TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-542-5p
miRNA Sequence: UCGGGGAUCAUCAUGUCACGAGA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000125chr673582 3570 1559 1437 901 625 584 1841 31202 269 37 --
NM_000210chr222329 505 167 --1277
NM_000278chr10112225 2205 1990 1742 1703 1663 1631 1598 905 256 58 1913 1544 --
NM_000337chr5126502 6441 6244 4460 4294 4279 1258 1231 933 331 283 205 15117 24840 1284 --
NM_000430chr1783486 3306 3097 3041 2703 2335 1343 837 ------
NM_001001890chr2153995 2811 758 745 625 --1313 --
NM_001003676chr116797 780 645 365 350 338 ----1387
NM_001006636chr23678 251 178 --1186 --
NM_001009555chr421436 607 ----1681
NM_001024647chr1267417 5729 5195 5071 3083 569 36410 4884 33 11087 --
NM_001024937chr177610 564 510 219 179 88 64 ----1575
NM_001025077chr10136912 6482 6119 2901 2890 2544 1753 1447 1129 1050 269 152 22 ------
NM_001029896chrX1236 ----1327
NM_001040056chr162665 659 2765 598 --1635
NM_001040151chr1194393 4024 3636 3567 3395 3222 3209 1486 775 1487 --14605
NM_001040152chr773426 1704 1269 650 345 61 40 13643 1853 --
NM_001040284chr1655272 5256 4492 3614 1310 15245 --1855
NM_001042404chr131933 1606 1541 1392 1118 --
NM_001042494chr1553652 3521 3330 595 207 11006 23491 475 --
NM_001042555chr1264141 3545 3197 3031 1234 765 --23533 223 --
NM_001042599chr2107708 7610 6718 6309 5542 2980 2160 2026 1580 600 --27138 447 --
NM_001100108chr1128241 7982 7850 6781 6651 5840 5174 2484 2149 1781 1570 298 17079 22340 2096 1136
NM_001390chr1853258 2808 2429 955 313 --1333 --
NM_001420chr19132888 2832 2814 2667 2513 2459 2371 2149 458 220 208 137 33 ------
NM_001421chrX101686 1433 1353 1324 1260 609 553 496 356 127 --2395 180 --
NM_002501chr19174121 4058 3884 3609 3209 3111 3093 3049 3008 2988 2974 2899 1648 1225 540 398 120 182 13019 13253
NM_002556chr1161980 1949 1857 1780 1724 1576 --12035 --
NM_002594chr2032429 2051 56 11540 --12340
NM_002595chr1211677 --1100 1648
NM_002699chr1101374 1140 1067 955 538 430 422 384 283 159 11047 ----
NM_002834chr1211603 13353 --13680
NM_003012chr821116 714 12466 33129 2963 149 --
NM_003076chr1281602 1536 1408 1370 1045 680 575 166 11683 ----
NM_003253chr2121534 88 --21681 491 1768
NM_003373chr1031259 736 502 ----11869
NM_003404chr2031752 1446 58 --11968 --
NM_003410chrX42414 2044 795 562 ----1251
NM_003482chr1262399 976 502 392 195 33 155 --11064
NM_003590chr23955 636 229 --1204 --
NM_003743chr222004 1759 --11474 22304 1787
NM_003877chr12----1746 144
NM_003988chr10102302 2282 2067 1819 1780 1740 1708 1675 333 135 --1621 --
NM_004588chr1194073 2944 1547 677 292 260 150 93 49 ------
NM_004745chr8226952 6246 6224 5008 4898 4826 4734 4626 2425 2400 1882 1779 1678 1668 1584 1485 626 486 421 124 109 43 1514 12326 11913
NM_004992chrX187909 7782 7751 6359 6130 5976 5926 5920 5700 5282 3087 2816 2228 1789 1511 1352 1301 1281 194 18515 22514 2507
NM_005116chr2083914 3240 3130 1684 989 976 519 187 22921 385 24092 3539 --
NM_005339chr463634 3523 850 706 602 425 1246 1156 --
NM_005652chr1671162 1118 1022 1002 913 814 308 1983 ----
NM_005880chr16------11385
NM_005955chr163874 2082 1703 1590 1195 117 --14939 --
NM_006772chr671692 1679 1324 1220 305 299 120 21209 109 11396 --
NM_006950chrX6804 723 356 204 102 87 --130 1144
NM_007359chr1771607 1379 1331 649 631 523 470 11133 ----
NM_012095chr1043451 2901 1064 447 --11211 12940
NM_012316chr1125351 3880 3804 2205 1962 1643 1284 901 744 403 156 87 --11070 --
