 --
NM_003887chr231605 446 152 21928 1632 11837 --
NM_003888chr1561596 1234 640 364 180 57 --21713 523 1481
NM_003895chr213773 542 521 1597 21529 214 --
NM_003899chr1372082 1779 1746 635 541 340 296 --22611 2474 12308
NM_003901chr1072579 2462 2074 1780 1711 1043 854 32376 666 461 --1653
NM_003902chr13830 586 188 1300 ----
NM_003908chr2051385 1104 898 323 115 --1439 --
NM_003909chr8103026 2756 2318 2095 1884 1050 1018 679 528 118 1750 12996 12551
NM_003913chr6184322 4245 3976 3525 3403 3358 3255 2993 2689 1692 1559 1378 1306 1239 1132 935 691 658 53982 3654 1571 990 764 44166 1112 151 95 --
NM_003914chr131179 ------
NM_003916chrX51062 953 570 260 149 11339 --21328 1012
NM_003919chr72193 174 --166 --
NM_003921chr1141802 1571 1556 1495 1371 1315 1131 728 718 591 334 223 144 23 --1217 --
NM_003922chr152306 285 --1177 --
NM_003924chr471653 1598 1545 1507 1401 1309 1139 1119 11537 --
NM_003927chr1881113 1024 771 717 687 677 410 160 ------
NM_003929chr161499 1478 580 551 515 170 --2423 349 --
NM_003931chr63203 143 98 1497 ----
NM_003932chr22101849 1806 1611 1595 1470 1362 1227 770 489 319 1730 1296 --
NM_003934chr9111163 1154 1104 1092 1060 902 875 509 351 205 191 1919 31175 477 147 --
NM_003939chr1063271 1494 899 688 643 311 23896 2724 13099 13506
NM_003941chr7131862 1730 1713 1675 1627 916 753 743 701 439 364 115 30 32109 535 382 --1256
NM_003942chr113505 171 154 ------
NM_003947chr351357 1341 1053 431 413 ----1858
NM_003948chr462237 1973 1645 654 585 460 12400 12619 12284
NM_003953chr162899 2867 2847 870 661 265 52893 2798 2201 2190 576 ----
NM_003956chr105461 419 372 153 86 ------
NM_003957chr112761 746 11099 ----
NM_003966chr5377786 7608 7243 7173 6921 6630 6528 6418 6412 6328 6227 6015 5297 5240 5090 5040 3041 2963 2856 2755 2744 2728 2721 2709 2650 2341 2290 2153 2041 1994 1654 1208 1146 641 389 330 74 35857 5764 1426 1257 11032
NM_003968chr3179 --1443 --
NM_003972chr104417 367 68 47 --1894 --
NM_003980chr651301 380 335 238 45 --3911 577 271 --
NM_003983chr16124395 4384 4345 3709 3346 3288 3176 1300 922 723 684 399 23696 2875 24456 451 --
NM_003987chr1052263 1591 1566 1467 389 ------
NM_003988chr1052340 1668 1643 1544 466 ------
NM_003989chr1052199 1527 1502 1403 325 ------
NM_003990chr1052199 1527 1502 1403 325 ------
NM_003994chr1274118 3367 3280 3110 1683 1570 1319 13850 32684 1723 462 11365
NM_003998chr43666 479 161 --1496 --
NM_004001chr15569 448 440 414 122 --1456 --
NM_004006chrX162573 2301 2175 2160 2131 2041 2020 1935 1747 966 760 753 737 561 226 184 1914 31737 846 342 --
NM_004007chrX162573 2301 2175 2160 2131 2041 2020 1935 1747 966 760 753 737 561 226 184 1914 31737 846 342 --
NM_004009chrX162573 2301 2175 2160 2131 2041 2020 1935 1747 966 760 753 737 561 226 184 1914 31737 846 342 --
NM_004010chrX162573 2301 2175 2160 2131 2041 2020 1935 1747 966 760 753 737 561 226 184 1914 31737 846 342 --
NM_004011chrX162573 2301 2175 2160 2131 2041 2020 1935 1747 966 760 753 737 561 226 184 1914 31737 846 342 --
NM_004012chrX162573 2301 2175 2160 2131 2041 2020 1935 1747 966 760 753 737 561 226 184 1914 31737 846 342 --
NM_004013chrX162573 2301 2175 2160 2131 2041 2020 1935 1747 966 760 753 737 561 226 184 1914 31737 846 342 --
NM_004014chrX162573 2301 2175 2160 2131 2041 2020 1935 1747 966 760 753 737 561 226 184 1914 31737 846 342 --
NM_004015chrX162573 2301 2175 2160 2131 2041 2020 1935 1747 966 760 753 737 561 226 184 1914 31737 846 342 --
NM_004016chrX162487 2215 2089 2074 2045 1955 1934 1849 1661 880 674 667 651 475 140 98 1828 31651 760 256 --
NM_004017chrX162573 2301 2175 2160 2131 2041 2020 1935 1747 966 760 753 737 561 226 184 1914 31737 846 342 --
NM_004018chrX162487 2215 2089 2074 2045 1955 1934 1849 1661 880 674 667 651 475 140 98 1828 31651 760 256 --
NM_004020chrX162573 2301 2175 2160 2131 2041 2020 1935 1747 966 760 753 737 561 226 184 1914 31737 846 342 --
NM_004021chrX162487 2215 2089 2074 2045 1955 1934 1849 1661 880 674 667 651 475 140 98 1828 31651 760 256 --
NM_004022chrX162487 2215 2089 2074 2045 1955 1934 1849 1661 880 674 667 651 475 140 98 1828 31651 760 256 --
NM_004023chrX162487 2215 2089 2074 2045 1955 1934 1849 1661 880 674 667 651 475 140 98 1828 31651 760 256 --
NM_004028chr18134102 3838 2960 2873 2549 1374 1322 1283 1272 1241 977 897 216 12815 1611 --
NM_004035chr17204979 4811 4480 4205 4196 3827 3676 3517 3383 3373 3366 3208 2028 1160 1075 1063 920 522 383 73 24849 1165 1600 11030
NM_004036chr23622 580 49 ------
NM_004040chr251269 1212 1165 1129 1121 ------
NM_004050chr1452727 2683 2461 2395 2378 ----12433
NM_004061chr53594 161 43 1265 ----
NM_004063chr85958 771 309 301 96 --1143 --
NM_004064chr1271272 1130 906 863 527 431 227 ----1957
NM_004067chr751227 1169 1024 458 429 11000 --175
NM_004071chr23213 104 58 --1267 --
NM_004077chr1231186 1097 536 ------
NM_004079chr1122959 2854 2780 2720 2288 1967 1820 1812 1149 665 461 48 --163 --
NM_004080chr761481 1321 1113 547 265 240 11030 11020 11060
NM_004081chrY61882 1734 1654 580 566 357 ----11474
NM_004085chrX2194 153 1281 ----
NM_004086chr14----2637 629 --
NM_004087chr391757 1508 615 569 519 317 81 45 22 31605 464 140 --1211
NM_004093chr1353281 3131 2403 2310 1113 12862 ----
NM_004094chr14132913 2517 2218 1870 959 842 835 807 409 285 210 117 110 ----22844 2351
NM_004096chr1082109 1895 1798 1390 1367 730 646 248 --1184 --
NM_004100chr662388 2210 1645 824 54 29 12372 31857 1834 554 --
NM_004103chr83767 718 712 2806 752 ----
NM_004105chr221075 856 ----1907
NM_004109chr1171924 1624 1616 806 251 175 44 1257 --161
NM_004113chr361783 1402 769 735 616 508 --12015 --
NM_004114chrX2503 456 1258 1794 --
NM_004117chr671662 1624 1534 819 743 500 280 --21730 409 11696
NM_004124chr14143152 3128 2671 2348 2297 2175 1433 1405 1396 701 629 579 265 232 ------
NM_004128chr132476 135 1164 1122 --
NM_004133chr892642 2602 2431 2317 1910 1832 630 236 138 22541 493 22032 743 --
NM_004136chr1593286 3051 3022 2908 2730 2639 2198 1183 966 11286 22881 909 1985
NM_004157chr32780 772 ------
NM_004161chr231506 1031 507 123 --11514
NM_004162chr32163 125 --31001 466 325 1266
NM_004169chr175829 777 756 154 130 2239 145 1869 --
NM_004170chr931467 496 388 2603 328 ----
NM_004171chr11389439 9031 8664 8149 7858 7737 7642 7618 7394 7365 7336 7175 7146 6881 6701 6584 6578 6423 6316 6190 6001 5847 5833 2832 2603 2516 2344 2317 2117 2108 1830 1785 1429 940 914 298 106 78 89542 9452 8250 7085 3181 2441 1684 218 89196 8240 8204 6548 5898 3518 2804 2706 --
NM_004172chr591724 1634 1561 1323 774 472 311 206 24 ----21931 1307
NM_004175chr223176 105 34 ------
NM_004180chr25607 581 396 161 131 --1532 --
NM_004187chrX21202 1116 --11337 --
NM_004200chr1153249 2888 348 242 160 --23194 2224 --
NM_004202chrY1595 153 ----
NM_004205chr11157 ------
NM_004208chrX171 ------
NM_004225chr841492 1252 599 462 ----1571
NM_004227chr753001 2951 2847 2583 596 12939 1512 11137
NM_004229chrX102171 2019 1906 1873 1776 1735 1543 1528 694 388 1323 ----
NM_004232chr18143849 3722 3567 3473 3382 2849 2819 1476 1359 932 863 609 597 324 --53839 1176 1062 911 652 --
NM_004233chr621455 647 1278 --11065
NM_004235chr93736 638 52 ------
NM_004241chr103714 290 23 ------
NM_004242chr63321 92 64 ----1310
NM_004244chr124440 427 373 98 1378 ----
NM_004249chr4----1109 --
NM_004252chr174501 463 119 60 --1134 --
NM_004261chr141001 670 319 195 3941 823 809 11020 1930
NM_004272chr562037 1886 1638 790 482 296 21653 1528 41813 1279 1262 777 1472
NM_004274chr14113189 2535 2468 2237 2204 1251 847 694 448 318 176 22989 2907 --1759
NM_004277chr661684 1482 1225 578 147 85 11540 ----
NM_004279chr74849 733 519 348 11522 2536 306 --
NM_004280chr62185 125 ------
NM_004281chr102407 174 ------
NM_004282chr62562 204 1654 ----
NM_004285chr1126441 6416 6402 6236 5989 5853 5378 3954 2123 1808 1778 782 --11694 1961
NM_004286chr2251999 650 634 391 248 11758 12302 --
NM_004290chr591252 1198 1123 1070 1021 505 298 181 38 ------
NM_004291chr51294 ------
NM_004293chr9103789 3307 3162 3008 2549 1249 978 773 544 421 33794 1394 315 11341 --
NM_004296chr1423328 1421 11510 23984 1504 --
NM_004301chr32134 106 ------
NM_004311chr10112984 2814 1972 1056 1044 924 848 640 476 337 89 --22780 1256 1199
NM_004316chr1241181 1085 729 82 21107 445 ----
NM_004319chr193017 2722 2548 2536 1083 556 286 87 78 --1234 --
NM_004323chr972168 2087 2024 1713 831 295 194 --22491 84 --
NM_004326chr171114 991 975 759 402 234 220 11252 ----
NM_004327chr2272419 2045 1771 875 591 570 334 ------
NM_004329chr1031355 1340 111 11241 ----
NM_004330chr156925 459 382 361 91 58 1126 1186 --
NM_004331chr8121942 1865 1751 1736 1689 896 881 874 825 804 748 455 22557 2126 32087 1829 889 22390 855
NM_004337chr8102316 2260 1976 1947 1913 684 290 262 135 49 31634 1524 788 --1279
NM_004338chr1896747 5631 5517 4699 4496 1630 870 445 139 65436 4969 4951 4838 1263 1014 27033 993 16644
NM_004341chr2----1234 --
NM_004342chr742318 617 409 220 32309 1620 558 21981 643 1121
NM_004346chr451545 1506 1437 495 345 11446 21395 1021 --
NM_004349chr841126 1056 913 230 --11265 11034
NM_004352chr16--1436 ----
NM_004354chr44613 584 575 308 1828 1235 --
NM_004360chr1692010 1951 1637 1487 779 629 408 222 98 41795 1643 331 72 11854 1205
NM_004362chr4199 2764 667 --1722
NM_004368chr197851 843 418 371 321 159 57 187 ----
NM_004370chr672178 1552 1510 1456 782 647 58 12053 --22200 2070
NM_004371chr12977 139 11206 ----
NM_004379chr241234 1106 705 103 --197 11501
NM_004380chr1682518 1013 730 645 489 357 242 158 ----1863
NM_004383chr151122 --1407 --
NM_004384chr5122249 2142 1884 1819 1756 1606 1524 1473 730 410 178 164 1416 11578 11951
NM_004385chr52682 105 --1242 --
NM_004386chr1922311 1652 --1802 --
NM_004389chr24724 625 70 30 ------
NM_004392chr1392648 2462 2252 1983 1971 1772 555 324 169 2695 573 12575 --
NM_004393chr382022 1579 617 535 400 266 217 211 1641 ----
NM_004395chr51180 1718 ----
NM_004396chr17--134 ----
NM_004397chr11164168 4045 3352 3344 2993 2888 2830 2747 1187 1053 1010 673 667 546 532 138 23552 89 1761 --
NM_004402chr161639 1564 1325 322 163 85 ----21680 456
NM_004405chr24925 699 403 232 ------
NM_004407chr45966 874 750 720 366 --1120 --
NM_004415chr64754 596 296 274 ------
NM_004423chr322671 1094 --1767 12181
NM_004426chr1291976 1966 1633 1231 534 497 425 214 195 1697 11769 --
NM_004428chr12787 728 ------
NM_004429chrX61450 1369 565 391 145 121 11465 1543 --
NM_004430chr882656 2437 2320 2181 2068 1901 1879 1851 22046 721 32780 2518 1065 --
NM_004431chr15844 811 787 746 102 ------
NM_004432chr992390 1911 891 664 492 411 404 391 152 22418 2052 1306 21944 1578
NM_004433chr141291 679 630 521 ------
NM_004434chr1441780 1299 1203 77 ----11433
NM_004436chr11220 1669 ----
NM_004437chr1143388 3013 2953 2920 2464 1251 1044 1028 985 867 652 631 202 141 33209 1240 490 23266 3055 --
NM_004438chr273147 3004 2721 2466 923 673 448 1226 13198 12220
NM_004440chr641995 1847 707 693 --21662 1620 --
NM_004441chr351193 1065 495 409 385 --11272 1171
NM_004442chr151124 1116 633 355 251 --21587 586 --
NM_004444chr72582 568 --1546 --
NM_004447chr1261167 983 968 871 206 174 11106 2227 94 --
NM_004449chr2121164 934 1587 ----
NM_004451chr111619 ------
NM_004454chr372138 1965 1955 1932 806 660 247 11836 ----
NM_004456chr71206 ----1234
NM_004457chr251632 1594 1082 622 135 --1254 11373
NM_004458chrX92529 2459 2392 2307 2229 2138 1812 844 749 11789 ----
NM_004459chr1791898 1740 1508 1428 1334 1257 795 550 454 41599 1562 1500 459 ----
NM_004462chr85663 654 439 86 53 1424 ----
NM_004464chr4164206 3861 3705 3670 3621 3469 3447 3343 3229 3220 3084 1529 602 360 354 49 54252 3329 1535 462 431 53244 2949 891 568 309 13289
NM_004469chrX277 35 ------
NM_004472chr53658 574 55 2669 474 ----
NM_004481chr132564 2547 648 32473 736 81 1977 --
NM_004482chr27932 891 773 762 721 617 174 3779 674 43 2596 126 --
NM_004483chr161490 1201 ----
NM_004484chrX2304 89 174 1350 --
NM_004494chr141039 990 884 811 ----11082
NM_004496chr1481255 1196 946 918 406 307 235 124 21164 952 11152 1137
NM_004498chr15157 1351 ----
NM_004499chr5--1357 ----
NM_004500chr1481455 1423 1322 695 627 596 497 229 11526 31673 775 40 173
NM_004501chr174087 3189 944 535 171 146 66 1562 43585 992 719 34 2772 358
NM_004502chr171173 1207 ----
NM_004504chr283089 2824 2793 2766 2755 2043 1055 978 22718 2485 62670 2191 925 855 496 295 --
NM_004505chr1772026 1761 1384 1318 551 527 425 21283 1271 11682 1517
NM_004514chr17103092 2952 2456 2432 2163 926 834 820 483 439 12351 ----
NM_004516chr1951272 1177 845 413 252 3510 238 106 ----
NM_004520chr54757 589 569 506 --1744 --
NM_004521chr102369 352 ------
NM_004523chr1061592 1289 1269 1231 521 29 --31508 569 450 --
NM_004525chr251094 948 461 174 54 --1110 --
NM_004528chr1172 ------
NM_004529chr971367 1294 1148 1088 1033 563 76 --21257 163 --
NM_004535chr2061580 1473 1382 1342 1180 245 ------
NM_004537chr1281448 1324 1296 1209 1067 437 394 364 21356 581 11494 --
NM_004538chrX6736 690 678 309 285 134 1797 ----
NM_004540chr213868 776 605 --192 --
NM_004543chr23351 145 108 --1254 --
NM_004549chr1171568 1554 1533 1356 1190 567 46 170 ----
NM_004561chr1181773 1276 1153 732 696 647 200 192 11287 ----
NM_004566chr1062326 2178 1802 1664 357 35 --22301 1756 --
NM_004569chr141644 ------
NM_004571chr21123428 3401 2944 2637 2311 2144 845 658 609 573 217 67 ------
NM_004575chr451559 1506 1256 553 51 21630 191 --1413
NM_004578chr14872 610 367 89 1909 1238 --
NM_004580chr1531676 1608 1567 --1185 11149
NM_004583chr172749 724 --1132 --
NM_004586chrX135151 5042 4840 4305 4148 3991 2169 1848 1803 846 500 487 323 54774 4332 3814 1108 711 35115 1990 1947 13691
NM_004588chr1194022 3905 3450 2923 2797 2692 2617 2595 918 13179 ----
NM_004593chr35873 301 270 236 61 1688 ----
NM_004596chr19--1219 ----
NM_004598chr5153324 3016 2919 2859 2560 2478 1223 1143 1075 1046 1000 939 788 483 226 23106 534 1282 1760
NM_004599chr223685 677 568 --143 --
NM_004600chr161506 1492 1102 981 966 606 31146 580 369 ----
NM_004602chr2091436 1360 1154 935 929 600 560 336 82 --11297 --
NM_004607chr52206 66 ------
NM_004612chr9164805 4798 4550 3954 3724 3384 3347 3243 1466 1173 1113 1085 828 762 249 32 23778 480 44340 3814 1023 159 --
NM_004614chr1642446 1807 1716 650 --11734 11937
NM_004615chrX3882 797 749 ------
NM_004619chr161687 1396 276 255 228 116 22239 509 21931 237 --
NM_004620chr113561 485 177 1207 1146 --
NM_004622chr2102472 2187 1982 1911 1711 1565 810 289 271 198 21499 119 ----
NM_004626chr113525 474 457 ------
NM_004630chr1151142 1043 482 438 255 --11130 --
NM_004631chr161330 900 564 205 127 86 --21228 1032 --
NM_004635chr32943 758 ------
NM_004637chr361291 1207 1152 998 987 406 ------
NM_004640chr62168 151 ------
NM_004643chr148834 805 738 724 581 570 546 117 1692 ----
NM_004654chrY7979 953 947 549 461 335 63 11120 ----
NM_004660chrY42163 2080 1755 710 --11492 1752
NM_004663chr1581557 1455 1244 1165 1052 603 564 512 21205 192 1120 --
NM_004666chr641314 1298 217 113 11400 ----
NM_004670chr1051687 624 451 56 21 1459 --1296
NM_004671chr18148 ------
NM_004685chr13103019 2536 2251 2021 1975 1086 947 555 542 477 1368 31105 865 779 --
NM_004687chr1731742 663 274 21658 1459 --1594
NM_004689chr141343 ------
NM_004690chr62730 715 ----2809 668
NM_004696chr17864 838 795 649 303 294 126 ------
NM_004698chr11213 ------
NM_004703chr1752340 2236 1975 723 294 --21828 954 1866
NM_004705chr113845 734 722 126 ----
NM_004709chrX21694 229 11571 2449 255 1344
NM_004713chr144751 552 261 156 ------
NM_004717chr731174 532 371 --11382 --
NM_004718chr23441 106 78 159 ----
NM_004719chr1292709 2138 1934 1895 643 516 468 417 120 --11981 --
NM_004721chr31284 --1353 --
NM_004723chr131029 730 692 ----1974
NM_004725chr1081499 1243 1203 1105 1008 394 285 153 --11321 --
NM_004726chrX165304 5237 4296 3869 3725 3713 3586 2004 1996 1784 1768 1673 1570 747 143 53 45683 5458 4945 3892 23484 1658 --
NM_004730chr551977 1944 1879 1602 323 1412 21986 527 --
NM_004731chr1241712 1682 549 396 21841 57 --11887
NM_004733chr31174 --1546 --
NM_004734chr13143113 2957 2896 2802 2779 2712 2305 2284 2157 683 653 509 355 161 33118 2427 690 11043 1480
NM_004736chr182125 1854 1838 1813 783 448 424 171 2623 561 11415 12248
NM_004738chr2022211 908 22558 746 11970 --
NM_004741chr103336 235 55 ------
NM_004742chr321581 356 --11542 --
NM_004744chr4123755 3747 3681 3587 2762 2750 1070 1058 1022 702 450 314 63731 2800 2735 1335 935 512 13763 11499
NM_004745chr8146810 6671 5857 5198 4866 4316 2663 1554 893 860 819 352 346 80 36687 6497 5736 76960 5451 1966 1390 1101 827 277 36593 2394 2366
