TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-543
miRNA Sequence: AAACAUUCGCGGUGCACUUCUU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000264chr9103185 3041 2928 2842 2787 1353 1186 1115 262 218 32798 2458 488 22326 2266 --
NM_000297chr431516 1375 395 ----22029 576
NM_000332chr6137112 6805 6249 5597 5534 5184 5163 5132 4905 1919 1492 1329 188 21866 876 16676 --
NM_000461chr3124522 4369 3972 3710 3093 3007 1416 1398 1051 646 544 394 14454 ----
NM_000575chr261035 1025 727 694 175 35 11075 1132 11110
NM_000618chr1296573 4889 4843 4596 4453 4291 2512 2067 241 15742 ----
NM_000719chr12105805 4184 2643 2398 1732 1553 1534 1169 775 44 26688 5175 1816 --
NM_000793chr1484903 4684 4497 3441 3156 1966 1137 528 --14747 15082
NM_000809chr4158518 8467 8377 8156 7607 7561 3481 3300 2267 2244 2006 1976 1570 61 48 27136 6898 ----
NM_000868chrX72645 2565 2387 770 729 241 114 12363 1591 12078
NM_000875chr15106903 6013 5694 5652 5272 4892 4723 4337 2266 1686 11796 26556 176 15048
NM_000926chr11199418 9368 8771 8197 8102 6697 6616 6282 3384 2957 2808 2402 2386 2353 2210 2122 1265 564 89 18894 28458 189 --
NM_001001419chr5114814 4147 3969 3829 3387 3335 1267 807 619 555 204 11945 24970 3533 --
NM_001001664chr283685 3581 3042 2701 1612 1441 1372 614 34055 3393 2849 1970 --
NM_001001668chr1974297 2767 1375 1342 1324 1129 875 11137 11684 --
NM_001003712chr1273797 3606 3159 1346 850 244 60 33638 2619 352 ----
NM_001008392chr363520 3475 2861 2299 701 126 12810 12519 1414
NM_001009554chr4104649 4572 4400 4022 3896 3828 3593 3285 2981 1705 11188 11461 --
NM_001011666chr7176163 6089 5788 5377 5202 4222 2506 2367 2132 1952 1748 1586 1237 858 837 713 149 56570 6242 4991 4138 4080 36046 5455 1785 --
NM_001012423chr1582863 2702 2172 2053 1900 862 681 195 21950 365 --1100
NM_001013620chr12178374 8309 7438 7372 7327 7175 7151 6280 6205 5518 3167 3142 2640 2184 2041 1062 262 38411 7428 5737 1288 --
NM_001014797chr1097898 7346 6447 5661 5242 5125 1557 1125 899 46596 6397 6202 3233 1128 --
NM_001018089chr1583469 3229 2771 2458 1471 1172 393 49 13861 1683 1484
NM_001023567chr1562495 2255 865 427 414 195 1365 1381 1100
NM_001024647chr12117619 7257 6158 4689 2417 1502 1267 640 334 282 224 1272 27593 7235 --
NM_001025356chr1272783 2344 2108 2058 1164 725 75 42972 2930 2519 228 ----
NM_001031804chr1643783 3618 1288 362 44203 3228 1625 691 --23286 1540
NM_001037165chr778818 8789 8558 6808 6482 3059 330 --1527 27697 7174
NM_001037174chr221683 580 1427 32028 1660 402 1347
NM_001039547chr3126833 6553 6365 6254 5264 2388 2369 2192 1952 1182 1047 984 17996 23230 3063 16791
NM_001039580chr494277 4093 1999 1985 1889 1238 596 468 150 55116 4173 3989 3897 3161 14030 --
NM_001039618chr11125141 4771 4537 3994 3865 2337 1608 1550 931 464 155 136 25826 4676 15525 --
NM_001039840chrX95648 5540 5192 4901 2414 1990 1211 690 279 25435 1888 ----
NM_001040284chr16104481 4331 2209 2001 1922 1871 1482 779 345 286 55614 4012 3875 3644 1858 14226 14770
NM_001042355chr1664441 2025 1963 1152 350 102 34395 4047 1013 43906 1168 1108 1062 --
NM_001042413chr9104085 4055 3451 3403 1460 903 562 130 93 42 11545 23959 3081 --
NM_001042493chr671989 1960 1700 740 401 321 71 51349 807 796 757 726 ----
