TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-542-3p
miRNA Sequence: UGUGACAGAUUGAUAACUGAAA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr521503 344 ------
NM_000081chr131368 1206 1184 --11851 --
NM_000084chrX56112 2779 2248 2106 414 1214 --25777 543
NM_000090chr22631 72 1868 ----
NM_000092chr264314 4179 3918 3820 2818 82 23417 905 12937 11243
NM_000109chrX42691 2488 641 236 1777 11803 12337
NM_000138chr1522619 859 3887 878 229 --21940 1788
NM_000141chr1031508 1442 1147 11410 ----
NM_000176chr533212 2601 752 --11178 --
NM_000216chrX53484 2838 2743 278 147 ----13979
NM_000217chr1254520 3516 2080 138 87 13884 15329 --
NM_000245chr722166 483 11738 --1240
NM_000248chr3------22353 703
NM_000259chr15106354 5231 2266 2022 1846 1743 1358 861 697 546 35139 4388 4134 44685 4422 4025 2504 --
NM_000291chrX2336 271 1918 ----
NM_000314chr10103077 2934 2925 2263 2102 1252 1243 1169 959 213 22161 785 2640 359 --
NM_000330chrX42177 2171 1829 1686 ------
NM_000332chr666581 5293 4565 758 194 130 25389 155 1796 11726
NM_000335chr331704 1632 762 --22105 1465 --
NM_000337chr555948 5374 5341 1457 422 --1267 --
NM_000362chr2253227 2761 2510 2310 1078 ----1150
NM_000390chrX43190 3120 989 717 12083 23167 2292 --
NM_000393chr221551 480 ----11330
NM_000405chr51380 ----21703 440
NM_000430chr1762860 2647 1463 853 557 318 1145 --1738
NM_000458chr17----2356 77 --
NM_000489chrX52795 2616 2470 2416 184 1337 ----
NM_000525chr1141465 1260 1040 144 21381 132 ----
NM_000533chrX1739 ------
NM_000555chrX37880 6470 559 11259 46112 4942 2585 1107 --
NM_000615chr1163010 2259 2250 1926 559 385 ------
NM_000618chr1286012 5743 5018 4949 1497 1306 1219 71 16577 ----
NM_000633chr1863914 1990 1495 1444 1117 70 --11154 --
NM_000663chr1642772 2023 753 49 13052 ----
NM_000665chr7------1216
NM_000725chr12----21018 815 --
NM_000726chr2----1121 --
NM_000767chr192973 958 ------
NM_000811chr52307 270 ------
NM_000813chr555033 2181 1508 491 334 35045 4577 3705 15261 --
NM_000814chr1563970 3737 3713 3285 1121 64 21572 1088 22910 799 14061
NM_000833chr1621478 1349 ------
NM_000875chr1566938 6133 5447 4906 4340 1210 26819 5214 24735 565 11615
NM_000891chr1783355 3239 3191 3175 2881 2779 2662 1213 1599 ----
NM_000899chr1213981 11225 23065 25 --
NM_000925chr31366 ------
NM_000944chr422081 513 --1371 --
NM_000963chr161723 751 357 193 165 89 11848 1440 1323
NM_001001331chr332573 2485 973 ------
NM_001001395chr1242550 2142 344 258 12847 1893 --
NM_001001433chr201577 --13164 --
NM_001001481chr833488 888 623 23456 1018 ----
NM_001001549chr72700 645 12655 --12486
NM_001001664chr2104138 3849 3394 3237 2873 2850 2654 1531 274 98 13004 ----
NM_001001936chr101286 --1743 --
NM_001001974chr1032341 2130 871 12224 ----
NM_001002860chr1444041 3978 3238 579 13971 24655 4369 1711
NM_001002909chr173625 393 296 ------
NM_001003407chr1044094 1273 1147 511 25089 64 33528 3491 1817 15109
NM_001003652chr1868391 7689 6231 2933 459 442 17655 28669 3467 155
NM_001003674chr1886595 6542 6451 5782 4568 2318 2097 1349 15903 16912 --
NM_001003682chr111110 1393 ----
NM_001003688chr421126 1031 --11220 --
NM_001003696chr21134 ------
NM_001003698chr61681 --21279 573 --
NM_001003712chr1293897 3870 3475 3114 2990 2887 2810 2516 502 32864 2824 2709 13050 --
NM_001003800chr953161 2894 2612 1013 176 13433 ----
NM_001004067chr162314 144 ------
NM_001004317chr664482 3880 3474 1406 218 178 --21657 486 --
NM_001005404chr1754199 2986 1281 1156 346 11414 --14486
NM_001005526chr2----1101 --
NM_001005609chrX33655 1299 299 --13223 --
NM_001005849chr17------1491
NM_001006935chrX------1138
NM_001007067chr8------1307
NM_001007097chr91622 --11936 24517 1070
NM_001007471chr9----1864 --
NM_001007553chr121203 330 ------
NM_001007559chr1831654 494 50 ----1297
NM_001008239chr1833125 1362 1086 179 --13145
NM_001008392chr363547 3067 2646 2612 2261 667 --1821 11039
NM_001008408chr766034 4744 2196 1051 609 227 11295 11790 --
NM_001008493chr12454 150 11739 ----
NM_001008495chr82903 24 22024 577 ----
NM_001008925chr443197 2822 1321 611 1304 ----
NM_001009881chr11458 ------
NM_001009996chr31114 198 --1525
NM_001010854chr141511 ----1602
NM_001010862chrX12285 --13163 --
NM_001010888chrX11756 12867 --1449
NM_001010934chr731026 846 795 11039 ----
NM_001011537chr31363 12377 1414 --
NM_001011663chr10----1183 --
NM_001011666chr736470 5598 460 --16272 --
NM_001012270chr1711664 --11924 2361 298
NM_001012755chrX63782 3305 1759 1537 933 278 --1884 --
NM_001012968chrX22792 37 ----11963
NM_001012989chrX1588 ----1182
NM_001013031chr102971 772 --21322 475 --
NM_001013415chr41602 ----11243
NM_001013437chr18----1306 --
NM_001013620chr1288029 7665 5945 5479 2584 2200 2152 1544 27907 6975 16353 15678
NM_001013622chr41831 ------
NM_001013659chr1974928 4565 4541 1653 1350 1178 72 24158 997 ----
NM_001014794chr111189 ----1240
NM_001014797chr1067218 7052 1884 1316 975 426 26598 1256 18152 15613
NM_001015887chr3----1143 1700
NM_001017395chr312703 --12654 --
NM_001017440chr777726 7487 6431 6393 6063 2823 842 26802 5151 ----
NM_001018004chr15------1103
NM_001018064chr941947 1568 751 491 ------
NM_001018065chr935460 5009 33 --14265 16079
