TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-544a
miRNA Sequence: AUUCUGCAUUUUUAGCAAGUUC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000021chr1421083 848 ----1239
NM_000025chr8--1431 ----
NM_000038chr51719 ------
NM_000084chrX26891 2448 16458 26612 1242 12160
NM_000092chr254271 4247 3729 2962 1790 2624 455 11670 --
NM_000125chr684072 3532 3175 1274 1165 662 558 341 11081 11038 --
NM_000138chr15154 ------
NM_000163chr5--21689 945 12156 12011
NM_000165chr611660 ----163
NM_000214chr2021190 579 ------
NM_000216chrX43852 3606 1610 808 11168 13892 2914 135
NM_000217chr1274166 3255 1587 1545 1301 745 97 13957 24952 3760 11686
NM_000252chrX--1595 1104 --
NM_000264chr932815 2375 1299 11135 22999 2136 --
NM_000266chrX142 1385 ----
NM_000280chr111305 ------
NM_000332chr677068 6135 4520 374 366 225 158 37083 5250 1442 21432 1276 12340
NM_000345chr41851 ------
NM_000346chr1711751 ------
NM_000351chrX24228 737 13318 2350 322 22969 1499
NM_000358chr51528 1512 --1227
NM_000368chr964230 3700 3647 3468 1176 434 41626 1508 1290 985 34754 3076 155 --
NM_000411chr2152888 2055 624 586 344 1207 ----
NM_000430chr1762693 1219 827 613 269 124 ------
NM_000448chr1162857 2805 2550 1138 1079 264 --13048 22296 2280
NM_000461chr374589 4145 4049 3784 3248 1273 651 14346 ----
NM_000480chr11--11134 ----
NM_000489chrX21377 976 ----12461
NM_000522chr711275 ------
NM_000533chrX2684 674 11460 --11251
NM_000536chr111561 ------
NM_000555chrX94847 3113 2244 1971 1549 1151 1076 662 349 ------
NM_000586chr41242 ------
NM_000599chr261770 1502 1470 1264 1163 627 21643 371 44463 2847 1534 317 --
NM_000618chr1256473 4643 2160 1150 43 --16074 --
NM_000618chr1256473 4643 2160 1150 43 --16074 --
NM_000627chr2------1815
NM_000663chr1652679 2628 2602 1035 888 12946 32043 513 200 22618 2092
NM_000673chr43738 321 111 ------
NM_000719chr1255712 5642 2063 451 427 --2948 195 35876 5485 369
NM_000793chr1464855 4444 4380 3770 761 592 25074 721 14839 25043 3152
NM_000801chr201850 ------
NM_000806chr541949 1203 662 339 1298 11609 --
NM_000809chr487669 6277 5809 3638 1619 1116 841 804 18262 29119 45 --
NM_000813chr554906 4180 2061 856 747 1753 --11493
NM_000829chr111854 11528 1397 --
NM_000831chr1155682 5589 5564 4979 4885 4781 4498 4330 2445 1729 1228 851 593 507 43 24841 1367 56109 5132 5034 1787 331 --
NM_000868chrX41993 1847 540 353 11030 ----
NM_000875chr1586324 5257 4636 4440 4265 2750 1895 1037 11540 --12495
NM_000876chr6----11269 --
NM_000877chr273010 2545 2412 717 676 416 55 --22074 85 --
NM_000891chr1753509 3086 2892 1429 280 --22444 224 --
NM_000908chr5----1145 --
NM_000933chr2061611 1220 1108 690 441 232 ------
NM_000938chr41165 ------
NM_000950chrX42683 1411 1081 436 11228 13278 --
NM_001001132chr2121325 143 --2562 158 21354 221
NM_001001323chr1252140 917 750 583 422 12705 11161 1805
NM_001001392chr1132694 2676 1233 --121 --
NM_001001668chr1963049 1455 1132 872 824 748 --11302 --
NM_001001924chr852046 1337 758 143 46 --32008 829 55 --
NM_001001925chr852046 1337 758 143 46 --32008 829 55 --
NM_001001931chr852046 1337 758 143 46 --32008 829 55 --
NM_001001995chrX21842 100 --11523 11361
NM_001002243chr2----1870 --
NM_001002838chrX1191 ----2552 176
NM_001003652chr1898286 8158 7981 7425 6799 3477 3436 2526 2386 22505 1521 16953 1535
NM_001003674chr18115568 5038 4797 2826 2463 2406 1964 1637 1412 1172 347 22546 2230 24552 782 15530
NM_001003675chr18115568 5038 4797 2826 2463 2406 1964 1637 1412 1172 347 22546 2230 24552 782 15530
NM_001003712chr1263239 2983 943 664 658 130 ----14010
NM_001003810chr41269 ------
NM_001004356chr461485 1352 945 577 429 77 ------
NM_001004358chr461485 1352 945 577 429 77 ------
NM_001004419chr1222954 770 11031 43673 1520 1280 953 --
NM_001005386chr211596 11912 11981 --
NM_001005473chr556331 6270 4123 1383 1217 16069 36432 5056 4362 26185 5908
NM_001005609chrX63304 2919 2348 1291 1120 234 2509 114 1584 13234
NM_001006681chrX152 ------
NM_001006682chrX152 ------
NM_001006683chrX152 ------
NM_001007023chr1464855 4444 4380 3770 761 592 25074 721 14839 25043 3152
NM_001007024chr1753561 2696 634 581 111 11405 11705 23605 1454
NM_001007025chr1753561 2696 634 581 111 11405 11705 23605 1454
NM_001007075chr41744 ------
NM_001007097chr965059 4520 3709 2046 1024 1001 21998 1803 1208 --
NM_001007466chr685220 4826 4617 3957 1714 786 547 50 23589 699 35061 3328 1648 24642 128
NM_001007794chr11211 --1615 2237 42
NM_001008225chr7------1563
NM_001008408chr7125955 5107 4605 4289 2460 2309 1582 1128 500 424 289 78 14296 11736 --
NM_001008707chr1451581 1562 1543 1515 1332 --11325 --
NM_001008738chr5--3599 273 44 ----
NM_001008925chr432956 1008 161 --23523 2493 --
NM_001009554chr431799 993 817 --21294 211 13748
NM_001009554chr431799 993 817 --21294 211 13748
NM_001009959chr21461 --21877 136 --
NM_001009993chr254147 3721 3695 1588 70 11360 34070 3810 926 21181 1147
NM_001010922chr134010 1514 1353 --1185 22750 979
NM_001010934chr7----144 --
NM_001010986chrX52350 996 537 364 308 11804 ----
NM_001011666chr724366 1317 15975 14416 11940
NM_001012393chr1143400 1896 1876 68 13748 24455 3438 1640
NM_001012753chr1911207 ----2780 426
NM_001012968chrX1475 179 --21014 413
NM_001013031chr1033477 1348 596 --13017 1281
NM_001013693chr192407 2341 2210 2030 1152 490 473 177 143 1670 12661 1765
NM_001013693chr192407 2341 2210 2030 1152 490 473 177 143 1670 12661 1765
NM_001014449chr16--1185 ----
NM_001014451chr16--1185 ----
NM_001014797chr1067478 6859 6709 6170 5774 5631 47017 2998 2701 2378 57987 6418 5113 1899 1813 --
NM_001015877chrX12797 12589 ----
NM_001017368chr1732153 1783 105 196 21969 79 1819
NM_001017369chr4--184 --1193
NM_001017395chr343633 2524 1468 1149 154 12910 12440
NM_001017424chr141307 1300 1255 1194 --1729 21563 715
NM_001017425chr141307 1300 1255 1194 --1729 21563 715
NM_001017440chr776811 6453 6283 6228 5326 2582 113 57308 2993 2403 2302 2219 77324 6095 2484 2422 2197 2036 1269 21730 725
NM_001018024chrX--1146 2177 136 --
NM_001018065chr965256 1650 1286 1156 767 556 24517 1354 22401 721 141
NM_001018066chr965256 1650 1286 1156 767 556 24517 1354 22401 721 141
NM_001018091chr153828 377 27 --22796 1089 11909
NM_001020658chr121649 89 ------
NM_001020658chr121649 89 ------
NM_001024455chrX82569 2417 2081 1967 819 672 572 513 --41044 1018 140 120 --
NM_001024647chr1267070 5347 2140 2134 1404 331 12000 15544 22426 1891
NM_001024649chr532850 2571 1828 12398 --1212
NM_001024947chr53904 800 102 ------
NM_001025107chr172597 2360 2132 785 769 657 612 22002 232 11872 --
NM_001025107chr172597 2360 2132 785 769 657 612 22002 232 11872 --
NM_001025108chr254047 4002 2904 907 145 13115 33422 1177 1095 23108 3100
NM_001025205chr31470 ------
NM_001025266chr364577 4185 3986 3633 3322 702 23897 306 13345 --
NM_001025356chr1252871 2405 2316 739 303 22180 1041 --21104 163
NM_001025389chr11--11134 ----
NM_001025390chr11--11134 ----
NM_001025580chrX139 1172 33503 1590 275 13375
NM_001029858chr612320 ------
NM_001029859chr1172208 2084 2061 1596 620 214 125 --12341 12118
NM_001029863chr642703 2427 855 669 ------
NM_001030006chr1732465 2271 87 41959 503 458 350 12025 --
NM_001030007chr1613871 13108 13440 --
NM_001030055chr1423526 452 ----2935 865
NM_001031679chr1253238 861 391 369 320 41406 1356 1340 609 23195 3060 --
NM_001031695chr2274365 3636 3485 1820 1177 576 445 --33629 1857 1362 --
NM_001031732chr473572 2874 2276 812 715 257 235 1909 23216 120 --
NM_001031748chr121522 --130 --
NM_001031812chr512213 --21795 709 1320
NM_001032288chr20198 ------
NM_001032380chr1011791 ------
NM_001032999chr2074788 3724 3394 1623 1019 299 183 25013 125 24408 863 24544 734
NM_001033045chr274344 4105 3609 3244 1054 562 536 --43919 3483 1767 1639 --
NM_001033047chr452432 2418 804 610 377 --11037 --
NM_001033057chr3----1291 --
NM_001033059chr631436 1338 1318 --145 2259 118
NM_001033087chr2053286 2944 728 624 481 --2631 422 1168
NM_001033112chr51915 ------