NM_001042555chr12164384 4237 3794 3439 3427 3384 3231 3084 3024 2974 1482 1275 912 872 595 421 22998 567 ----
NM_001042599chr267266 7123 2798 2210 726 211 37549 7481 1796 12959 --
NM_001042603chr12114626 4616 4156 3952 2035 1943 1913 1662 1070 336 244 14905 32007 1518 92 --
NM_001099678chr386196 5829 5315 4665 4268 4118 1945 106 32302 1447 1426 --14537
NM_001204chr297155 6436 6413 6036 5892 5492 792 509 62 46046 1882 1643 1029 ----
NM_001259chr785734 5182 4758 2351 2073 1932 854 401 24140 476 --13868
NM_001356chrX72368 2206 2153 1961 1910 994 988 12035 11904 --
NM_001432chr443550 1063 755 135 23603 96 --13760
NM_001616chr292881 2695 2398 2202 1342 750 260 148 104 21263 119 42334 2141 496 307 --
NM_001621chr762921 2812 2389 901 792 583 32979 2932 474 1966 11190
NM_001918chr1118360 7265 6667 6431 6093 6029 2901 1299 1164 249 224 15802 --17532
NM_002025chrX118624 7342 7218 6982 6742 6722 2943 2386 1464 731 530 29038 7280 12249 16198
NM_002214chr775634 4171 4120 1832 1645 1588 275 --31425 1066 978 1798
NM_002264chr3164968 4919 4824 4543 4237 4087 3902 3862 3532 1826 1683 1470 953 638 440 99 25058 1723 24867 4130 --
NM_002270chr5155430 5400 5235 5049 4796 4760 4344 4223 4177 2011 1697 1458 1373 265 194 41893 1317 843 88 --15676
NM_002310chr5105475 5349 4581 4570 4028 2364 1757 565 147 56 26544 6139 45976 4815 1803 1041 25807 4693
NM_002430chr221818 32379 559 251 1805 22516 2253
NM_002581chr985444 5135 4754 3922 1645 1158 1101 320 21143 1115 ----
NM_002610chr292783 2731 2618 2336 2263 2200 2192 2054 1953 ------
NM_002645chr1163115 2641 2301 746 604 402 22767 1923 --1439
NM_002655chr894891 4868 4265 4002 3804 3336 1772 519 397 45267 4656 4306 1202 14397 13510
NM_002834chr1283868 3836 3806 3224 3198 1551 811 794 ----13986
NM_003112chr793203 3008 2346 2234 1122 888 860 796 158 32917 2839 523 ----
NM_003262chr3115254 5141 4862 4844 4715 4004 3564 3226 1551 1360 981 21493 1376 --11875
NM_003274chr21112694 2378 2130 2099 1969 1171 1084 959 718 689 131 12238 22170 1861 --
NM_003298chr3135829 5741 5557 5518 5122 4049 2375 1885 1502 1031 1018 666 195 21862 1283 14744 --
NM_003463chr693226 2517 2425 2202 2143 1213 1173 797 717 22087 1140 ----
NM_003472chr651322 1173 1125 1068 78 1574 --21378 149
NM_003566chr1242783 2439 1248 848 22661 2411 --1143
NM_003590chr2123818 3683 3561 3282 2892 2746 2483 1406 1284 381 357 244 33171 2929 1344 --13103
NM_003799chr1894159 3911 3590 3219 680 470 463 322 237 33858 3169 1279 13927 --
NM_003913chr6114121 4063 4045 3713 3593 2955 1556 1155 1141 985 878 43348 3326 572 163 13881 22787 606
NM_004136chr1573017 2456 2267 1172 1156 974 124 13205 12950 1879
NM_004171chr1189640 9394 8811 7344 6279 3449 579 414 36991 3009 2263 27449 6222 16956
NM_004293chr983479 2638 2466 1132 691 638 610 344 33336 3241 810 --11322
NM_004501chr1103541 3286 3247 2985 2940 2847 2510 634 309 231 24036 406 13274 --
NM_004719chr12112608 2400 2391 2005 1846 1798 1072 580 465 244 140 --12757 --
NM_004745chr8126826 6776 6559 6413 5918 5653 4730 2486 2342 1876 1456 1038 15589 66621 6087 4759 4385 1953 721 26331 2573
NM_004815chr163366 3163 1714 1210 900 562 13072 44756 412 173 76 --
NM_004852chr181813848 13375 13079 11982 11734 11554 11009 9818 5472 5454 5040 4919 4900 4704 4518 3444 3302 2267 19831 33586 2330 1129 111935