NM_001018067chr195064 4451 4432 3422 1958 1946 1426 593 491 --34002 3954 109 --
NM_001024948chr132655 2136 1371 ----12948
NM_001025076chr1042273 2179 994 672 --24769 1485 --
NM_001025077chr1022352 2030 11138 26127 2843 --
NM_001025079chr343826 3771 1024 128 23317 1617 1743 --
NM_001025201chr22635 580 ----1462
NM_001025580chrX22730 1205 21316 682 23954 3390 --
NM_001029863chr643001 2016 636 146 22267 599 12761 12149
NM_001030007chr1632915 1563 631 --12857 --
NM_001030055chr1484315 4054 3602 3021 1771 1488 747 695 --1296 --
NM_001031710chr72958 740 ----11078
NM_001031812chr532266 532 216 1124 11776 --
NM_001033057chr3----1416 --
NM_001033112chr52179 90 2574 100 1162 --
NM_001033117chr344380 2974 1704 1288 --34857 3932 1558 --
NM_001033566chr173843 814 670 ------
NM_001033953chr11----1409 --
NM_001037131chr21487 ------
NM_001037132chr76528 505 434 424 274 63 11585 1628 --
NM_001039479chr141143 --21900 238 --
NM_001039538chr213710 1138 13595 13549
NM_001039574chr11706 --11015 --
NM_001039762chr1052198 2071 1525 945 188 1616 1336 --
NM_001039840chrX76040 5801 3939 3709 2217 1454 29 35893 5445 2203 26027 36 --
NM_001039937chr1363842 1519 900 335 326 263 1677 ----
NM_001040001chr631721 770 416 ------
NM_001040057chr7--11262 --11406
NM_001040142chr22870 350 11632 12158 --
NM_001040152chr785009 4939 4365 3473 3458 3322 1760 348 --21159 315 15124
NM_001040152chr785009 4939 4365 3473 3458 3322 1760 348 --21159 315 15124
NM_001040402chr433153 2617 48 32704 2188 2172 2435 35 --
NM_001040429chr1343295 2427 1170 320 1662 12739 --
NM_001040441chr121482 743 13601 34063 2172 525 --
NM_001040712chr942335 1439 1114 666 13595 12683 --
NM_001042388chr181246 ------
NM_001042406chr61372 1224 ----
NM_001042413chr963834 3275 2994 2939 2750 293 23681 3618 1280 --
NM_001042494chr151703 --22400 683 13061
NM_001042510chr831993 695 567 ------
NM_001042533chr362070 1147 1134 957 792 296 ----1136
NM_001042537chrX42285 1842 1772 259 --12377 --
NM_001042603chr1243997 3619 1668 530 --34399 1248 470 --
NM_001043318chr1432562 1549 682 --12641 13964
NM_001044385chr243814 3407 1398 849 --12620 11215
NM_001046chr542367 1064 919 526 12781 --12954
NM_001068chr31262 ------
NM_001071775chr1331926 1682 1192 11830 11571 --
NM_001100108chr1158177 7712 7574 7346 7122 6963 6575 5790 2717 2615 2606 2107 1695 1292 494 28162 274 47904 7037 5836 1682 --
NM_001106chr3118993 8828 8726 8647 7822 7545 7385 7014 3555 3307 1652 --39356 3400 3108 1444
NM_001126chr11338 --1434 --
NM_001147chr8------1296
NM_001172chr141559 --1722 --
NM_001204chr2106942 6825 6701 6318 6047 6023 1883 1535 246 98 --27283 2912 --
NM_001206chr932915 2362 2288 22741 2482 1637 --
NM_001219chr72672 494 --190 --
NM_001232chr1----21199 245 --
NM_001270chr51123 ----11117
NM_001293chr112413 162 ------
NM_001316chr202440 105 --1323 --
NM_001364chr1154756 4701 4578 3957 877 ------
NM_001387chr543188 2810 606 149 --22061 1957 1544
NM_001395chrX1407 --1206 --
NM_001396chr2122157 602 22431 1023 ----
NM_001408chr111372 ------
NM_001412chrX22779 1064 1487 23258 2617 12791
NM_001438chr111312 ------
NM_001449chrX----21269 951 --
NM_001455chr684150 3916 3354 3345 927 820 450 169 11795 13176 --
NM_001483chr71436 --1949 --
NM_001616chr263396 3314 1264 1183 818 341 ------
NM_001627chr342105 1820 773 365 ----1146
NM_001656chr52674 658 ----11487
NM_001664chr32736 365 --1643 --
NM_001677chr1------190
NM_001690chr3------12306
NM_001743chr22499 98 --1166 --
NM_001753chr711189 --11544 --
NM_001759chr1224173 848 --21214 564 --
NM_001918chr188346 7533 7482 6543 5860 2335 600 142 28404 8378 26933 2023 1206
NM_001938chr121474 110 21612 291 1732 --
NM_001945chr5----11345 11388
NM_001949chr622985 2600 13182 167 1555
NM_001957chr451632 914 717 489 274 ------
NM_001995chr421413 1340 --11253 --
NM_002024chrX3648 513 428 --11892 11877
NM_002025chrX138963 8515 8200 8157 7864 6934 6568 3104 2896 2664 1711 510 458 38109 2995 2044 28934 2369 --
NM_002080chr161296 --1398 11019
NM_002126chr1774149 4124 4056 3832 2937 2755 1198 11346 ----
NM_002141chr7------1565
NM_002146chr1731455 1428 1082 --11204 11181
NM_002156chr21321 --1182 --
NM_002163chr161326 ----156
NM_002207chr31774 --2299 41 --
NM_002211chr103464 355 221 --1845 --
NM_002214chr7105015 4782 4716 3851 2191 1578 1197 763 373 319 1700 --14530
NM_002254chr232180 928 324 11814 11508 --
NM_002264chr354977 4252 3285 3078 653 --23776 1950 --
NM_002270chr572114 1927 1601 1212 1125 844 89 ------
NM_002271chr1352012 1912 1845 604 521 ------
NM_002314chr711022 ------
NM_002356chr652494 2483 1880 352 210 ------
NM_002375chr321893 88 ----1755
NM_002397chr571961 1726 1702 1650 1608 399 307 1293 ----
NM_002399chr1521369 449 --11354 --
NM_002401chr173702 586 209 11653 --11585
NM_002473chr22----11323 11247
NM_002480chr1221211 587 --1103 --
NM_002499chr152938 597 11799 32344 2072 858 --
NM_002500chr23417 143 59 11030 1910 --
NM_002515chr1461823 1769 1314 368 236 95 --11255 --
NM_002522chr1723184 564 ------
NM_002583chr12----2561 462 --
NM_002594chr201141 --1253 1410
NM_002645chr112440 367 --12218 --
NM_002648chr6134 --1421 --