NM_004748chr15203975 3808 3797 3488 3392 3384 2941 2897 2781 2744 2573 1638 756 607 539 250 195 61 43 25 --32839 1311 1235 --
NM_004755chr141823 1130 21086 487 --
NM_004757chr48702 621 583 533 274 242 176 97 ------
NM_004759chr131621 1600 688 144 11632 --
NM_004760chr7112432 2216 2097 1976 964 619 566 311 266 222 32 41612 977 537 428 12487 1661
NM_004762chr1741854 451 281 148 ------
NM_004764chr126586 533 235 139 53 30 1213 ----
NM_004768chr131153 732 349 11071 --165
NM_004772chr571386 1359 1250 1153 1116 614 74 1394 ----
NM_004774chr17113125 2879 2839 2683 2146 1997 1116 805 354 347 336 23087 548 12322 11955
NM_004775chr18122360 2330 2198 2121 2027 1787 893 678 653 442 276 105 32236 2180 611 11534 11913
NM_004776chr20103312 3222 2412 2031 1210 1148 1122 860 508 62 23340 2679 ----
NM_004779chr541117 1080 823 360 --21339 904 --
NM_004781chr141278 642 132 105 --11492 --
NM_004781chr141278 642 132 105 --11492 --
NM_004785chr162492 370 ------
NM_004787chr42148 123 ------
NM_004788chr1192054 1908 910 736 579 375 103 91 65 11755 1350 --
NM_004789chr91372 --2358 31 --
NM_004791chr133126 119 34 --2545 250 --
NM_004792chr21156 ------
NM_004794chrX146 ------
NM_004795chr1381736 1687 1547 642 369 339 248 126 21809 1416 11508 1428
NM_004796chr14112382 2264 2205 2044 1696 1667 1655 1599 622 438 43 22397 2217 11839 --
NM_004797chr3123687 3605 3574 3439 3268 3227 3211 3195 2754 2521 930 922 13658 13448 11393
NM_004801chr241567 1161 978 277 21059 176 ----
NM_004804chr23497 447 262 --21875 234 --
NM_004808chr1071066 452 390 315 263 165 59 42715 2251 398 291 1587 --
NM_004815chr1224877 4835 4153 4135 4097 4071 4058 3690 3561 3208 1910 1886 1851 1663 1468 1200 674 555 415 369 262 227 33761 776 739 --1533
NM_004818chr12--159 ----
NM_004820chr82120 78 --168 --
NM_004821chr55636 610 593 585 195 --1538 --
NM_004824chr671359 1251 942 920 484 302 294 --1391 11483
NM_004830chr64801 784 341 190 --2841 711 --
NM_004834chr273415 2805 2728 1327 953 867 655 23104 198 2700 500 --
NM_004835chr32325 170 ------
NM_004835chr32325 170 ------
NM_004836chr22337 110 ----1855
NM_004837chr151703 1336 420 380 330 11099 ----
NM_004840chrX72066 1880 1817 1716 816 228 143 1235 ----
NM_004841chr161064 1042 977 799 471 307 ------
NM_004842chr661614 1485 1479 663 551 100 31727 1449 671 11146 31456 1421 1122
NM_004849chr671605 1344 1047 1039 588 472 330 11285 21384 1169 --
NM_004850chr231292 1286 532 --11130 --
NM_004856chr151378 --152 1414
NM_004857chr14184693 3940 3920 3898 3878 3304 3234 2915 2908 1888 1835 1655 1646 1473 1057 1024 1011 425 44698 3490 3374 1460 24081 3107 173
NM_004859chr1762684 696 569 263 248 135 --12403 --
NM_004860chr171393 ----1559
NM_004863chr14135188 4618 4488 4455 4094 3761 3742 3733 3370 3340 1213 1206 627 44495 3536 1374 238 23544 648 23688 3578
NM_004865chr62369 319 1417 ----
NM_004866chr5194979 4705 3863 3541 3467 3364 3312 3210 1890 1713 1696 1683 1433 939 542 407 243 74 45 44017 1751 1062 182 21649 708 34506 3072 611
NM_004867chrX5574 483 455 257 229 2598 466 ----
NM_004869chr1871168 1093 559 340 301 55 41 --1585 --
NM_004871chr17104354 4263 3733 3596 3582 3437 3114 389 367 176 12899 32978 2956 204 13144
NM_004873chr14123122 3098 3020 2958 2932 2619 2453 1990 1982 1193 555 391 1468 13065 --
NM_004874chr81409 ------
NM_004879chr115649 302 239 202 149 ------
NM_004884chr1561363 1341 1218 431 115 68 1419 1290 --
NM_004888chr96883 689 388 371 295 248 1302 1829 1216
NM_004891chr21223 ------
NM_004893chr51466 ------
NM_004896chr1061215 1036 503 342 207 193 --11289 --
NM_004897chr105927 781 594 142 113 3757 731 629 1828 1181
NM_004898chr452848 2295 817 692 252 1824 --1891
NM_004902chr204799 758 562 37 ------
NM_004904chr7276517 5997 5864 5489 5466 5043 4410 4336 4322 4281 4260 4085 2616 2534 2527 2030 1961 1788 1500 1338 1140 675 608 233 129 72 58 45416 1152 629 509 35403 4709 2575 14181
NM_004906chr66693 560 536 270 149 134 ------
NM_004912chr771413 1376 1293 1141 591 512 55 ----171
NM_004915chr214846 801 744 516 ------
NM_004922chr101224 --11003 11022
NM_004924chr1931091 1043 1030 ------
NM_004926chr1471785 1489 1359 1323 1314 676 304 11866 11779 --
NM_004929chr851048 445 433 156 84 --11243 --
NM_004932chr54531 198 192 155 11293 21413 58 --
NM_004937chr1782542 1972 926 673 592 507 344 243 ------
NM_004938chr971236 1193 1041 431 351 150 95 --1772 1419
NM_004947chr382575 1689 1602 704 276 251 234 218 --22385 685 --
NM_004949chr18111968 1794 1643 1634 1453 726 408 398 313 280 153 ----1392
NM_004952chr11692 1928 ----
NM_004954chr111289 ------
NM_004956chr784514 3874 3669 1018 888 106 86 46 --43682 2853 2787 1838 --
NM_004958chr12917 33 ------
NM_004961chrX41364 1200 571 113 --1378 --
NM_004964chr14579 546 407 46 1379 182 --
NM_004965chr214205 150 117 67 ------
NM_004966chr102990 168 2215 154 --1382
NM_004967chr42461 179 1407 ----
NM_004969chr102194 90 --1229 --
NM_004972chr931008 823 168 2293 236 2798 465 --
NM_004973chr6111577 1256 1222 1158 1066 549 414 355 308 118 37 ------
NM_004976chr11115153 4238 4193 4186 3690 3591 3567 3559 3410 1517 1353 --25194 1455 --
NM_004979chrX41052 971 67 39 --1206 --
NM_004985chr12224493 4323 4276 3932 3735 3698 3684 3678 3250 3231 3157 3080 2963 1702 1284 895 788 599 254 173 100 51 21194 23 44201 3792 1584 299 24237 4221
NM_004992chrX157239 7227 7125 7017 6728 6168 5773 5586 5477 5426 3077 3059 1233 1214 118 1191 17047 --
NM_004992chrX157239 7227 7125 7017 6728 6168 5773 5586 5477 5426 3077 3059 1233 1214 118 1191 17047 --
NM_004993chr1471270 987 552 539 363 345 243 --1296 1419
NM_004995chr1421529 1490 ------
NM_004996chr1641660 1632 1326 541 --11787 --
NM_004998chr153893 648 403 2850 729 ----
NM_004999chr6114470 4389 2805 1660 1241 1063 924 859 658 527 493 44258 3746 334 269 44434 3221 1292 195 14240
NM_005006chr231028 795 359 --2786 81 --
NM_005010chr722028 693 21478 203 21759 32 11902
NM_005011chr741705 1690 163 48 11365 ----
NM_005016chr124361 149 120 70 --1257 1330
NM_005020chr73597 555 454 ------
NM_005021chr63146 132 68 1156 2319 104 --
NM_005022chr172223 83 ------
NM_005023chr541384 1024 485 241 1947 ----
NM_005027chr1951086 424 209 199 151 --1110 --
NM_005028chr1092361 2248 2117 2086 1901 1585 832 596 203 ----1788
NM_005032chrX1926 --1304 --
NM_005036chr22118367 7103 6636 6574 6326 6075 5322 1653 1610 1508 1442 57024 5393 3183 3175 1493 58122 7395 5963 3007 2866 25436 2935
NM_005044chrX134462 4274 3901 3781 3722 3620 3415 3260 2921 1711 1354 483 123 32847 1338 504 13675 1491
NM_005045chr74863 847 789 21 1835 ----
NM_005054chr261789 1770 1732 1311 1236 644 --1341 --
NM_005056chr12185608 5284 5139 5019 4768 4530 4365 4251 3816 2192 2178 1867 1745 1548 1397 1364 1258 770 25315 2163 35380 4504 1442 13810
NM_005057chr111776 31798 1235 29 ----
NM_005063chr10123818 3758 3556 3243 2891 2613 2452 1451 1388 825 814 676 23130 28 1198 1848
NM_005065chr14175339 5321 5039 4985 4389 4211 4117 3722 3449 2162 2014 1974 1517 1448 1132 312 251 35344 1195 602 35273 1998 944 23471 2068
NM_005066chr14577 294 215 190 --2772 208 --
NM_005067chr31972 ------
NM_005068chr621408 443 ------
NM_005069chr2151600 1258 1194 567 546 ----11683
NM_005076chr154157 3610 3144 1050 199 24232 2642 13799 --
NM_005077chr91443 ------
NM_005078chr1561872 1563 1550 1469 1448 335 --11317 --
NM_005086chr1251571 179 168 137 129 --1159 --
NM_005087chr31782 ------
NM_005088chrX5891 751 696 344 181 ------
NM_005093chr2095271 5237 4522 4452 4007 3766 1537 1529 800 1712 11254 --
NM_005095chr162124 1681 1605 1470 889 299 12186 21497 245 --
NM_005099chr161221 1092 1084 947 939 534 ----11312
NM_005102chr21892 2798 330 --1290
NM_005105chr182044 2024 682 489 440 431 272 151 11982 2552 265 --
NM_005109chr392571 2564 2524 2035 1969 1703 929 580 480 11841 ----
NM_005112chr431035 411 81 1869 174 --
NM_005113chr143189 80 38 --1507 --
NM_005114chr44536 490 458 282 1206 1169 --
NM_005116chr2074576 4473 4379 4277 3362 3162 374 11509 23524 3442 --
NM_005119chr161226 999 988 896 447 314 2888 256 ----
NM_005121chr17133691 3425 3409 3028 2881 2871 2792 2379 2323 1365 1327 613 262 32893 2738 1040 --31153 486 175
NM_005124chr64930 743 681 139 1640 ----
NM_005126chr372261 2019 1950 1918 1569 1444 639 2675 278 1847 --
NM_005128chr213694 659 612 1641 2652 509 --
NM_005134chr181352 1668 --1229
NM_005135chr15113664 3591 2910 2904 2698 2517 2394 1257 1077 658 499 23631 36 2741 513 --
NM_005141chr43171 72 46 ------
NM_005146chr11164 ------
NM_005151chr1852089 839 719 230 59 22130 328 4953 449 313 249 --
NM_005154chr152635 501 1538 1566 --
NM_005156chr9245023 4785 4556 4518 4100 3741 3699 3665 3641 3475 3285 1675 1644 1593 1445 1229 1144 944 930 585 352 215 192 151 73959 1533 1418 1379 1180 605 265 43784 3451 1623 598 21511 1046
NM_005157chr921966 1910 1359 11564 --
NM_005160chr22256264 5983 5938 5634 5505 5446 5279 4942 4832 4745 4719 4239 2586 2427 2419 2305 2232 2027 1363 1149 1109 532 447 279 211 15383 25474 4770 --
NM_005163chr141931 --188 --
NM_005164chr1272605 2498 1856 1701 1664 663 591 --1968 12340
NM_005166chr191235 ------
NM_005168chr281758 1682 1372 1287 1173 697 384 328 --1495 --
NM_005171chr1271132 1036 891 856 419 326 23 ------
NM_005178chr191421 --1403 --
NM_005180chr10101645 1601 1550 1336 1270 1097 269 238 215 114 --1501 --
NM_005181chr85716 630 334 303 252 1779 4734 688 651 103 --
NM_005188chr11228354 8341 7987 7832 7616 7151 7126 7107 6910 5453 3335 3282 3229 3140 3039 1751 1642 1326 1224 1138 835 590 48312 8275 2790 1623 46300 6032 5487 2163 12579
NM_005190chr671087 1011 786 419 151 135 104 ----1286
NM_005194chr202507 179 ------
NM_005197chr14336178 5906 5744 5718 5377 5338 5242 4991 4860 4804 4491 4455 4447 4405 4012 2177 1737 1532 1490 1484 1475 1463 1455 1443 1420 1238 1073 986 723 199 125 92 63 --45562 4472 4373 3785 15893
NM_005201chr32949 36 1925 ----
NM_005202chr172112 2094 1990 893 195 172 146 ----11724
NM_005203chr10156 ------
NM_005204chr102789 695 ----1212
NM_005206chr173413 264 183 1209 1981 --
NM_005207chr2273688 3255 747 739 494 421 76 32886 2688 2323 ----
NM_005214chr241118 1047 203 83 ----1427
NM_005222chr76907 389 346 231 208 174 1259 ----
NM_005224chr194570 549 540 441 ----1246
NM_005227chr11507 ------
NM_005229chrX61252 961 838 399 354 279 ----21302 412
NM_005230chr121426 ----1501
NM_005231chr1151406 1375 975 273 89 11279 ----
NM_005233chr3162620 2594 2413 2019 1999 1930 1855 808 782 771 646 621 571 431 394 206 11781 12182 --
NM_005235chr2387855 7585 7573 7560 7492 7357 7280 7216 6818 6475 6416 6303 6162 5971 5892 5141 2974 2925 2694 2668 2662 2375 1908 1789 1776 1586 1387 1187 1114 887 711 698 549 533 342 317 214 67 47033 5649 5566 651 45441 5016 2081 223 2879 838
NM_005238chr11123321 2911 2655 2577 2334 2192 2174 1198 600 308 113 92 32435 1042 607 11163 --
NM_005241chr341410 1315 1265 450 1948 11066 --
NM_005243chr22145 ----1138
NM_005244chr201565 ------
NM_005245chr42544 493 1773 --1628
NM_005249chr143705 110 85 --1827 --
NM_005250chr161671 11926 1683 --
NM_005252chr145694 683 538 310 304 ------
NM_005254chr1551226 1185 953 523 506 11371 2978 452 21241 329
NM_005256chr112391 160 1797 --1246
NM_005257chr1861191 1080 902 884 309 141 1553 1381 --
NM_005259chr241548 1415 1179 1016 --1344 11496
NM_005261chr87822 795 750 719 415 267 170 1998 1343 2955 653
NM_005264chr103911 142 134 ------
NM_005273chr72341 322 ------
NM_005277chr471802 1748 1607 1435 1298 574 310 21419 1362 11642 2357 241
NM_005279chr26780 333 249 206 145 119 --1808 --
NM_005281chr13717 623 344 ------
NM_005284chr62432 362 ------
NM_005295chr71269 ------
NM_005296chrX5779 419 373 311 36 21033 784 149 --
NM_005302chr72298 177 --175 --
NM_005313chr1561122 935 477 393 279 147 1161 ----
NM_005316chr1181056 957 941 861 820 788 434 421 ------
NM_005318chr2281171 1163 868 853 814 417 70 62 --1168 --
NM_005324chr1742153 632 551 254 21588 415 ----
NM_005327chr43662 291 220 ------
NM_005328chr84733 697 246 208 --1785 --
NM_005329chr16102304 2276 2239 2194 2129 1974 1790 950 935 425 11579 --12152
NM_005333chrX7956 917 496 247 208 123 36 2357 346 1766 --
NM_005339chr4174287 4267 3982 3539 3361 3189 2893 1677 1482 1429 1334 1133 1121 904 718 219 67 32900 883 226 74305 3898 921 812 773 663 88 --
NM_005342chrX112651 2596 2540 883 851 793 646 571 328 317 238 22840 1883 ----
NM_005349chr42605 91 2615 249 ----
NM_005358chr1371674 1597 1506 582 527 285 177 21517 756 11485 11588
NM_005359chr18266524 6196 5752 5006 4992 4856 4388 4363 4263 4097 2491 2024 1894 1774 1519 1443 1352 1346 1337 1032 857 779 622 559 181 175 25759 5103 45344 5055 4162 823 --
NM_005369chrX3601 592 156 1677 1278 --
NM_005370chr1951208 1163 1145 1139 874 1182 2881 221 --
NM_005373chr131679 235 193 11248 11403 11438
NM_005375chr691007 848 798 417 390 328 268 191 106 ------
NM_005376chr131107 1080 906 ------
NM_005378chr23755 742 50 --1826 --
NM_005384chr91238 ------
NM_005385chr372538 2501 2380 765 352 241 193 12152 12416 --
NM_005387chr112713 220 --1585 --
NM_005388chr991624 1504 1340 1304 1290 1280 475 469 65 21616 402 --129
NM_005392chr941779 1208 1177 617 1206 --11480
NM_005397chr783640 3598 3346 3120 3065 2961 2834 1445 23986 712 1147 --
NM_005398chr1031156 497 232 1252 11030 --
NM_005399chr1124424 3826 3623 3374 1424 1081 988 972 811 471 266 54 23783 903 1332 --
NM_005400chr2132965 2929 2796 2674 2668 2640 2591 2258 2248 2192 1977 1216 1021 ------
NM_005401chr11184 ------
NM_005402chr771414 1369 1361 1162 587 280 265 21427 23 --11603
NM_005406chr1861633 1522 1293 260 134 89 21541 1027 ----
NM_005407chr1421001 97 1250 1197 --
NM_005409chr451100 1071 414 350 257 1773 11003 --
NM_005410chr56592 556 307 244 187 62 ------
NM_005424chr11111 ------
NM_005429chr43342 299 287 --1241 --
NM_005433chr18132616 2448 2222 2116 2048 1782 764 528 486 458 318 312 157 2677 555 12259 --
NM_005436chr10184145 3483 3470 3446 3432 3414 3227 3050 2808 1512 1389 1258 1211 817 568 371 299 203 31628 1219 1188 ----
NM_005437chr1061373 1268 1105 557 436 88 21034 287 ----
NM_005439chr122521 70 ------
NM_005443chr43573 470 435 --178 --
NM_005455chr181879 1533 1495 1432 1326 1221 399 160 --11316 11158
NM_005458chr982445 2315 2219 1945 1704 965 948 936 --22417 213 11993
NM_005461chr2091961 1701 1655 1593 1571 1472 745 696 678 ------
NM_005465chr182055 1633 1555 1475 817 618 400 354 12048 --11597
NM_005475chr1283215 2949 2890 2497 2050 2007 665 204 22965 345 1591 12263
NM_005487chr2242146 1484 256 109 11638 11566 --
NM_005493chr62786 88 1612 ----
NM_005494chr73472 200 71 1425 ----
NM_005497chr17135819 5437 4869 4861 4108 2432 1792 1620 1571 1487 982 662 607 11316 --11078
NM_005499chr191569 ------
NM_005502chr9133254 3167 3112 2983 2800 2552 2484 2452 2412 1290 1239 1148 972 21157 513 12139 12157
NM_005504chr12246619 5957 5914 5866 5689 5364 5341 5190 4749 4691 4375 4290 4253 2442 2402 2271 2121 1479 1449 786 546 452 368 149 14495 55603 4551 2247 1623 90 15049
NM_005506chr462925 2755 2439 2153 678 522 --21017 863 12426
NM_005509chr541193 747 736 104 2666 284 21707 322 11697
NM_005513chr381479 1288 561 532 425 417 242 27 1522 11462 --
NM_005519chr101516 ------
NM_005520chr54493 282 205 176 ------
NM_005522chr741349 1257 106 85 ------
NM_005526chr81286 ------
NM_005530chr1571360 525 386 311 194 115 100 21220 133 ----
NM_005536chr831090 454 294 1137 2965 383 11033
NM_005537chr133427 378 100 --1266 --
NM_005539chr101564 --11106 --
NM_005541chr21993 21191 1075 ----
NM_005542chr751940 1780 1709 1245 450 187 ----
NM_005544chr21784 ------
NM_005546chr582249 2234 2049 1902 922 475 371 359 12141 ----
NM_005561chr1361003 847 829 823 369 48 1101 ----
NM_005562chr141683 1518 1138 679 --11307 --
NM_005563chr17751 702 672 589 199 79 24 --1233 --
NM_005573chr57661 499 469 288 261 113 90 ----1718
NM_005575chr55850 683 641 632 602 1708 2558 256 1155
NM_005576chr153297 233 197 ------
NM_005578chr3245155 4984 4867 4821 4791 4775 4532 4414 4364 3910 3718 3662 3593 3398 3373 1662 1651 1447 999 950 533 361 236 150 65112 4673 3899 1940 1624 332 44109 852 805 711 21975 1437
NM_005581chr191323 ------
NM_005591chr11112486 2344 2023 1727 971 921 704 692 439 248 125 ----1877
NM_005593chr123608 509 194 --2432 106 --
NM_005595chr14940 867 860 139 1689 --1178
NM_005596chr9246175 6093 5949 5745 5524 5442 5177 5164 5156 4951 4799 4663 4084 4008 2463 2332 2084 2038 1988 1772 1660 1604 590 149 25812 1794 25917 1360 --
NM_005599chr131520 1053 998 21537 1448 1431 --
NM_005602chr381156 1134 1067 943 889 307 257 223 1928 ----
NM_005603chr1871970 1807 1556 1348 1255 739 47 11426 31954 1858 1571 --
NM_005604chr6112450 2400 2336 2279 1766 1742 945 682 581 575 109 --22368 2292 --