NM_001033117chr341362 907 571 108 14207 24252 138 1641
NM_001033521chr20----1167 --
NM_001033522chr20----1167 --
NM_001034833chr5----1280 --
NM_001034841chr1695470 5320 4664 4198 3837 1295 338 317 273 --43861 3656 287 100 25560 3379
NM_001034850chr51619 ------
NM_001035003chr411313 11093 --21355 1229
NM_001035004chr411313 11093 --21355 1229
NM_001039111chr31414 ------
NM_001039465chr141153 ------
NM_001039538chr222579 55 ----43416 2856 448 174
NM_001039547chr396939 6498 5193 5035 4943 2239 1794 1625 52 --11186 26103 2569
NM_001039585chr134100 3912 2816 22750 1695 --1240
NM_001039590chrX23157 2997 13165 12928 23822 149
NM_001039591chrX23157 2997 13165 12928 23822 149
NM_001039618chr1195705 5426 5304 4733 4349 3726 2325 1768 1376 ------
NM_001039675chr15----1372 --
NM_001039693chr273772 3166 3010 822 769 652 469 --13110 13520
NM_001039709chr2074788 3724 3394 1623 1019 299 183 25013 125 24408 863 24544 734
NM_001039802chr131337 1227 982 ------
NM_001039840chrX42381 1802 117 60 --14336 1695
NM_001039888chr11763 ------
NM_001039937chr1334085 2956 2694 23592 1262 --13951
NM_001040152chr744807 4269 3734 3493 34449 1805 1551 14544 --
NM_001040159chr431250 1172 528 ------
NM_001040181chr31432 ------
NM_001040182chr31432 ------
NM_001040183chr31432 ------
NM_001040199chr31432 ------
NM_001040200chr31432 ------
NM_001040284chr1624003 2006 --24077 321 25696 2097
NM_001040424chr2152866 2422 1938 357 342 22027 1187 42000 876 129 37 --
NM_001040429chr1343397 3217 2903 1037 --11379 --
NM_001040450chr1512833 --12274 1851
NM_001040453chr1512833 --12274 1851
NM_001040665chr744286 1440 1081 344 1427 11642 --
NM_001040712chr9--23290 1015 22476 660 1689
NM_001042355chr1694554 4428 3555 3315 2062 2037 1758 1113 39 35171 1226 1053 15248 22154 1218
NM_001042412chr1694554 4428 3555 3315 2062 2037 1758 1113 39 35171 1226 1053 15248 22154 1218
NM_001042413chr943061 1615 159 146 --22614 119 1174
NM_001042414chr131105 ------
NM_001042453chrX1669 --21556 1200 --
NM_001042481chr1442336 1887 1056 1035 1598 ----
NM_001042537chrX32150 696 208 1786 --11672
NM_001042599chr2146991 6588 5839 5291 5246 5212 5001 4860 4770 3070 2715 2422 1415 941 27048 1870 13155 1420
NM_001042601chr332858 2313 2119 1956 --22832 984
NM_001042604chr343889 3593 3430 1421 13215 33745 3641 3573 12984
NM_001042683chr6158 ------
NM_001042749chrX1565 ----1819
NM_001042750chrX1565 ----1819
NM_001042751chrX1565 ----1819
NM_001044385chr244006 3328 1533 384 21625 818 ----
NM_001044722chr512213 --21795 709 1320
NM_001044723chr512213 --21795 709 1320
NM_001068chr3----1220 --
NM_001071775chr1321747 1579 11779 11260 1108
NM_001079874chr162023 2013 1927 1374 1308 420 11809 ----
NM_001096chr171570 ----1695
NM_001099678chr364922 4781 1883 1668 403 278 26344 1264 1766 --
NM_001106chr3148513 8015 7727 7411 6705 6512 3667 3597 3561 3511 3331 2534 1936 926 48519 8270 6814 3357 49256 9112 7707 275 58800 8468 7434 3915 2599
NM_001111chr172597 2360 2132 785 769 657 612 22002 232 11872 --
NM_001113490chrX31368 833 23 22994 1222 22567 546 --
NM_001126chr12991 304 ------
NM_001128chr1613871 13108 13440 --
NM_001153chr2--1240 ----
NM_001167chrX116732 6374 6232 6198 5389 4800 4406 4400 4205 1684 1297 ------
NM_001173chr1423526 452 ----2935 865
NM_001186chr2153049 3023 2319 1059 506 13080 22535 387 --
NM_001198chr63821 698 481 --21987 673 --
NM_001204chr215804 15004 156 22658 158
NM_001206chr952924 2688 940 689 377 1927 32632 1238 813 --
NM_001222chr1031435 585 319 --31890 697 673 --
NM_001282chr1732465 2271 87 41959 503 458 350 12025 --
NM_001324chr20----1167 --
NM_001326chr112436 400 ----123
NM_001331chr111275 1841 --22730 797
NM_001332chr51256 1200 ----
NM_001343chr531752 453 21 11473 11159 --
NM_001346chr341869 1785 389 303 42889 2692 942 592 22147 1935 12437
NM_001358chr41392 ------
NM_001399chrX63304 2919 2348 1291 1120 234 2509 114 1584 13234
NM_001412chrX43443 3175 448 233 1806 43264 1073 800 787 1656
NM_001417chr1241894 1700 1504 373 1313 ----
NM_001438chr153458 2692 2454 2331 1306 ------
NM_001530chr141995 ------
NM_001604chr111305 ------
NM_001614chr17----1165 --
NM_001614chr17----1165 --
NM_001634chr631436 1338 1318 --145 2259 118
NM_001650chr183746 739 103 11467 11175 --
NM_001663chr1452683 2330 949 455 431 11978 11916 22769 2546
NM_001682chr1261854 1108 631 464 297 136 12419 1875 1519
NM_001690chr311891 22071 802 11628 1488
NM_001729chr4--1305 ----
NM_001746chr532850 2571 1828 12398 --1212
NM_001791chr131337 1227 982 ------
NM_001799chr5----2236 91 --
NM_001825chr51103 ------
NM_001839chr11687 ------
NM_001854chr12954 158 --1479 1287
NM_001873chr41661 ------
NM_001904chr31355 --1764 --
NM_001918chr1157862 7687 7680 7542 7410 6366 6047 3231 3203 2568 2543 1885 1809 1533 482 27084 1852 29077 8845 28453 3609
NM_001949chr662840 2471 916 655 434 202 11283 22964 357 --
NM_001967chr3--1414 ----
NM_001977chr421467 319 11212 ----
NM_001995chr41195 ----11132
NM_002006chr455343 4026 1969 1697 1359 15661 24140 4000 --
NM_002015chr1343168 1221 227 210 21048 54 23319 489 1297
NM_002025chrX118919 8893 8710 7263 6040 3498 3098 3063 2805 1666 966 ------
NM_002069chr7166 ------
NM_002074chr111637 ------
NM_002092chr454850 4096 3098 3086 510 ------
NM_002099chr41703 ------
NM_002111chr4103581 2751 1341 1250 824 792 392 357 240 160 --12574 --
NM_002126chr1743719 3308 3181 881 --13897 12629
NM_002137chr751918 902 668 465 147 11902 1308 1169
NM_002138chr41269 ------
NM_002145chr171319 ------
NM_002146chr1711254 1331 21350 1010 --
NM_002202chr5----11065 --
NM_002214chr744574 3925 3838 278 --13471 --
NM_002223chr1253625 3532 1555 1221 287 --23572 1507 13388
NM_002265chr17--1224 1886 --
NM_002268chr321889 1198 11854 11745 --
NM_002270chr532208 1466 582 14069 21943 1343 25608 2102
NM_002271chr1321920 986 31951 431 141 32097 1721 162 11687
NM_002285chr254047 4002 2904 907 145 13115 33422 1177 1095 23108 3100
NM_002293chr132442 2186 371 21837 919 22578 2289 --
NM_002300chr12------124
NM_002310chr566102 2439 2307 1327 1210 397 14847 35968 2240 1240 --
NM_002334chr1111537 11831 --11898
NM_002351chrX169 ------
NM_002356chr61715 ------
NM_002372chr5--1642 ----
NM_002374chr222579 55 ----43416 2856 448 174
NM_002387chr544542 4335 4313 262 --34670 3870 3852 --
NM_002408chr14----1734 1645
NM_002481chr145765 5284 2234 470 35909 5718 1243 37459 6771 5234 --
NM_002499chr1521682 359 --1239 21870 886
NM_002515chr142773 308 --178 --
NM_002519chr11------21377 218
NM_002522chr1753143 3081 2469 997 282 --12967 --
NM_002545chr1143400 1896 1876 68 13748 24455 3438 1640
NM_002547chrX63842 3694 3022 1571 1226 85 23316 1491 23521 2586 --
NM_002572chr11----1102 --
NM_002581chr944893 4346 1682 889 1402 --1480
NM_002594chr2021850 536 ------
NM_002613chr16165416 4954 4783 4549 4541 4160 4072 4029 3862 3704 3462 3441 1805 1058 1039 114 53760 1675 928 899 121 14173 --
NM_002628chr3177 ------
NM_002645chr1121936 1052 --32710 434 240 --
NM_002655chr831801 1762 1394 21173 1004 ----
NM_002687chr14141 ----1366
NM_002718chr332369 2107 1052 ----1400
NM_002719chr1442409 1617 797 197 --1685 158
NM_002734chr17--1494 1426 --
NM_002737chr17146567 6526 6189 5836 4250 4082 2536 2403 2281 2131 1985 1955 1478 1366 11867 21158 241 --
NM_002740chr31133 --12760 --
NM_002745chr2253543 3388 2976 2890 515 33779 2861 998 --11404
NM_002755chr151626 ------
NM_002767chr171435 ------
NM_002829chr91179 ------
NM_002834chr1253967 1379 917 319 250 22585 1091 ----
NM_002839chr9--23290 1015 22476 660 1689
NM_002886chr374460 3962 3715 3473 3445 1980 517 --11043 --
NM_002897chr2----1669 --
NM_002906chr1122139 69 --1545 --
NM_002945chr175544 327 198 43 25 1295 1102 --
NM_002948chr351302 1090 415 309 96 ------
NM_002956chr12179 ----1294
NM_002959chr173710 3669 3033 2740 1669 454 162 33501 748 731 1474 --
NM_002973chr121540 ------
NM_002977chr232791 2458 1369 ----1288
NM_003016chr171330 --11662 21725 169
NM_003020chr151137 ----1349