NM_002655chr884755 4657 4583 4269 4034 3228 690 667 1232 ----
NM_002709chr273431 2486 2373 1443 1159 1085 200 1110 ----
NM_002734chr1721600 1512 11674 1230 --
NM_002738chr1621137 1005 2989 870 136 --
NM_002745chr2264474 1456 1186 765 715 219 13711 --11388
NM_002822chr1221492 482 1230 11519 --
NM_002835chr71115 --1763 1235
NM_002844chr621247 1143 ----177
NM_002867chr1----1515 2100 66
NM_002869chr1121792 876 ------
NM_002874chr912248 --12335 --
NM_002899chr31136 ------
NM_002911chr1931684 1275 1213 --11329 --
NM_002912chr62385 111 1683 1212 --
NM_002922chr1------1232
NM_002941chr321323 61 11646 ----
NM_002968chr16------1998
NM_002998chr812163 --22212 463 --
NM_002999chr201106 --11931 --
NM_003010chr1741952 1712 754 359 --1154 --
NM_003017chr621068 219 --1957 --
NM_003020chr15137 --1357 --
NM_003081chr2051161 447 143 137 35 ------
NM_003099chr1565702 5233 5207 4113 2072 848 25021 2162 22578 338 --
NM_003101chr131287 79 28 ------
NM_003108chr256768 5186 2291 1505 1261 11645 1516 16459
NM_003112chr743116 3106 2987 2696 11133 ----
NM_003128chr262786 2761 2573 1088 1071 822 --1914 --
NM_003130chr731332 356 338 --1540 1208
NM_003144chr651926 1829 1562 479 89 ------
NM_003155chr822835 2657 1487 --11098
NM_003178chr342054 1915 1650 243 12114 11498 --
NM_003185chr202868 305 ----11195
NM_003234chr382217 2101 2066 1776 1671 981 790 629 12003 ----
NM_003246chr15--1311 --1518
NM_003253chr2121927 163 11298 ----
NM_003295chr132174 59 --137 --
NM_003336chrX21061 59 --177 --
NM_003337chr52438 405 1680 ----
NM_003340chr421289 451 1393 --1995
NM_003341chr34672 593 446 208 ----139
NM_003342chr1732556 2546 1129 32913 2528 2499 22027 1080 --
NM_003348chr1231255 578 314 ----1182
NM_003350chr8----1225 --
NM_003375chr10----1340 --
NM_003392chr343876 1275 860 755 1587 1139 --
NM_003406chr851505 1462 622 114 58 --11712 --
NM_003410chrX53029 2731 2021 654 426 ------
NM_003412chr322324 725 1912 11125 --
NM_003471chr3169 --32250 1570 152 --
NM_003478chr1122777 412 --13127 --
NM_003505chr711270 ----11743
NM_003559chr1733950 2859 2422 --13926 --
NM_003574chr1885238 4581 4540 3556 1517 752 633 597 --24640 370 --
NM_003583chr1233894 2493 877 13013 13781 --
NM_003592chr71329 ------
NM_003603chr431814 1671 88 ----11949
NM_003607chr173865 3495 3487 3296 3212 1741 1721 14319 33413 2839 997 --
NM_003622chr1242644 2172 2003 123 1356 21807 841 12231
NM_003629chr123376 1301 ------
NM_003633chr542555 2016 646 401 ------
NM_003664chr51224 --1525 --
NM_003714chr532792 2340 608 23077 98 1758 --
NM_003716chr34706 284 91 64 --1889 --
NM_003787chr1831344 527 242 11400 ----
NM_003794chr32413 265 1698 ----
NM_003825chr1541519 1087 412 244 11479 ----
NM_003831chr182190 44 ------
NM_003872chr212144 22080 1922 12339 22880 2563
NM_003895chr2152012 1604 1584 823 741 ----12208
NM_004027chr2------130
NM_004055chr111326 --21679 247 --
NM_004093chr1322978 915 32799 2160 441 22055 513 13165
NM_004113chr322022 1787 11430 12058 --
NM_004114chrX197 --1933 --
NM_004124chr1452920 697 620 411 291 --33461 2680 95 --
NM_004130chr31187 ----191
NM_004162chr3----1980 --
NM_004170chr941852 1354 634 289 --1373 --
NM_004171chr1187995 6805 6253 6244 2921 1049 949 125 17590 12986 1640
NM_004232chr1831520 950 874 12969 ----
NM_004238chr2196 ----133
NM_004263chr221456 1149 ------
NM_004274chr1433068 2854 117 12620 ----
NM_004330chr151368 11142 --2917 106
NM_004379chr241386 1304 1216 26 1478 ----
NM_004392chr1322631 901 ----1521
NM_004397chr1152782 1693 1635 1451 350 13810 11700 12962
NM_004430chr832211 1743 1111 12614 ----
NM_004432chr91454 ----1236
NM_004443chr3------1550
NM_004459chr1751679 782 715 441 212 11812 ----
NM_004469chrX----267 31 --
NM_004496chr142885 536 --1172 --
NM_004501chr133628 1452 651 1389 ----
NM_004504chr252929 2847 1142 828 363 ----1401
NM_004529chr921400 1051 ----1890
NM_004569chr142516 472 --1633 --
NM_004571chr2123001 342 ------
NM_004586chrX55123 4735 1933 750 729 ----15424
NM_004615chrX--1634 --1703
NM_004635chr32776 130 ------
NM_004650chrX11413 ------
NM_004660chrY42167 1978 1900 1844 ------
NM_004735chr2----1154 --
NM_004738chr2041895 1759 687 293 1754 --1934
NM_004742chr321790 533 1662 11691 --
NM_004748chr1511672 12833 --1138
NM_004763chr211110 7784 728 448 392 336 280 263 ----
NM_004774chr1711966 ------
NM_004808chr1033229 1295 1246 --11239 --
NM_004834chr233116 2972 2757 33152 2466 1085 ----
NM_004845chrX63948 3780 3669 1139 996 653 ------
NM_004849chr64639 616 449 60 ------
NM_004852chr181012137 11353 10423 4948 3547 1487 1319 1186 952 371 313037 3924 3846 29082 1199 --
NM_004866chr544820 1562 1220 534 13453 125 13509
NM_004884chr1531262 1193 140 11738 2396 76 --
NM_004898chr442864 2679 2198 1969 2774 378 ----
NM_004902chr20----2127 106 --
NM_004922chr101406 --1175 1241
NM_004926chr1441137 392 285 202 ------
NM_004961chrX31529 1013 963 --21305 1247 --
NM_004977chr19132 ------
NM_004985chr12114497 3775 3578 3354 1815 1677 1449 1079 714 504 123 11715 --13917
NM_004992chrX56820 6017 5553 2718 2190 --47846 6895 6366 2878 --
NM_005028chr1022160 710 --22109 1841 --
NM_005096chrX11237 --11135 --
NM_005097chr10----1264 --
NM_005121chr1733044 2959 2671 22601 1023 --12512