NM_005607chr85919 796 789 248 186 3673 202 149 1713 --
NM_005610chr12214 41 1311 2591 283 --
NM_005611chr165980 463 256 202 80 ----11329
NM_005613chr162151 2039 1596 867 496 227 12053 11362 --
NM_005614chr721050 93 ----2272 234
NM_005618chr63550 425 32 --1644 1448
NM_005625chr861052 790 760 444 342 254 --1982 --
NM_005626chr14442 357 205 103 ------
NM_005627chr63683 677 204 1742 ----
NM_005629chrX2169 162 ------
NM_005632chr161981 ------
NM_005637chr1871928 1785 1431 1312 685 368 210 ------
NM_005638chrX41509 1480 1196 288 21661 1300 1247 --
NM_005639chr121303 --21705 91 --
NM_005644chr12117 83 ------
NM_005647chrX53200 1023 1002 842 418 4869 823 700 566 13316 --
NM_005648chr8--173 ----
NM_005650chr2241196 1105 1088 359 ------
NM_005655chr831220 473 252 --21302 1090 1207
NM_005662chr8--1342 ----
NM_005665chr1184929 4880 4714 4424 4294 4204 3567 3465 3103 1978 1621 1486 835 828 671 662 351 276 24337 844 --11301
NM_005668chr5154388 3691 3580 3494 3439 3246 3201 1715 1652 1243 1148 960 833 824 624 64644 4568 4355 2813 1830 1287 21771 1167 34494 1765 1446
NM_005685chr72112 101 ------
NM_005688chr33414 100 30 21025 954 ----
NM_005707chr1541336 1330 1257 1196 1196 ----
NM_005711chr53783 437 249 1107 11026 --
NM_005715chr682734 2496 2247 2159 1782 670 629 192 --12350 --
NM_005717chr13849 346 101 1127 ----
NM_005718chr31246 ------
NM_005721chr241073 1029 858 196 --1797 1717
NM_005722chr282361 2262 685 618 612 249 164 40 12512 ----
NM_005724chr151176 ----1821
NM_005725chr152349 882 765 227 76 1390 31630 1584 436 --
NM_005730chr1283614 3294 3284 3256 3063 826 729 540 --11053 --
NM_005733chr52253 206 ------
NM_005734chr114707 666 267 96 ----1762
NM_005736chr10160 --11058 --
NM_005737chr2102851 2554 2263 2254 2188 2053 2018 1785 1134 143 --21853 381 12282
NM_005738chr761782 1352 536 522 510 40 22017 1459 ----
NM_005742chr22532 32 1313 2272 56 --
NM_005746chr792696 2551 2455 1904 1000 824 443 369 133 11807 11954 1918
NM_005748chr12123479 2899 2545 2297 2203 1255 1161 1138 888 614 598 347 23245 460 --31073 642 23
NM_005749chr174589 261 78 54 2552 61 --1151
NM_005751chr71434 1350 ----
NM_005752chr164988 877 262 86 1276 1165 --
NM_005754chr561249 1235 1132 1038 464 299 11142 --1384
NM_005756chrX41492 1438 449 196 1210 11470 --
NM_005759chr2144752 3890 3855 3846 3629 3573 3400 3079 1876 620 530 505 450 241 21866 328 54548 3995 3514 1797 356 --
NM_005765chrX2727 155 ------
NM_005766chr134492 370 348 57 1499 ----
NM_005768chr123718 669 572 ------
NM_005776chr142156 137 ------
NM_005777chr3--1110 ----
NM_005779chr5103146 3035 2952 2924 1426 795 722 361 317 26 --23398 2503 13197
NM_005786chr1851055 1027 989 963 416 21268 129 1183 --
NM_005789chr1762085 2044 1376 460 341 240 21532 179 11322 --
NM_005795chr2112853 2744 2714 2497 2355 2228 1054 988 889 824 576 ----22383 882
NM_005797chr11121769 1662 1545 1379 1301 1123 599 527 521 477 278 77 1239 51591 1366 574 383 55 --
NM_005798chr13245023 4673 4628 4622 4485 4457 4414 4397 4334 4137 4046 3645 3376 3356 3293 3246 1816 1296 928 895 876 539 530 27 23749 2113 25183 3577 15050
NM_005802chr94756 643 325 134 ------
NM_005806chr2141265 1098 980 465 ------
NM_005808chr393458 3151 2750 2455 1367 937 798 762 684 1236 1438 --
NM_005813chr292624 2500 2401 2392 1977 989 918 587 256 2547 261 1311 --
NM_005819chr183451 2835 2463 1263 1088 608 373 129 13470 23425 3178 2566 487
NM_005822chr651983 1950 1876 819 51 21721 240 ----
NM_005826chr11450 --2624 170 --
NM_005828chr17104692 4250 3775 3750 3741 3415 937 507 444 233 1724 44981 4830 4657 543 --
NM_005832chr391478 1106 504 496 418 253 231 51 26 31273 555 426 11050 1378
NM_005835chr63471 195 35 ------
NM_005836chr8147 --1471 --
NM_005839chr18970 921 904 790 700 368 358 287 1390 ----
NM_005840chrX246660 6576 6520 6186 5997 5952 5768 4802 3070 2698 2180 1436 1350 912 762 706 678 633 620 583 571 563 396 32 76899 6051 6003 2688 923 605 181 57566 7204 6964 5812 3007 17268
NM_005841chr431001 762 84 --2149 95 --
NM_005842chr13138 1596 ----
NM_005843chr271936 1855 1475 1324 1234 87 21 41592 513 503 180 2572 264 11927
NM_005850chr11145 --1162 --
NM_005853chr161413 --165 --
NM_005857chr16987 981 577 556 42 32 1603 1564 1173
NM_005859chr551560 1146 1000 513 181 1524 ----
NM_005862chr35812 676 376 298 270 1940 1723 --
NM_005863chr1071260 384 282 247 213 139 68 1559 11422 --
NM_005868chr792300 2190 2037 2031 960 706 610 533 257 1185 2557 505 12023
NM_005870chr1311041 --132 --
NM_005871chr1051044 917 784 686 669 1186 4856 847 432 66 --
NM_005872chr12353 199 ------
NM_005875chr32408 291 --129 --
NM_005880chr1691415 1271 1226 1061 612 569 316 295 34 ------
NM_005885chr541597 1559 1478 454 1625 21072 74 --
NM_005895chr12124182 4127 3603 3518 3475 3166 3034 3026 2859 2569 723 84 1395 ----
NM_005896chr23648 533 214 2283 158 3756 640 65 1777
NM_005898chr1173166 2729 2317 2199 951 785 192 22684 2214 22248 1242 --
NM_005899chr173445 349 91 1229 2329 298 --
NM_005900chr461192 1092 1008 797 788 777 1823 ----
NM_005901chr18318589 8578 8493 8421 8240 8171 7697 7547 7306 7190 6553 6308 6194 6132 6002 5972 5407 3452 3118 3007 2989 2879 2796 1732 1569 1163 1049 753 740 464 361 56605 6316 5370 2459 1786 88085 7987 7448 5909 2846 2633 1499 547 17954
NM_005902chr1584064 3966 3193 3163 1653 1225 1010 113 23578 713 24508 3260 14032
NM_005903chr5164884 4474 4401 4395 3980 3759 3664 3265 1657 1650 1002 824 686 429 300 113 44996 4121 2063 1792 54659 4167 4084 3653 2030 13216
NM_005904chr1841504 1472 1440 138 --21135 1052 --
NM_005906chr651545 1450 1150 536 89 1181 ----
NM_005907chr63635 437 347 31669 1563 1284 ----
NM_005909chr593855 3585 3371 2830 2804 2711 1367 987 571 43378 3285 3256 525 13777 1162
NM_005911chr241429 1179 1171 513 ------
NM_005920chr1103914 3395 2970 2946 2901 1382 844 272 178 107 13793 13766 --
NM_005922chr6--1488 ----
NM_005923chr64568 276 194 185 ------
NM_005924chr71928 21095 140 1979 --
NM_005927chr571118 897 813 397 354 293 82 165 1172 1914
NM_005933chr1172531 2132 1912 1111 726 676 223 11866 22068 341 --
NM_005935chr4194920 4802 4707 4701 4529 4239 4137 3923 3824 3675 3360 2091 1764 1525 466 421 303 297 40 24812 1389 33850 1382 1082 14260
NM_005937chr1783859 3317 1643 1614 1580 1514 504 460 14013 11501 --
NM_005941chr8152937 1687 1641 1341 1318 1161 812 441 433 425 417 374 338 230 23 --21230 711 13607
NM_005944chr32957 784 21218 1084 ----
NM_005953chr161102 ------
NM_005955chr1145406 5154 5143 4965 4855 4533 4341 3784 3671 2035 2017 903 770 138 34866 4839 3955 24607 3624 44881 4650 4150 1816
NM_005962chr1082312 1964 1796 891 546 325 276 243 ------
NM_005962chr1082312 1964 1796 891 546 325 276 243 ------
NM_005964chr1731480 1466 1450 --11039 --
NM_005966chr242184 2062 1653 603 12233 12315 --
NM_005968chr192195 50 ------
NM_005977chr1311028 2868 328 1129 --
NM_005982chr14192 ------
NM_005986chr13122605 2358 2259 2096 2054 2041 830 805 732 616 297 243 21786 953 22061 641 1939
NM_005989chr711509 1233 --129
NM_005994chr17--1724 ----
NM_005999chr181523 1106 1034 975 402 345 322 235 --1443 1177
NM_006007chr9114480 4467 4457 4409 4147 3822 3331 2999 1676 1585 389 --187 1861
NM_006010chr33248 226 83 ------
NM_006011chr1574045 3966 3608 3239 3182 1199 110 14159 ----
NM_006015chr141254 1113 1083 153 11185 ----
NM_006016chr6102253 2106 2065 1720 1690 1586 1445 517 421 263 --1888 12156
NM_006024chr73866 634 369 ----1928
NM_006029chr14151 1636 --1534
NM_006033chr1882350 2090 2032 1744 1605 821 706 604 1315 32277 828 593 --
NM_006036chr292516 2493 2415 2291 1974 1954 1938 390 114 2581 559 11643 --
NM_006037chr2164731 4695 3644 3501 3470 3392 3121 2978 1916 1715 1703 1672 1644 1534 702 484 44771 1549 1355 645 34327 3806 1595 --
NM_006041chr171100 ------
NM_006047chr20123334 3141 2759 2737 2529 2388 2220 1214 686 631 492 471 32575 2143 1405 12781 --
NM_006048chr151210 1192 463 419 345 ------
NM_006054chr1151523 1468 1055 528 139 11313 ----
NM_006067chr1651021 948 885 740 63 ------
NM_006070chr31114 ------
NM_006076chr732018 918 88 1278 ----
NM_006079chr68810 795 712 697 686 300 266 183 ------
NM_006080chr762670 1027 955 773 287 186 189 23021 887 --
NM_006089chrX71711 1424 1267 1261 1169 674 164 2760 489 3587 442 72 --
NM_006090chr13759 734 652 1690 ----
NM_006091chr1571744 1728 1502 1393 1376 1241 45 ------
NM_006094chr871754 954 930 741 642 152 46 1421 ----
NM_006095chr4154426 4163 4086 3776 3483 3287 3183 2916 1523 1387 911 825 554 487 205 64359 3937 2804 1619 1569 276 23518 855 1800
NM_006100chr33148 60 46 ------
NM_006106chr11103422 3360 2399 2213 1355 1259 1243 1014 553 410 13427 1237 --
NM_006107chr173523 409 54 ------
NM_006108chr1162398 2111 2000 1703 935 108 22231 2045 21749 728 --
NM_006110chr16------199
NM_006134chr2161576 1564 1374 638 124 114 --21489 161 1170
NM_006135chr131372 1310 230 --11004 --
NM_006136chr751304 1210 921 465 358 21003 241 11338 1171
NM_006139chr242820 2305 2229 2155 22621 323 1132 --
NM_006141chr1652664 2048 1956 879 865 --173 --
NM_006145chr194782 731 184 55 ------
NM_006147chr1298 56 1197 1473 --
NM_006148chr1752983 2954 2641 2596 221 32294 719 508 ----
NM_006152chr12135 ------
NM_006153chr35668 555 230 137 104 --1429 --
NM_006154chr15152924 2696 2645 2389 2309 2225 2148 1005 997 983 854 745 596 559 165 2791 364 11919 11100
NM_006157chr111332 ------
NM_006158chr861679 1539 1147 566 525 440 ------
NM_006160chr1751629 1366 624 466 27 ------
NM_006162chr1821785 470 11699 ----
NM_006164chr21398 ------
NM_006166chr1282589 1882 1672 726 563 526 492 227 51808 1613 812 318 177 ----
NM_006180chr981904 1775 520 309 276 261 244 213 ----11971
NM_006183chr121563 --1136 --
NM_006186chr261260 1240 1207 1171 1078 120 1821 11158 --
NM_006187chr1252949 1021 944 925 851 --12831 --
NM_006190chr22948 332 11001 2837 102 --
NM_006191chr123691 637 386 ------
NM_006194chr1431325 887 182 --1167 --
NM_006197chr882040 1967 1831 1765 838 755 241 214 22257 808 1137 --
NM_006202chr1991557 1528 491 472 269 245 154 148 139 --11241 --
NM_006203chr5145383 4902 4554 4299 4257 4097 3815 3490 1269 1229 942 670 581 337 24495 176 24426 3977 12005
NM_006204chr101213 ------
NM_006206chr4102720 2652 2594 2486 2197 1157 1112 893 801 510 22100 2087 ----
NM_006209chr83438 155 48 ------
NM_006212chr1144991 4889 4820 4593 3881 3581 1469 1353 1180 1108 947 839 651 485 23436 1844 21326 426 14638
NM_006216chr23666 152 94 1113 ----
NM_006226chr231380 1155 66 153 ----
NM_006232chr31221 1242 ----
NM_006237chr1362145 2130 2113 1958 369 53 --1695 --
NM_006238chr652012 310 279 261 236 2342 223 ----
NM_006241chr3111969 1846 1840 1729 1620 903 818 617 564 544 392 1599 12419 --
NM_006242chr2031593 1471 626 --2789 757 --
NM_006243chr11113 --1360 1963
NM_006246chr141503 ------
NM_006251chr5123167 2961 2729 2704 2666 2605 2289 1283 1191 1015 669 264 12988 2661 23 12854
NM_006252chr1217269 6756 6541 6234 6228 6016 5342 5303 4841 4750 2797 1788 1538 1388 1258 1163 819 648 532 259 61 57583 7156 2999 793 619 46813 6371 6089 2860 36046 5254 2746
NM_006254chr3--1353 ----
NM_006256chr162732 2098 2018 675 537 292 ------
NM_006257chr10--182 ----
NM_006258chr1041433 596 433 45 ------
NM_006259chr45968 694 296 276 77 1228 ----
NM_006264chr42457 174 1505 135 --
NM_006265chr861449 1310 322 138 125 99 ------
NM_006267chr21632 --21787 748 --
NM_006273chr171432 2149 71 ----
NM_006275chr2042382 1745 708 369 21649 769 11793 --
NM_006278chr11----1580 --
NM_006279chr12571 369 ------
NM_006281chr871144 1063 921 887 778 436 78 ------
NM_006281chr871144 1063 921 887 778 436 78 ------
NM_006282chr2074724 4661 3407 3210 3202 996 311 14345 ----
NM_006283chr8124963 4415 4153 3939 3669 3241 3096 1210 1147 1073 408 380 23579 3086 24637 1344 --
NM_006291chr1422003 1325 ------
NM_006298chr652843 2728 1112 610 542 22988 995 1631 --
NM_006299chr63242 87 79 1198 ----
NM_006300chr1952337 2234 1783 500 453 22342 1586 32313 216 107 --
NM_006305chr151201 ------
NM_006310chr1741289 1177 434 382 11188 ----
NM_006311chr17164 ------
NM_006312chr121684 1613 ----
NM_006313chr1241606 1221 1206 304 11052 --1690
NM_006315chr4134024 3871 3844 3192 2937 2801 1651 1497 1473 1247 1240 853 722 22945 1059 23428 3361 --
NM_006317chr53780 619 239 ----1668
NM_006320chr46754 327 321 314 299 252 ------
NM_006321chr362260 2183 1624 182 161 153 --12115 --
NM_006322chr133825 630 603 1841 1337 --
NM_006328chr111621 1112 ----
NM_006330chr891659 1160 1099 647 629 451 300 182 86 21651 257 21531 1362 11346
NM_006333chr21448 1104 1252 --
NM_006334chr92222 99 ------
NM_006335chr13757 391 142 --122 --
NM_006336chr961536 1332 1275 1227 230 189 ------
NM_006345chr421030 376 1335 2945 515 --
NM_006346chr134356 187 98 54 1475 ----
NM_006350chr5184 ------
NM_006352chr1142066 1922 1892 1880 1832 1794 1623 1555 823 505 482 433 333 214 11931 ----
NM_006353chr651452 1044 1013 881 60 ----1921
NM_006359chrX132359 2326 2317 2243 2233 1733 1001 896 677 496 485 363 302 1309 12472 --
NM_006360chr11121 ------
NM_006364chr148903 513 481 426 347 108 67 58 1829 1448 --
NM_006366chr631178 393 147 2849 463 1935 11293
NM_006369chr13125 116 98 1440 ----
NM_006371chr3105291 5201 4643 4404 4377 3558 774 688 666 385 3617 514 214 1816 --
NM_006372chr62441 187 1198 ----
NM_006375chrX61786 1384 616 380 327 75 --11761 --
NM_006378chr981279 1029 522 479 463 180 153 68 --11410 --
NM_006379chr772193 1775 1717 1671 934 263 161 12068 ----
NM_006380chr17134243 4210 4079 3962 3611 3440 3312 2884 1516 1254 1129 902 523 33831 3453 3024 12691 --
NM_006386chr22132462 1985 1864 1855 1658 1544 504 380 186 104 96 88 72 1526 3788 283 125 2459 326
NM_006390chr1261667 1189 675 436 413 394 31366 620 580 1704 --
NM_006391chr113327 240 233 ------
NM_006393chr10124157 3669 3561 3278 3201 2937 1482 1305 1270 1242 866 291 14109 13176 1608
NM_006399chr14----1299 --
NM_006401chr93474 428 334 1396 ----
NM_006403chr681847 1831 1773 1371 1129 372 185 89 ----11721
NM_006404chr201125 ----1538
NM_006405chr14140 --1229 --
NM_006413chr1061147 1096 974 484 466 303 --1244 --
NM_006415chr971293 1189 1114 996 972 217 175 1291 1910 --
NM_006416chr62684 566 --2671 646 --
NM_006420chr20103365 3183 2817 2657 2651 2583 2338 580 236 56 12361 32490 2260 251 12154
NM_006421chr82924 482 11126 2827 91 --
NM_006424chr421943 1772 ----11561
NM_006434chr1072969 2874 2832 2534 873 855 29 12257 23191 3175 1428
NM_006449chr281992 1758 1602 790 650 631 524 135 --11545 --
NM_006451chr53913 892 325 21034 725 ----
NM_006457chr4143163 3133 2991 2590 1630 1557 1110 1052 1005 978 878 833 208 71 31530 1516 924 43780 2958 2703 930 12620
NM_006460chr1791792 641 534 450 402 279 238 213 172 --11489 --
NM_006463chr21178 --1598 --
NM_006464chr2124629 4576 4475 3805 3238 2986 1270 935 802 447 116 76 11876 11695 14613
NM_006466chr2021073 144 1701 ----
NM_006467chr582219 939 450 375 283 101 77 27 11539 22074 1875 11506
NM_006469chr131406 1200 469 21293 409 11441 --
NM_006471chr182286 62 1262 ----
NM_006474chr1111976 1894 1880 1641 1633 1489 1404 1263 1252 661 53 ------
NM_006475chr134579 520 484 150 1241 --1612
NM_006479chr125980 922 643 399 245 --1384 --
NM_006482chr12173763 3441 3414 3249 3088 3080 2855 2693 2420 2397 1470 1438 1337 1256 1071 793 783 33554 3427 454 ----
NM_006489chr1451793 1765 247 190 90 ------
NM_006495chr173312 104 53 ------
NM_006496chr141774 698 360 328 1372 1408 1251
NM_006497chr171233 ------
NM_006502chr63348 111 38 ------
NM_006504chr10102822 2629 2575 2158 2095 1158 1088 441 225 24 --31908 1027 103 1255
NM_006516chr151102 560 262 239 126 ------
NM_006517chrX61494 875 779 596 215 73 --21969 637 --
NM_006520chrX91702 1671 1561 597 580 557 499 456 436 ------
NM_006526chr20132062 2010 1904 1869 1669 1594 1448 882 820 788 494 464 315 --31887 1399 283 --
NM_006534chr20143447 3201 2802 2375 2332 1271 1044 964 950 828 560 408 321 195 22633 2261 12511 --
NM_006536chr14986 884 646 137 --1388 --
NM_006537chr151236 ------
NM_006538chr2114166 2898 2811 1662 1519 1358 718 570 499 481 192 42776 2767 1288 335 23277 1294 --
NM_006540chr841524 1292 463 390 11545 ----
NM_006544chr14256065 5755 5735 5710 5078 4410 4257 3845 2355 2269 2209 2142 2107 2085 1848 1569 1458 1362 1345 1315 1072 912 561 500 208 35977 3804 1062 36119 4763 4278 22118 699
NM_006546chr17206617 6224 6105 5828 5792 5729 5331 4834 4639 4456 4385 2643 2394 1800 1716 1705 1215 902 487 409 15365 45646 4595 2286 393 11845
NM_006547chr7111885 1865 1760 1696 1626 1606 1495 711 553 481 126 32140 1852 1766 ----
NM_006548chr371393 1385 1277 1202 532 514 370 ------
NM_006549chr1292949 2775 2137 1099 748 720 580 572 140 --52793 2338 2053 2021 698 22260 863
NM_006554chr22293 222 --1303 --