NM_003043chr3194215 3708 3483 3155 2816 2796 1715 1707 1527 1427 1145 953 938 885 847 706 543 463 255 43223 928 730 441 --23124 1062
NM_003045chr1374431 3925 3872 3611 3259 1377 320 11573 23913 851 --
NM_003108chr272547 2510 1697 1648 723 704 399 26836 4661 57051 6861 4609 490 41 15893
NM_003112chr742084 1218 622 329 11008 1945 --
NM_003126chr1--127 ----
NM_003137chr632073 1373 879 2448 26 --11703
NM_003144chr62515 509 22020 900 11912 178
NM_003199chr1895578 4985 4928 4093 4027 3499 1960 1364 967 33877 2273 912 35276 4436 865 15333
NM_003206chr61338 ------
NM_003234chr331838 1797 778 ----21578 598
NM_003246chr1541836 1795 801 449 31567 812 631 --11649
NM_003255chr1732032 932 256 12213 1771 2659 383
NM_003262chr324012 508 1649 23755 1594 14729
NM_003269chr6----1925 11147
NM_003270chrX1157 ----11028
NM_003272chr11158 ------
NM_003337chr511525 ----21105 108
NM_003338chr102575 564 --11539 --
NM_003344chr721537 1311 --11427 11326
NM_003349chr20198 ------
NM_003360chr41211 ------
NM_003392chr333699 1325 646 1411 14151 13019
NM_003403chr14----1791 --
NM_003404chr2021652 306 1322 ----
NM_003406chr81449 1583 1531 21826 710
NM_003410chrX21155 26 148 --12876
NM_003423chr192893 708 1778 ----
NM_003439chr742456 2430 654 202 ----22189 549
NM_003453chr131554 ------
NM_003463chr6----21321 824 12409
NM_003466chr252297 1906 831 821 221 1840 ----
NM_003468chr254341 4016 3847 3615 3560 14153 ----
NM_003473chr101143 --1199 1288
NM_003483chr1232048 730 560 --22825 2737 --
NM_003559chr1793800 3665 3632 3515 3455 2456 1536 1360 104 21083 746 ----
NM_003566chr1223217 3044 --13129 --
NM_003569chr61620 ------
NM_003574chr1835710 2006 502 14930 24530 1759 --
NM_003590chr243312 811 439 208 33303 3156 2776 11581 --
NM_003597chr2--1243 1781 1343
NM_003607chr143588 2719 705 125 13019 42990 1458 802 554 31057 981 790
NM_003615chr343298 1006 663 498 --33888 761 553 --
NM_003618chr21291 ------
NM_003620chr171184 ------
NM_003629chr152610 2461 2211 1307 1270 ----11068
NM_003672chr1----11956 --
NM_003692chr91905 --1958 --
NM_003705chr21684 ----1354
NM_003743chr22738 237 11537 --22251 910
NM_003759chr431364 550 445 1927 21601 1593 23548 2942
NM_003762chr11394 11020 --21317 450
NM_003779chr11170 ------
NM_003799chr1874134 2922 1786 1427 1068 1037 784 34009 4002 1701 1115 1141
NM_003806chr12--1192 --1238
NM_003825chr151343 11269 ----
NM_003861chr1442596 2338 983 498 12489 22208 1102 --
NM_003864chr4------166
NM_003872chr252530 2195 1136 374 156 --12295 21940 226
NM_003877chr12----1907 --
NM_003884chr311769 ------
NM_003899chr1342317 1970 931 462 12125 11650 1568
NM_003902chr12231 73 ----1197
NM_003913chr673779 1707 1234 620 482 413 203 13801 --22935 1595
NM_003916chrX148 --11306 1216
NM_003939chr1053368 2665 1021 942 391 12638 11413 1494
NM_003941chr741763 650 509 428 12018 1903 --
NM_003953chr142644 2557 2128 617 32436 891 749 --161
NM_003980chr61431 --21166 496 --
NM_003983chr1674076 3924 3579 2961 2937 1461 1075 13412 14134 --
NM_004016chrX1126 ------
NM_004018chrX1126 ------
NM_004021chrX1126 ------
NM_004022chrX1126 ------
NM_004023chrX1126 ------
NM_004028chr183746 739 103 11467 11175 --
NM_004035chr1794890 4184 4028 3836 1900 1629 1568 462 300 23692 1357 41655 1513 754 397 --
NM_004067chr731378 1308 296 --2981 125 --
NM_004068chr31470 ------
NM_004085chrX1785 ------
NM_004100chr622476 712 11894 1985 12310
NM_004113chr341545 1487 1278 301 21805 205 21656 503 --
NM_004117chr621879 1815 --12097 1377
NM_004171chr1198831 8721 7073 7037 6143 2745 1246 1156 758 37508 1923 1188 49275 7116 3485 1557 57801 5926 3456 2630 312
NM_004172chr522028 1460 ------
NM_004180chr21558 ------
NM_004185chr12251 125 --1585 --
NM_004211chr11------1145
NM_004229chrX11362 --11786 11746
NM_004232chr18--12437 21379 247 22874 2472
NM_004236chr151125 ----2368 46
NM_004297chr91123 ------
NM_004301chr31307 --191 --
NM_004311chr1082200 2114 2040 1248 1208 1144 645 580 --125 12097
NM_004319chr121102 405 12090 33096 2256 156 --
NM_004329chr1011132 21395 381 --11075
NM_004331chr812184 --1740 --
NM_004338chr18115568 5038 4797 2826 2463 2406 1964 1637 1412 1172 347 22546 2230 24552 782 15530
NM_004342chr742063 731 53 37 --21782 341 --
NM_004370chr652144 1994 1907 1545 1497 ----32008 1517 239
NM_004376chr1021068 291 1473 41535 612 562 532 1591
NM_004380chr161621 --12063 1629
NM_004384chr512213 --21795 709 1320
NM_004392chr1322015 946 --1758 11806
NM_004412chr1034892 2011 1306 35731 5597 1396 --11350
NM_004432chr91858 ----1824
NM_004434chr1451581 1562 1543 1515 1332 --11325 --
NM_004437chr143152 3096 3082 601 22529 467 13487 --
NM_004454chr321769 1495 1200 --12203
NM_004501chr133170 3145 2493 13494 21592 642 --
NM_004504chr252689 1972 601 549 256 1204 --1756
NM_004505chr1711262 31783 693 158 ----
NM_004519chr8136 ------
NM_004521chr10----1108 --
NM_004529chr911202 ----1989
NM_004537chr1221395 209 --11438 --
NM_004575chr4----1661 21280 298
NM_004586chrX54576 3584 3511 3320 1670 23565 3526 ----
NM_004588chr1182607 1437 1328 1302 823 813 581 273 32539 1512 1208 ----
NM_004598chr573196 2547 945 884 851 435 322 ------
NM_004612chr964522 4414 4307 1804 1587 684 13456 14068 --
NM_004685chr1322713 2495 --32780 2543 647 --
NM_004697chr92245 128 ------
NM_004705chr11167 ------
NM_004734chr1353084 2462 997 524 227 43272 3133 2553 2251 22501 2440 --
NM_004745chr8136427 6211 5477 5111 5044 4755 4743 2647 2622 2540 2377 1714 1521 2746 470 36543 5645 4631 26230 5151
NM_004748chr1553654 3155 1576 1024 926 ----12563
NM_004768chr1--11110 ----
NM_004774chr1732632 2348 2105 22909 407 11077 12004
NM_004788chr112548 43 ----1208
NM_004798chr2083483 2681 2367 1157 1013 418 397 133 21117 29 23147 2622 21036 75
NM_004834chr252788 1254 731 542 120 22392 452 1919 11318
NM_004841chr11281 ------
NM_004845chrX33576 2780 1528 43819 2632 2529 116 54201 3358 2725 273 35 2729 201
NM_004857chr1444070 855 821 135 23549 26 21190 567 44759 4605 3075 992
NM_004860chr171470 ------
NM_004866chr524287 3893 34601 797 441 35012 4681 1365 21983 206
NM_004869chr181570 --11440 --
NM_004871chr1753561 2696 634 581 111 11405 11705 23605 1454
NM_004902chr20------2691 243
NM_004904chr724366 1317 15975 14416 11940
NM_004921chr14694 390 375 207 11752 1174 1960
NM_004936chr91643 32114 485 102 21155 706 1890
NM_004949chr1851979 662 574 290 190 ----11491
NM_004963chr12--1110 --1439
NM_004969chr10----1187 1143
NM_004976chr11194955 4919 4784 4685 4661 4607 3995 3429 3415 1909 1882 1272 1210 525 502 456 424 297 267 34614 3842 433 ----
NM_004985chr1244078 3317 3239 117 ------
NM_004992chrX117600 6560 6086 3356 2413 1863 837 807 692 488 284 16322 68151 7557 6765 5814 3242 1751 --
NM_004992chrX117600 6560 6086 3356 2413 1863 837 807 692 488 284 16322 68151 7557 6765 5814 3242 1751 --
NM_004999chr694050 4042 4016 3623 3031 2918 2864 2783 977 --14521 --
NM_005065chr1445224 3698 1803 1497 14995 13831 14407
NM_005068chr621345 273 11198 ----
NM_005086chr1241824 1781 539 462 21417 545 1719 1198
NM_005093chr2074788 3724 3394 1623 1019 299 183 25013 125 24408 863 24544 734
NM_005095chr1----11366 1785
NM_005105chr152138 1616 584 578 445 11604 ----
NM_005109chr31434 ------
NM_005116chr2063649 3100 2962 2851 2813 1256 --13288 --
NM_005137chr2262429 2164 2063 1875 706 258 11762 32071 1749 932 151
NM_005156chr984278 4266 2104 2069 1829 1815 1654 1353 --14764 11246
NM_005159chr1542058 1974 721 453 --1887 1509
NM_005180chr10------1406
NM_005188chr11138178 7739 7340 6881 6566 6224 6198 5608 3215 2175 1988 78 22 36861 5292 5237 12885 --
NM_005221chr71286 ------
NM_005229chrX1467 ------
NM_005230chr121486 ------
NM_005233chr332544 1730 66 ------
NM_005235chr2146991 6588 5839 5291 5246 5212 5001 4860 4770 3070 2715 2422 1415 941 27048 1870 13155 1420
NM_005249chr141231 --1200 --
NM_005252chr141102 ------
NM_005254chr1511388 --11024 --
NM_005264chr10------1839
NM_005277chr4----11912 1700
NM_005296chrX1140 ------
NM_005302chr7----1134 --
NM_005308chr101147 ----1542