NM_005156chr995395 4660 4439 3812 3631 3297 1661 796 720 ------
NM_005238chr1121225 835 1369 --1692
NM_005249chr141863 ------
NM_005259chr211064 --21381 1256 --
NM_005276chr1241428 446 395 176 11352 11491 --
NM_005296chrX3846 793 388 --1431 --
NM_005312chr921040 80 --21733 695 --
NM_005316chr111762 --1974 --
NM_005342chrX72569 2437 2147 1939 788 712 159 12789 ----
NM_005380chr111263 ------
NM_005381chr2----163 --
NM_005465chr1----130 --
NM_005475chr123806 533 117 ----1359
NM_005504chr1276623 5598 5376 4782 2362 1104 646 56485 5518 2541 558 134 11978 --
NM_005509chr51495 1259 11555 --
NM_005512chr112549 247 --11991 --
NM_005563chr12351 70 --1666 --
NM_005569chr2221427 1354 --1286 --
NM_005578chr353747 3379 1867 906 165 ----1352
NM_005596chr946348 5847 4739 4390 21221 360 ----
NM_005724chr15----1307 --
NM_005737chr212487 11845 12418 --
NM_005742chr21261 --1864 1233
NM_005778chr31101 --2375 66 --
NM_005828chr1784576 4246 4169 1698 1399 1306 1185 291 13687 1126 --
NM_005843chr251835 1687 630 612 384 1471 1340 --
NM_005885chr52556 311 ------
NM_005898chr1142494 881 155 64 22486 1210 1854 --
NM_005899chr172516 366 --158 --
NM_005909chr533824 575 136 --23535 2784 13609
NM_005910chr1721572 148 1421 ----
NM_005933chr1162811 2570 2357 2294 477 251 --22310 582 --
NM_005935chr464266 4018 3311 2022 1789 1510 ------
NM_005941chr8114112 3942 3470 3107 2878 1600 1215 904 592 235 72 24062 1153 ----
NM_005955chr154832 1761 550 272 257 --14657 --
NM_005964chr171959 11068 --1387
NM_005966chr231640 1511 902 --11560 11498
NM_006011chr15103729 2689 1203 1193 1021 1008 943 934 791 393 --32768 2673 970 --
NM_006040chr1641375 1014 307 150 --21387 416 --
NM_006043chr16----1685 --
NM_006047chr2043559 3004 1276 1090 42824 1343 695 194 --11413
NM_006106chr1143348 3321 818 172 23414 382 ----
NM_006107chr17----1496 1476
NM_006135chr11979 --1201 --
NM_006153chr3143 1512 ----
NM_006212chr154752 4384 3871 2131 73 --11342 --
NM_006216chr22697 85 --2634 267 --
NM_006246chr1421181 402 11051 1440 --
NM_006267chr21143 11762 1690 11250
NM_006322chr132910 317 ------
NM_006325chr123824 679 297 --1303 --
NM_006352chr12692 303 ----1274
NM_006358chr223182 170 107 ------
NM_006379chr742080 1535 376 192 12291 1608 12240
NM_006380chr1752831 1652 1444 1026 579 --11352 --
NM_006393chr1074523 4219 3996 1812 1294 775 733 14516 1359 --
NM_006421chr811087 --1918 1819
NM_006439chr41408 ------
NM_006451chr53976 789 117 183 ----
NM_006517chrX11863 12127 21573 1530 1652
NM_006527chr41106 --1744 --
NM_006534chr2063430 3178 850 314 291 146 --1621 --
NM_006544chr1484803 2234 1483 1387 916 325 305 276 24083 602 21676 1050 14238
NM_006546chr1756176 5134 4039 2374 569 --11098 14494
NM_006547chr711732 11532 --11940
NM_006557chr911290 --21440 372 --
NM_006565chr161888 ----11043
NM_006591chr1111653 --1202 --
NM_006599chr1645755 1563 1457 1185 11294 --13280
NM_006600chr1------1193
NM_006602chr201770 1657 --1598
NM_006614chr342574 2249 1314 654 12793 ----
NM_006618chr1----1446 --
NM_006624chr1021818 1398 ------
NM_006628chr1564637 3038 1642 942 350 58 --34488 4291 1340 --
NM_006646chr1343003 2690 2167 607 --22942 228 --
NM_006690chr2031867 946 584 --21646 698 1672
NM_006698chr203405 378 356 1107 11202 --
NM_006736chr211339 ------
NM_006750chr1637347 1824 1573 17480 --136
NM_006761chr17177 ------
NM_006764chr3193 ------
NM_006775chr652634 2100 1237 1074 98 22768 771 --12185
NM_006777chrX22749 1169 12010 12878 --
NM_006807chr1711344 ----127
NM_006823chr821368 471 --1193 --
NM_006827chr1463284 2289 2199 2178 844 604 ----23299 736
NM_006832chr14--1208 --1954
NM_006856chr1221004 65 --21116 389 --
NM_006874chr43843 779 33 1372 1895 --
NM_006885chr1664064 2959 2739 2647 1605 1296 34175 4158 419 --1246
NM_006892chr20------11171
NM_006908chr721074 940 1133 11229 --
NM_006912chr111600 32465 2243 215 --12135
NM_006920chr22400 162 1382 ----
NM_006931chr1232141 1626 1364 1559 21486 1356 --
NM_006940chr1221607 115 --1104 --
NM_006943chr2052858 2502 2492 2089 1304 --11060 --
NM_006946chr11182 --1142 --
NM_006981chr932860 2034 745 --12494 --
NM_007005chr931441 1165 445 --156 --
NM_007011chr1545978 5873 4367 383 12258 24830 1991 --
NM_007034chr1----1807 --
NM_007038chr2195963 5223 5012 4936 3935 2049 413 307 114 --12265 13918
NM_007050chr2037891 6748 5579 --25241 2643 --
NM_007067chr1751453 1365 1273 1144 272 --169 --
NM_007106chr1332786 1932 908 12773 1142 --
NM_007114chr312580 ------
NM_007124chr621338 280 11691 ----
NM_007146chr1732848 2260 2134 21924 492 12733 --
NM_007159chr321088 599 ----11511
NM_007173chr11175 --11533 --
NM_007249chr1399022 8283 7354 6872 3519 3271 2654 602 311 --37416 831 475 --
NM_007347chr1531981 1208 995 --13191 1607
NM_007349chr7----1289 --
NM_007372chr172346 243 ------
NM_007374chr14------1356
NM_007375chr142570 2279 1095 317 2451 198 ----
NM_012081chr543428 992 957 860 23705 3685 11266 --
NM_012100chr2192 ------
NM_012156chr2012252 --2702 119 --
NM_012158chr1321790 412 2577 512 ----
NM_012193chr11--31613 605 483 24833 3962 --
NM_012233chr221186 422 --1871 --
NM_012234chr323516 2872 12594 13663 --
NM_012247chr10------1179