NM_006557chr941600 622 393 41 11662 11123 --
NM_006558chr82386 67 ------
NM_006559chr14396 253 231 116 1977 154 --
NM_006561chr10216167 6154 5982 5923 5905 4531 4182 4040 3956 3880 3820 1921 1891 1525 1388 1130 1054 998 447 329 131 55881 4658 582 335 42 25291 1287 66204 6141 6086 5376 1670 532
NM_006565chr1631101 843 81 --168 11193
NM_006572chr17103426 3138 2940 2795 2332 2185 1222 588 580 143 1745 23467 1052 --
NM_006575chr1441146 1133 549 311 1999 --11356
NM_006577chr291315 1239 1228 1132 453 284 247 188 81 11017 ----
NM_006587chr471485 1431 1234 1202 1167 1053 464 3410 177 164 21263 189 11045
NM_006595chr1171989 1948 1396 1332 1285 606 254 21861 580 11416 --
NM_006599chr16318262 8087 8001 7994 7883 7568 7408 6906 6755 6397 6151 5911 5745 5381 5198 5141 5121 4991 3046 2783 2763 2083 1950 1778 1755 1734 1606 1538 814 679 389 67071 1746 881 653 511 465 97812 7063 5951 5149 2503 1674 1137 1078 1040 15064
NM_006601chr124921 840 767 321 ----1132
NM_006603chrX52032 1918 1711 607 398 31718 582 220 198 --
NM_006609chr292883 2831 2514 2035 509 233 197 178 75 32960 2500 1846 22284 130 --
NM_006614chr3163545 3463 3217 2944 2920 2561 1463 1291 1105 1015 823 704 650 642 359 160 2850 624 --11165
NM_006618chr181475 1390 522 498 464 206 188 123 31323 1112 474 31329 145 63 --
NM_006620chr6103663 3582 2950 1414 935 876 814 457 356 26 33905 737 414 11144 13011
NM_006621chr1131993 1662 1616 1604 1595 1353 735 687 277 267 103 79 58 1131 2785 628 1384
NM_006624chr1041751 562 427 273 51696 591 567 433 182 1600 --
NM_006625chr11396 ------
NM_006625chr11396 ------
NM_006625chr11396 ------
NM_006626chr9122682 2561 2345 2324 2226 2099 1999 805 660 569 458 422 32138 1063 107 31980 1790 836 12035
NM_006628chr1594695 3991 3786 3763 3601 1307 1173 1034 718 13280 31805 386 45 34433 4038 1289
NM_006629chr1872296 2181 1058 970 852 639 602 22263 1050 ----
NM_006633chr53728 113 67 ------
NM_006636chr281052 1008 952 818 793 777 151 80 ------
NM_006644chr135690 568 461 94 44 ------
NM_006646chr13103013 2916 2727 2588 2308 1971 537 524 468 440 --42550 2480 2320 1868 --
NM_006648chr91119 ------
NM_006654chr12194531 4423 4404 4061 3862 3855 3800 3559 3341 3149 1838 1773 1566 973 855 777 281 113 77 14344 34166 3970 3948 --
NM_006658chr781010 863 826 294 217 197 92 80 ------
NM_006667chrX51127 434 285 242 28 1411 ----
NM_006670chr63633 222 158 ----1257
NM_006675chr1282720 2541 2271 2201 2194 976 626 575 --1606 --
NM_006680chr111106 ------
NM_006691chr11101179 1054 1027 1021 994 788 782 430 401 40 1980 ----
NM_006693chr74845 603 584 176 ------
NM_006698chr2041254 1215 907 497 1551 1444 --
NM_006699chr182504 2433 2420 2350 1889 693 654 452 11750 32740 873 635 11765
NM_006700chr121103 --1120 --
NM_006703chr64372 365 357 179 ------
NM_006704chr131323 --1452 1385
NM_006708chr62333 233 1404 21195 533 1978
NM_006716chr741221 427 87 56 11335 ----
NM_006717chr9143356 3258 3154 2727 2720 2302 2273 2172 2122 2089 997 802 528 200 22877 2535 22918 2418 --
NM_006718chr62842 778 --2384 23 --
NM_006720chr10174672 4545 4484 4271 4058 3994 3698 3654 1774 1226 1130 1060 1027 494 297 290 208 24832 3580 34293 3675 3251 --
NM_006721chr104679 334 267 99 ------
NM_006722chr3152985 2836 2411 1217 1015 895 889 870 835 711 339 310 151 83 44 33084 738 116 32894 2476 2137 11996
NM_006724chr6--1488 ----
NM_006726chr451115 462 229 142 116 --21081 428 --
NM_006727chr53536 524 110 1117 ----
NM_006729chrX185028 4830 4540 4441 4121 4112 3946 3929 3574 3533 2094 1851 1831 1441 1126 924 791 107 14601 33665 1255 904 35139 1422 1407
NM_006731chr9175670 5490 4825 4819 4798 4514 4292 2145 1881 1774 1710 1554 1073 972 953 831 646 24628 1190 55843 3755 1958 1397 29 33955 1843 539
NM_006732chr1971939 1908 1796 1421 760 712 202 --11399 --
NM_006734chr66515 426 281 251 59 44 21297 520 1343 --
NM_006735chr75342 307 298 95 86 ------
NM_006738chr1594604 4558 3445 3432 3426 3282 3208 3153 3011 14546 11198 1630
NM_006745chr481118 1018 1000 975 918 425 304 161 ------
NM_006749chr851262 1242 1036 967 434 --11108 11284
NM_006750chr16277816 7742 6648 6459 6315 6049 5729 5466 5411 5190 5097 4903 3231 3183 3162 2303 2122 2114 1959 1350 835 771 758 361 328 305 274 46586 6072 2727 314 36735 5447 2956 16256
NM_006751chr221037 929 3912 720 305 5889 331 236 93 38 1160
NM_006754chr741217 509 239 82 31162 986 261 ----
NM_006756chr8101457 1355 1305 1129 1019 615 385 310 224 101 1283 2606 275 11315
NM_006759chr21119 144 ----
NM_006763chr161635 611 592 516 120 89 --1525 11446
NM_006764chr33408 103 50 --1475 --
NM_006766chr8152650 2352 2239 2073 2037 1842 1679 955 728 669 404 305 202 144 88 52328 2213 1758 1709 1059 1125 --
NM_006772chr661726 1699 1639 1291 1103 398 --11094 1520
NM_006773chr2151559 1531 1427 1419 1291 1098 1076 620 442 350 242 202 175 76 50 21434 606 1460 --
NM_006775chr6143041 2833 2667 2609 2588 2234 1121 1111 1060 976 799 682 406 202 --12787 12557
NM_006777chrX82442 2269 2223 1811 976 768 147 134 1396 22688 1182 --
NM_006778chr631637 1627 388 --21950 1922 --
NM_006784chr14604 363 355 38 130 1191 --
NM_006785chr183837 467 339 --21641 685 11724
NM_006788chr1871614 1565 1544 1382 1339 324 258 1362 ----
NM_006790chr52379 63 ------
NM_006791chr154651 180 171 47 2633 191 ----
NM_006800chrX2639 542 1572 ----
NM_006801chr194563 542 475 267 1531 ----
NM_006803chr891905 1822 1525 1384 1366 569 359 281 125 141 --148
NM_006805chr56664 548 508 495 255 225 ------
NM_006806chr211127 1156 ----
NM_006807chr1751302 1171 842 384 128 ------
NM_006808chr91160 --155 --
NM_006811chr202835 234 ------
NM_006813chr61721 3784 675 358 138 --
NM_006815chr12101018 970 956 882 544 470 425 121 86 78 --2291 204 --
NM_006818chr11332 1649 2643 176 --
NM_006820chr1124307 4008 3945 3549 3423 3087 2854 2790 1713 1190 957 231 34253 3664 1352 24273 519 --
NM_006825chr122386 69 --197 144
NM_006827chr14163380 3206 2853 2843 2811 2651 2235 1303 1278 974 963 649 468 398 338 115 33395 908 785 13311 11022
NM_006831chr111418 --1269 --
NM_006838chr1251604 1173 681 613 216 ------
NM_006851chr12132799 2772 2451 2241 2199 2042 1990 1946 852 843 646 345 290 32669 927 912 21160 886 2752 660
NM_006852chr17142764 2478 2444 2414 2404 2357 1109 898 690 608 571 425 136 127 --21066 843 --
NM_006854chr792059 1631 1602 1310 1274 449 322 220 169 ------
NM_006857chr28747 734 676 354 277 194 112 27 ------
NM_006868chr1863181 3031 2434 1059 1051 261 --1628 --
NM_006870chr201247 ------
NM_006873chr2113265 2871 1080 1038 1022 792 664 451 301 218 171 23273 3039 21280 361 23186 973
NM_006874chr45967 955 924 385 105 1787 ----
NM_006877chr65304 296 284 276 270 ------
NM_006884chr351855 1617 1599 1350 710 ----1449
NM_006885chr16234033 3865 3747 3570 3440 2848 2808 2623 1621 1507 1451 1401 1343 1315 1240 1093 1072 1066 1040 848 674 597 199 22913 561 1433 11154
NM_006887chr23264 219 188 ------
NM_006888chr14133533 3414 3297 2892 2826 2810 2802 2238 1195 869 681 113 24 1313 13128 --
NM_006892chr2091390 1315 1288 1090 517 495 427 300 244 ----21023 966
NM_006892chr2091390 1315 1288 1090 517 495 427 300 244 ----21023 966
NM_006894chr12308 23 ------
NM_006901chr153518 464 365 1397 ----
NM_006908chr721417 160 1968 1145 1273
NM_006910chr162297 145 ------
NM_006913chr61102 --1294 1374
NM_006914chr951366 1169 1093 1025 405 ----1135
NM_006915chrX112376 2328 1904 1885 1877 1722 1650 563 462 248 125 22068 407 12471 1916
NM_006916chr261094 1015 929 419 249 189 1378 ----
NM_006918chr11155718 5657 5485 5430 4812 4671 4318 4203 3808 1931 1795 1722 893 837 434 25566 4958 55134 5031 4886 1621 57 --
NM_006920chr2132078 1868 1787 1775 1727 1601 1313 796 641 466 451 387 64 31933 1545 1521 11814 11457
NM_006922chr2102558 2003 1853 1744 683 628 525 433 361 337 12481 ----
NM_006924chr17114416 4197 4138 1629 1621 1615 1581 1237 903 707 75 --24043 2707 14218
NM_006930chr551916 1866 1839 1272 1259 ------
NM_006931chr1241528 794 596 505 21556 120 --12097
NM_006937chr172198 118 1435 ----
NM_006938chr184911 197 178 44 --1235 --
NM_006939chr1451210 958 943 915 414 ----1337
NM_006940chr12111893 1299 1292 1248 754 670 495 476 468 458 420 21360 89 21385 542 11445
NM_006952chr321062 277 --1470 11085
NM_006965chr186970 338 313 303 95 42 --11100 --
NM_006981chr9102911 2505 2264 1962 1902 1069 1049 615 146 139 12172 ----
NM_006982chr121243 --123 157
NM_006988chr2141191 1177 1053 787 --1270 --
NM_006993chr102279 261 --181 --
NM_006996chr171896 1551 651 579 478 235 70 11741 1107 --
NM_006997chr102469 101 --1179 --
NM_006999chr592081 2066 2052 2008 702 571 518 469 141 ------
NM_007005chr921200 1056 1140 ----
NM_007006chr16103494 2823 2696 2498 2469 2226 893 772 676 429 22778 948 1310 1271
NM_007007chr12174734 4565 4403 4194 3702 3673 3565 3440 3329 3301 2944 1930 1705 1062 674 530 187 33997 3482 1217 23351 1801 1978
NM_007008chr23679 243 133 ------
NM_007010chr1731360 370 193 11181 11917 21565 1470
NM_007011chr15166736 6632 6535 4667 4354 2761 2695 2676 2649 2045 1855 1824 1438 1339 206 184 --45846 1907 1556 981 1701
NM_007017chr58866 847 837 831 686 644 632 609 ----1301
NM_007018chr91373 ----1399
NM_007019chr202174 74 --144 --
NM_007023chr221019 347 ----1761
NM_007026chr172606 198 ------
NM_007027chr31415 1189 ----
NM_007033chr142073 1984 110 69 22280 221 2656 195 --
NM_007034chr151044 413 290 236 168 11007 1219 21029 327
NM_007035chr123198 137 44 --2686 610 --
NM_007038chr21165704 5646 5442 5309 4950 4901 4858 2329 2207 2115 2109 2056 1869 1668 908 455 55249 2342 1876 1774 739 84965 4209 3969 1556 1525 1514 1279 1096 24330 1235
NM_007039chr1472337 1861 626 518 376 359 187 2770 666 2610 420 --
NM_007042chr352433 2303 2062 1684 51 12019 22490 441 12447
NM_007045chr63138 66 58 --1230 --
NM_007046chr21379 ------
NM_007050chr20137973 7905 7413 5903 2946 1614 1518 1101 1008 909 845 828 285 27383 2879 --25919 1710
NM_007054chr5113773 3735 3462 3120 2815 2807 1143 1103 974 838 802 --11010 --
NM_007064chr351717 1363 1352 1305 1036 1453 ----
NM_007067chr1721359 1175 11496 31218 532 74 --
NM_007068chr222997 97 ------
NM_007073chr6114056 3716 2746 1449 1091 875 743 733 570 350 328 173 23276 924 14258
NM_007078chr1082952 1974 1907 818 786 446 147 81 --22486 2213 12446
NM_007080chr4365 55 43 1324 --1118
NM_007084chr1341551 1335 1254 530 1402 11196 --
NM_007099chr23899 787 607 1131 --164
NM_007106chr13112836 2782 2651 2604 2023 1066 1038 977 668 209 193 22128 151 22139 201 21728 182
NM_007107chr372396 2211 2081 1801 1572 1558 565 1579 42151 915 847 514 --
NM_007111chr132618 283 --1261 1767
NM_007114chr3142988 2837 2515 2384 2369 2070 1009 982 895 533 242 226 199 127 --12825 23166 2817
NM_007115chr2----1101 --
NM_007124chr641801 447 399 213 --2749 735 12010
NM_007125chrY71281 985 520 296 288 52 34 11223 1380 --
NM_007129chr136994 836 661 372 149 114 1949 21028 727 --
NM_007136chr33402 45 33 --1311 --
NM_007137chrX124113 4085 4034 3894 3804 3584 3488 1540 1311 816 717 583 3571 542 507 35523 4563 3591 12065
NM_007145chr1941361 1247 1228 513 ----11258
NM_007146chr1742819 2635 1162 332 11109 21096 138 --
NM_007147chr1971172 1071 1012 893 398 251 49 ------
NM_007150chrX52145 1646 1638 1581 488 1554 2831 122 --
NM_007157chrX132934 2686 2519 2377 2334 2255 2233 1860 1021 904 791 785 718 21172 328 2300 94 --
NM_007158chr151244 1190 1182 826 440 --11000 --
NM_007159chr381707 1648 704 559 494 474 239 83 --1368 21277 229
NM_007166chr1161412 1294 1049 636 490 440 --21439 1405 --
NM_007170chr12896 370 ------
NM_007172chr2292701 2343 2058 2036 675 518 245 234 75 12143 1283 --
NM_007173chr11101906 1850 1764 1714 1634 1571 794 664 411 322 ----2812 146
NM_007174chr1282321 2118 1743 1512 497 414 403 392 ----12148
NM_007175chr8103312 3245 3226 2887 2435 733 656 644 555 49 32783 1278 1200 ----
NM_007178chr122371 342 --1430 --
NM_007187chr134930 783 731 692 1150 --2992 888
NM_007190chr1071160 1108 1082 1020 809 352 28 1360 1398 --
NM_007191chr123466 446 204 ------
NM_007192chr1421110 954 --181 --
NM_007195chr18243416 3383 3096 3081 2993 2921 2890 2881 2875 2869 2845 2837 2795 2412 2388 2381 1340 1332 1158 1139 1060 898 365 353 --23109 768 22325 273
NM_007197chr123969 70 57 ----11003
NM_007198chr871659 1457 1447 1157 1087 455 211 1361 ----
NM_007200chr1594604 4558 3445 3432 3426 3282 3208 3153 3011 14546 11198 1630
NM_007203chr9133822 3810 3642 3031 2848 2509 1150 905 825 786 574 514 486 23983 3388 11424 12568
NM_007204chr15649 239 202 192 101 ----1152
NM_007207chr19944 825 807 622 598 273 236 147 77 --1913 --
NM_007212chr1152120 1490 916 828 644 624 613 540 415 370 314 254 238 204 114 12245 32292 2042 49 1306
NM_007214chr651182 1060 520 361 47 ----11009
NM_007218chr82364 249 --2879 855 --
NM_007222chr871512 1356 1339 1239 1201 1151 673 21444 1286 1266 11137
NM_007224chr121650 ------
NM_007231chrX81931 1793 1785 1593 766 288 267 42 32471 384 129 1199 1324
NM_007235chr122370 67 194 2445 136 --
NM_007241chr173238 133 108 ------
NM_007246chr481056 1005 921 821 814 778 192 166 1827 1380 --
NM_007249chr13259128 9103 8606 7770 7621 7408 7376 7370 6497 6464 6210 5933 3637 3456 3391 3346 2908 2424 1973 1821 1707 1676 1641 1614 1206 47139 6952 6881 897 48945 7548 5820 5743 27360 6733
NM_007250chrX2516 72 1215 2597 368 --
NM_007255chr51599 --1552 --
NM_007257chr8132973 2805 2759 2701 2511 1832 1824 1034 653 394 216 202 56 2782 557 2525 227 --
NM_007260chr11760 1219 ----
NM_007269chr12452 168 1245 --1130
NM_007271chr651345 1136 535 196 153 ------
NM_007279chr19--1510 1525 --
NM_007281chr4175 --1185 --
NM_007282chr35969 644 104 85 65 ------
NM_007285chr161196 ----1129
NM_007287chr373193 1177 749 540 343 267 242 23082 275 1686 2716 218
NM_007288chr373193 1177 749 540 343 267 242 23082 275 1686 2716 218
NM_007289chr373193 1177 749 540 343 267 242 23082 275 1686 2716 218
NM_007292chr17204979 4811 4480 4205 4196 3827 3676 3517 3383 3373 3366 3208 2028 1160 1075 1063 920 522 383 73 24849 1165 1600 11030
NM_007294chr1741147 1134 929 899 11225 --1236
NM_007295chr1741147 1134 929 899 11225 --1236
NM_007296chr1741147 1134 929 899 11225 --1236
NM_007297chr1741147 1134 929 899 11225 --1236
NM_007298chr1741147 1134 929 899 11225 --1236
NM_007299chr1741147 1134 929 899 11225 --1236
NM_007300chr1741147 1134 929 899 11225 --1236
NM_007302chr1741147 1134 929 899 11225 --1236
NM_007303chr1741147 1134 929 899 11225 --1236
NM_007304chr1741147 1134 929 899 11225 --1236
NM_007305chr1741147 1134 929 899 11225 --1236
NM_007308chr43585 295 24 ----196
NM_007313chr921966 1910 1359 11564 --
NM_007315chr281552 1281 1183 1174 1125 450 424 92 11086 21351 153 --
NM_007325chrX62042 2025 1974 1926 876 155 11874 2683 519 --
NM_007331chr482680 2531 2500 2375 1985 757 673 514 1829 2796 464 --
NM_007345chr18102324 2277 1603 1457 918 893 494 482 391 34 12084 1328 --
NM_007347chr15103021 2968 2534 2421 2403 2393 2194 2070 587 134 ------
NM_007350chr12114553 3888 3614 3238 1474 960 669 575 569 357 64 44237 3320 3306 1494 43643 2821 1519 483 24620 2996
NM_007357chr11202 ------
NM_007358chr192043 1989 1859 1730 1517 1240 498 246 218 41950 1299 691 92 41870 1488 726 300 --
NM_007361chr143516 493 191 ------
NM_007362chr351538 1467 1391 392 91 11282 11197 11079
NM_007363chrX51034 983 882 818 752 2990 24 ----
NM_007365chr172196 1945 1936 1830 1819 864 554 --21904 727 --
NM_007372chr176865 798 742 332 174 42 ------
NM_007373chr10121776 1767 1540 1501 1331 1224 353 325 222 198 161 127 157 3667 507 434 --
NM_007375chr192825 2802 2399 2393 884 692 410 288 143 21709 632 2153 51 --
NM_009585chr32325 170 ------
NM_009585chr32325 170 ------
NM_012064chr1251075 427 383 149 113 --11105 --
NM_012069chrX72520 1996 1833 340 180 79 36 22718 947 ----
NM_012074chr1441027 811 127 79 --11019 --
NM_012081chr5123155 3123 2856 2810 2745 1138 1080 894 322 286 239 137 43637 3443 1145 441 12641 --
NM_012082chr84695 667 641 242 1603 --1943
NM_012089chr151386 1153 295 248 120 ------
NM_012090chr151215 524 499 307 137 ------
NM_012092chr261879 1746 1442 617 600 501 ------
NM_012093chr151250 1238 1219 1187 1178 ------
NM_012095chr1062875 2323 2137 631 615 244 --23509 1108 12353
NM_012096chr3143763 3736 3315 3093 3084 2304 1474 1455 1268 778 382 281 183 46 23676 2403 21234 604 11399
NM_012102chr1142640 2520 2248 2099 1884 1858 1847 1786 998 657 595 565 450 299 --32173 1869 115 1314
NM_012104chr1173694 3400 2539 2468 1425 857 737 23341 345 23365 1158 --
NM_012104chr1173694 3400 2539 2468 1425 857 737 23341 345 23365 1158 --
NM_012115chr63546 502 229 ------
NM_012118chr42365 40 1428 ----
NM_012120chr6102938 2716 2363 2339 2225 2161 947 515 427 318 21941 1836 --2917 208