NM_004857chr1454553 4158 3441 1333 481 34815 4655 4623 23936 3274 --
NM_004985chr1264447 4261 4137 3812 1075 518 23353 1448 34389 3488 317 --
NM_005065chr1495363 4827 4736 4576 4124 3794 3663 1750 503 25291 4261 25389 203 --
NM_005188chr11108233 7183 6601 6193 5771 5684 1348 863 358 249 28257 8022 37484 1608 710 --
NM_005436chr10102954 1577 1337 1317 803 764 432 213 170 148 1721 ----
NM_005504chr12125973 5858 5100 4847 4788 4431 4334 4049 2314 1370 1307 447 11385 ----
NM_005596chr966150 5778 5653 4327 807 385 --34878 2424 2417 16221
NM_005665chr164912 4274 3714 1182 962 273 ----13763
NM_005668chr574413 3876 2874 1282 1075 257 242 24023 3399 ----
NM_005746chr7102685 2499 2287 1772 981 970 808 663 149 45 22796 1757 ----
NM_005898chr1162892 2817 2170 2162 716 446 --13210 12609
NM_006106chr1183287 3096 2985 2546 1125 1108 976 327 23347 470 ----
NM_006252chr197507 6956 6883 2662 2625 2427 2412 2036 486 25620 1646 --27407 1526
NM_006330chr841646 110 92 53 1103 --11464
NM_006420chr2073355 3174 2915 2511 2237 934 461 11388 33095 481 41 --
NM_006544chr14136035 5697 5546 4052 2351 2277 1384 1240 884 332 298 243 49 43880 1986 1482 324 ----
NM_006599chr1687927 7828 6639 5367 3149 2112 1717 1508 55939 5389 3173 2309 189 1809 15898
NM_006640chr1761918 1891 1521 1515 1507 441 ------
NM_006948chr2192082 2012 1888 1879 1806 1650 784 655 148 12246 12331 11524
NM_007007chr12124714 4687 4037 3766 3245 1672 1329 1077 1071 465 410 357 21478 514 ----
NM_007038chr21114562 4455 3990 2371 1681 1315 1085 469 326 260 166 12048 12434 --
NM_007114chr373099 2877 2862 2659 365 117 34 41080 709 484 401 22976 916 --
NM_012081chr573217 3172 1458 1422 1329 971 785 43764 3554 3427 2491 --1859
NM_012214chr275999 5868 5641 5185 4974 2489 983 2439 323 46117 4991 4602 1954 --
NM_012249chr262802 1148 1072 1020 548 523 13488 1158 12322
NM_012464chr4102697 2256 2127 1909 1166 943 480 337 89 33 ----11928
NM_013255chr768862 5424 3149 2790 2318 2070 78891 8052 7717 7408 5882 2011 1782 35382 3405 399 17676
NM_014021chr1103473 3458 3318 2466 2307 1127 384 331 246 237 ------
NM_014331chr4116908 6511 5912 4965 2839 1314 1297 1172 923 687 416 26207 969 --16132
NM_014755chr2123897 3456 3166 3148 3135 2855 2848 1039 707 505 268 260 --13293 --
NM_014787chr161935 1871 1767 1728 944 158 --22721 165 --
NM_014797chr6113329 3219 3010 2945 2931 2183 1176 1082 931 316 138 12032 --13033
NM_014877chr17106203 6165 5091 5068 2704 2113 1268 1078 988 885 26356 738 26989 31 24740 2033
NM_015032chr13122819 2506 2194 2060 1929 1797 1116 1061 759 539 410 281 ----1877
NM_015137chr862542 2365 1997 1809 312 134 ----11737
NM_015263chr1541144 1041 960 339 11184 11078 1846
NM_015271chr4124188 4142 3914 3822 3761 3547 1708 1702 1598 1148 806 139 21496 1026 13896 --
NM_015310chr8128249 8067 6947 6437 5997 5600 5530 2897 2238 2163 2127 2033 16909 26342 2670 --
NM_015336chr12102633 1856 1674 812 760 582 557 529 478 347 1391 22541 2079 --
NM_015446chr151651 1590 1236 1042 601 ----21292 244
NM_015458chr895223 4886 4832 4795 4450 3364 1678 1204 432 15301 11138 --
NM_015550chr793621 3220 2883 2541 1125 1084 877 580 202 23329 180 1264 --
NM_015879chr18118573 8393 8105 6670 5674 3336 3268 3177 3000 2007 88 27734 1458 37956 6687 225 --