NM_012259chr631068 978 246 ------
NM_012262chr175260 5215 4069 3783 1636 1091 171 14371 ----
NM_012281chr731672 384 196 ----1735
NM_012287chr354460 3289 2770 1562 1270 1827 ----
NM_012290chr23575 354 164 11396 --1252
NM_012297chr442393 2069 361 346 ------
NM_012301chr732218 897 344 ----192
NM_012309chr111718 1751 23600 3302 --
NM_012316chr134263 1512 1045 --11229 --
NM_012330chr1021312 308 --1225 11267
NM_012395chr773395 3351 3039 2113 940 801 41 12180 13403 1833
NM_012416chr931247 336 239 --1484 --
NM_012417chr172430 94 ------
NM_012453chr71615 --31375 1351 1273 --
NM_012464chr452856 1929 947 918 355 12703 12173 --
NM_013233chr231110 930 419 11345 133 --
NM_013262chr641443 1329 591 500 --11238 --
NM_013279chr1112238 179 1560 --
NM_013281chr2011462 --11218 11143
NM_013286chr373115 3058 2672 2644 1500 1429 294 138 --13340
NM_013396chr2131538 1511 1158 ----168
NM_013995chrX22238 207 ----128
NM_014011chr232576 589 130 --1148 --
NM_014023chr1042659 2402 796 496 ----1528
NM_014028chr633027 2685 838 23247 242 ----
NM_014048chr1664386 3393 1814 1192 694 234 34942 4339 116 33693 1126 1035 --
NM_014112chr864972 4241 2187 1427 1290 241 14520 --15488
NM_014117chr1632222 2176 2055 --22572 1732 --
NM_014155chr1162541 2455 2432 1054 824 815 16533 25651 100 --
NM_014181chr232909 1923 1074 12900 ----
NM_014240chr3----14132 13020
NM_014248chr22----165 --
NM_014263chr1031399 1332 130 1143 11173 --
NM_014268chr1821167 405 1416 1915 --
NM_014317chr101272 --1208 --
NM_014319chr1241962 1860 1309 30 --11951 --
NM_014372chr151863 1704 1525 607 61 21714 1570 ----
NM_014393chr8--32157 2000 1584 22178 1907 --
NM_014411chr741332 202 148 91 ------
NM_014423chr575586 5376 5158 5115 3896 3564 1909 150 14540 --
NM_014437chr1----1964 --
NM_014494chr16------12012
NM_014585chr2----128 --
NM_014586chr2134491 4420 67 --22943 341 --
NM_014646chr1843136 2579 1305 942 13271 ----
NM_014648chr32569 129 ------
NM_014660chr751109 337 205 171 144 ------
NM_014671chr7----11208 11231
NM_014682chr821606 62 --11616 --
NM_014686chr1932244 2056 1842 --12033 --
NM_014711chr1651330 1296 635 622 577 ------
NM_014720chr1041715 1525 561 47 ----1331
NM_014751chr811614 12013 --1643
NM_014752chr1121738 791 ----1547
NM_014755chr224101 1476 ----13750
NM_014772chr1873314 2815 2348 2270 1161 561 459 --1974 --
NM_014784chr121085 445 ------
NM_014787chr121874 1067 22196 57 12694 --
NM_014810chr11576 --23359 911 --
NM_014819chr511825 --11937 --
NM_014820chr31527 1133 21974 75 --
NM_014827chr12609 330 --11253 1245
NM_014830chr1242840 1153 1114 410 --1168 --
NM_014841chr63925 263 190 11089 --1435
NM_014873chr144035 1734 1132 479 --11237 --
NM_014876chr2231896 337 158 11866 ----
NM_014893chrY22327 887 ----1233
NM_014900chr21975 ------
NM_014903chr1231991 1814 100 11917 11670 --
NM_014909chr1443935 1462 1350 318 ----13147
NM_014912chr1053421 3086 1250 1171 281 13307 ----
NM_014913chr1811343 11527 2245 157 --
NM_014925chr121294 --11005 127
NM_014945chr531945 794 132 ------
NM_014949chr11199 --1962 --
NM_014962chr2022155 740 --11833 --
NM_014974chr1031236 564 433 --1460 --
NM_014978chr1021546 1276 ----1710
NM_014982chr1494687 4538 3891 3799 3288 1891 1545 714 261 1391 21153 177 --
NM_015015chr1921626 317 ------
NM_015017chr151061 910 809 283 257 --11274 --
NM_015025chr222683 930 12405 ----
NM_015026chr1234642 3891 971 13331 11187 --
NM_015032chr1352880 2035 486 472 405 ----11881
NM_015035chr2066246 5812 5727 1761 732 409 --1371 --
NM_015045chr104766 379 344 233 1704 --11825
NM_015075chrX1763 ------
NM_015076chr654491 4072 3174 1187 904 13290 22772 521 --
NM_015090chr146071 5356 2459 629 16100 ----
NM_015092chr1644340 3661 889 765 14192 ----
NM_015093chr64331 257 178 97 --161 --
NM_015129chrX21779 649 --11502 --
NM_015130chr441349 1155 1054 272 ------
NM_015155chr1033316 2114 767 12710 22990 2972 --
NM_015156chr1473414 3223 3191 3175 2813 2659 674 22594 651 ----
NM_015199chr322159 975 --22471 1189 --
NM_015252chr21812 --1901 --
NM_015265chr242669 1797 1727 860 ----12435
NM_015267chr1212088 ----1419
NM_015271chr432794 1601 1027 12701 23903 1527 12814
NM_015272chr1621833 1758 11963 --22146 2131
NM_015275chr1242113 2074 1797 1639 1123 ----
NM_015286chr1522354 1815 12498 ----
NM_015288chr532420 1423 353 23849 3462 --1509
NM_015291chr153333 3117 2633 826 383 --11054 --
NM_015296chr131161 --11114 --
NM_015299chr14133 --22918 1257 11424
NM_015310chr887900 7629 7536 6111 3315 2074 823 336 25396 2286 12520 --
NM_015317chr222116 1884 --12315 1295
NM_015326chr122338 52 12849 22943 1930 --
NM_015328chr72783 691 --13010 --
NM_015331chr1183 ------
NM_015344chr82284 24 --141 --
NM_015355chr1771813 1692 1430 540 273 205 110 ------
NM_015358chr211412 ----11277
NM_015361chr22767 82 ------
NM_015375chr133767 1451 301 14889 --1646
NM_015423chr1131753 1277 615 --11548 --
NM_015442chr3----125 --
NM_015443chr1721216 1034 1198 ----
NM_015446chr131377 1293 522 --1492 --
NM_015455chr564060 3969 2792 2683 1193 1174 23562 244 ----
NM_015508chr31993 ----11447
NM_015534chr121088 825 ------
NM_015553chr633799 1410 986 13918 13437 --
NM_015554chr1532068 1129 783 ------
NM_015564chr522754 2254 --1809 --