NM_012129chr7112539 2189 2177 1790 1751 1693 1578 652 549 536 189 11842 31814 981 366 --
NM_012137chr1102898 2742 2344 2140 2012 949 934 884 444 299 22127 388 32551 2091 1026 --
NM_012141chr13174026 3988 3775 3392 2937 2911 2857 2722 2570 1393 1334 745 380 219 184 167 142 33707 2710 305 33570 3138 3052 --
NM_012153chr1182602 2053 2047 1789 1738 893 690 94 42454 872 288 265 ----
NM_012154chr81319 1829 ----
NM_012155chr191227 ------
NM_012156chr2073356 3281 3161 3146 3114 2893 27 43288 2907 889 308 ----
NM_012157chr32740 627 1887 ----
NM_012158chr1331669 1501 221 ------
NM_012160chr63526 518 364 --1489 --
NM_012161chr461106 871 738 433 174 50 --2247 79 1128
NM_012164chr9287430 7393 7307 7193 7066 6911 6480 6383 5953 5554 5514 5200 4721 4555 2748 2740 2381 2373 2210 1462 1442 1212 1191 924 899 842 398 284 37198 5746 4601 27373 6191 --
NM_012175chr114881 797 692 218 ----2584 58
NM_012176chr52245 233 ------
NM_012177chr66568 560 540 519 173 129 1460 ----
NM_012180chr44688 629 602 136 --1197 --
NM_012183chr12623 428 ------
NM_012186chr12773 733 --1237 --
NM_012193chr11215390 5194 5018 4691 4676 4670 4100 3833 3543 3351 1871 1722 1555 1150 1142 1022 982 773 762 728 25 21737 1207 1669 --
NM_012199chr1224689 4434 4229 3902 3825 3687 3299 3281 3267 3227 2963 1816 1799 1521 1504 1461 1262 1151 1074 826 579 455 --11637 21189 1133
NM_012207chr1031028 422 208 159 174 --
NM_012210chr961531 1225 1043 422 348 23 --21011 1001 --
NM_012214chr2256365 6278 6180 6120 5382 5344 5075 4924 4903 4747 4074 3901 2548 2524 2293 1985 1977 1941 1912 1875 1862 496 481 79 25 16190 35064 4540 557 3637 596 218
NM_012215chr1071916 1750 1674 1607 1411 799 723 21277 339 21297 664 --
NM_012219chr352864 2766 1242 437 84 2954 894 12724 --
NM_012223chr241226 1063 987 149 11135 ----
NM_012224chr451223 1182 1154 843 420 2392 128 --1164
NM_012233chr251191 1081 1012 434 220 ------
NM_012234chr3113530 3482 3409 1381 1177 1095 1063 1032 718 436 133 33758 2452 2343 --23439 1276
NM_012238chr10101787 1605 1319 504 431 345 314 266 172 157 21239 145 --11309
NM_012242chr102304 162 --2284 258 --
NM_012243chr12770 337 128 1637 --
NM_012244chr1451849 1747 1730 1715 1676 11641 21801 1737 --
NM_012247chr1041058 812 395 171 1904 ----
NM_012249chr2103020 2504 2208 1287 1277 1112 927 846 587 345 22296 613 138 --
NM_012250chr114907 419 349 56 1883 ----
NM_012252chr7205365 4857 4676 4664 4024 3956 3885 3740 3645 3558 3539 3448 3420 1200 1111 1001 821 460 210 96 104742 4477 4159 3925 3730 3612 3394 3383 868 103 13570 25251 1072
NM_012255chr203446 332 135 --3405 117 69 --
NM_012257chr73968 749 170 --1226 --
NM_012259chr691417 1187 1136 1054 1002 951 926 425 172 --11294 --
NM_012261chr20--1675 ----
NM_012262chr1215279 4876 4870 4863 4844 4624 4515 4286 4249 4108 3288 1999 1770 1702 1680 1450 898 773 572 526 195 45018 3343 2012 350 33928 3610 202 21075 653
NM_012266chr931125 851 104 21079 435 --1933
NM_012278chrX1148 ------
NM_012281chr7102318 1780 1768 1686 968 918 783 571 376 178 1907 --1652
NM_012284chr121318 ------
NM_012286chrX3649 66 26 1178 ----
NM_012287chr3174301 4164 4092 4017 3895 3572 3353 2938 1409 1401 1245 1030 891 433 337 233 72 24133 2749 34344 4139 3968 --
NM_012288chr6135724 5684 5150 5103 4696 4519 4463 3770 3595 864 394 224 218 45662 4924 3972 893 45674 5433 2017 382 --
NM_012290chr281496 1384 1235 1207 666 631 425 85 21523 386 11278 11350
NM_012294chr7104058 3886 3591 3015 1219 773 761 663 498 190 21181 264 23422 1286 --
NM_012296chr1131093 508 221 1496 ----
NM_012297chr4152416 2107 2099 2081 1951 1943 1924 1834 1607 864 825 818 416 353 68 11797 2755 111 --
NM_012300chr562040 1791 1019 667 574 551 --1606 1168
NM_012301chr792248 2143 1770 1362 805 696 665 647 523 --11376 --
NM_012302chr12361 162 21274 1180 --1862
NM_012304chr582417 2332 2323 1936 1755 233 107 56 --1143 1154
NM_012307chr1851065 854 838 757 255 1827 2867 679 1399
NM_012309chr11224521 4357 4302 4236 4192 4067 3369 3222 3127 1981 1826 1677 1614 1605 1395 1377 706 699 579 496 241 209 34957 4490 3133 11947 --
NM_012311chr102493 216 --1582 1657
NM_012316chr1125419 4268 3586 1166 1085 980 942 563 359 347 341 239 34065 2236 394 55613 5447 3539 3485 583 --
NM_012322chr72146 64 ------
NM_012327chr1861591 1553 1489 1271 1111 179 51505 1265 639 585 247 1530 21198 575
NM_012328chr741209 369 250 216 --1932 11377
NM_012329chr17101600 1389 1196 1187 1083 1036 647 561 503 381 --1310 --
NM_012330chr10101814 1759 1578 1246 587 374 220 197 190 182 --1708 1528
NM_012333chr131195 1188 176 1665 11538 --
NM_012334chr5103528 3441 3391 3288 3281 1651 1485 1452 1252 558 33568 3148 532 ----
NM_012338chr741144 1034 912 56 ----11221
NM_012342chr102501 492 --1146 --
NM_012343chr561103 880 720 705 302 227 2972 436 --1161
NM_012347chr692942 2898 2405 2388 2264 2039 533 348 208 21969 325 12204 --
NM_012382chr5153456 3394 3043 2763 1666 1359 1189 833 758 743 699 602 580 472 429 54064 3679 3119 1744 118 12874 1202
NM_012383chr91297 ----1364
NM_012388chr15112808 2219 2020 1933 952 759 601 404 317 148 24 1202 12892 --
NM_012394chr1296 22 ------
NM_012395chr7133415 3209 3182 2757 2729 2476 2370 2291 2281 814 458 175 114 23057 2592 ----
NM_012397chr1871721 1581 1397 1285 1236 1117 195 ------
NM_012399chr22101898 1361 1342 1330 1293 765 747 636 578 527 --4790 568 495 307 --
NM_012405chr1103828 3556 3117 3016 2821 2811 2641 807 581 483 22653 93 13149 --
NM_012412chr75850 824 262 220 84 ------
NM_012414chr12256 111 --1839 --
NM_012416chr95962 876 818 132 96 ------
NM_012419chr64549 479 445 150 ------
NM_012420chr1082148 1944 1557 1503 796 193 183 34 --11751 1310
NM_012421chr11438 ----1470
NM_012425chr10122719 2544 1998 1992 1843 1778 779 675 644 557 285 213 11692 22774 115 --
NM_012426chr162346 333 ------
NM_012428chr153699 314 246 1886 1796 --
NM_012430chr33663 536 111 1753 1224 --
NM_012431chr7143200 3039 2818 2751 2411 1243 1204 1131 1033 757 617 390 195 104 22405 225 32743 802 399 --
NM_012433chr21240 ------
NM_012434chr671663 1623 1327 1146 275 122 40 --11470 --
NM_012446chr51487 1397 ----
NM_012448chr1782293 2121 1020 996 912 499 238 143 --22359 1652 --
NM_012449chr7123 ------
NM_012453chr72311 221 1116 11552 --
NM_012454chr63567 455 365 ------
NM_012463chr1241300 1146 670 660 21554 265 1202 11499
NM_012464chr482890 2774 2733 2345 1897 1079 963 59 42016 1840 1119 1046 21865 1023 --
NM_012465chr1093365 3316 3263 2982 2975 2853 1309 472 37 1777 42868 2745 841 108 1625
NM_012467chr16------126
NM_012475chr1184 ------
NM_012479chr7122662 2622 2335 2253 2154 2140 1969 770 599 373 159 55 --32647 2366 2017 --
NM_012486chr12100 88 ------
NM_013227chr152822 346 --1260 --
NM_013229chr12162831 2788 2721 2680 2654 2207 1905 1896 1813 1759 1048 1038 746 738 166 40 1198 ----
NM_013230chrY41613 1412 1345 1152 ------
NM_013231chr1484272 3975 3260 2759 1530 1350 1196 911 --43872 3620 1749 316 --
NM_013233chr22415 172 --2395 269 1553
NM_013235chr51307 1906 1194 --
NM_013236chr2241055 783 187 29 1435 --153
NM_013243chr152162 87 1469 11045 --
NM_013245chr162644 273 ------
NM_013249chr11----1205 --
NM_013254chr124604 469 166 94 --1679 1720
NM_013255chr7248718 8356 8123 7416 7386 7333 7216 6921 6862 6851 5700 3442 2616 2166 2157 2060 2053 1970 1533 1177 987 697 328 258 78880 8727 3529 2576 1993 1129 263 56258 5817 5693 2144 335 11605
NM_013257chr8102352 2294 2282 1981 1861 298 265 223 145 106 32388 2241 2130 2950 465 12071
NM_013261chr4223737 3673 3427 3263 3205 3114 3034 3028 3022 2816 2747 2672 2603 2437 2422 2283 1471 1457 1105 862 778 677 22823 1518 31446 1195 99 --
NM_013262chr651310 1253 504 458 253 21403 1105 ----
NM_013263chr16--143 ----
NM_013264chr11174 ----1223
NM_013269chr12114443 4373 3808 3733 3238 3229 3223 3210 3185 1407 772 13982 34508 4160 1299 186
NM_013272chr153391 355 49 2159 55 ----
NM_013277chr1251012 969 899 726 348 11099 1928 --
NM_013280chr113661 315 182 ------
NM_013281chr2041259 597 343 238 21450 1268 11519 21368 410
NM_013282chr1991291 1212 1092 1021 984 937 327 279 151 21343 1227 21121 257 1159
NM_013283chr55873 802 645 609 350 --1197 --
NM_013286chr3123804 3016 2790 982 973 623 492 323 269 261 223 181 --11212 --
NM_013293chr73576 267 31 --1773 --
NM_013302chr16174733 4711 4612 4324 4311 4173 3997 3336 1875 1855 1327 1159 609 464 456 140 103 43530 1246 863 831 21724 616 --
NM_013309chr1552635 2621 2598 447 395 11786 --22432 643
NM_013316chr781041 942 686 667 235 197 126 53 --1787 --
NM_013322chr781733 1654 1598 1432 1405 1142 1093 156 --11387 11508
NM_013341chr262073 1953 1125 131 70 53 ------
NM_013354chr841129 482 445 23 11488 1316 --
NM_013357chr83864 735 84 ----1586
NM_013365chr222848 532 ------
NM_013367chr41113 ------
NM_013371chr11331 ------
NM_013372chr1562979 2946 2822 2799 2502 1347 22481 583 12140 --
NM_013374chr3153088 3006 2986 2956 2728 2353 2063 1250 1013 942 844 687 530 382 131 ------
NM_013377chr122201 124 1165 --1154
NM_013381chr1282053 1821 930 623 197 167 147 129 22142 1512 --42295 1728 871 853
NM_013390chr931747 565 466 ------
NM_013396chr2131488 1173 612 1308 11192 --
NM_013423chrX61210 1125 1048 926 837 498 31278 1173 1108 --1849
NM_013427chrX61210 1125 1048 926 837 498 31278 1173 1108 --1849
NM_013433chr1972057 1833 1821 1340 1328 823 26 ------
NM_013436chr24763 626 311 35 1149 1114 --
NM_013437chr851411 1187 992 318 246 11074 1553 1117
NM_013438chr971291 1194 511 424 238 165 38 --1175 --
NM_013441chr12500 261 --1432 --
NM_013444chrX5721 442 369 185 40 --21138 200 --
NM_013448chr143729 686 255 2772 298 ----
NM_013449chr12122560 2542 2429 2298 2257 1988 1844 638 588 552 174 122 --52531 2248 1185 1129 265 --
NM_013450chr251154 403 155 108 24 11033 1925 21244 378
NM_013937chr64920 904 777 156 --2716 285 --
NM_013943chr1133256 3201 3141 2898 2793 2583 2476 1282 1019 1013 908 613 441 32968 1105 705 43212 3016 2726 2238 --
NM_013952chr21628 12365 11903 --
NM_013953chr21628 12365 11903 --
NM_013958chr82472 28 ------
NM_013959chr82472 28 ------
NM_013961chr82472 28 ------
NM_013962chr82472 28 ------
NM_013975chr172560 550 ------
NM_013986chr22145 ----1138
NM_013989chr14103918 3322 3259 3111 1862 1544 1093 956 657 522 13265 11643 11942
NM_013992chr21628 12365 11903 --
NM_013993chr63779 757 635 --1729 --
NM_013994chr63779 757 635 --1729 --
NM_013995chrX132542 2341 2256 2246 1884 1715 921 764 467 350 335 212 183 22486 928 31609 891 870 12072
NM_013996chr7------1141
NM_013996chr7------1141
NM_013997chr7------1141
NM_013997chr7------1141
NM_013998chr7------1141
NM_013998chr7------1141
NM_014000chr1051808 1436 362 266 195 1172 --11336
NM_014011chr2102466 2453 2124 1999 1990 752 682 569 398 384 197 22637 1754 1317
NM_014016chr341686 1281 1245 376 21316 458 ----
NM_014021chr1163445 3346 2961 2899 2344 1144 1130 994 983 784 754 738 729 582 399 199 43463 2972 2533 24 ----
NM_014023chr1082857 2596 2067 1845 604 522 184 86 22868 2576 12685 --
NM_014028chr6133339 2717 2501 2476 1052 860 843 733 661 563 528 194 132 22035 624 21228 154 11191
NM_014034chr651104 402 256 191 180 11145 ----
NM_014035chr521399 562 1442 ----
NM_014038chr7------1312
NM_014039chr1161296 1020 474 398 378 220 2937 273 ----
NM_014043chr371676 1486 1129 1068 1047 538 472 1316 170 --
NM_014044chr22202 187 --160 --
NM_014048chr16195300 5205 4921 4881 4860 4239 4201 4184 4133 4072 3457 1984 1575 1539 1119 903 877 610 190 13954 44779 1945 1389 255 23822 1274
NM_014055chr12--2346 175 2459 71 --
NM_014057chr931495 1297 1098 11344 --21390 534
NM_014059chr132361 255 ------
NM_014079chr331038 167 58 ------
NM_014089chr13102127 1962 1952 1893 1802 1746 1672 205 173 144 1352 32118 119 62 --
NM_014106chr15172890 2810 2549 2217 2127 2038 1894 1197 934 928 886 744 736 490 316 75 46 21051 958 12075 --
NM_014109chr851178 1043 1020 438 54 ----1843
NM_014110chr13859 302 277 ------
NM_014112chr8215420 5378 4794 4762 3949 3602 3535 3333 2206 2198 2071 2020 1984 1850 1785 1664 1380 1010 677 149 42 55102 4390 3324 2100 2077 55008 3809 1488 976 811 15451
NM_014117chr16112658 2447 2263 2183 2082 1991 1826 1690 550 483 452 32441 2353 192 --1923
NM_014141chr7184555 4198 4139 3989 3603 3492 3449 2080 2073 1687 1529 1182 1145 1008 949 910 817 380 45122 4780 1645 980 34759 2147 192 1714
NM_014142chr102105 26 ------
NM_014149chr73589 555 347 2764 718 ----
NM_014153chr16--1466 2616 526 --
NM_014154chr351595 1255 1100 385 209 ------
NM_014155chr11307205 7156 6521 6501 6340 6309 6093 6019 5971 5797 5785 5376 5318 5238 5048 4758 4710 2950 2112 2086 2061 1932 1778 1610 1425 1419 1248 820 803 351 37556 7243 758 22974 441 1834
NM_014181chr282523 2422 2194 949 823 667 523 365 22859 1096 1875 --
NM_014183chr201307 ------
NM_014184chr12143 132 ------
NM_014191chr12--1352 ----
NM_014211chr571668 1594 1578 1555 1340 468 373 ----11412
NM_014212chr126970 835 810 659 65 59 ----1628
NM_014216chr142488 125 ------
NM_014217chr171551 523 415 320 211 178 81 11386 11603 --
NM_014223chr17695 637 297 207 200 185 42 1494 ----
NM_014231chr1262107 1836 735 579 249 139 11908 ----
NM_014233chr1771888 1443 1380 678 610 117 72 --11778 --
NM_014239chr142368 341 ------
NM_014240chr3124099 3564 3437 3429 3252 2657 1127 1048 802 772 410 205 12627 23606 2875 --
NM_014241chr10128 1113 ----
NM_014243chr472069 1925 1607 1505 1335 1317 552 ------
NM_014250chr2242146 1484 256 109 11638 11566 --
NM_014253chrX52371 1993 1718 742 198 11760 --1813
NM_014263chr101414 ------
NM_014264chr44568 489 460 70 ------
NM_014267chr115722 660 639 186 99 --1334 --
NM_014268chr18101474 1363 1311 1305 1296 1239 563 278 167 48 11264 1286 1393
NM_014271chrX2256 211 --1160 --
NM_014278chr41444 ------
NM_014283chr151270 1162 595 414 128 1243 31366 430 345 11121
NM_014289chrX41383 1368 1151 1077 ----11130
NM_014290chr9139 ------
NM_014294chr8121480 1417 1338 1268 1052 480 470 388 347 261 138 112 --3331 272 76 11238
NM_014296chr311433 --11616 --
NM_014299chr1962128 1648 720 405 382 81 --12147 --
NM_014302chr72134 111 125 ----
NM_014309chr22175324 4732 4708 4613 4546 4520 4512 4454 4070 3864 2077 2022 1500 1041 486 226 189 --34622 776 177 11033
NM_014313chr141161 423 235 102 ------
NM_014315chr141150 ------
NM_014319chr1251772 463 387 294 100 --1364 --
NM_014322chr171220 1049 991 891 817 404 293 --1332 1999
NM_014323chr224729 281 113 103 ------
NM_014325chr1241901 849 749 490 11503 2736 402 --
NM_014331chr4327795 7361 7243 6458 6158 6119 5828 5411 5386 5155 5142 4891 4821 2922 2914 2752 2595 2486 2409 2283 2230 2224 1886 1862 1175 1042 1005 729 610 159 125 59 67457 5996 5111 2468 737 693 85854 5841 4923 2742 2423 2208 2046 352 16924
NM_014333chr11132771 2470 2243 1784 1099 1088 976 856 476 382 330 228 205 32475 2155 2041 32659 1876 235 --
NM_014335chr1521187 1102 1125 11055 --
NM_014342chr1181477 950 424 302 218 157 73 29 ------
NM_014344chr112800 153 --1696 --
NM_014345chr651051 783 358 273 254 ------
NM_014350chr561084 1026 1017 766 428 344 1409 1386 --
NM_014368chr931803 369 267 ------
NM_014372chr171961 1894 1888 1734 506 371 199 21459 1349 1351 --
NM_014376chr572407 2286 2061 1824 299 250 193 ------
NM_014382chr391649 1286 670 633 586 532 491 356 346 2643 392 --11794
NM_014388chr1225900 5801 5795 5772 4994 4602 4227 4120 2229 2090 2081 1665 1654 1633 1562 1484 1217 1192 1045 778 277 146 85520 4704 4623 4031 4013 1508 727 564 21088 348 --
NM_014390chr7----1429 --
NM_014393chr8122225 2216 2188 2099 1817 1640 1621 1564 729 397 181 173 --12043 2858 251
NM_014394chr1081148 989 969 850 802 364 299 168 ------
NM_014395chr461987 1851 1354 692 575 105 21834 1316 1505 --
NM_014397chr941436 534 502 221 --11085 --
NM_014399chr76993 776 279 167 152 139 1271 --1868
NM_014411chr751992 1558 1327 757 476 11351 11419 --
NM_014415chr341148 1102 672 394 --11217 --
NM_014417chr193940 924 89 ------
NM_014421chr451945 1664 1522 1389 390 22032 680 22136 1957 12047
NM_014423chr5175501 5340 5281 4960 4060 3642 2267 1953 1821 1551 1201 863 414 360 317 114 33 --55413 5217 2115 1133 1000 34164 1396 992
NM_014429chr33647 450 221 1135 168 --
NM_014431chr1021670 1433 1661 11460 --
NM_014435chr42551 45 2606 591 --1645
NM_014447chr461106 1037 634 265 196 44 1145 21383 136 --
NM_014452chr65297 177 80 73 65 ------
NM_014454chr641078 941 683 134 --21097 144 --
NM_014455chr11140 ------
NM_014456chr1081299 678 482 323 189 172 155 120 11412 2584 465 --
NM_014458chr151396 1177 1140 384 201 21341 1207 ----
NM_014462chr81123 ------
NM_014469chr114623 309 208 146 ------
NM_014470chr121703 1107 ----
NM_014491chr73248 190 86 ------
NM_014494chr1682416 2232 2048 907 760 363 343 302 1600 11616 --
NM_014497chr22176 62 ------
NM_014498chr31261 ------
NM_014500chrX1265 ------
NM_014503chr121470 ------