NM_005312chr992664 2502 2053 1972 1761 496 459 94 43 1344 22483 503 --
NM_005316chr11----1754 1728
NM_005358chr133166 63 32 --21875 449 --
NM_005359chr1832125 1493 1232 31537 1223 389 36288 988 330 --
NM_005376chr13918 911 762 ------
NM_005385chr342040 1974 1063 939 21780 1752 12256 12738
NM_005388chr9--21540 588 --11205
NM_005399chr173715 3117 1624 1457 925 791 162 --23519 798 1310
NM_005414chr31126 ------
NM_005429chr4162 ------
NM_005436chr1043769 2677 2627 1476 11011 2826 498 1390
NM_005455chr111812 ----11477
NM_005458chr93738 93 55 12080 1553 22058 71
NM_005465chr131898 1743 574 --1649 --
NM_005477chr1562507 2317 2125 939 611 601 1143 --12487
NM_005477chr1562507 2317 2125 939 611 601 1143 --12487
NM_005493chr61653 ------
NM_005497chr1765339 4875 1800 1539 1057 588 12377 1223 1515
NM_005501chr17----1893 --
NM_005502chr9--12447 11106 12933
NM_005504chr1256585 5909 2081 1517 1467 36298 1425 1014 16452 11395
NM_005509chr521563 202 ----11904
NM_005563chr1--1547 ----
NM_005587chr1521010 218 ----2359 316
NM_005596chr954839 4569 4487 3969 1115 34440 208 101 25775 5507 14629
NM_005626chr12518 81 ------
NM_005639chr122234 163 --1598 --
NM_005647chrX21359 141 22564 1310 22362 1377 13215
NM_005665chr164040 3097 2988 1967 1762 1687 ----13273
NM_005668chr531732 796 408 14433 23487 1018 11455
NM_005688chr311118 ------
NM_005711chr5--1283 1716 --
NM_005721chr22319 164 --1171 --
NM_005722chr211596 11912 11981 --
NM_005724chr153749 729 276 ------
NM_005737chr252350 1974 1820 1105 395 12030 3917 738 173 22104 1874
NM_005748chr1211387 ----23287 2309
NM_005751chr72448 423 ------
NM_005756chrX----1491 --
NM_005759chr234217 3923 91 --21645 367 22907 1101
NM_005801chr172681 52 ------
NM_005828chr17114791 4270 4119 4051 3946 3833 3723 3704 3695 3142 1379 --24811 3395 14644
NM_005832chr31127 ------
NM_005840chrX96955 6731 6352 2983 2721 1975 1699 1271 350 14917 37458 1521 164 16600
NM_005859chr521187 1170 ----11017
NM_005863chr10----11091 --
NM_005871chr104774 239 134 32 ------
NM_005885chr5--1503 ----
NM_005895chr1253718 3284 1625 1481 143 1438 1946 --
NM_005898chr1152949 2604 2464 2158 458 12345 12428 12030
NM_005901chr1898286 8158 7981 7425 6799 3477 3436 2526 2386 22505 1521 16953 1535
NM_005902chr1594533 3500 3036 1699 1245 828 639 437 271 23788 1550 33979 1447 53 --
NM_005909chr52733 374 ----14193
NM_005924chr7----11117 1891
NM_005935chr454367 4046 1478 1170 320 1198 1191 11658
NM_005937chr17103206 2850 2827 2776 2673 1605 586 484 322 307 --12816 --
NM_005941chr833793 2595 927 --43425 1620 621 35 --
NM_005955chr174426 2220 950 916 795 390 44 24043 1557 33540 1459 673 --
NM_005966chr232114 1936 960 1698 11595 11779
NM_005977chr132988 38 ------
NM_006035chr1421314 112 1322 1100 --
NM_006036chr262427 1722 1584 957 900 278 ------
NM_006047chr2043509 1239 611 348 12554 --12302
NM_006076chr7103172 2808 2523 2446 2430 2357 2092 1142 1050 967 1211 ----
NM_006080chr742846 2352 2339 226 42564 2122 1002 36 ----
NM_006090chr11211 --1615 2237 42
NM_006095chr444066 2778 1516 1195 ----14304
NM_006113chr162023 2013 1927 1374 1308 420 11809 ----
NM_006122chr1582771 2717 2583 2041 1023 534 469 440 1647 31054 984 638 --
NM_006136chr7--1880 ----
NM_006141chr1632686 2165 541 1420 22292 1769 --
NM_006159chr12----1236 --
NM_006203chr555310 4315 3445 920 587 45077 4165 4068 42 11690 1856
NM_006206chr422165 1008 --32026 1094 81 --
NM_006212chr185258 4797 4155 3907 3602 3327 2105 918 11082 25412 878 --
NM_006241chr321780 1534 --11893 12310
NM_006251chr533284 998 677 ----1174
NM_006252chr155880 5243 2919 1626 1251 25075 2013 16986 1184
NM_006256chr1----1908 --
NM_006275chr2031869 1532 326 12351 1203 --
NM_006283chr8----13134 21929 99
NM_006307chrX1250 ------
NM_006323chr41737 ------
NM_006330chr811181 --21075 25 --
NM_006353chr6----188 --
NM_006357chr24350 190 175 35 ------
NM_006359chrX32150 696 208 1786 --11672
NM_006362chr11----1217 --
NM_006364chr142319 158 11201 ----
NM_006380chr1753934 3160 1589 806 242 13696 2739 155 2452 296
NM_006403chr651821 1695 596 291 94 ------
NM_006421chr821019 953 3788 274 214 --11117
NM_006449chr231655 424 273 11440 1677 1876
NM_006489chr142773 308 --178 --
NM_006496chr131405 1300 735 --21261 120 --
NM_006519chr61120 ------
NM_006538chr2134161 3720 3381 2992 2802 2553 1273 1079 1009 617 271 187 33 ----12856
NM_006544chr1425694 636 --14966 1248
NM_006546chr1766112 5416 4471 1982 580 117 24857 47 14587 34507 4134 356
NM_006549chr1282787 2621 2534 1978 591 536 242 106 1384 11873 --
NM_006601chr1211054 ------
NM_006603chrX1565 ----1819
NM_006609chr232188 820 330 --12474 --
NM_006614chr323575 3177 1770 13521 --
NM_006628chr15104380 3834 3385 3375 3346 1636 637 545 159 116 --11016 21828 1083
NM_006699chr162535 2237 2055 1801 1046 150 11788 52665 2106 2043 1926 356 12134
NM_006713chr5----1114 1749
NM_006717chr953289 2978 2661 130 55 ------
NM_006729chrX75611 5556 5390 4128 3584 1464 1374 21991 1006 13501 11430
NM_006734chr611028 ------
NM_006735chr7----1349 --
NM_006738chr1554370 3756 1540 1116 1030 --23636 1349 14188
NM_006745chr4--184 --1193
NM_006756chr8--21263 340 ----
NM_006766chr861998 1782 802 485 229 109 21775 593 22368 2131 22143 1882
NM_006769chr11229 ----1664
NM_006775chr62887 561 12037 --1959
NM_006791chr151247 ------
NM_006806chr21145 --1293 --
NM_006826chr23987 848 266 ----1210
NM_006827chr1462672 2666 2359 693 582 46 13413 ----
NM_006873chr283168 2844 2585 2525 888 722 508 80 --22375 478 --
NM_006885chr1624192 2950 23684 626 23693 1169 11583
NM_006914chr91306 11125 ----
NM_006924chr172952 365 14389 44124 3289 3142 26 --
NM_006925chr141153 ------
NM_006981chr922896 723 42839 1008 495 314 1188 1125
NM_007005chr931293 983 455 21401 1317 --21473 998
NM_007006chr1632725 2332 934 183 168 1516
NM_007023chr2--2719 308 ----
NM_007030chr5135081 3970 1832 1539 1391 1312 1093 1025 536 529 400 300 95 --14112 11846
NM_007034chr1174 ------
NM_007038chr2165581 4521 3987 3723 290 138 21960 1864 1778 --
NM_007039chr1421957 903 ------
NM_007050chr20157933 7277 7088 6817 6785 6739 6498 6054 5818 4922 3163 1645 735 348 255 25955 1888 15251 --
NM_007054chr553243 3137 1354 245 113 ----2752 566
NM_007055chr10----1839 --
NM_007106chr131397 1294 --1811
NM_007114chr353095 2771 2540 330 113 12268 --12287
NM_007137chrX104995 4632 4553 4390 4059 3834 1553 1456 642 469 44461 4160 3375 1281 1481 --
NM_007146chr1782887 2625 2474 2094 1971 1895 370 296 11787 21074 446 --
NM_007159chr31109 ----21542 1500
NM_007175chr863325 2665 2274 1073 906 328 --22802 849 1491
NM_007187chr132923 808 ------
NM_007195chr1873608 3486 3446 2911 2859 2693 669 ------
NM_007200chr1554370 3756 1540 1116 1030 --23636 1349 14188
NM_007214chr6----11335 21074 332
NM_007216chr1121141 374 ----11172
NM_007235chr121428 ------
NM_007242chr16--1185 ----
NM_007249chr1377974 7502 6575 2959 2375 1458 706 3974 499 134 27287 1487 16560
NM_007269chr11199 ------
NM_007282chr31938 ----2931 92
NM_007292chr1794890 4184 4028 3836 1900 1629 1568 462 300 23692 1357 41655 1513 754 397 --
NM_007322chr191502 ------
NM_007353chr772920 2568 1014 893 695 475 403 --21205 686 --
NM_007373chr1031733 428 83 ------
NM_012096chr3163 --1732 13299
NM_012129chr751886 1675 322 291 137 21769 732 ----
NM_012141chr1334085 2956 2694 23592 1262 --13951
NM_012156chr2082844 2767 2387 2362 2108 794 278 225 23086 2307 1399 12587
NM_012164chr967164 5432 2821 1854 1282 614 21637 730 22150 1900 11021
NM_012199chr133987 1448 370 13843 33111 1730 803 --
NM_012214chr2115112 4867 4108 4089 2132 1629 1618 1471 1445 837 114 24066 1639 ----
NM_012234chr333062 2782 1340 ----12551
NM_012238chr1031681 1156 576 ------
NM_012243chr11620 ----1284
NM_012249chr232251 1035 725 ------
NM_012250chr1111035 ------
NM_012252chr711507 34462 1926 158 25228 1341 --
NM_012257chr7--1304 ----
NM_012262chr133462 3418 890 23938 3772 15246 --
NM_012266chr91307 ------
NM_012281chr7192 1839 --1559
NM_012286chrX1237 ------
NM_012287chr344415 3674 3358 238 11749 ----