NM_015569chr111844 ------
NM_015576chr342935 372 345 227 12132 ----
NM_015577chr541530 1180 720 34 11606 1220 --
NM_015578chr192542 109 ------
NM_015630chr2----21138 222 --
NM_015652chr101648 --1587 --
NM_015691chrX72918 2894 2809 2527 889 561 504 ------
NM_015850chr832464 1661 356 --12418 11772
NM_015902chr8--1920 --198
NM_015906chr164419 3421 1555 930 370 186 14125 --11463
NM_015994chr141579 1272 1488 --
NM_016019chr72853 292 --1893 --
NM_016037chr12120 23 11127 1808 --
NM_016040chr131878 847 832 12045 12000 162
NM_016061chr251409 599 580 559 312 --174 11668
NM_016072chr1242377 873 673 466 --12271 11778
NM_016076chr153065 2424 2359 1038 265 23200 3058 23125 1181 --
NM_016083chr623900 126 11131 1670 11120
NM_016126chr1158 ------
NM_016131chr21853 --1391 --
NM_016133chr211668 --1354 --
NM_016206chr3138287 7993 7422 7087 6351 6005 5970 2894 2366 1530 324 125 67 16566 37933 6156 2967 --
NM_016231chr1731355 254 162 ------
NM_016248chr1343532 2610 795 188 --13376 --
NM_016252chr21717 ----1896
NM_016269chr421210 1137 --21123 412 --
NM_016271chr1822129 945 --11646 --
NM_016287chr111474 ------
NM_016322chr973165 2777 2170 1261 1172 788 267 12446 ----
NM_016396chr1533052 1029 465 --1407 --
NM_016436chr2021091 976 1850 22120 1678 --
NM_016530chr1551625 1591 1490 893 559 43433 3069 1443 1271 24015 3598 --
NM_016531chr4123676 3365 2807 2796 2682 2620 1523 1353 1131 772 542 320 --11152 13198
NM_016570chr12------1186
NM_016577chr384443 4117 3765 3331 2843 2820 1816 260 23775 1520 21484 194 13799
NM_016578chr11------1500
NM_016588chr61194 ----1754
NM_016607chrX21680 474 --1303 --
NM_016631chr21------2791 216
NM_016644chr51445 1360 ----
NM_017508chr1142118 2020 1854 1651 ------
NM_017533chr17160 ------
NM_017542chr11526 --21810 1264 --
NM_017577chr321500 438 --11661 --
NM_017580chr1032124 1805 815 --11479 --
NM_017633chr623429 2595 1801 1261 --
NM_017637chr9106757 5945 3055 2938 2891 2094 1894 1587 727 619 27418 5726 29317 7799 15992
NM_017643chr1732564 2486 365 --1384 --
NM_017644chr373477 3422 3220 1619 1606 1156 223 24242 373 13701 --
NM_017658chr1474573 4238 3781 3392 3256 3156 1458 13905 ----
NM_017752chrX51787 445 316 96 54 --1651 --
NM_017798chr2051182 488 473 395 222 --21199 956 --
NM_017799chr1441637 1429 1307 208 21299 495 ----
NM_017801chr362561 2334 1820 1759 457 23 --22058 303 22042 312
NM_017848chrX54639 3891 3743 3558 308 11310 23867 2992 --
NM_017849chr221173 818 12076 32309 2198 2187 --
NM_017902chr1075227 5042 4727 3995 1400 314 286 13583 1393 --
NM_017907chr111502 ------
NM_017964chr2------1329
NM_018013chr622921 60 1669 21093 138 --
NM_018014chr211234 --2268 68 --
NM_018030chr18----1384 --
NM_018043chr1121073 492 11264 1999 --
NM_018086chr251641 1493 1347 716 347 11420 --11727
NM_018094chrX1144 ------
NM_018098chr311077 --1243 1173
NM_018121chr1063075 2941 2637 2511 644 348 ------
NM_018133chr331488 623 438 --1646 --
NM_018200chr1522235 281 12407 1418 --
NM_018243chr464013 3849 3806 3602 1022 297 13886 23511 286 --
NM_018254chr121889 739 ------
NM_018263chr242255 1047 964 128 2794 260 ----
NM_018320chr1131238 1025 182 ------
NM_018362chr1131195 498 127 1267 12957 11279
NM_018364chr131158 919 616 --11394 11640
NM_018374chr784648 4191 4074 3896 3216 1073 983 557 --25212 4511 --
NM_018388chrX31119 985 392 1280 ----
NM_018403chr32961 673 1705 1836 --
NM_018444chr822086 805 --12049 --
NM_018449chr91495 --1503 --
NM_018462chr31257 --1573 --
NM_018482chr842518 2494 1702 394 ----194
NM_018489chr121512 712 --21948 335 --
NM_018490chr1151563 1509 626 353 112 ------
NM_018553chr1741473 1395 1342 632 --21868 396 --
NM_018557chr2--1404 --11385
NM_018566chr165073 4635 4248 3728 1766 1707 44345 3981 3895 853 ----
NM_018682chr72179 68 ----1693
NM_018685chr73805 442 41 --31090 1080 181 --
NM_018700chr521484 291 --21399 99 --
NM_018704chr1--11439 21785 804 --
NM_018715chr141402 1393 813 685 --148 --
NM_018718chr732057 1911 933 --11676 --
NM_018834chr51716 1738 ----
NM_018898chr532380 2118 1998 --11896 --
NM_018945chr643592 3314 887 187 11279 11347 --
NM_018963chr2121170 438 ----11145
NM_018970chr721081 313 ----1779
NM_018976chr1242814 2257 548 312 ------
NM_018999chr1074685 4133 3809 3706 1469 1320 1093 24316 4274 14240 --
NM_019024chr22330 34 --1366 --
NM_019063chr221858 1729 --21465 386 --
NM_019094chr12103548 3348 3111 2747 2457 1270 1030 976 616 332 21049 544 12537 --
NM_019613chr1711064 --21210 1204 --
NM_020122chr244296 4095 1012 640 1115 56019 5660 1426 633 105 --
NM_020177chr553273 3244 2506 1235 27 23337 627 1834 --
NM_020182chr2032987 2969 2797 --1986 --
NM_020184chr22689 76 12285 ----
NM_020199chr521090 239 1145 1340 --
NM_020336chr2052955 1491 1077 1061 507 1588 --21211 520
NM_020342chr232597 2582 38 --12294 --
NM_020346chr1111271 1385 11708 --
NM_020348chr1051902 1816 613 595 145 --12666 --
NM_020381chr61208 1458 11711 --
NM_020382chr1231609 1046 1029 ----1171
NM_020390chr344900 4590 511 71 24527 4446 ----
NM_020403chr1341756 1320 482 398 ------
NM_020432chr752109 1877 765 733 73 11494 ----
NM_020456chr1361665 630 601 552 356 38 ------
NM_020474chr1811387 ----1377