NM_014504chr762066 1961 504 249 148 113 11331 22032 768 --
NM_014515chr126799 701 690 324 213 38 1243 ----
NM_014516chr191220 ------
NM_014517chr351628 1319 767 754 739 11226 ----
NM_014521chr261737 1453 1153 737 431 305 --11665 --
NM_014547chr154738 190 128 110 ------
NM_014547chr154738 190 128 110 ------
NM_014552chr251507 1474 968 575 46 2598 195 ----
NM_014554chr1282345 1681 1671 1659 1545 1446 900 187 11925 21703 1502 --
NM_014570chr225844 260 194 139 132 21011 116 1149 --
NM_014572chr1341127 512 289 237 31744 1309 294 11499 --
NM_014574chr1441442 1349 1273 317 1437 ----
NM_014575chr31169 ------
NM_014577chr228922 866 860 818 636 255 115 90 1275 ----
NM_014583chr3--1448 ----
NM_014584chr1441327 1198 157 29 11039 --1426
NM_014585chr271262 1175 972 945 939 430 411 ----1269
NM_014587chr1651360 624 618 600 213 --11415 --
NM_014592chr51205 ----1817
NM_014602chr32345 68 ------
NM_014606chr4101419 1411 1107 1095 1075 982 317 145 90 84 31466 1069 363 ----
NM_014607chr272146 1970 1644 1410 616 609 37 ----12090
NM_014608chr15270 44 --1157 185
NM_014612chr96494 456 440 372 309 170 1501 ----
NM_014613chr5102695 2655 2020 2014 1224 1185 692 581 528 134 23068 759 11885 --
NM_014614chr251346 1190 1103 1081 127 11146 ----
NM_014615chr16103627 2831 1295 1079 898 887 864 540 375 236 23317 607 --2281 79
NM_014616chr3123478 3330 3190 3073 2899 2752 2411 2161 872 744 442 358 --12397 1233
NM_014618chr9----2442 401 --
NM_014620chr122298 119 ------
NM_014630chr1563983 3955 3558 3334 2950 2854 43608 2942 1322 1301 --11329
NM_014633chr112433 118 --1102 --
NM_014634chr2252727 2270 2263 737 697 ----1850
NM_014635chr271748 1710 1657 1573 1279 608 21 --1305 --
NM_014636chr9124253 4178 4138 4083 3754 3698 3237 2974 2728 1502 1433 1312 12981 --24303 4049
NM_014637chr871430 1081 1074 1044 572 373 227 11005 ----
NM_014644chr121026 802 --2655 342 --
NM_014647chr16112081 2008 1617 1438 1423 656 644 272 200 184 146 22209 212 ----
NM_014655chr162004 1939 1668 1624 775 449 --22014 1497 --
NM_014660chr73774 716 246 --2847 259 --
NM_014665chr843688 2778 1244 566 ------
NM_014666chr581278 1121 873 494 358 215 92 37 --1380 11217
NM_014667chr382398 1920 1848 915 846 682 582 372 1325 11893 --
NM_014670chr261577 1272 1218 588 177 146 11546 ----
NM_014671chr741611 496 490 161 11542 --11330
NM_014672chr144414 316 185 140 ------
NM_014674chr3184018 4005 3749 3699 3338 3324 3002 2942 2932 2506 1574 1004 552 425 401 382 173 123 43372 1316 942 696 24033 1086 --
NM_014675chr11454 ------
NM_014676chr131632 1140 208 ------
NM_014677chr861194 1052 1010 346 332 118 11323 --21166 1000
NM_014679chr1161042 526 489 470 404 309 ------
NM_014682chr8102269 2234 2161 1540 557 521 442 372 303 238 1823 1249 12290
NM_014683chr1781808 1606 1475 1453 1385 841 770 215 1808 11906 --
NM_014686chr1932262 640 400 2970 477 ----
NM_014689chr22176 114 ------
NM_014690chr762667 1002 982 832 449 414 12913 12888 --
NM_014693chr31718 ------
NM_014700chr1621370 1344 --11321 --
NM_014701chr15103388 3182 2936 2642 2583 2531 2429 2091 1344 127 --12749 --
NM_014702chr6153409 2978 2946 2522 2459 2438 2423 2332 2178 1354 997 987 907 583 191 13452 23100 1076 2609 178
NM_014705chr762057 1994 1837 1751 1451 770 1224 1677 --
NM_014707chr762020 1878 1852 1456 1435 385 22295 1893 21592 60 --
NM_014709chr21572 ------
NM_014711chr16102070 2027 2000 1668 1589 1501 824 747 480 385 ------
NM_014712chr162611 214 ------
NM_014718chr121547 1686 1520 --
NM_014720chr1051483 727 667 504 429 1615 ----
NM_014721chr6307368 7162 6824 6628 6610 6592 6182 6077 6059 5538 5359 5334 4928 4857 4765 2308 2202 2171 2144 2067 2021 1970 1938 1932 1827 1542 1066 1050 762 468 25033 667 76504 6476 5348 5314 2713 2269 1846 --
NM_014723chr2032336 994 121 1129 12923 12012
NM_014729chr861759 879 554 543 208 182 ------
NM_014730chr1264282 3947 3901 3469 1455 70 15272 54156 3416 1328 809 756 180
NM_014730chr1264282 3947 3901 3469 1455 70 15272 54156 3416 1328 809 756 180
NM_014733chr5122218 2054 2040 1931 1899 1846 1791 793 772 582 416 107 --1248 --
NM_014735chrX81942 1696 1686 1506 1349 783 539 431 32142 2113 2064 21565 121 --
NM_014739chr6113907 2729 2664 2570 1133 1093 820 644 482 64 50 43340 3227 2836 1034 34035 3893 3233 33575 3183 1177
NM_014741chr1122174 563 1859 ----
NM_014742chr2071748 1643 1636 311 298 235 182 --11716 11514
NM_014743chr4153112 3025 2718 2677 2368 2352 2303 2203 1266 1253 1112 650 591 188 140 --1605 23205 2424
NM_014746chr2144058 3804 3608 3279 3119 3107 1479 1039 780 634 555 497 285 94 13417 --11569
NM_014751chr882037 1662 1413 859 766 734 393 217 --2674 255 --
NM_014752chr11101865 1824 1688 1674 1664 1428 552 461 282 27 2768 671 ----
NM_014753chr101300 ------
NM_014755chr2133900 3367 3341 3312 3240 3072 3044 1682 1122 590 557 440 353 21032 100 --13536
NM_014757chr582172 1760 850 567 463 455 400 46 11543 11619 --
NM_014758chr1152487 1979 1805 868 807 22460 2355 --1564
NM_014761chr1621142 953 --169 --
NM_014764chr1231263 1101 941 --1274 --
NM_014765chr152073 900 858 663 476 11985 1171 --
NM_014770chr1211215 ------
NM_014772chr1893128 3107 2838 2713 2498 2440 2330 1303 241 22467 956 --1710
NM_014774chr182843 2599 2321 2259 1075 416 273 160 23122 1248 23291 772 --
NM_014776chr1272953 1056 649 372 218 144 83 22596 970 1574 2993 358
NM_014779chr351021 991 847 785 388 11007 ----
NM_014781chr831226 927 36 21184 275 11202 --
NM_014782chrX1271 ------
NM_014783chr15101651 1587 672 655 596 579 409 400 210 164 31401 195 141 ----
NM_014784chr141133 1112 398 383 1788 ----
NM_014787chr162396 2176 1794 482 407 173 11801 1416 1144
NM_014795chr291276 1192 1183 937 561 552 509 401 31 1516 11394 11164
NM_014797chr6103086 2981 2520 2425 1267 987 844 802 299 273 43018 2276 2116 428 1434 2724 675
NM_014802chr1251152 1061 971 466 237 --21126 1042 --
NM_014803chr10182889 2674 2650 2547 2444 2088 1973 1919 1798 1026 973 921 852 767 660 599 242 136 52846 2710 2045 1827 440 ----
NM_014810chr163097 3026 2899 2839 1001 539 --1521 12448
NM_014811chr92228 184 ------
NM_014812chr182012 1997 1946 1909 1459 356 303 145 1784 11549 --
NM_014813chr13564 546 108 ------
NM_014819chr582518 2245 1779 1653 773 518 218 184 42410 2322 2259 444 32210 1813 1726 22266 504
NM_014820chr392053 1892 1569 652 463 399 307 241 108 --11446 --
NM_014822chr44638 234 227 212 1534 197 1456
NM_014824chr1171979 1829 1550 1483 1449 1326 406 --1211 1810
NM_014826chr1134125 4081 4070 3516 3292 3242 3059 2974 1585 1476 1066 910 653 13030 12661 --
NM_014827chr151057 1042 652 345 172 11228 192 --
NM_014829chr572297 2121 601 522 116 93 21 1875 41978 1896 837 612 11752
NM_014830chr12103839 3654 3399 3366 2887 2760 1571 1508 733 725 1242 ----
NM_014832chr1392021 1986 1879 1783 1452 1371 749 443 294 32009 1634 1325 21761 603 --
NM_014838chr2262334 2094 1862 959 881 637 21799 1084 22893 2078 12742
NM_014839chr172064 2035 902 740 670 652 292 2793 230 22566 342 11989
NM_014840chr1283430 3418 3395 3153 3147 2197 1259 417 11012 ----
NM_014841chr641336 938 556 419 1496 1514 11218
NM_014846chr82237 107 ------
NM_014847chr12215 205 ------
NM_014848chr1582698 2161 1932 1848 923 649 588 470 12518 1308 1845
NM_014850chr3114925 4802 4588 3883 3716 3657 3227 2995 1510 1077 494 13261 23926 3255 13572
NM_014853chr1711479 ------
NM_014859chr17----11263 --
NM_014862chr1544083 3786 3239 1133 11506 44128 4077 1271 397 --
NM_014864chr1134360 4088 3691 3626 3074 1620 1351 1343 1172 992 951 852 370 24174 1045 13680 13576
NM_014867chr873310 3125 3115 2982 1027 594 442 21354 1235 13476 --
NM_014868chr12286 54 1810 1291 --
NM_014871chr121607 ------
NM_014872chr9102382 2210 2095 1552 668 538 531 328 317 168 11451 2952 52 --
NM_014873chr1214909 4878 4737 4667 4576 4555 4424 4341 4300 3893 3833 3388 1799 1551 1538 1532 1376 1368 1199 921 48 24850 3432 ----
NM_014874chr141853 452 284 274 11670 ----
NM_014876chr2272188 2049 1642 1601 762 744 113 --11914 --
NM_014877chr17327606 7599 7473 7263 7096 6680 6504 6230 6078 6070 5913 5499 5296 5052 4941 3033 2976 2903 2829 2381 1865 1512 953 792 702 474 452 409 236 189 159 40 66994 6762 6291 6275 1137 866 22889 1563 --
NM_014883chr472375 2335 2080 2025 1844 986 644 --12459 --
NM_014888chr751441 1360 517 400 390 ----11330
NM_014890chr32345 37 ------
NM_014893chrY62120 771 399 371 227 195 11595 22047 880 12096
NM_014897chr17103077 3002 2637 2400 2195 2079 2069 690 611 523 21094 650 11176 22895 2029
NM_014899chr592805 2765 2693 2665 2317 2148 1045 833 816 22204 639 128 --
NM_014900chr231152 261 185 11158 ----
NM_014901chr542257 2186 2100 1521 --22025 855 --
NM_014902chr2041193 1038 459 245 178 ----
NM_014903chr1282424 1635 954 839 354 316 212 202 ------
NM_014904chr10114032 3946 3143 2756 2744 2668 2611 1472 1287 1266 745 1376 32498 1251 591 32453 1349 343
NM_014905chr251452 795 660 132 76 11972 ----
NM_014906chr17103431 3067 2665 2536 1647 1248 906 735 625 78 23564 2737 23937 3529 13986
NM_014912chr10173393 3325 3275 3237 3180 3168 3103 2911 2805 2684 2621 2473 979 857 626 265 114 53378 3254 3121 2313 997 23078 609 13218
NM_014913chr1861475 1255 1179 1074 571 237 3369 345 53 ----
NM_014914chr221143 977 ------
NM_014916chr72795 586 ------
NM_014917chr13965 746 195 --2868 719 --
NM_014918chr1541312 1297 272 59 1117 21572 1192 150
NM_014920chr6133428 3175 3059 2696 2626 2378 2333 1422 1415 1109 805 767 571 33224 549 245 32656 2610 682 13549
NM_014921chr1962846 2817 2800 2155 1019 601 --13126 --
NM_014923chr1371985 1907 1487 466 234 126 62 11879 22298 1517 --
NM_014924chr14112960 2743 2029 1216 925 719 646 609 517 471 157 12439 ----
NM_014926chr341031 929 386 271 3952 457 38 1740 --
NM_014932chr391814 1609 1575 1510 1485 1464 606 253 26 41627 1526 1282 230 11891 --
NM_014933chr41134 --2361 38 --
NM_014934chr13114020 3112 2535 2501 2492 2452 1376 1004 330 318 270 43580 2931 2640 308 33122 2771 386 1496
NM_014936chr661773 1079 920 895 468 375 11784 ----
NM_014942chr642101 879 846 549 21743 492 22392 2382 --
NM_014944chr141230 424 395 27 ------
NM_014945chr542001 360 177 160 2485 353 ----
NM_014946chr2113062 2828 2472 1053 934 770 573 531 489 428 191 42541 1978 958 402 31073 631 417 --
NM_014947chr182994 2438 2045 1223 1079 915 508 398 ----1308
NM_014949chr13966 853 178 1141 ----
NM_014950chr1431557 1125 1080 ----11745
NM_014951chr10102655 2492 2484 2476 2388 2321 2309 1966 970 550 ------
NM_014952chr1531869 574 125 --1828 --
NM_014953chr1363833 2767 2646 967 137 35 13031 44147 4107 3312 1118 --
NM_014961chr452123 1402 288 255 188 2877 178 2860 653 --
NM_014962chr2072853 2670 1046 944 936 726 391 --2665 138 11890
NM_014964chr1751688 1677 1504 976 677 12373 1474 11706
NM_014969chr12978 934 --1817 11138
NM_014974chr1071750 1520 1225 559 417 309 265 21217 1186 ----
NM_014977chr143525 519 513 ------
NM_014978chr1071854 1802 1649 1552 1492 281 46 21421 306 ----
NM_014982chr14244968 4590 4390 4322 4031 3977 3496 3310 2098 2054 1956 1789 1656 1351 1255 1147 1012 947 753 565 420 330 287 211 45441 4756 3727 1066 73518 2081 1133 709 361 352 28 23559 597
NM_014988chr462493 2327 2255 1997 169 111 22559 2500 22359 37 12100
NM_014989chr651674 1275 572 465 367 1130 ----
NM_014990chr143937 368 272 11140 1844 --
NM_014991chr4133285 3130 2995 2918 2828 2687 2592 2420 1185 601 448 324 311 23291 2800 22502 638 --
NM_014992chr145736 677 560 287 101 --1727 --
NM_014996chr351082 688 357 208 105 1870 ----
NM_014997chr742885 2087 1047 408 32832 1084 156 21106 649 --
NM_014999chr1261588 1482 1101 574 409 400 21596 1270 ----
NM_015000chr12162944 2900 2874 2864 2544 2482 2395 2260 2166 2107 911 897 782 527 212 147 21893 1076 32654 1037 1021 12280
NM_015002chr1272266 2243 2161 2134 2014 821 581 11929 32088 774 425 --
NM_015008chr3133205 2666 2547 2408 2294 1189 833 821 664 472 220 172 142 22494 532 1895 --
NM_015011chr132744 360 1198 1438 --
NM_015015chr1932028 1996 1379 1478 ----
NM_015017chr131104 389 231 1107 1129 --
NM_015018chr6182 ------
NM_015020chr16123853 3835 3826 3723 2998 2908 2458 907 660 607 418 278 12515 184 --
NM_015023chr121647 1567 21328 109 ----
NM_015024chr891492 1405 1365 1324 1245 1148 581 409 104 1343 11331 --
NM_015025chr272654 2572 2483 1657 556 285 93 ------
NM_015026chr12174601 4465 4448 4292 3873 3526 3255 3128 3119 3113 3080 1646 1621 1306 1144 939 621 44532 3687 3295 399 54551 4438 2945 1338 851 21272 85
NM_015027chr1651803 1739 1548 743 688 --1630 --
NM_015032chr13132940 2932 2788 2161 2119 2031 1963 1786 478 291 284 267 24 22679 1182 22652 2286 --
NM_015035chr20146590 6032 5378 5197 4855 4706 4689 4447 4290 4227 2279 1851 974 850 22432 750 11960 11468
NM_015039chr162767 1503 1367 1336 78 59 2881 857 33267 498 470 --
NM_015040chr2122781 2676 2346 2085 994 861 782 773 714 694 468 432 1237 23322 85 --
NM_015042chr1564330 4285 4277 4244 2983 1188 --33607 2969 1334 --
NM_015044chr1632622 2065 299 1366 --1268
NM_015045chr10112146 2084 2068 1738 1503 1441 655 618 538 298 130 1464 21818 148 12166
NM_015047chr15883 415 339 282 246 1385 21120 924 --
NM_015049chr2142705 2663 2470 2454 2337 2072 2039 1211 1118 1017 994 706 691 263 1577 ----
NM_015051chr9113374 3287 3053 2490 2349 1319 1204 534 365 137 96 22992 930 --1413
NM_015052chr781296 1085 1072 556 444 434 355 116 21104 1078 ----
NM_015055chr1192934 2892 2794 2213 1943 1894 1819 1018 556 22886 1856 22904 917 --
NM_015057chr132703 102 ------
NM_015059chr1573985 2639 1598 1137 988 900 576 11606 23743 1125 --
NM_015061chr95917 779 722 643 573 1737 1859 --
NM_015068chr732711 1530 458 12860 43946 3441 416 243 --
NM_015069chr163501 261 205 ------
NM_015070chr1351574 1411 1179 142 93 ----21093 489
NM_015071chr5186532 6447 6257 6032 5723 5688 5456 5163 4505 4151 2164 2084 1874 1589 988 783 652 139 56478 4279 4161 2006 268 22100 78 11271
NM_015072chr143632 432 97 ------
NM_015073chr19102095 2060 2028 1925 1914 1892 732 630 473 394 32000 1810 611 ----
NM_015074chr183455 3414 3151 890 690 558 449 184 44549 3028 725 428 2482 64 13468
NM_015075chrX32242 2029 1597 ------
NM_015076chr6134111 3661 3476 2911 2903 1787 1552 1502 1113 1007 976 871 684 44295 1362 1218 319 33150 1237 291 --
NM_015080chr112930 281 --1381 --
NM_015082chr582396 1856 1807 602 508 255 186 82 ------
NM_015087chr13122326 2284 2264 2099 1079 858 792 457 321 252 227 99 12242 ----
NM_015090chr1156207 5969 5905 5670 5621 5247 5026 4713 4165 1655 1574 772 676 582 412 25627 2227 16237 --
NM_015091chr143677 256 123 1791 1868 --
NM_015092chr16154295 4269 4209 3942 3766 3620 3552 3413 3058 2970 2854 1149 1014 966 855 34683 3320 1166 34345 3012 2982 --
NM_015093chr661704 1365 1218 740 700 319 21724 693 1672 --
NM_015094chr2241797 665 628 616 --14374 13394
NM_015097chr381659 1508 1481 734 422 392 330 252 1915 12290 11768
NM_015100chr1112020 1924 1910 1466 776 650 621 471 353 109 103 21601 542 21564 299 --
NM_015107chrX92430 2321 2295 2232 2211 1670 1557 1494 123 12400 11893 --
NM_015110chr9112536 2417 2207 2066 1626 872 835 812 410 107 32 1980 52379 1756 934 848 494 1896
NM_015115chr4153026 2797 2577 2571 2544 2401 2123 1221 1183 834 789 654 623 355 318 33013 2448 723 ----
NM_015116chr1321539 1321 11278 11381 --
NM_015124chr2252503 2450 2329 2292 35 1822 ----
NM_015125chr192448 371 ----1559
NM_015129chrX71459 1190 536 504 395 227 213 11443 --1324
NM_015130chr451340 1189 508 76 50 --11251 --
NM_015132chr761978 1904 1293 665 273 192 --11749 --
NM_015134chr172637 217 ------
NM_015137chr8112546 2337 2262 2095 1743 1723 1710 1693 888 730 400 11943 ----
NM_015138chr1572282 2147 1861 1069 634 623 491 32664 989 697 22566 2546 --
NM_015141chr3122687 2367 2320 1919 1852 754 611 598 545 375 243 126 32595 382 272 32214 1846 388 12411
NM_015144chr16153977 3848 3794 3763 3244 3038 2928 2771 2668 1597 1076 819 763 698 486 ------
NM_015149chr141752 1529 768 506 21537 531 ----
NM_015151chr212362 334 ------
NM_015153chr63619 223 106 --1789 1742
NM_015155chr1092641 2560 2100 973 839 348 297 251 137 12071 11148 1182
NM_015156chr14113378 3357 3219 2624 2609 1619 1465 1280 889 455 393 12788 23998 910 --
NM_015161chr1661473 1393 1339 1028 510 58 1246 21534 1041 --
NM_015163chr1482016 1994 1913 1775 1713 1694 325 301 1403 --11541
NM_015169chr83375 364 182 ------
NM_015170chr862058 2022 2013 1662 1609 595 --22354 824 11791
NM_015172chr171566 1451 1285 1184 536 513 279 ------
NM_015176chr161629 1618 1117 582 294 257 ------
NM_015180chr143658 615 571 2885 767 ----
NM_015184chr3--1641 1689 --
NM_015185chrX152931 2763 2738 2285 2194 1940 826 556 512 467 440 357 341 299 69 2918 624 12300 --
NM_015186chr92467 108 --1479 --
NM_015191chr1172622 2569 1800 1073 837 91 57 ----1416