NM_012290chr211570 11337 11187 11441
NM_012296chr11143948 3919 3666 3456 1356 1335 1237 1060 1043 1003 687 660 628 517 21249 943 23280 681 --
NM_012300chr532111 772 227 ------
NM_012306chr1283288 2949 2806 2573 687 520 349 310 --32554 809 324 12430
NM_012309chr1184437 4368 3866 3517 1893 1310 1293 283 1570 ----
NM_012316chr195147 5121 3902 3808 3518 2225 1826 788 51 --24313 1023 --
NM_012325chr2041305 267 201 146 ----21407 1198
NM_012338chr7------191
NM_012421chr11107 ------
NM_012428chr151952 --1195 --
NM_012479chr721821 245 11106 11024 --
NM_012482chr11672 ------
NM_013255chr756602 3116 2138 819 603 36173 5956 2756 48825 6572 1682 896 12314
NM_013261chr443232 2975 2558 1022 13318 22633 655 --
NM_013269chr1222881 697 1958 43600 1447 1207 880 --
NM_013277chr121253 --11020 --
NM_013280chr115718 706 580 287 204 1129 1163 1590
NM_013283chr51298 ------
NM_013302chr1653458 3205 3179 1757 1343 1186 --24332 1843
NM_013309chr1542266 2183 1886 1629 12564 ----
NM_013330chr11179 ------
NM_013363chr3--170 ----
NM_013381chr12--11630 ----
NM_013396chr2121080 162 --11069 --
NM_013411chr152572 2441 2014 1086 77 1260 22784 1762 --
NM_013436chr2158 ------
NM_013444chrX2902 475 1824 1752 --
NM_013450chr21229 ------
NM_013943chr182945 2884 2650 2644 1038 604 336 79 186 1672 12248
NM_013951chr252297 1906 831 821 221 1840 ----
NM_013952chr252374 1983 908 898 298 1917 ----
NM_013953chr252374 1983 908 898 298 1917 ----
NM_013989chr1464855 4444 4380 3770 761 592 25074 721 14839 25043 3152
NM_013992chr252374 1983 908 898 298 1917 ----
NM_014011chr231046 941 652 --11929 --
NM_014016chr3----5407 316 256 138 50 --
NM_014021chr123409 394 13379 1771 --
NM_014034chr621215 1168 --1995 1124
NM_014048chr1644771 3774 1726 494 --12084 14870
NM_014112chr834501 4351 466 25260 4648 24370 1398 --
NM_014141chr764869 4496 4014 3713 3343 564 13252 15143 14565
NM_014155chr1156819 5283 2642 1939 1431 36631 2791 171 ----
NM_014181chr221149 1019 12068 --12816
NM_014186chr1162291 847 476 224 105 71 11652 --12142
NM_014212chr12----1608 --
NM_014217chr141307 1300 1255 1194 --1729 21563 715
NM_014221chrX--1146 2177 136 --
NM_014253chrX2375 237 11564 --11003
NM_014305chr13----3666 248 145 1706
NM_014309chr2274355 3626 3475 1810 1167 566 435 --33619 1847 1352 --
NM_014325chr1232035 1684 1664 189 --21724 189
NM_014331chr467238 6654 6642 5324 4722 1531 46849 6686 2532 1956 --17426
NM_014333chr111791 1840 --1287
NM_014393chr852091 2006 1944 1702 930 12081 ----
NM_014399chr71380 ----1290
NM_014415chr31187 ------
NM_014421chr442067 1639 858 30 --190 --
NM_014423chr542259 1714 1118 407 ----15148
NM_014431chr1041483 1466 645 285 11110 11384 11266
NM_014454chr61833 ------
NM_014462chr8198 ------
NM_014469chr11--2812 274 ----
NM_014491chr7------1357
NM_014522chrX2209 130 --2175 35 --
NM_014547chr15187 --1296 --
NM_014547chr15187 --1296 --
NM_014570chr2221029 97 ----1413
NM_014577chr221676 ----1575
NM_014584chr1421466 419 ------
NM_014585chr21932 1160 2830 69 1873
NM_014620chr121685 ------
NM_014630chr1573574 1504 1369 909 659 405 64 --12555 23191 3080
NM_014634chr22103472 3172 3074 2858 2493 1257 1138 1017 789 544 --23642 2826 --
NM_014665chr8103248 3177 3161 3121 2783 2672 2654 2646 2509 1353 --22392 772 13235
NM_014667chr352237 1643 718 633 283 22250 209 --11987
NM_014670chr2143 ------
NM_014674chr353874 3686 3512 3271 2491 13437 33114 2719 1267 12731
NM_014676chr121649 89 ------
NM_014682chr842081 1463 940 804 11771 ----
NM_014683chr1721732 230 12081 2857 224 --
NM_014707chr721524 102 1504 ----
NM_014721chr666393 6220 6107 1608 1205 292 22856 2531 22598 2504 12877
NM_014727chr191215 ------
NM_014729chr821922 301 ----32188 823 715
NM_014732chr16105096 2331 1867 1749 1523 993 678 613 360 25 45877 937 796 548 45052 4829 4094 1613 11084
NM_014738chr171719 ------
NM_014739chr621578 32 21063 202 33955 1123 895 --
NM_014751chr861469 1436 1328 841 527 411 11795 --11948
NM_014764chr12----11280 --
NM_014765chr122629 144 11850 12599 --
NM_014767chr10103421 3319 2637 2470 1390 860 823 738 269 43 12916 1879 --
NM_014787chr152079 1815 1047 453 29 --1238 --
NM_014795chr22156 117 ------
NM_014826chr143588 2719 705 125 13019 42990 1458 802 554 31057 981 790
NM_014828chr1461902 828 762 601 231 149 12186 12248 --
NM_014832chr1321498 193 126 ----
NM_014836chr1011791 ------
NM_014839chr141878 1727 394 159 --2426 264 1693
NM_014841chr61954 ------
NM_014850chr341362 907 571 108 14207 24252 138 1641
NM_014857chr1------1220
NM_014873chr141720 1475 1089 743 14076 --23490 3098
NM_014877chr1776739 5925 5146 5016 1797 639 56 26369 1120 25826 223 --
NM_014893chrY31636 908 646 --1500 1537
NM_014904chr1043951 3833 878 353 --23553 3506 22464 394
NM_014906chr1711095 23044 62 --11175
NM_014909chr1493551 3110 1507 1210 1167 1154 779 656 486 73991 3583 3319 2844 1372 1364 1332 22560 1476 23539 120
NM_014910chr192689 34 124 --1314
NM_014912chr1023027 299 --3210 203 195 --
NM_014920chr672917 1142 1043 903 707 456 43 11029 23420 89 --
NM_014923chr13----21970 888 11577
NM_014934chr1311350 --33720 3652 2788 13983
NM_014946chr252693 804 741 358 326 --22929 26 --
NM_014947chr132943 2355 1051 --32632 2188 466 12589
NM_014953chr1333546 3044 1754 33007 1163 574 1209 --
NM_014962chr2032869 2532 2521 1747 1931 --
NM_014969chr12991 760 --3962 754 245 --
NM_014988chr421944 752 1596 --1406
NM_014991chr432187 162 37 12819 --53115 2445 2050 905 875
NM_014992chr14----1632 --
NM_014996chr3----146 --
NM_014997chr732470 876 477 21841 953 173 --
NM_014999chr1251671 1654 1635 1511 1309 ----2605 148
NM_015000chr1222601 1131 --2884 507 --
NM_015008chr343633 2524 1468 1149 154 12910 12440
NM_015009chr31775 2627 53 ----
NM_015020chr1663306 3182 2809 2505 2470 39 2968 647 1835 --
NM_015026chr1264651 4011 3710 3606 3215 92 24693 28 ----
NM_015027chr1611811 --1197 --
NM_015032chr1322203 235 ----12323
NM_015033chr932663 2023 830 --12992 1494
NM_015035chr20106521 6437 6110 5926 5818 4882 4729 1985 1546 1129 25661 381 22350 652 11117
NM_015039chr143829 3297 1537 1090 23652 3611 33872 1392 518 21409 149
NM_015050chr641137 915 358 322 --21331 29 1181
NM_015051chr932842 2711 869 2828 607 --12472
NM_015052chr731357 993 423 11244 1866 11169
NM_015055chr114627 280 49 34 11093 22254 649 --
NM_015064chr1273607 3581 3093 2909 2467 2365 691 --3277 269 211 12444
NM_015068chr733659 3121 2586 33301 657 403 23396 1570 --
NM_015071chr555093 4955 4396 3944 221 13971 34560 4450 523 14812
NM_015082chr552417 2287 2004 1716 411 22311 646 --1981
NM_015137chr822267 694 --1395 22180 830
NM_015144chr1673418 2727 2714 1245 935 613 151 11583 --1272
NM_015154chr1573112 2906 2517 2321 2138 2091 535 12107 1771 1528
NM_015156chr1453587 2758 1495 994 979 --13988 --
NM_015178chr872581 2442 2205 1765 385 226 187 22222 513 21042 205 --
NM_015191chr1132201 2077 1737 22414 367 22345 323 32233 2114 1084
NM_015194chr17112014 1790 1585 1376 1295 776 602 585 579 536 301 --2388 367 --
NM_015200chr432529 2342 2068 21754 198 12108 --
NM_015206chr151586 --12665 13033
NM_015208chr1853992 3599 3243 713 539 1691 --12706
NM_015247chr1694554 4428 3555 3315 2062 2037 1758 1113 39 35171 1226 1053 15248 22154 1218
NM_015277chr1831431 274 105 194 31776 1488 81 --
NM_015282chr262647 2386 2346 1858 626 25 1341 22753 156 21973 1178
NM_015285chr1832375 1877 165 12123 1216 1652
NM_015288chr563621 3088 2926 2651 826 760 --22405 552 --
NM_015299chr1453836 3375 2570 1367 515 23219 345 33526 2562 2519 --
NM_015310chr888185 7067 6878 6669 6653 1368 1158 469 27657 6885 23245 3037 57114 5943 5913 5378 816
NM_015313chr1161869 1346 1320 1230 941 28 1952 1494 24686 90
NM_015317chr2--1902 11927 12563
NM_015335chr1211901 11938 1573 12287
NM_015355chr17----11676 --
NM_015365chrX139 1172 33503 1590 275 13375
NM_015384chr5------1127
NM_015393chr473276 2904 2866 2661 757 628 64 --1290 --
NM_015396chr321468 109 ----11137
NM_015429chr31795 ------
NM_015446chr111593 ------