NM_015888chr163229 3194 2966 2248 525 310 32717 1357 705 1937 12957
NM_016083chr683699 3614 3442 3411 1375 1075 459 155 23354 1388 12915 --
NM_016206chr3128812 7946 7863 7647 7133 6985 3239 2405 596 529 453 353 28736 2202 16396 --
NM_016217chr663392 3379 2742 631 479 427 1362 13598 22439 177
NM_016248chr1373634 2967 2453 1604 1395 1032 65 23702 959 12837 --
NM_016831chr132159 800 447 ----22172 106
NM_017628chr485322 5292 4402 3840 3549 1521 1319 182 13412 21354 471 --
NM_017637chr9189391 8397 7734 3620 3522 3308 3296 3226 3036 2932 2824 2501 2386 1923 1687 1562 1555 845 36944 6477 979 --11121
NM_017644chr374787 4324 4282 3363 1877 1392 241 --24660 1497 14641
NM_017658chr14144682 4641 4489 4456 3202 2976 1640 1417 1311 910 827 592 452 410 21076 1058 23190 976 --
NM_017736chr1632367 1248 53 23114 2313 1250 23059 2482
NM_017769chr1473270 3056 2446 2409 2156 538 513 --12175 --
NM_017770chr642760 2417 376 135 1391 22516 2099 12622
NM_017813chr895510 3984 1886 1567 1484 1462 1262 504 391 14288 14522 --
NM_017919chr955690 5460 4264 3556 116 24940 183 --24671 4255
NM_018036chr14104375 3766 3535 3387 2997 2734 1397 848 496 203 --1569 --
NM_018225chr9115193 4907 4671 4564 4043 3737 1803 1796 1227 799 229 35272 1355 719 14663 --
NM_018293chr342730 2371 2213 2017 22443 1203 12140 12869
NM_018440chr8127959 6820 6470 6462 5959 3173 1715 1240 1079 954 776 198 28275 5927 47990 6089 3318 1901 --
NM_018566chr194974 4955 4351 4119 3631 1850 1790 1578 761 13727 34095 4046 1071 1700
NM_018638chr1295641 5587 4799 3868 2127 1884 1706 745 350 41807 1698 1666 721 ----
NM_018999chr10104937 4780 4522 4349 4251 3452 3140 1359 1203 132 33428 3235 1319 14168 --
NM_019084chr1051995 1619 375 349 233 ----1775
NM_019593chr2063177 3000 2943 2700 2589 2474 42552 1956 644 269 12398 11166
NM_019885chr262526 2424 1836 1025 319 308 22620 284 22916 2853 --
NM_020193chr1181246 1013 850 453 374 189 141 128 --1327 --
NM_020347chr352313 1910 1856 1573 357 1340 --1778
NM_020466chr694919 3999 3182 3142 1759 1599 707 197 188 ----11767
NM_020718chr16146373 5957 5636 5597 5357 4806 4635 4549 2115 1229 565 137 38 21 24295 1102 14760 --
NM_020738chr261665 1545 1518 1494 1487 1387 11374 --21574 28
NM_020918chr1063299 2774 2764 2675 2485 610 23528 1308 --11383
NM_020940chr1082700 1835 959 762 737 645 180 170 12911 ----
NM_020964chr1884253 3192 1871 1771 1710 713 371 296 --24525 1300 --
NM_021116chr799026 7899 6118 2523 2221 1533 1333 1109 420 49015 7651 7347 3480 29060 7715 --
NM_021629chr3135085 4925 4872 4508 4304 4097 3756 2037 1673 1540 1169 294 269 1940 ----
NM_021961chr11127173 7164 5579 5534 4937 4712 4643 1829 1557 1534 879 543 1602 25635 2091 --
NM_021964chr355744 4506 4114 2225 1227 46183 5461 4935 1716 11340 16157
NM_022048chr15135934 5862 5803 5726 5651 5627 5289 5166 4763 4704 3937 2162 1024 14983 15734 --
NM_022459chr13146313 6050 5955 5896 5472 5393 5346 4635 4448 4382 1148 1076 487 394 45285 4527 1635 194 12282 16163
NM_022473chr1554370 3318 3072 858 284 23484 217 13578 13234
NM_022763chr383208 2993 2944 2866 2645 592 447 143 ----12956
NM_024524chr332767 761 502 --1570 22152 448
NM_024947chr3149400 8654 8518 6836 6266 3777 2847 1869 1854 1822 1424 793 710 306 27707 6110 33052 1756 1520 --