NM_015192chr20102985 2948 2525 2304 2066 930 912 441 243 235 ----13045
NM_015196chr41127 ------
NM_015199chr381953 1114 1008 834 700 665 657 534 22761 53 ----
NM_015200chr4102509 2501 2256 2102 1033 905 880 645 514 474 21611 256 1506 --
NM_015202chr1641701 1695 1364 1199 --21389 1172 --
NM_015206chr15133801 3280 2885 2818 2578 2441 1521 1494 1423 1248 1205 218 120 13814 12837 --
NM_015208chr18123431 3409 2885 2797 2629 1517 1438 1361 1249 480 414 196 1918 22554 447 --
NM_015209chr182290 2084 2054 2022 754 376 366 317 --32069 867 299 --
NM_015213chr115723 654 536 141 63 ------
NM_015215chr1113050 2778 2724 2712 2517 1941 1011 807 730 564 59 1787 ----
NM_015216chr541011 572 112 59 1553 ----
NM_015225chr963038 2819 2274 1089 127 93 12707 12649 --
NM_015226chr1653312 715 627 479 324 1184 2880 826 --
NM_015229chr1711144 ----1413
NM_015230chr461670 1651 1533 1273 1172 33 --31435 1346 1262 31830 1358 656
NM_015231chr114944 268 197 90 1928 ----
NM_015233chr1352266 833 518 494 405 --22399 1873 --
NM_015236chr451418 1314 944 219 161 ------
NM_015238chr51274 --1456 --
NM_015247chr16195420 5398 5347 5231 5203 4882 4848 4670 4308 4066 3921 3590 1856 1806 1424 661 557 548 292 11765 35238 4217 397 14166
NM_015250chr931920 1797 1694 1680 --11667
NM_015252chr26905 881 735 344 336 207 1980 --1754
NM_015256chr55619 576 566 186 159 1260 ----
NM_015262chr10----1146 --
NM_015263chr1541232 1129 752 356 1467 ----
NM_015264chr2294928 4922 4885 4543 4257 3926 3333 1562 1304 24264 3750 11791 --
NM_015265chr2132677 2643 2596 2465 2315 2072 1689 886 692 643 623 605 121 21974 150 2168 60 12290
NM_015267chr1252143 1793 1773 1367 553 11454 ----
NM_015268chr35229 223 138 123 93 ------
NM_015269chr11548 ------
NM_015271chr4154349 4012 3584 3538 3418 3029 2760 2721 2642 1614 1322 719 488 173 133 --22787 2627 2610 61
NM_015272chr1692125 1808 1798 1784 587 570 340 334 71 42052 661 305 164 1178 --
NM_015275chr1261589 1581 814 794 245 216 11971 31939 1775 306 --
NM_015277chr1881807 1789 1249 630 561 506 500 449 11837 ----
NM_015278chr652962 2604 2438 358 243 --23478 3250 --
NM_015282chr272999 2681 2037 2005 1079 426 352 22925 359 11917 --
NM_015285chr1852596 1928 526 367 246 --11022 22506 2277
NM_015288chr593596 3569 3390 3265 2878 2719 2628 1259 133 --13661 13639
NM_015291chr193432 3022 2879 2354 2344 2210 2170 2140 282 --23112 228 21319 1029
NM_015292chr121697 ------
NM_015296chr1341130 869 861 310 ----1268
NM_015299chr1453279 2501 1271 1078 246 13496 --11015
NM_015305chr1481978 1955 1907 1901 358 299 155 137 --11644 --
NM_015310chr8278117 7789 7597 6563 6536 6498 6101 5974 5792 5752 5463 5444 3261 3070 2850 2220 1935 1783 1531 1266 1232 1022 287 197 151 141 125 152 57771 5810 1507 899 180 --
NM_015313chr11234448 4309 4259 3860 3753 3620 3379 3361 3341 3185 3058 2938 1812 1735 1729 1503 1491 1459 1153 893 855 789 383 11647 24408 3425 --
NM_015314chr7102577 2172 2143 1921 919 686 297 263 185 143 21652 490 22429 496 1549
NM_015315chr5123463 2937 2767 2424 2239 2180 1386 1034 905 879 547 268 --1734 13220
NM_015317chr2112866 2725 2602 2229 2194 1771 452 311 150 100 51 22042 890 ----
NM_015319chr122480 459 ------
NM_015320chr23753 172 58 ------
NM_015321chr1964290 3327 1026 929 917 586 14307 13138 --
NM_015326chr183002 2425 2070 1897 1012 835 727 515 12120 22165 855 --
NM_015328chr7103050 2780 2638 2466 2429 1255 620 314 54 27 62881 2818 2645 2010 603 406 ----
NM_015331chr13620 605 499 ------
NM_015335chr12122445 2411 2265 2255 1911 1873 1845 1700 881 646 501 98 11705 12430 --
NM_015336chr12122559 2471 2028 2013 1971 1926 1796 1697 831 619 590 193 42460 2060 144 69 --1291
NM_015339chr202421 149 --2712 296 --
NM_015342chr53144 127 119 ------
NM_015344chr8102090 2015 1994 827 733 676 402 295 278 192 11458 --11617
NM_015345chr632458 2416 2401 12765 22530 2245 --
NM_015347chr1262797 2133 1817 1122 1091 1054 ----1296
NM_015349chr672642 2626 2379 2255 2068 1959 1915 ----11073
NM_015352chr2053817 3800 580 351 335 13268 11433 33774 3258 251
NM_015353chr1782607 2559 2443 2256 1014 957 908 685 21985 844 ----
NM_015354chr91163 ------
NM_015355chr17101843 1563 1461 1249 783 475 377 350 325 255 ----11698
NM_015358chr2181252 1172 1092 1062 513 450 345 272 3843 426 303 1370 --
NM_015359chr862872 2803 2383 2104 288 236 22462 498 22374 1917 --
NM_015360chr51181 ------
NM_015361chr24900 762 286 228 2948 708 1370 --
NM_015365chrX183903 3683 3639 3551 3540 3529 3093 3079 2610 1005 957 612 546 330 311 304 256 221 24042 1543 23024 1256 --
NM_015367chr2261631 1555 1343 1097 1028 557 1264 ----
NM_015375chr194856 4723 4569 3900 3673 3338 1136 624 390 --21409 1339 --
NM_015378chr172526 2514 978 736 342 271 216 21122 816 12985 1669
NM_015379chr72219 44 ------
NM_015381chr2242009 1941 1531 826 1455 ----
NM_015382chr144717 578 317 114 --1558 --
NM_015385chr1072969 2874 2832 2534 873 855 29 12257 23191 3175 1428
NM_015387chr242080 1901 1770 1673 31909 1790 1395 ----
NM_015393chr493619 3316 3154 3093 2994 2937 2426 1521 512 22435 476 13724 1378
NM_015394chr1261635 834 744 582 432 196 ------
NM_015396chr341485 285 225 171 1424 1416 --
NM_015397chr961736 1356 232 75 69 59 --1271 11771
NM_015412chr373082 2992 2840 2345 2193 2063 492 11127 2568 192 --
NM_015415chr1----1216 --
NM_015423chr1171543 1281 1248 1103 394 358 193 --11297 --
NM_015429chr32981 227 ----11116
NM_015431chr1113308 2756 1292 717 708 652 515 426 287 241 226 23563 524 22764 2644 --
NM_015435chr841289 1101 496 469 --11251 --
NM_015436chr4123385 3246 2933 2842 2806 2547 2274 2226 815 619 551 345 --53049 1312 964 916 746 12927
NM_015439chr62491 23 --1319 --
NM_015443chr1791449 1379 1224 1186 602 487 192 165 146 21162 577 ----
NM_015446chr161574 475 456 343 286 111 --31183 402 183 --
NM_015455chr5123713 2695 1655 1380 1077 1013 846 746 658 605 542 90 33280 2639 410 23957 263 --
NM_015457chr1151097 346 319 301 106 ----1921
NM_015458chr8175308 4291 4282 3870 1904 1859 1818 1619 1606 1505 1413 1283 1234 611 521 311 247 34266 864 437 14841 1142
NM_015460chr332000 1765 1706 ------
NM_015461chr181604 ------
NM_015462chr171225 --1291 --
NM_015463chr2------1833
NM_015464chr74975 923 717 174 3738 190 93 ----
NM_015466chr3------1211
NM_015474chr202234 213 1255 ----
NM_015475chr24910 760 232 163 ------
NM_015481chr1221081 385 ------
NM_015483chr72124 51 ------
NM_015484chr15958 926 800 185 49 1150 2266 211 --
NM_015496chr82238 119 1305 1271 --
NM_015497chr1541124 1083 407 314 ------
NM_015508chr351594 1554 523 517 126 11498 ----
NM_015509chr1231398 1377 1234 21531 125 1344 --
NM_015513chr32263 97 ------
NM_015520chr3102805 2349 2285 2086 1925 1919 1062 1027 974 909 1779 12552 --
NM_015525chr651032 949 786 718 250 --1127 1177
NM_015530chr23926 918 795 --1393 --
NM_015532chr15142524 2505 2457 2333 2226 2191 2152 2007 1776 949 910 550 319 282 42240 1953 1927 329 ----
NM_015534chr131042 927 764 ----1229
NM_015535chr2113830 3821 3510 2696 1043 873 622 515 438 207 135 33974 2656 1340 13038 13599
NM_015542chr1041150 1127 1109 997 ----11017
NM_015548chr65815 787 666 238 166 ----1880
NM_015550chr7103459 3258 2876 2493 2471 2448 2243 1149 588 162 32911 2261 982 53342 1412 769 222 37 --
NM_015553chr6115166 4806 4682 4193 4185 4041 3951 3684 1278 1238 969 25188 382 65051 4625 4476 4464 4411 76 21515 1231
NM_015554chr15142882 2856 2696 2690 2501 2431 2389 2357 2266 1013 853 775 697 589 22956 2635 42379 2016 948 518 --
NM_015555chr681824 1698 1281 1198 1117 632 382 163 --11245 --
NM_015559chr182933 746 11085 1686 --
NM_015564chr5193494 3451 3215 3158 3039 2904 2893 2771 2706 2698 2568 1050 1040 766 561 315 157 150 78 23391 2645 32583 739 488 13195
NM_015565chr2172272 2115 2036 1702 676 244 205 11502 21803 263 --
NM_015567chr1391324 1312 1056 934 823 499 413 306 219 ----1129
NM_015569chr1124845 4770 4590 4388 4171 3629 3326 3142 1811 1210 526 489 23814 1016 64618 3744 3682 3564 780 396 44736 3829 3398 1202
NM_015571chr6112427 2258 2229 1949 1684 966 867 823 765 688 24 2892 220 32550 1924 196 --
NM_015575chr2153533 3495 3226 2276 1472 928 816 672 652 395 383 366 351 175 136 22347 786 2802 779 --
NM_015576chr362998 2539 2400 2109 710 298 12314 32754 1034 628 1233
NM_015577chr561685 1302 1270 548 453 139 21538 1198 ----
NM_015578chr19112039 1921 1450 1370 1337 796 679 468 458 143 35 41362 774 577 303 --1250
NM_015601chr104964 653 205 57 1396 1334 --
NM_015602chr151824 691 516 343 101 31388 1363 325 11311 1359
NM_015608chr10--1601 --1494
NM_015609chr182340 2332 2292 602 559 487 476 467 12578 ----
NM_015610chr782903 2512 2234 1961 807 681 616 239 1364 22526 595 --
NM_015626chr1751224 1096 299 207 184 ------
NM_015630chr22450 217 --1767 --
NM_015633chr1271114 1074 907 788 769 368 91 11173 11016 --
NM_015635chr9122196 2190 2067 1892 1813 1678 1670 1515 1480 341 273 218 ----1264
NM_015640chr1165382 5108 4781 4533 4388 3979 2108 1508 1436 1411 1400 1178 1090 962 863 555 1574 ----
NM_015641chr7121291 1195 1084 960 807 799 370 258 161 146 134 55 ------
NM_015642chr31107 123 ----
NM_015657chr22845 808 --1167 --
NM_015670chr173178 148 140 1119 ----
NM_015678chr1331208 1199 649 31297 505 175 ----
NM_015691chrX62904 2179 1148 661 364 191 12185 12943 --
NM_015695chr6102151 1903 1838 1435 1350 813 600 551 531 131 ----21864 1386
NM_015711chr194795 763 265 111 ------
NM_015713chr8143586 3424 2947 2785 2772 2721 2453 2309 2270 1377 1313 1218 866 559 43509 3488 3342 2672 12763 --
NM_015725chr191502 ------
NM_015833chr2131976 1513 558 32146 1926 778 ----
NM_015840chr192450 2389 2239 705 253 211 170 111 93 ------
NM_015841chr192450 2389 2239 705 253 211 170 111 93 ------
NM_015844chr184992 984 951 697 ------
NM_015846chr184992 984 951 697 ------
NM_015847chr184992 984 951 697 ------
NM_015850chr8102289 2218 2129 2083 2068 2035 1701 836 812 350 ------
NM_015852chr773107 2880 2615 2478 2455 2423 2224 13120 33444 3136 3044 190
NM_015866chr131408 1058 467 --1526 --
NM_015874chr42605 91 2615 249 ----
NM_015878chr862138 1585 1397 1362 861 659 1575 --1702
NM_015879chr18208464 7449 7302 7058 7024 6946 6109 5990 5881 5730 5713 3394 2410 2287 2258 1477 1352 330 306 133 16653 26748 3113 --
NM_015885chr117824 767 712 350 304 70 25 1730 --1268
NM_015886chr8245753 5579 5509 5260 4717 4627 4594 4400 4241 3817 3715 2057 1986 1926 1718 1409 1401 1007 851 611 511 456 195 35 23954 616 24786 4225 15004
NM_015888chr1103310 3127 2929 2835 2750 2352 2297 2160 1082 1028 --32988 2328 471 --
NM_015891chr6102081 2066 2019 1981 1860 1827 1798 1745 541 35 --11438 --
NM_015892chr1072163 2145 881 640 608 602 436 2847 235 21978 1904 12295
NM_015895chr61162 1197 ----
NM_015901chr102650 293 ----2856 821
NM_015902chr82687 55 ------
NM_015904chr23842 790 299 --1521 --
NM_015905chr72159 39 ------
NM_015906chr1224836 4705 4653 4632 4594 4545 4425 4064 3983 3864 3638 3544 3115 3093 3010 1889 1880 1754 1686 1099 385 257 21762 543 34017 3417 1411 11566
NM_015907chr42240 150 1278 ----
NM_015912chr842501 2117 1762 389 11674 ----
NM_015913chr15733 553 517 508 210 ------
NM_015926chr3--1246 ----
NM_015927chr161353 ------
NM_015934chr21215 ----1185
NM_015938chr381005 813 800 773 425 382 371 224 ------
NM_015939chr203664 159 125 187 ----
NM_015942chr8167 ------
NM_015946chr54735 670 481 232 --1560 2121 61
NM_015955chr22139 128 ------
NM_015956chr191225 ------
NM_015967chr16915 789 750 370 307 299 ----2991 281
NM_015975chrX6682 593 514 457 419 351 41496 1318 213 174 1123 --
NM_015976chr11291 1298 ----
NM_015980chr551617 1586 1362 1052 276 --21462 186 --
NM_015982chr173337 314 56 ------
NM_015986chr1771329 1287 1159 956 559 345 205 11277 ----
NM_015990chr421035 81 ----2913 194
NM_015994chr142626 91 --1659 --
NM_015995chr1565313 4505 4042 3972 3841 2002 54732 4574 1188 250 119 ----
NM_015999chr13592 584 97 ------
NM_016002chr12796 612 1235 1727 --
NM_016003chr782903 2512 2234 1961 807 681 616 239 1364 22526 595 --
NM_016004chr202198 25 171 --1166
NM_016009chr1144910 4841 4756 4395 4042 3903 3779 3769 3320 2995 1733 1590 613 321 24798 211 1661 1303
NM_016018chr8162577 2513 2467 2369 2339 2299 2231 1743 1104 1048 1029 989 531 292 53 37 22444 2078 11995 --
NM_016019chr72308 192 --1367 --
NM_016021chr692762 2719 2159 2119 1191 763 721 396 321 1260 ----
NM_016023chr892034 1835 1776 1576 1369 1345 823 763 56 11996 --11819
NM_016025chr1662002 1978 1486 550 279 212 21812 1247 21241 155 --
NM_016027chr83558 460 393 2519 58 1191 --
NM_016032chrX3176 153 113 --1884 --
NM_016037chr161187 958 946 229 223 208 ------
NM_016039chr141155 ------
NM_016040chr182313 2256 2171 818 757 701 563 488 12377 --12698
NM_016041chr172308 283 --1384 --
NM_016045chr20101854 1657 1635 1589 1486 1479 1393 1262 540 239 ----1307
NM_016048chr52919 842 2975 333 ----
NM_016057chr1261317 1028 829 521 299 254 1181 ----
NM_016059chr65857 718 631 596 179 ----1330
NM_016061chr291545 1405 1351 1235 1032 665 631 229 144 11098 ----
NM_016072chr12112318 2266 2174 2126 1896 1787 1573 899 863 332 282 21938 938 1886 12099
NM_016073chr154917 819 378 266 ------
NM_016075chr13123213 2954 2588 2515 2230 2205 2138 1999 1946 900 840 563 22645 2013 32816 2412 2326 1141
NM_016076chr162966 2904 2864 2495 2314 805 22931 128 33097 1285 243 --
NM_016078chr173848 409 111 ----1904
NM_016079chr262316 2187 2028 1702 346 196 1790 --11441
NM_016081chr431955 1791 826 11423 22068 344 --
NM_016083chr6153584 3488 3427 3195 2877 2403 1418 1201 1103 1020 858 562 394 90 38 --2664 611 33252 2632 1495
NM_016087chr761689 1563 1409 1384 1081 405 21601 1062 31653 1136 197 --
NM_016090chr112666 128 --2336 117 --
NM_016096chr862060 1718 869 431 240 133 11458 11594 --
NM_016103chr51353 1481 ----
NM_016106chr141135 ------
NM_016107chr56867 511 286 246 233 130 160 --1899
NM_016118chr74845 823 753 740 11124 ----
NM_016120chrX1150 1328 1283 --
NM_016121chr121000 191 2973 809 ----
NM_016123chr12268 55 ------
NM_016124chr141445 498 489 155 11315 ----
NM_016126chr1285 29 ------
NM_016127chr82279 59 --1652 2684 49
NM_016128chr31132 ------
NM_016129chr4137 ------
NM_016131chr292199 2073 1627 1512 229 183 100 80 45 21502 108 1739 11763
NM_016132chr15153127 2956 2900 2713 2623 2518 2151 1266 1032 472 346 304 259 164 65 32800 2537 2158 42806 2731 1041 505 32410 1103 384
NM_016133chr271588 1366 1202 540 460 296 284 11023 1491 11066
NM_016138chr1661315 602 474 284 267 182 11402 1166 --
NM_016141chr32244 158 ------
NM_016144chr56787 772 624 576 293 194 124 ----
NM_016147chr11----1451 --
NM_016152chr361274 1164 981 812 320 75 11135 ----
NM_016169chr1093219 3135 2998 2879 2807 2473 2361 727 493 1344 --12316
NM_016185chr173542 158 139 ------
NM_016192chr22245 201 ------
NM_016200chr75770 752 745 204 142 ------
NM_016201chr351659 1487 736 658 535 --32023 2000 1646 --
NM_016203chr71834 11042 1125 2698 281
NM_016205chr431296 591 452 ----1584
NM_016206chr3248585 8071 7715 7005 6836 6541 6229 6160 5833 5582 5442 3380 2605 2420 1881 1042 607 459 444 400 301 195 152 75 88660 6860 6264 5840 2988 1847 1585 1112 88745 6436 5713 3489 1602 1593 1504 784 25775 2279
NM_016211chr41134 --2361 38 --
NM_016213chr15----1156 --
NM_016216chr35766 655 569 205 197 --1789 --
NM_016217chr6103651 2901 2885 2828 2813 2728 2671 1478 1427 550 --33536 2794 1034 21270 582
NM_016218chr56891 826 486 291 280 27 ----1364
NM_016221chr582228 1927 1692 1664 954 920 666 626 ------
NM_016224chr692163 1724 740 704 467 286 235 74 39 21693 418 31803 1525 1366 --
NM_016227chr151270 1162 595 414 128 1243 31366 430 345 11121
NM_016230chr64491 354 170 79 1123 ----
NM_016231chr1731177 1058 322 ----11273
NM_016235chr1651389 1179 1135 1091 66 --21527 33 --
NM_016247chr33512 198 192 2355 151 ----
NM_016248chr13153996 3720 3442 3280 2805 2443 1480 1009 876 854 777 598 477 466 456 23447 2601 --1571
NM_016252chr25992 801 783 777 329 ----1201
NM_016255chr653319 3085 2947 2770 209 3661 281 261 12261 --
NM_016257chr183394 2674 2343 2205 1326 1163 790 503 21040 868 12313 13119
NM_016258chr16775 740 731 552 320 312 191 ----
NM_016260chr2396973 6918 6873 6766 6673 6576 6284 6232 6063 5783 5753 5739 5710 5625 5518 5410 4976 4911 4861 2708 2652 2363 2350 2325 2207 2091 2084 2001 1563 1157 922 877 833 774 699 469 268 218 107 37045 2369 1067 87584 6850 6839 6731 1422 1255 1048 678 15025
NM_016262chr64135 116 70 46 3594 96 28 2633 211 --
NM_016269chr471199 1169 1085 879 871 857 320 --1944 --
NM_016270chr192422 354 ------
NM_016271chr18112371 2198 1783 1690 1495 769 621 568 549 481 286 22048 1556 1659 32353 2089 296
NM_016272chr22132785 2769 2634 2562 2424 2344 2327 2306 2234 2225 2156 2139 767 52530 2376 2349 2003 269 1249 --