NM_015455chr543909 3317 1589 796 12950 11553 22905 985
NM_015458chr855073 4599 4117 4091 1978 --14807 --
NM_015461chr181588 ------
NM_015535chr2----1418 --
NM_015548chr62404 119 ----2736 76
NM_015550chr753150 2618 2514 2360 1073 --1206 22577 361
NM_015556chr141153 ----1183
NM_015564chr542815 2330 1268 507 1356 12684 --
NM_015565chr211486 11672 --12208
NM_015578chr1952061 1988 1678 366 233 --1728 --
NM_015635chr922128 555 11686 --1901
NM_015691chrX52498 2471 2465 2459 440 --1620 22833 1903
NM_015840chr172597 2360 2132 785 769 657 612 22002 232 11872 --
NM_015841chr172597 2360 2132 785 769 657 612 22002 232 11872 --
NM_015852chr722229 241 22416 2299 ----
NM_015859chr141123 ------
NM_015879chr1888092 6756 5917 3016 3010 1313 386 175 11375 12926 17535
NM_015885chr113754 554 214 --1181 --
NM_015886chr875087 4329 1903 1629 1193 823 417 --11415 1763
NM_015906chr144433 3180 805 509 --24778 332 --
NM_015912chr831646 1579 818 --21572 737 12260
NM_015949chr71900 ------
NM_015990chr41744 ------
NM_015995chr1575272 4854 4457 2056 1446 1357 829 65067 4691 3759 3501 1372 730 43639 3478 840 585 --
NM_016018chr842612 1876 663 252 1572 1698 1331
NM_016061chr251619 1047 260 215 199 --1108 --
NM_016072chr1211885 --11768 --
NM_016073chr151796 ------
NM_016075chr1343036 992 755 49 --22055 236 1326
NM_016083chr643010 2433 1509 712 ----13120
NM_016097chr18147 --11080 11017
NM_016120chrX51158 1138 1060 870 856 1992 1934 --
NM_016125chr171405 ------
NM_016169chr1082714 2295 2260 2161 1230 464 373 253 --22704 398 1517
NM_016206chr348044 6289 2524 1716 --13613 28500 407
NM_016213chr15--188 ----
NM_016221chr511642 12027 11953 1932
NM_016247chr31442 ------
NM_016252chr21863 ----1657
NM_016260chr247308 1646 1528 1126 1984 --27461 4927
NM_016287chr1------31535 366 348
NM_016297chr273501 3012 2877 2302 1420 1126 472 22640 75 ----
NM_016308chr121577 652 11869 --1537
NM_016374chr121344 284 ------
NM_016374chr121344 284 ------
NM_016418chr2293254 2761 2601 2464 1200 828 720 707 249 12682 22640 23 --
NM_016422chr1131131 333 327 --22182 433 --
NM_016454chr15------1224
NM_016480chr51915 ------
NM_016485chr621446 607 22232 2223 1795 --
NM_016488chr1211947 ------
NM_016513chr672917 1142 1043 903 707 456 43 11029 23420 89 --
NM_016530chr1553999 3558 2817 1358 416 12951 43149 1239 267 227 11016
NM_016531chr444019 3569 3440 741 --1849 13486
NM_016542chrX1669 --21556 1200 --
NM_016545chr11811 ------
NM_016577chr3113791 3562 3443 3085 3001 2907 2780 1755 1645 1635 779 13823 21779 1055 --
NM_016603chr522108 2033 ------
NM_016623chr82599 28 ------
NM_016628chr103238 205 194 ------
NM_016654chr1511388 --11024 --
NM_016836chr2----1669 --
NM_016839chr2----1669 --
NM_016929chr684239 3543 2909 1807 1726 1598 1265 1094 23550 207 21419 33 --
NM_016950chr431250 1172 528 ------
NM_016953chr236018 2026 824 25415 165 --15021
NM_017418chr9159 ------
NM_017420chr1442781 660 371 175 --1600 --
NM_017423chr432109 1446 220 ----12138
NM_017455chr151952 --1195 --
NM_017515chr1141181 296 255 44 3524 187 168 ----
NM_017580chr104425 111 78 22 11784 --31710 1599 1569
NM_017589chr11137 ------
NM_017590chr2292624 2316 2129 1037 1030 992 768 456 379 --11683 1709
NM_017594chr932697 2208 660 1437 23200 3010 --
NM_017610chr1561738 830 660 588 330 303 ------
NM_017628chr421444 979 34804 4347 3487 34769 4564 1513 14592
NM_017629chr151960 1941 1459 642 586 ------
NM_017633chr632390 1359 618 23832 1266 13690 --
NM_017634chr821780 1254 --11738 11720
NM_017637chr979120 8305 7196 3518 1810 1543 1227 17615 18538 38495 5790 631
NM_017641chr1211088 ------
NM_017657chr2----1870 --
NM_017658chr1434423 1772 308 ----14167
NM_017660chr1993249 2988 2724 1293 1271 1019 773 682 554 2875 290 1140 --
NM_017664chr1321000 31 --1421 2908 739
NM_017679chr17----1238 --
NM_017700chr4169 ------
NM_017709chr134241 2892 1139 42705 1675 1506 481 --13630
NM_017724chr32815 213 --1256 --
NM_017770chr642971 2777 919 910 --12953 --
NM_017813chr825756 387 21937 602 --13607
NM_017819chr3----1199 1230
NM_017831chr1864788 3988 1547 752 726 410 11060 ----
NM_017850chr1------1994
NM_017907chr111175 ------
NM_017919chr944816 4220 3779 384 11307 13817 24059 318
NM_017926chr143822 586 364 1863 --1599
NM_017933chr2----11516 --
NM_017935chr4--1117 --1507
NM_017972chr143822 586 364 1863 --1599
NM_017994chr772879 2676 2401 2138 2109 906 399 --12631 1539
NM_018010chr331507 424 314 11262 --11431
NM_018027chr1053201 3136 2905 1019 430 32533 1327 78 33214 2129 2086 --
NM_018046chr531737 1438 721 --11446 1553
NM_018064chr6----1336 --
NM_018085chr1138026 7668 7557 7547 7205 6313 6287 2608 2583 2205 1805 1384 1358 22741 364 28010 6574 15419
NM_018112chr93394 344 178 ------
NM_018126chr41973 ------
NM_018157chr1222753 328 31083 412 230 12162 13093
NM_018184chr342081 1576 1403 250 ----1578
NM_018200chr1532352 1871 107 196 --1345
NM_018227chr423040 1081 --1875 --
NM_018243chr423797 773 1170 23878 3211 11409
NM_018246chr882900 2288 2127 1930 835 606 56 44 ------
NM_018256chr2179 ----187
NM_018323chr421163 310 --11299 1225
NM_018326chr7--1200 --2695 247
NM_018327chr204594 496 400 309 1728 11299 1177
NM_018334chr71445 ------
NM_018338chr31259 166 ----
NM_018340chr1653065 1742 1717 520 483 11131 55051 3718 3575 1988 879 13669
NM_018353chr141210 ----1681
NM_018362chr1143648 3034 1079 257 ------
NM_018373chr1466042 5888 5205 2334 1464 1232 --25680 4577 --
NM_018374chr734806 4642 965 11043 ----
NM_018403chr382961 2935 2628 1171 459 373 78 28 --43788 3482 1624 989 23166 949
NM_018413chr12----1209 --
NM_018425chr1031816 737 390 1744 --32595 2253 70
NM_018427chr1621339 537 ----11584
NM_018439chr182908 887 --12317 2992 81
NM_018440chr888067 7804 6844 6353 6327 2658 2084 1881 47604 5922 3128 2348 11967 --
NM_018448chr1211096 ------
NM_018471chr21464 ----1237
NM_018489chr131751 1641 250 11567 --22216 2052
NM_018557chr2----11101 --
NM_018566chr154944 4701 3672 3627 758 --2433 326 13797
NM_018638chr1232281 1198 508 14266 23747 1967 1922
NM_018650chr1--11995 1110 12049
NM_018671chr15----1372 --
NM_018691chr51117 --1803 2237 74
NM_018700chr511627 ------
NM_018704chr141810 1417 567 355 1161 1341 --
NM_018717chr472849 2235 1789 1768 998 325 221 ----22504 1016
NM_018719chr741087 1044 550 183 --1494 1121
NM_018834chr52780 240 --1296 --
NM_018840chr201357 --1465 --
NM_018847chr91259 31776 1693 217 ----
NM_018947chr764847 4316 4011 3111 1935 1552 --2937 745 14979
NM_018970chr743095 3060 2951 2505 32969 2516 2185 1804 --
NM_018976chr122851 111 --21893 139 --
NM_018982chr1388 79 70 2449 164 --163
NM_018993chr2021261 508 --1308 21012 920
NM_018999chr1034308 3771 1189 --1645 13230
NM_019000chr51619 ------
NM_019001chr343889 3593 3430 1421 13215 33745 3641 3573 12984
NM_019003chrX152 ------
NM_019004chr712366 ------
NM_019006chr15187 --1250 1275
NM_019044chr284548 4194 3276 2970 1520 1206 833 477 14115 43376 1103 1050 781 24431 928
NM_019045chrX--1177 ----
NM_019072chr5166 --12649 13125
NM_019091chr21284 ------
NM_019116chr1672839 2781 2622 1380 983 955 751 13241 13496 --
NM_019556chrX1503 --1172 11233
NM_019593chr2062915 2540 2323 2292 721 664 --11235 1998
NM_019610chr1----11432 --
NM_019860chr1031224 618 56 --1127 2429 25
NM_019891chr111285 --11275 1852
NM_019895chr31432 ------
NM_020116chr431810 1304 306 11617 --11249
NM_020122chr274072 3703 3677 2251 840 729 213 14884 55139 4053 2161 2125 691 --
NM_020123chr101963 ----11032
NM_020144chr721731 628 ----11384
NM_020148chr18--12935 --32146 2103 879
NM_020151chr2----170 --
NM_020159chr41378 ------
NM_020182chr2062663 1392 1128 725 445 47 11437 1804 1752
NM_020205chr131402 826 353 13145 1219 1987
NM_020245chr675126 4732 4523 3863 1620 692 453 23495 605 34967 3234 1554 24548 34
NM_020337chr453070 1979 722 663 257 --11225 1865
NM_020341chr201314 22037 1827 11820 11885
NM_020342chr211705 21013 309 --1329
NM_020346chr11------1254
NM_020390chr353600 3348 630 205 48 14278 --14713
NM_020440chr193182 2972 2801 1319 1313 1214 1044 896 368 23037 2364 13241 --