NM_020482chr62243 45 ------
NM_020640chr312090 ----1841
NM_020717chrX53333 1997 1854 1714 1521 ----11703
NM_020718chr1696460 6448 5863 2425 1435 1139 1129 950 652 36272 6054 1104 24024 1990 --
NM_020752chr1022194 92 --1724 --
NM_020772chr17148517 8497 8215 7844 7217 7006 6673 6036 5904 2739 2699 2267 784 280 27529 3414 1359 --
NM_020774chr1865614 5272 5207 4719 4329 2116 24457 455 14983 --
NM_020783chr18--1333 1485 22196 753
NM_020794chr141592 1500 1018 209 ------
NM_020805chr1841712 1372 730 512 --21720 1597 --
NM_020814chr231351 1305 883 ------
NM_020824chr102747 64 ----145
NM_020830chr24754 658 562 411 --12897 --
NM_020845chr1232228 1690 195 ----12522
NM_020850chr1612970 --1585 --
NM_020871chrX1791 1903 --12334
NM_020920chr14----1374 --
NM_020962chr1542284 1797 1682 793 ------
NM_021038chr311052 --11166 --
NM_021097chr263055 2555 1234 1221 971 88 --12035 11081
NM_021190chr161271 1190 472 378 139 47 ------
NM_021192chr2------1442
NM_021215chr2062417 1640 1588 1511 754 501 --22061 1649 --
NM_021255chr1453608 3399 3319 2958 416 --21223 1020 --
NM_021638chr484481 4206 3848 3626 3057 1286 1054 628 1696 ----
NM_021728chr141637 ----1218
NM_021813chr664821 3988 3886 2137 748 602 1334 ----
NM_021914chr142638 570 11534 2607 195 1231
NM_021961chr1156879 6422 5270 2838 1269 12051 26120 4604 --
NM_021964chr356281 6270 6184 5633 200 45807 1546 1501 1002 36190 4996 4566 --
NM_021977chr663534 3180 2867 703 490 240 --12529 --
NM_022073chr1421421 451 ----1552
NM_022075chr13839 212 142 ------
NM_022130chr521185 1018 --1253 --
NM_022166chr1655755 5003 1651 1641 1293 --13924 16318
NM_022337chr112626 280 --2553 238 1226
NM_022351chr863668 3636 3282 671 395 327 13419 ----
NM_022459chr1356288 4295 1536 360 187 --15538 1210
NM_022475chr42533 76 1727 157 --
NM_022552chr21836 ------
NM_022658chr1221270 138 --189 --
NM_022735chr141775 1558 1546 1251 --11800 11530
NM_022763chr33846 530 451 1344 11209 --
NM_022781chr922749 1108 --1733 11300
NM_022826chr221055 851 ------
NM_022841chr1512097 ----1271
NM_022843chr13----21452 346 --
NM_022893chr221172 174 22529 2047 --12544
NM_022912chr242806 2019 1933 336 12621 --12420
NM_023012chr123717 550 54 ------
NM_023074chr192888 53 --1482 --
NM_023076chr1652752 2706 2235 515 194 --12127 2186 128
NM_024071chr142485 225 ------
NM_024312chr121291 11471 1251 --
NM_024334chr3------11410
NM_024513chr312822 21479 245 --162
NM_024524chr343142 853 755 269 ----12783
NM_024529chr11878 --1142 --
NM_024557chr1121555 1522 1112 1171 --
NM_024594chr531173 81 35 1365 ----
NM_024612chr1741161 834 419 182 --1305 --
NM_024613chr841845 1475 743 327 ----1512
NM_024665chr333390 1583 1557 23919 188 11681 --
NM_024692chr231862 1680 408 11216 11435 --
NM_024749chr122233 1894 --1770 11993
NM_024761chr964893 4576 4383 3653 1100 393 15356 ----
NM_024829chr121105 ------
NM_024896chr982551 2504 2493 2433 2130 1730 340 68 12368 1710 12152
NM_024900chr4--1800 21764 530 1600
NM_024947chr3109480 8564 7913 7708 6781 5954 3770 1955 1699 420 32068 730 244 38086 3111 3072 --
NM_024993chr221151 523 ------
NM_025054chr843942 699 390 216 --13206 --
NM_025134chr1652368 2015 982 760 431 --1586 --
NM_025135chr18------1320
NM_025146chr362717 2361 1016 710 291 38 --11000 12737
NM_025191chr1------11110
NM_025222chr322909 455 23043 1025 2777 239 --
NM_030627chr543487 3475 3339 176 11054 ----
NM_030797chr21117 ------
NM_030805chr221158 864 --31125 128 34 --
NM_030806chr1119291 8675 6802 3481 3403 2817 2469 2137 1370 982 204 39423 6389 1287 --11781
NM_030915chr212369 ------
NM_030940chr931462 1203 474 --183 --
NM_031216chr1841451 867 317 253 --22111 539 --
NM_031296chr432740 162 122 ----12747
NM_031483chr2053204 2648 1437 1265 592 12689 13466 --
NM_032144chr221648 728 ------
NM_032145chr61109 ------
NM_032153chr312344 --1711 --
NM_032160chr1824357 195 --31460 1344 810 --
NM_032221chr2061847 1581 1372 750 232 63 21401 431 --11432
NM_032291chr11391 ----1429
NM_032352chr142367 42 ----11147
NM_032410chr821094 376 ----155
NM_032439chr1031336 640 455 --1116 --
NM_032440chr1042567 2430 2171 2027 12154 11845 1410
NM_032449chr12951 420 --11096 --
NM_032457chr473909 3398 2686 2390 421 203 163 22859 657 --12492
NM_032509chr822051 1937 --12331 --
NM_032538chr642819 2472 2224 1824 12430 1950 --
NM_032682chr333122 2703 747 --1771 --
NM_032727chr1011123 ------
NM_032810chr1041370 1328 1185 564 1158 11002 --
NM_032833chr131002 555 300 --1987 --
NM_032840chr121193 --1147 1479
NM_032873chr1144300 3322 1780 1132 1905 13653 --
NM_032968chrX11374 13386 32683 1007 581 --
NM_032973chrY11374 13381 32678 1007 581 --
NM_033055chr121130 992 1187 --1856
NM_033132chr1321680 1537 --11870 --
NM_033224chr716561 35059 2861 1572 --11015
NM_033225chr833136 3110 2842 --12883 1629
NM_033389chr1773913 3854 1870 1628 1197 1152 1118 24872 1065 14630 11674
NM_033426chr14--11081 3314 56 24 --
NM_033495chrX2888 312 151 ----
NM_033505chr276619 6270 4980 4953 2352 2163 1502 ------
NM_033512chr893103 3014 2200 997 769 734 531 421 258 1190 1935 --
NM_033542chr2062060 1368 1354 592 531 150 --31735 395 297 --
NM_052864chr43442 423 106 ----12002
NM_052879chr1243991 1402 877 568 --14001 --