NM_012395chr753001 2583 2107 1081 124 --13452 --
NM_013238chr1351804 1746 1660 272 189 ----11436
NM_013309chr1522144 1024 1829 --195
NM_013411chr172750 2586 2404 2240 914 600 488 21814 1718 157 --
NM_013433chr1971661 1544 1429 1348 751 715 143 1479 ----
NM_014752chr1151944 1798 1564 1485 115 --1621 --
NM_014758chr1152050 2003 1637 949 205 1321 11924 --
NM_014872chr932172 1638 1623 --1386 1208
NM_014909chr1493823 3518 3225 2658 2478 1104 919 775 411 13945 ----
NM_015051chr952937 2852 1342 1012 235 2973 147 ----
NM_015111chr5113545 3228 2870 2697 2678 2663 2625 2549 1037 854 783 11427 22897 1098 --
NM_015265chr212498 1638 --12128
NM_015272chr1661852 1606 401 328 185 25 ----11628
NM_015299chr1493817 3746 3591 3531 3399 1359 1343 820 376 13096 1970 --
NM_015315chr5103141 2680 2663 2110 1331 1182 964 551 380 195 --11120 12349
NM_015328chr762546 2285 422 365 297 281 ------
NM_015576chr352308 885 869 453 291 12718 ----
NM_016169chr10123061 2608 2483 1302 1171 1124 1010 946 645 594 262 86 ------
NM_016255chr653063 2193 1133 879 325 --167 --
NM_016448chr151708 1698 720 699 424 1203 11850 11303
NM_016530chr1543486 3098 2499 721 --1979 1614
NM_017409chr125830 724 615 44 28 191 ----
NM_017420chr1432871 2709 2532 ----12842
NM_017633chr6------11485
NM_017848chrX74475 4397 3976 3860 3126 278 154 14333 --11533
NM_017849chr283087 2765 2085 1945 969 937 715 25 1903 1168 --
NM_018181chr18--1516 129 21287 160
NM_019067chrX64845 4814 4048 3757 1553 693 185 --11150
NM_019087chr531357 335 246 ----11678
NM_019594chr9101561 1441 1424 1350 1344 1110 399 366 278 207 --11075 --
NM_019891chr1--11026 --11005
NM_020144chr71181 1672 1172 --
NM_020337chr442965 2570 2264 1183 1277 12992 1907
NM_020405chr1744016 3248 1551 1263 2817 685 14466 --
NM_020772chr1785980 3446 3082 2530 2297 2284 1526 929 --1251 --
NM_020795chr17121977 1970 1714 1530 1292 1253 730 417 276 146 38 28 --21701 1269 --
NM_020899chr1792377 1843 1606 918 558 260 177 79 70 21664 45 12509 --
NM_021038chr3------12267
NM_021079chr17142870 2526 2345 2246 2217 2195 2039 1181 994 843 768 753 236 212 12500 1101 --
NM_021097chr24865 726 461 173 --22174 573 --
NM_021202chr2092585 1966 467 457 374 275 209 161 67 2360 132 32917 282 46 --
NM_022912chr272883 2766 2710 841 835 680 673 --143 --
NM_023067chr351113 1033 421 412 187 1220 --11343
NM_024787chr85928 891 739 283 208 --1863 --
NM_030640chr124324 276 231 61 --1728 --
NM_031306chr11101 ----1161
NM_031445chr252880 2400 2391 662 408 13316 --1353
NM_032449chr142673 2160 1092 514 ----1815
NM_032968chrX31566 1392 231 --14025 --
NM_032973chrY31565 1392 231 --14017 --
NM_033225chr852536 2313 1993 972 772 12613 --12302
NM_033315chr17112017 1735 1648 1380 880 729 667 646 490 450 392 ------
NM_133265chrX43572 2596 1322 1162 ----12500
NM_139167chr82578 362 ----1469
NM_152594chr1522332 1447 ----11944
NM_153620chr771416 1363 637 428 352 315 274 --1181 --
NM_172071chr167016 6156 6056 5824 5521 593 16422 --15512
NM_173595chr12225214 5170 5146 5080 4984 4724 4345 4151 3636 3434 3361 2070 1846 1561 1394 1222 724 500 422 392 358 337 --1445 --
NM_174909chr5------1100
NM_182485chr423645 3388 --22839 1028 --
NM_183397chr20134636 4302 4208 3896 3849 3179 1864 1676 1301 1242 679 195 56 ----134
NM_198859chr374936 4648 3512 3365 1560 886 322 --1848 --
NM_205848chr162414 2399 2244 2044 739 726 ----1103
NM_207043chr141822 1816 1610 207 --11807 12036