NM_020443chr186633 6408 5669 4675 1937 1786 1470 36 21655 426 24342 2326 16767
NM_020447chr15132532 2482 2212 2169 1945 1050 855 613 508 304 216 184 120 32386 1810 398 12021 22340 1990
NM_020465chr1651522 1502 1304 723 153 21797 639 ----
NM_020466chr654748 1908 1692 971 485 1942 23034 1707 --
NM_020654chr31309 ------
NM_020686chr1652679 2628 2602 1035 888 12946 32043 513 200 22618 2092
NM_020699chr164662 4322 3867 1395 565 508 21928 1613 11245 13553
NM_020704chr712110 ----1793
NM_020706chr21148 ------
NM_020711chr21461 --21877 136 --
NM_020717chrX64869 4379 3576 1926 973 503 24896 4180 14617 13823
NM_020718chr1696511 6370 5072 4475 4168 4032 416 379 256 25187 691 14382 --
NM_020739chr1553654 3155 1576 1024 926 ----12563
NM_020749chr852046 1337 758 143 46 --32008 829 55 --
NM_020766chrX31430 428 54 ----1859
NM_020771chr621111 52 --21391 1098 --
NM_020772chr1778647 7921 7820 2791 2046 114 99 28157 1250 48283 8164 1112 803 11347
NM_020782chr1254079 3325 1462 1337 284 --24670 1834 --
NM_020813chr193897 809 183 --11791 1104
NM_020819chr621111 77 ------
NM_020824chr101663 ------
NM_020825chr1673677 1162 947 672 577 490 407 2653 123 --12382
NM_020839chr34286 225 212 187 11112 --11414
NM_020841chr1263239 2983 943 664 658 130 ----14010
NM_020843chr152158 120 ------
NM_020858chr1531718 466 346 11614 11813 11579
NM_020865chr32168 115 ------
NM_020871chrX21982 565 1490 12010 11757
NM_020886chr1151332 1215 1089 528 347 1215 ----
NM_020918chr1033272 3037 197 --12573 13102
NM_020922chrX1191 ----2552 176
NM_020956chr19114743 4386 4090 3807 3739 3544 3430 3316 3046 1440 988 --21234 883 --
NM_020962chr15193 ------
NM_020975chr10--11341 11918 11685
NM_020988chr161942 --2182 172 --
NM_021032chr341545 1487 1278 301 21805 205 21656 503 --
NM_021033chr1342240 2201 1069 1057 --32924 86 77 1921
NM_021072chr521761 1054 21798 25 ----
NM_021129chr10----1100 --
NM_021183chrX22046 692 22185 1694 198 --
NM_021190chr131281 915 183 ----1991
NM_021204chr41276 ----1223
NM_021205chr132867 718 89 ----12573
NM_021239chr1411228 --21136 334 1119
NM_021252chr1032017 1585 720 ------
NM_021255chr1463181 2619 1383 1321 478 154 --33392 2899 353 23144 1131
NM_021620chr61693 ------
NM_021629chr384426 4301 3553 1928 1902 1722 1657 93 13370 1286 --
NM_021647chr431799 993 817 --21294 211 13748
NM_021813chr655072 4905 1046 826 173 --24764 4515 --
NM_021831chr2--1263 ----
NM_021911chr554906 4180 2061 856 747 1753 --11493
NM_021923chr461485 1352 945 577 429 77 ------
NM_021961chr1177384 6675 5220 5060 1511 1318 632 1343 45494 2892 2846 319 47239 7065 5959 5697
NM_021963chrX1168 ------
NM_021988chr20198 ------
NM_022041chr1622590 234 173 --12365
NM_022048chr1565089 5006 4784 4476 2394 1940 45579 5560 4513 2031 26009 415 --
NM_022051chr1----1281 --
NM_022114chr1114665 4459 4158 3683 785 745 709 638 362 284 245 11270 24722 465 1947
NM_022154chr421278 311 1897 1458 --
NM_022166chr16136294 6091 5986 5443 5422 4907 4163 2505 2209 1323 341 164 31 21998 843 46338 6160 4372 1891 36249 2065 2036
NM_022340chr383142 3132 986 960 722 75 59 44 2343 131 11254 --
NM_022351chr833461 3079 1009 --12622 13301
NM_022361chr61495 ------
NM_022442chr20198 ------
NM_022456chr1267070 5347 2140 2134 1404 331 12000 15544 22426 1891
NM_022458chr782971 2508 2342 2335 2158 482 260 221 1912 2399 75 --
NM_022469chr143388 2664 2056 650 12069 12160 11082
NM_022484chr71372 ------
NM_022491chr1293522 3390 2741 2477 2326 1252 711 505 493 1384 --11406
NM_022648chr2134326 4221 3802 3571 3474 3087 1445 1438 1326 1305 1188 845 678 --1157 --
NM_022658chr1221300 1161 ----1417
NM_022726chr6----1578 --
NM_022756chr12378 35 ----1226
NM_022758chr693012 2628 2425 2138 1109 733 513 149 86 1849 23111 2393 13157
NM_022841chr151422 22192 85 2199 125 --
NM_022894chr22544 168 ------
NM_022898chr1443953 3137 931 265 13225 13829 14118
NM_022900chr71967 ------
NM_022910chr1651522 1502 1304 723 153 21797 639 ----
NM_022918chr1141962 1320 527 294 --11535 --
NM_023037chr133898 812 150 ----11050
NM_023929chr822774 2303 11840 ----
NM_024052chr1762530 2523 2170 1107 480 443 22113 702 13110 --
NM_024076chr19102330 2185 1754 1739 1713 1672 735 613 318 96 --22276 379 1456
NM_024090chr431188 555 298 11740 --1520
NM_024294chr693012 2628 2425 2138 1109 733 513 149 86 1849 23111 2393 13157
NM_024345chr994528 4192 4093 3707 2029 1753 1494 1170 391 16073 15354 11385
NM_024408chr14813 766 346 22 --13652 11388
NM_024494chr12251 125 --1585 --
NM_024511chr453480 2964 2918 2354 665 1499 1636 --
NM_024523chr7----1269 21268 947
NM_024524chr31816 --1767 11152
NM_024563chr531455 645 205 21645 651 --11749
NM_024569chr152721 2634 2205 694 61 32513 968 826 --1138
NM_024574chr41372 --131 --
NM_024582chr41931 ----1323
NM_024653chr741416 1068 330 213 ----21004 989
NM_024665chr324532 306 23719 1736 33964 3444 1087 --
NM_024721chr842632 910 614 191 --2711 593 --
NM_024744chr21867 22492 780 --1790
NM_024824chr14122 --11595 1664
NM_024834chr1011844 ----21870 1632
NM_024885chrX153 1741 --1169
NM_024896chr931752 1588 869 --12480 11681
NM_024900chr421777 539 ----11668
NM_024900chr421777 539 ----11668
NM_024920chr411096 11079 1634 --
NM_024947chr379599 8657 7219 5904 2676 1684 1598 18370 17812 13847
NM_024953chr1232501 840 737 ----22133 1849
NM_024956chr15133 --1174 1187
NM_024963chr7145704 5201 5063 4779 4475 4440 3932 2178 2141 2133 2006 1785 1103 543 15317 21971 50 14242
NM_024979chr1351642 1508 1196 1101 152 --21407 134 11429
NM_024989chr298055 7362 6942 6279 5161 1762 1518 1292 1213 26517 6093 17845 17009
NM_025054chr833605 3161 27 33778 1646 789 11312 24014 764
NM_025073chr134311 3764 3636 ----14540
NM_025133chr2----11111 --
NM_025134chr1642292 2007 1030 959 --1444 --
NM_025146chr332484 2350 336 ----11699
NM_025179chr164638 4585 3840 3307 1968 1488 44428 3045 1328 524 ----
NM_025181chr2------177
NM_025221chr411313 11093 --21355 1229
NM_025237chr1741517 1060 636 461 1301 21388 1259 --
NM_025246chr3------1134
NM_030621chr1441586 1043 401 116 --23584 3391 24173 2742
NM_030625chr102730 188 ------
NM_030627chr543459 2652 715 164 12589 13234 --
NM_030647chr766059 5133 2027 1626 763 217 24006 1487 35885 1062 55 --
NM_030648chr465271 4472 4463 4386 4208 1559 14658 --21910 1238
NM_030674chr1254824 4214 3756 1685 1661 --11350 14943
NM_030780chr821572 1317 1680 ----
NM_030786chr11189 ----11207
NM_030799chr562006 1861 800 582 463 102 --12146 --
NM_030806chr1128997 7664 7631 7376 7120 6912 5695 2867 1842 1688 1210 688 52974 2917 2738 2702 1834 48976 8561 1517 827 13029
NM_030816chr153046 2453 928 650 570 13447 12757 --
NM_030817chr12----13606 23710 1355
NM_030915chr251765 1657 1620 620 137 1461 --21845 664
NM_030918chr184834 4341 4305 4247 4238 3878 2009 1590 31050 801 454 13509 14367
NM_030920chr13685 543 192 11324 11998 --
NM_030939chr611008 1940 --2883 764
NM_030945chr522170 975 --11819 11864
NM_030965chr1--197 --1786
NM_030979chr131288 ------
NM_031216chr181502 ------
NM_031243chr751918 902 668 465 147 11902 1308 1169
NM_031268chr16165416 4954 4783 4549 4541 4160 4072 4029 3862 3704 3462 3441 1805 1058 1039 114 53760 1675 928 899 121 14173 --
NM_031369chr41269 ------
NM_031370chr41269 ------
NM_031371chr121344 284 ------
NM_031371chr121344 284 ------
NM_031445chr233441 1042 625 ----12151
NM_031449chr771958 1916 1731 1598 741 594 418 --21491 243 1644
NM_031468chr776811 6453 6283 6228 5326 2582 113 57308 2993 2403 2302 2219 77324 6095 2484 2422 2197 2036 1269 21730 725
NM_031469chr653416 3368 1515 1457 1252 11431 23355 491 13544
NM_031476chr1662783 2028 2003 1012 684 460 --11850 --
NM_031844chr133170 3145 2493 13494 21592 642 --
NM_031845chr222579 55 ----43416 2856 448 174
NM_031847chr222579 55 ----43416 2856 448 174
NM_031886chr1942131 2055 682 600 21862 1643 122 1578
NM_032012chr954573 3296 1191 875 120 21783 486 14808 14956
NM_032042chr512614 ------
NM_032102chr1132773 2202 771 12380 32581 1940 643 12867