NM_052978chr14----11878 --
NM_057175chr442571 2478 466 62 11012 --1312
NM_057749chr851226 911 338 305 196 ------
NM_058170chr141632 1235 501 223 11599 1360 --
NM_078469chr10----1390 --
NM_080546chr941512 603 537 202 ------
NM_080723chr611038 1440 11084 11194
NM_080862chr311330 1506 161 1935
NM_080872chr854092 3801 1037 741 406 24076 2653 --12809
NM_080927chr352926 2501 1292 1211 203 12964 22582 101 11125
NM_133264chr1753767 3338 2717 973 332 12572 13213 --
NM_133265chrX63268 3215 1333 1183 1046 269 23067 2357 ----
NM_133329chr231611 1336 101 1461 ----
NM_133468chr75982 739 633 560 339 ------
NM_133496chr133551 3369 2937 1511 13345 11236
NM_138426chr742364 1754 761 212 --11861 --
NM_138444chr1334316 4162 3633 23162 1933 ----
NM_138694chr653256 3015 1337 762 501 22300 908 13519 1432
NM_138779chr13------1182
NM_139015chr1241711 1665 1610 483 --1291 --
NM_139126chr62896 867 --1930 --
NM_144723chr5------1558
NM_144778chr13159 --1470 1911
NM_145011chr102740 347 12193 11995 --
NM_145804chr1121347 282 1496 1138 11080
NM_145808chr722578 843 13045 173 --
NM_148894chr4----11218 --
NM_152265chr121581 405 11344 193 --
NM_152291chr4----21049 30 --
NM_152400chr441976 1901 1718 149 ------
NM_152409chr523463 2359 --12245 --
NM_152512chr223565 195 121 ------
NM_152519chr211472 --11872 --
NM_152556chr712155 31994 490 211 1228 12383
NM_152594chr1522190 1983 1200 --1606
NM_152624chr586958 6324 5691 2919 2553 2071 1530 316 31071 918 445 --1356
NM_152625chr5----175 --
NM_152641chr1242911 952 730 237 --160 --
NM_152688chr62699 676 ----1921
NM_152734chr644782 4727 4373 994 14700 --25363 4634
NM_152745chr72404 120 --162 --
NM_152756chr543944 3530 857 620 13931 23507 3209 --
NM_152758chr833014 2006 21 --12249 --
NM_152787chrX43456 3400 3154 1170 13167 ----
NM_152835chr142868 2859 2641 2588 ------
NM_152994chr22404 232 --1413 --
NM_153020chr61468 ------
NM_153246chr611989 ------
NM_153267chr9----1197 --
NM_153332chr832842 2570 188 1330 ----
NM_153335chr1711415 --1509 --
NM_153341chr1------1351
NM_153354chr5------1208
NM_153607chr562927 2414 1941 498 274 44 ------
NM_170606chr7----2753 728 --
NM_171998chrX22272 2071 ------
NM_172070chr22670 562 --12264 21745 1653
NM_172212chr1146 1225 2426 136 --
NM_173156chr131603 648 116 --11934 --
NM_173199chr92464 416 ----1160
NM_173468chr465898 5695 5601 5106 3933 1480 12275 24852 1189 --
NM_173469chr1511230 --1139 --
NM_173475chr1641679 1191 553 388 ------
NM_173478chr171792 1187 --11070
NM_173519chr842047 2015 631 433 1621 2651 145 --
NM_173552chr352428 768 679 560 529 199 2996 230 --
NM_173560chr61181 ----1554
NM_173582chr11126190 5981 5904 5596 5490 4358 4243 4117 2415 1981 925 477 1561 24141 2424 --
NM_173595chr1235285 1707 853 --14070 --
NM_173614chr162314 144 ------
NM_173644chr20----11452 --
NM_173808chr111011 --11492 --
NM_173825chr332785 1970 259 1522 23100 473 --
NM_173826chr311066 --11091 11743
NM_173851chr883796 3497 3286 1599 1517 1371 1106 109 22497 585 53963 3955 3406 3193 2545 --
NM_174909chr53912 813 682 --1224 --
NM_175607chr331517 1400 238 11262 11732 --
NM_175854chr1372727 2603 2516 2265 640 554 207 --1150 --
NM_175907chr1832867 2833 2599 --12754 --
NM_178011chr1043084 2185 1993 481 1948 ----
NM_178140chr532715 565 516 1413 12423 --
NM_178313chr231984 1370 748 11835 ----
NM_178812chr821437 1400 --1556 --
NM_178831chr772986 2636 2415 2398 1935 157 103 ------
NM_181354chr841205 1061 293 97 ------
NM_181504chr544049 3708 1046 633 13384 13358 21586 604
NM_181670chr123962 409 125 --1975 --
NM_181672chrX21562 470 --1829 --
NM_181714chr631965 1412 634 --21993 1459 1700
NM_182503chr644726 3947 596 144 22113 1429 21807 1189 13587
NM_182511chr1821366 568 ----11276
NM_182756chr22633 532 --1248 --
NM_182765chr1022157 1888 1287 --12094
NM_182830chr142395 344 1710 1530 --
NM_194247chr274480 3526 3412 3246 1378 1341 54 14258 11523 1197
NM_194272chr1531049 992 839 --1422 --
NM_194282chr42744 538 23030 425 ----
NM_194285chr1152274 1256 1106 713 540 22639 2427 2146 132 --
NM_194291chr872696 2307 1000 892 471 323 284 12678 12641 2522 65
NM_197941chr562905 2575 2327 1864 400 31 12807 ----
NM_198243chr151882 ------
NM_198273chr512989 12859 --1855
NM_198467chr7------1102
NM_198511chrX21418 644 11282 11372 --
NM_198859chr364790 1871 1633 1138 667 126 1597 --24802 3133
NM_201280chr621610 448 --11033 1411
NM_203364chr1131125 1017 48 --1179 --
NM_203403chr9------1192
NM_203446chr2142822 2414 2394 2111 --176 13018
NM_203459chr122347 129 1575 --22582 2422
NM_203463chr254094 3659 1716 826 409 13989 24945 1156 --
NM_205848chr121839 287 12801 22749 2119 --
NM_206853chr633562 1475 688 13335 ----
NM_206933chr14823 428 397 268 12805 11129 --
NM_207043chr111983 --31893 1840 1752 --
NM_207303chr1024168 54 21607 960 1671 --
NM_207352chr452516 2473 2023 396 61 1534 2713 233 --
NM_207372chr103859 705 268 --12247 --
NM_207406chr496460 5856 4629 4281 4212 1587 1423 1332 951 11659 55265 2237 2231 94 72 --
NM_207422chrX31312 268 156 1428 1134 1519
NM_207429chr1112238 --22261 423 --
NM_207577chr1142360 2287 557 377 ----1723
NM_207578chr1------1308
NM_213604chr19----2670 343 1185