NM_016275chr371989 1057 1043 819 582 361 122 1317 --1845
NM_016277chr661548 1393 1200 1161 1067 212 11228 11262 11491
NM_016279chr54510 502 480 188 ------
NM_016281chr123968 871 857 11051 11003 11127
NM_016282chr931479 1404 125 --1342 --
NM_016284chr161190 --1623 --
NM_016287chr1121783 1615 1603 1450 1297 1288 629 517 353 319 264 213 21895 1720 11797 1641
NM_016289chr272287 2228 1686 766 644 627 204 2144 124 1798 22313 1724
NM_016299chr10125 189 ----
NM_016300chr32443 183 --125 138
NM_016303chrX186 --1378 --
NM_016304chr152749 79 --121 --
NM_016306chr31118 1389 ----
NM_016308chr162010 1538 1416 374 245 147 11273 --11452
NM_016315chr2101861 1746 1623 1464 1421 1347 1237 546 229 172 1133 11820 --
NM_016316chr23716 591 249 --2137 110 1696
NM_016322chr9102702 2514 2144 1299 1196 1010 633 380 314 239 1968 22747 521 --
NM_016328chr72112 101 ------
NM_016333chr162517 156 1470 ----
NM_016338chr531077 358 128 ------
NM_016339chr1731371 1338 627 ------
NM_016351chr74633 567 561 168 --1499 --
NM_016355chr121421 ------
NM_016356chr6102625 2209 2175 2168 2152 2089 1897 1889 962 518 1414 42203 1056 1019 355 --
NM_016357chr1281246 1193 1156 1031 984 950 474 451 11221 ----
NM_016359chr157849 274 266 237 104 62 47 1854 ----
NM_016376chr17164081 4074 3980 3782 3462 3129 3051 3003 2928 2739 1496 1448 1303 1282 543 520 1581 --24023 3813
NM_016377chr661614 1485 1479 663 551 100 31727 1449 671 11146 31456 1421 1122
NM_016395chr1561948 1802 1449 1322 532 303 1309 --11732
NM_016396chr15173042 2959 2591 2535 2363 1978 1844 1158 995 957 705 570 490 363 287 246 98 1120 42883 2407 2048 459 --
NM_016404chr113144 43 22 1150 ----
NM_016410chr95241 180 143 107 97 1210 1600 1648
NM_016422chr1173202 2345 2154 831 707 541 122 --1692 1926
NM_016423chr142393 320 ------
NM_016424chr1772028 1914 1778 1559 727 510 374 21478 52 31519 494 334 --
NM_016436chr2052555 1920 927 535 415 1558 11768 --
NM_016441chr2102364 2197 1992 1900 1713 1538 959 690 568 403 32142 1553 213 2755 634 --
NM_016442chr541866 1518 773 340 42291 2186 2157 1481 1929 22148 2108
NM_016447chr7----1209 --
NM_016448chr13683 340 131 ----11194
NM_016451chr111279 ------
NM_016454chr152235 129 ------
NM_016463chr51154 ------
NM_016467chr251393 981 447 202 81 1987 21429 466 146
NM_016475chr1441237 1003 963 293 1406 11188 --
NM_016480chr5--1884 ----
NM_016485chr642088 339 143 30 ------
NM_016487chr6174 ------
NM_016499chr111123 --1517 --
NM_016506chr112618 573 3641 536 277 ----
NM_016507chr17163166 3098 2820 2773 2468 2294 2268 1140 855 790 625 594 548 453 414 380 --11253 12548
NM_016513chr6133428 3175 3059 2696 2626 2378 2333 1422 1415 1109 805 767 571 33224 549 245 32656 2610 682 13549
NM_016516chr25779 603 547 265 187 ----1237
NM_016519chr41361 --1549 --
NM_016521chrX2308 88 --1268 --
NM_016522chr1161538 1517 1330 1199 1047 235 11094 11077 --
NM_016530chr15163965 3921 3570 3424 3393 3369 3227 3155 2904 2626 2571 2538 916 804 282 243 63385 2825 1327 921 506 192 53728 3695 717 586 578 --
NM_016531chr473635 3491 3360 2785 2612 235 83 23597 2555 ----
NM_016542chrX41724 1605 1466 1130 ----21508 276
NM_016544chr2133951 3867 3617 3187 2423 1399 1383 1188 1157 1147 362 251 233 32952 2675 257 53119 2925 2897 2415 1215 --
NM_016545chr13899 880 710 ------
NM_016548chr941585 641 605 225 11596 ----
NM_016557chr321046 684 1842 --1937
NM_016559chr361366 1345 1071 949 592 413 11093 --11050
NM_016575chr1284495 4262 4246 4030 3719 1889 1443 1425 21556 1241 11562 --
NM_016577chr364155 2741 1287 325 299 210 --1112 13908
NM_016578chr113655 638 211 --184 --
NM_016584chr121299 1283 ----
NM_016588chr62311 288 --1171 --
NM_016598chr32263 180 --21511 204 11432
NM_016603chr531946 1732 1564 31382 421 362 ----
NM_016604chr52830 328 ------
NM_016605chr542004 778 705 588 1801 11913 12277
NM_016607chrX41478 1369 1203 54 --1251 --
NM_016608chrX1269 174 ----
NM_016612chr82240 85 127 1459 --
NM_016617chr13112040 1961 1832 1802 1794 1676 787 510 442 304 53 11869 22132 1947 --
NM_016618chr25578 505 413 396 204 189 ----
NM_016620chr121214 1020 ------
NM_016621chr11123413 1429 1380 1047 1007 989 981 969 463 347 339 86 11089 13476 --
NM_016623chr8--1411 2669 113 --
NM_016626chr1851530 1251 1189 1152 1138 11320 11755 194
NM_016628chr102614 69 2642 564 1200 --
NM_016631chr2151044 972 374 202 180 177 1152 --
NM_016640chr51101 ----1118
NM_016644chr51427 1456 ----
NM_016649chr202182 118 --3451 403 138 --
NM_016651chr144953 364 84 40 ------
NM_016652chr2061268 1231 672 210 138 34 31220 606 348 11777 --
NM_016654chr1551226 1185 953 523 506 11371 2978 452 21241 329
NM_016655chr15191 ------
NM_016818chr214846 801 744 516 ------
NM_016823chr173283 134 53 179 1851 --
NM_016824chr10101768 1642 1316 1281 1202 618 508 414 389 345 11448 --2662 353
NM_016831chr192193 1837 1824 1651 1609 885 772 128 114 1520 11871 --
NM_016836chr23560 270 157 1544 169 --
NM_016839chr23560 270 157 1544 169 --
NM_016936chr1651907 1867 1624 643 571 12115 11931 --
NM_016946chr1113582 3559 3487 3281 3273 3098 3020 2651 2400 2259 1122 12827 1247 --
NM_016950chr461489 1124 1117 936 390 36 1276 ----
NM_016953chr2115637 4921 4892 4754 4148 3840 1715 1542 1156 713 495 13860 45775 4995 1522 947 --
NM_016954chrX149 --1117 --
NM_017410chr121852 ------
NM_017412chr831431 902 267 --1924 --
NM_017415chr5123978 3919 3261 3021 2940 1518 1215 691 488 346 336 271 23146 3038 24037 390 13168
NM_017416chrX2143 49 ------
NM_017420chr14133714 3114 2907 2468 1402 1395 835 757 704 689 569 511 456 3919 740 503 23831 215 --
NM_017423chr472131 2080 1576 1469 876 360 354 ----21362 557
NM_017426chr45654 620 544 277 110 ------
NM_017437chr1482183 2165 1670 604 453 346 256 135 --1611 --
NM_017440chr124555 434 89 74 --2513 47 --
NM_017447chr21164409 4337 4060 4035 3490 3347 3227 3094 3052 3032 2876 1598 1562 631 349 214 32991 2902 2839 21619 1055 --
NM_017449chr151124 1116 633 355 251 --21587 586 --
NM_017450chr1731428 434 108 ------
NM_017452chr2091436 1360 1154 935 929 600 560 336 82 --11297 --
NM_017453chr2091436 1360 1154 935 929 600 560 336 82 --11297 --
NM_017454chr2091436 1360 1154 935 929 600 560 336 82 --11297 --
NM_017455chr153699 314 246 1886 1796 --
NM_017456chr1741854 451 281 148 ------
NM_017459chr1177 ------
NM_017481chr11277 45 ------
NM_017489chr841060 538 530 390 --2369 118 --
NM_017490chr111289 ------
NM_017491chr431035 411 81 1869 174 --
NM_017495chr2031477 1437 528 ------
NM_017514chrX2932 910 ------
NM_017519chr671017 918 911 862 505 329 229 2936 868 --11196
NM_017520chr132448 221 1583 ----
NM_017522chr161330 900 564 205 127 86 --21228 1032 --
NM_017544chrX2938 45 ------
NM_017545chr201600 139 ----
NM_017548chr331911 1518 773 ------
NM_017551chr1052572 2474 2150 1784 765 22601 758 41996 1832 440 129 12129
NM_017558chr163404 182 25 1100 --156
NM_017563chr3176385 6282 6107 6094 6002 5199 3968 3958 2262 2179 2066 1543 1452 1092 1086 1061 499 44852 4159 1259 1225 26123 5052 11776
NM_017577chr3101694 1533 1364 1309 1165 319 212 168 122 97 31112 632 108 51495 1266 266 228 138 --
NM_017580chr1082393 2314 1771 1580 1544 784 353 247 12221 11751 --
NM_017581chr42126 80 ------
NM_017582chr151722 1523 484 357 344 --31821 639 107 --
NM_017583chr1151290 1132 588 389 80 ----21689 1155
NM_017588chr941900 782 742 279 21452 326 1202 --
NM_017592chr1952724 816 435 413 403 --1454 --
NM_017593chr41327 1499 ----
NM_017594chr9163331 3059 2919 2596 2423 2409 2328 2281 2089 2078 1194 979 900 882 869 795 12060 12305 --
NM_017596chr164645 4289 4081 1280 1245 1239 23864 895 ----
NM_017599chr1292019 1943 1604 709 671 647 571 445 279 11476 21513 304 1564
NM_017610chr1592094 2028 1670 1525 721 628 386 240 201 --32021 266 218 --
NM_017617chr931494 1214 141 21582 370 ----
NM_017628chr4154908 4753 4514 4432 3691 3661 3558 3498 3331 503 450 359 321 116 57 21161 631 54052 985 935 916 151 35286 1462 876
NM_017629chr191794 1382 1251 530 489 374 302 240 185 --21335 1202 --
NM_017632chr43356 304 106 ------
NM_017633chr6133956 3933 3540 3006 2799 2679 2614 1565 1309 1290 951 670 374 22659 2512 13551 --
NM_017634chr881843 1572 1557 1226 573 192 177 60 --22006 1892 1756
NM_017635chr1161449 1322 1223 1058 415 181 1580 11363 --
NM_017637chr9219461 9303 9247 8439 8155 8120 7506 6986 6655 5701 3469 2756 2669 2432 2193 2104 2041 1834 779 686 599 78898 8232 7884 6663 3440 827 204 47669 6600 1960 1930 12022
NM_017640chr64776 255 120 79 --1201 --
NM_017641chr1271126 1081 1036 992 844 780 261 ------
NM_017643chr1783032 2929 2874 2749 2480 2234 430 209 22970 1031 1539 2593 133
NM_017644chr3215154 4927 4913 4832 4808 4693 4680 4317 3839 3829 3647 3535 3504 3498 1784 1773 1709 1615 1400 523 134 44852 4519 1672 799 21565 1211 21792 1351
NM_017645chr983086 3043 2877 2391 2133 1233 183 156 2448 109 21212 265 22619 321
NM_017649chr1011077 3962 351 272 ----
NM_017650chr7175723 5604 5567 5370 4984 4967 3993 3967 2379 2058 2049 1838 1704 1672 1624 1119 901 22252 1929 36044 5711 2273 --
NM_017655chr181606 1266 596 564 549 291 161 47 31338 362 320 1275 --
NM_017657chr25743 719 226 41 23 ------
NM_017658chr14164344 4265 4089 3945 2953 1877 1810 1547 1534 1168 1022 857 775 603 259 100 33428 1197 903 21713 1597 21263 471
NM_017660chr19112339 2291 1225 1219 942 932 905 504 432 256 248 ------
NM_017664chr135980 965 784 245 201 --1301 --
NM_017666chrX162245 2205 2135 2106 2005 1617 1484 1475 1468 900 877 522 384 318 254 214 2341 82 22146 1694 41809 428 419 349
NM_017670chr112779 70 ------
NM_017672chr1531177 1140 1126 ------
NM_017673chr16915 880 856 655 617 288 --1355 --
NM_017680chr93817 272 220 ----11014
NM_017686chr13700 240 130 ------
NM_017693chr1361462 1445 1439 1280 1024 451 11077 11544 --
NM_017694chr252036 1857 1573 611 446 11869 1284 --
NM_017704chr117866 370 314 286 216 198 27 ------
NM_017705chr1553773 3331 3311 2601 2300 21288 666 1166 1744
NM_017709chr1133733 2786 1697 1626 1577 1430 1074 1044 858 814 703 518 137 1375 14073 14181
NM_017714chr203876 371 91 ------
NM_017719chr341869 345 218 187 --12297 --
NM_017724chr33690 278 237 ------
NM_017730chr34689 516 88 81 ------
NM_017734chr13634 244 86 --163 --
NM_017735chr2188 ------
NM_017736chr1683119 2969 2373 2059 1936 1205 604 472 33167 2157 32 ----
NM_017737chr172134 2123 1964 1923 1802 1561 135 --1257 32163 1391 482
NM_017741chr4102764 2720 2592 2433 2008 1758 1731 972 833 710 --2911 774 --
NM_017742chr18101967 1935 1698 1572 1398 1284 1236 736 111 86 1415 1136 1130
NM_017745chrX5658 275 214 167 75 ------
NM_017747chr5295 69 --1351 --
NM_017752chrX31930 1360 539 21817 1618 ----
NM_017753chr991047 1041 995 709 393 313 237 172 137 1319 1919 --
NM_017754chr6104602 4081 3455 3225 1711 1567 1550 1340 1146 765 --33064 1452 627 11604
NM_017757chr1861176 1168 1067 892 870 342 --1882 --
NM_017758chr1741472 1457 945 541 --1137 11416
NM_017761chr141094 1056 601 262 --31558 1441 456 --
NM_017762chr1572192 1939 1905 1797 383 268 47 11732 31781 437 285 --
NM_017768chr17781 727 377 338 204 191 183 2325 307 1986 --
NM_017769chr1492722 2637 2630 2432 2192 1199 1155 336 223 22830 2296 22746 374 22386 216
NM_017770chr663014 2739 2599 2521 2487 862 1331 32963 2460 103 --
NM_017772chr631722 1089 669 31581 1564 593 1584 --
NM_017774chr63401 386 42 ------
NM_017778chr871176 1047 389 195 188 144 86 --31189 455 60 --
NM_017779chr182714 2278 2116 1044 797 496 410 106 ------
NM_017780chr84873 848 382 278 ------
NM_017784chr331102 899 345 11192 --1354
NM_017794chr92261 228 170 ----
NM_017798chr2071235 895 454 215 170 136 123 ----1345
NM_017799chr1441976 692 471 66 ------
NM_017801chr392531 2383 2247 962 918 576 515 407 195 32155 1593 1007 ----
NM_017810chr165760 739 687 602 56 --1615 --
NM_017811chr953105 2596 2493 1163 560 ------
NM_017812chr73670 533 57 ------
NM_017813chr8305188 5066 5057 4772 4565 4509 4444 4136 4041 3862 2319 2223 2217 2135 2117 2107 1950 1725 1400 1383 1271 1170 976 710 639 562 528 444 380 213 44907 1761 1534 849 --23763 1375
NM_017824chr1092751 2681 2486 2255 2194 797 560 276 116 52331 2212 785 627 379 32471 2425 413 --
NM_017830chr431008 381 169 ------
NM_017831chr18104745 3964 3484 3462 2930 1836 1828 1667 1619 982 34375 3090 1680 14639 33895 1002 952
NM_017837chr16502 468 447 217 126 120 ------
NM_017845chr4------1524
NM_017848chrX154381 3930 3799 3357 3339 3150 3015 2926 2855 618 612 468 363 191 163 --44448 3755 702 105 --
NM_017849chr2103230 2968 2911 2869 2679 2452 2442 2266 2104 2039 --12192 --
NM_017851chr1541190 799 495 373 21304 472 11216 --
NM_017857chr11--1655 ----
NM_017872chr51262 ------
NM_017880chr21467 ------
NM_017890chr881660 1375 1366 664 576 383 200 52 ------
NM_017893chr1041479 1266 354 348 ------
NM_017896chr20113360 2973 2761 2424 2372 817 708 610 458 423 105 23353 2961 23557 2967 --
NM_017906chr64283 252 75 67 --1100 --
NM_017910chr23320 302 93 ------
NM_017913chr93149 98 67 ------
NM_017915chr124750 332 248 67 --1741 --
NM_017919chr9195762 5624 5405 5324 5261 4955 4821 4346 4305 3951 2218 1830 1585 1517 1416 1139 772 344 261 24105 1174 25306 5093 35437 3551 1640
NM_017921chr1731879 670 409 ------
NM_017922chr145660 235 227 118 56 ------
NM_017925chr921846 76 11247 ----
NM_017933chr2--1651 1260 11204
NM_017938chrX51838 1765 1713 1611 48 1319 11849 11810
NM_017944chr1172527 2114 1927 1035 955 933 582 ------
NM_017953chr12300 109 1852 ----
NM_017954chr761597 1567 1246 1185 1128 57 --41486 652 324 122 1377
NM_017958chr283004 2931 2199 2063 1902 1227 291 72 32486 2126 416 22877 1151 --
NM_017964chr29996 984 968 922 755 626 359 232 154 --2873 351 --
NM_017969chr2184 --1142 --
NM_017987chr10111742 1660 1646 1588 1505 1367 1354 690 649 481 307 21897 182 22034 1540 --
NM_017988chr123925 729 200 --1693 --
NM_017990chr1683990 3117 1582 996 885 731 694 409 1738 11631 13575
NM_017994chr782793 2735 1971 1914 1160 991 966 520 --31859 1145 959 --
NM_017998chr931258 1179 941 ----21428 1406
NM_018003chr1551945 962 699 539 258 1170 --1764
NM_018004chr34164 67 40 23 ------
NM_018008chr32138 71 ------
NM_018009chr121112 ------
NM_018010chr381560 1289 1077 1063 1043 1025 105 23 21069 541 --1266
NM_018011chr131171 ----1233
NM_018014chr241173 445 353 182 21160 893 ----
NM_018015chrX2982 213 ------
NM_018017chr1092649 2344 2320 2079 1973 1853 1770 664 457 32043 630 607 32033 413 322 --
NM_018018chr1291734 1242 1228 635 517 511 269 223 21 31847 1498 768 ----
NM_018025chr192181 175 --2245 37 --
NM_018026chr1121247 996 21436 1310 --11459
NM_018027chr1062887 2241 2233 2187 1142 225 --32738 2283 773 --
NM_018028chr1941288 1019 1007 986 --1122 --
NM_018030chr183374 81 67 ------
NM_018034chr5194 ------
NM_018036chr1494408 4154 3405 2950 2827 2737 997 942 122 44217 1107 1047 360 44352 3599 877 655 --
NM_018037chr11512 --1259 --
NM_018043chr1181451 1358 1056 1013 925 211 169 155 ----11176
NM_018045chr142987 2450 1991 278 1864 13005 --
NM_018046chr561646 1466 753 575 161 62 ------
NM_018047chr52957 338 --180 --
NM_018048chr1252022 1613 1557 738 288 21921 1279 --11860
NM_018056chr13180 142 126 ------
NM_018061chr161471 1203 610 351 230 59 ------
NM_018063chr103438 319 308 ------
NM_018070chr12445 391 ------
NM_018078chr461007 1000 947 752 657 180 1424 1289 --
NM_018079chr22445 147 138 ----
NM_018084chr2153351 3275 3035 2871 2837 2828 2560 2284 1122 984 857 741 231 119 80 83061 2229 1161 896 772 575 362 61 1820 13265
NM_018085chr1107864 7062 6487 6092 1530 1282 1086 733 245 85 --47719 1960 1551 878 1205
NM_018086chr281904 1821 1811 1504 1403 585 485 373 --41626 1609 1426 599 --
NM_018090chr151178 1158 956 923 910 --11096 --
NM_018092chr1641325 587 416 90 21641 466 31040 409 388 11364
NM_018094chrX2312 97 1153 --1305
NM_018095chr112618 573 3641 536 277 ----
NM_018098chr321095 1038 --21052 143 --
NM_018105chr851073 787 165 124 25 --1953 --
NM_018110chr161319 ------
NM_018112chr97962 798 741 404 358 277 36 3848 681 43 2946 71 1351
NM_018117chr104688 676 494 292 1504 ----
NM_018120chr891529 1510 1255 1228 998 434 385 348 233 11115 21331 485 --
NM_018121chr10123118 3059 2855 2783 2777 2665 2506 2186 1990 1953 344 167 13215 22003 733 --
NM_018125chr1--1164 ----
NM_018126chr461464 1456 1366 1297 621 152 ----21322 301
NM_018131chr103830 769 641 --2869 167 --
NM_018133chr392176 2141 1672 1546 775 654 505 448 384 ------
NM_018142chr84208 198 185 179 ------
NM_018151chr22763 681 3307 232 196 2507 48 --
NM_018155chr383207 3088 3041 2853 2522 912 557 258 2854 703 42927 2416 2315 693 --
NM_018156chr172526 2514 978 736 342 271 216 21122 816 12985 1669
NM_018157chr12123250 3176 2153 2072 2063 2052 2030 1292 1050 958 74 49 --22238 620 --
NM_018159chrX31314 540 123 --1296 --
NM_018169chr122561 370 1471