NM_024949chr4104867 3834 3784 3552 3286 1112 842 811 247 180 ----14987
NM_024989chr2108059 6775 6237 5635 5299 4977 2539 2125 1414 153 36056 5284 2904 38204 8071 5734 --
NM_025054chr8103759 3714 3608 3250 2593 1365 569 508 382 298 34236 3941 2779 21109 31 --
NM_025160chr174324 4214 3724 2868 2778 1644 1390 14109 23338 3248 13234
NM_030627chr584148 3363 3134 2707 1334 1212 924 758 44077 2785 2701 913 12669 --
NM_032047chr351877 1573 864 665 69 52356 2283 541 322 303 1136 --
NM_032329chr274342 4170 3570 2969 2960 1340 973 --1136 24284 4059
NM_032873chr1193828 3539 3413 3030 1068 919 559 367 40 12843 1276 1903
NM_033389chr17114863 4481 3537 3476 3193 3000 2954 1301 577 404 38 --14777 --
NM_033505chr296574 5980 5809 4183 1384 1290 281 247 226 21775 1083 ----
NM_033515chr631026 897 65 21125 192 --1519
NM_033656chr2164753 4076 3763 1596 909 132 55619 5473 3959 1577 1477 35571 1676 1586 --
NM_052879chr1243922 1642 597 535 34042 1136 1102 33231 2755 2624 13193
NM_080867chr1445055 4731 4020 3325 24048 531 25042 505 1563
NM_133646chr2115414 5297 4550 3404 3382 2070 1420 1249 889 834 34 35375 4948 1913 13659 11318
NM_138959chr166788 5608 4427 2661 2508 1467 14688 25703 4494 22608 2199
NM_144571chr4106731 6546 6539 6253 6003 4703 2546 2279 1872 792 41924 1323 915 876 15910 --
NM_152622chr5113395 3102 3005 2921 2873 2739 2263 1305 1157 455 382 22630 995 1928 --
NM_152624chr5147232 7194 7005 6844 6694 5535 5425 2861 2322 2259 1216 1106 214 115 87106 6557 6026 2552 2191 2070 1360 916 16003 --
NM_153607chr5112601 2540 2320 2298 2207 2027 1265 990 742 706 490 1250 ----
NM_153689chr282356 2204 2144 1608 350 177 145 80 22266 1513 --159
NM_172071chr1117357 7161 6884 5839 5653 4826 4754 1159 1150 801 783 15293 11019 --
NM_173468chr4136070 5536 5142 4691 4227 3964 3851 1278 1179 921 894 229 51 --23884 710 --
NM_173510chr2262964 2303 2045 1891 1860 703 21134 34 32880 2794 237 --
NM_173536chr4105145 5017 4871 4611 4489 4114 1558 1245 1209 873 11531 11835 --
NM_173582chr11105734 4723 4615 4239 3871 2511 2302 2253 742 640 46309 1052 559 391 25605 1947 --
NM_173851chr863005 2987 2962 1240 714 229 23997 2696 33591 2782 2758 13884
NM_175861chr1295530 5441 4786 4113 1979 1933 1798 894 698 21656 1213 ----
NM_181077chr1572248 2087 1417 427 414 380 195 21965 365 --1100
NM_181723chr842122 1937 669 305 31437 1420 200 21658 381 --
NM_182485chr4103146 2958 2497 2401 2346 2275 1011 810 725 233 --23428 293 --
NM_182503chr684007 3887 2020 1921 1242 445 356 329 35325 3422 1427 25533 3740 --
NM_194282chr452928 1967 550 300 270 13028 12023 1423
NM_198581chr2177563 7275 6821 5516 5101 4889 2858 2681 2176 2062 1588 1257 905 764 748 580 315 --12754 --
NM_198859chr395129 5020 4004 3564 1828 1740 953 875 45 24558 77 23382 859 --
NM_198935chr2031011 414 281 12197 32576 2483 2377 12996
NM_199072chr773041 2868 2666 2471 2305 1085 820 1268 138 12492
NM_203463chr284573 3819 3710 3507 1844 1062 1056 723 23546 1324 23037 1645 --
NM_206853chr6124058 4014 3976 3949 3918 3774 3591 2949 1113 693 550 204 --1714 --
NM_207361chr1395352 5286 5215 5195 4462 4272 888 864 261 35149 5141 4899 1376 --
NM_213589chr285550 5010 1976 921 758 648 456 310 1103 45446 5432 4920 490 --