NM_032105chr145898 5417 2367 603 36042 5851 1376 37592 6904 5367 --
NM_032121chrX--11983 12627 12222
NM_032189chr1395037 4983 4391 3959 3785 3591 647 468 171 13251 33803 3069 212 14596
NM_032208chr252653 2468 1453 1047 575 23163 2592 2551 341 --
NM_032217chr42464 26 1421 1130 --
NM_032312chr2--1923 ----
NM_032321chr232508 2487 544 1790 ----
NM_032352chr1411261 --1589 11199
NM_032373chr1065705 5258 4077 1779 1015 600 14618 1928 15740
NM_032377chr191634 ------
NM_032434chr211077 ------
NM_032435chr132233 2169 888 ----12324
NM_032440chr1062852 2512 2351 762 292 114 ------
NM_032457chr452480 1533 1496 445 352 23760 1024 --1190
NM_032458chrX13127 12919 ----
NM_032466chr8----11553 --
NM_032471chr61836 1914 --1414
NM_032491chr121253 ------
NM_032505chr332734 2196 137 12531 ----
NM_032509chr82907 786 --141 11858
NM_032536chr91606 ------
NM_032547chr42209 129 ------
NM_032557chr41295 ------
NM_032558chr921251 368 1300 ----
NM_032574chr2140 ------
NM_032590chr122899 778 --1469 --
NM_032626chr16------1138
NM_032632chr1421319 398 ------
NM_032664chr821541 628 ------
NM_032682chr343062 2861 2543 395 --23218 2879 --
NM_032784chr6124 ------
NM_032787chr3----1292 --
NM_032804chr1042234 1578 775 605 ----12401
NM_032838chr19----11099 31078 323 98
NM_032857chr15----1167 --
NM_032859chr1322918 603 13439 31319 919 45 22714 731
NM_032876chr1441882 106 96 34 1739 ----
NM_032968chrX21050 957 13900 23800 1210 --
NM_032969chrX21050 957 13900 23800 1210 --
NM_032973chrY21050 957 13892 23792 1210 --
NM_032983chr741297 1162 1021 472 12979 2591 225 --
NM_033020chr144433 3180 805 509 --24778 332 --
NM_033055chr11822 ------
NM_033083chr322945 2622 12630 22657 230 --
NM_033133chr1763406 2494 2385 1437 897 773 21431 677 --23128 3081
NM_033138chr742063 731 53 37 --21782 341 --
NM_033139chr742063 731 53 37 --21782 341 --
NM_033140chr742063 731 53 37 --21782 341 --
NM_033157chr742063 731 53 37 --21782 341 --
NM_033181chr643010 2433 1509 712 ----13120
NM_033219chr9143 ------
NM_033224chr7107802 7344 6432 5943 5261 2215 2006 753 704 115 11513 47495 6197 2957 1916 58105 4986 2947 2548 2276
NM_033225chr81632 ----11023
NM_033274chr553047 2781 675 667 389 22560 1166 43380 2450 362 51 --
NM_033285chr854153 3736 1692 1370 687 --1711 12934
NM_033360chr1244199 3438 3360 238 ------
NM_033389chr1764854 4727 3709 1763 700 132 24114 3063 24408 3748 11934
NM_033394chr22546 317 --11368 --
NM_033406chr113275 244 50 ------
NM_033407chr12496 147 1451 1592 --
NM_033426chr1452584 2055 1873 283 253 22869 2810 11827 12920
NM_033430chr432813 2647 1377 ----11353
NM_033437chr432813 2647 1377 ----11353
NM_033495chrX----1833 --
NM_033505chr2105896 5199 4517 2318 2297 1651 822 734 295 223 25242 127 34969 4197 1642 26454 5684
NM_033631chr163242 3077 654 642 634 317 1543 --12624
NM_033637chr1053368 2665 1021 942 391 12638 11413 1494
NM_033644chr532111 772 227 ------
NM_033645chr532111 772 227 ------
NM_033656chr2164958 4268 1635 1261 972 540 24172 3818 25994 3744 --
NM_044472chr1------154
NM_052834chr1832375 1877 165 12123 1216 1652
NM_052845chr1242130 999 968 583 --11249 31015 306 261
NM_052879chr1213060 --23080 1148 1289
NM_052896chr131810 794 238 3647 220 71 11670 31929 582 563
NM_052906chr22124670 4636 4293 4019 1914 1453 1045 1008 958 468 297 125 13567 24850 3629 24066 3894
NM_052907chr12103949 3533 3491 3461 3222 1584 1489 1106 1052 1009 11197 1639 --
NM_052911chr18--1642 11005 --
NM_052918chr1023676 795 --13216 1480
NM_052927chr522165 1882 1529 --1374
NM_052937chr842414 2208 1066 442 12161 11971 --
NM_052953chr3--157 ----
NM_052978chr1411365 11450 21603 1444 11775
NM_053001chr81256 ------
NM_053016chr9127628 6811 6777 6634 5858 5658 5649 5029 3177 2870 2295 2107 --22302 620 26027 4833
NM_053042chr422437 77 33068 2046 1139 --196
NM_053043chr7125955 5107 4605 4289 2460 2309 1582 1128 500 424 289 78 14296 11736 --
NM_053067chr9----1340 --
NM_054016chr12699 346 ------
NM_054016chr12699 346 ------
NM_054016chr12699 346 ------
NM_057175chr432125 2076 884 1339 --2963 550
NM_057178chr1732153 1783 105 196 21969 79 1819
NM_058172chr43626 455 269 11312 1308 --
NM_078470chr1032241 519 241 --42708 1785 1735 1705 11764
NM_080391chr12552 525 ------
NM_080392chr13601 574 51 ------
NM_080422chr18------1242
NM_080423chr18------1242
NM_080491chr11143948 3919 3666 3456 1356 1335 1237 1060 1043 1003 687 660 628 517 21249 943 23280 681 --
NM_080629chr12954 158 --1479 1287
NM_080630chr12954 158 --1479 1287
NM_080645chr652144 1994 1907 1545 1497 ----32008 1517 239
NM_080647chr227421 412 403 393 384 360 292 ------
NM_080676chr2053286 2944 728 624 481 --2631 422 1168
NM_080743chr641837 591 518 250 ----12262
NM_080759chr1322015 946 --1758 11806
NM_080760chr1322015 946 --1758 11806
NM_080836chr2084109 3786 3185 1850 1829 778 274 91 13428 --1561
NM_080867chr1454305 3357 1874 1353 626 ------
NM_080872chr883712 3498 3330 2726 2719 1630 896 281 1328 13827 13201
NM_100264chr103238 205 194 ------
NM_100486chr103238 205 194 ------
NM_130391chr9--23290 1015 22476 660 1689
NM_130392chr9--23290 1015 22476 660 1689
NM_130393chr9--23290 1015 22476 660 1689
NM_130782chr11287 1887 1465 --
NM_130798chr151343 11269 ----
NM_133170chr20157933 7277 7088 6817 6785 6739 6498 6054 5818 4922 3163 1645 735 348 255 25955 1888 15251 --
NM_133265chrX31368 833 23 22994 1222 22567 546 --
NM_133334chr475927 4981 1143 819 476 247 32 24340 509 24275 1237 --
NM_133370chr473572 2874 2276 812 715 257 235 1909 23216 120 --
NM_133372chr5--3599 273 44 ----
NM_133478chr261986 1967 1870 1659 940 914 --12109 12342
NM_133646chr254853 3999 3973 1846 581 21652 95 25194 3590 --
NM_138270chrX21377 976 ----12461
NM_138300chr151694 1056 606 248 165 2141 119 ----
NM_138426chr711986 ----12357
NM_138444chr1343833 3307 1535 639 14707 2740 403 23441 1505
NM_138468chr295961 5654 5590 4352 3906 2398 2372 1544 682 14194 15678 1715
NM_138473chr1233495 824 578 --11306 --
NM_138576chr1443953 3137 931 265 13225 13829 14118
NM_138621chr2134161 3720 3381 2992 2802 2553 1273 1079 1009 617 271 187 33 ----12856
NM_138782chr521567 723 21694 657 ----
NM_138959chr195804 5661 4811 4559 2505 1371 1342 878 371 --26139 2302 15882
NM_138969chr8------1500
NM_139072chr22261 116 ------
NM_139136chr123914 793 260 ------
NM_139168chr51597 11950 --11230
NM_139169chr102681 55 --162 --
NM_139207chr1232069 1599 883 --12112 --
NM_139244chr63710 390 294 ----1885
NM_139246chr942202 1774 914 793 ----2503 85
NM_139321chr2063645 3229 2780 1276 274 63 34153 1137 992 ----
NM_139323chr2021652 306 1322 ----
NM_144570chr1652957 2385 1967 800 432 22724 402 ----
NM_144571chr432375 2070 1990 ----12457
NM_144578chr1433753 1286 1058 23604 1729 11761 --
NM_144579chr282787 2676 927 405 317 311 294 84 3981 815 785 1681 --
NM_144590chr1042333 2235 1159 565 11095 11835 --
NM_144599chr15104473 4413 3455 2151 2114 1798 1539 628 166 77 23791 361 ----
NM_144633chr31146 1973 --1117
NM_144642chr33911 287 59 --1976 198
NM_144664chr111662 187 11850 1876
NM_144767chr1554370 3756 1540 1116 1030 --23636 1349 14188
NM_144775chr17164890 4466 4373 3378 3034 1901 1891 1336 1075 966 946 813 724 459 292 165 21567 335 14712 --
NM_144778chr1322032 571 --1800 1349
NM_144949chr231046 941 652 --11929 --
NM_145011chr1062023 1920 792 623 364 226 ------
NM_145165chr1422347 625 22449 1091 32599 669 602 --
NM_145178chr101215 1498 ----
NM_145206chr1042540 2411 2300 1272 ----12276
NM_145259chr286706 6120 5435 4362 4313 715 466 173 15103 24599 861 --
NM_145307chr1041818 1596 1131 304 11068 24273 188 --
NM_145320chr753150 2618 2514 2360 1073 --1206 22577 361
NM_145321chr753150 2618 2514 2360 1073 --1206 22577 361
NM_145322chr753150 2618 2514 2360 1073 --1206 22577 361
NM_145686chr252788 1254 731 542 120 22392 452 1919 11318
NM_145687chr252788 1254 731 542 120 22392 452 1919 11318
NM_145690chr81449 1583 1531 21826 710
NM_145753chr311254 ------
NM_145793chr10------1839
NM_145799chrX43054 2781 2373 58 21895 891 ----
NM_145808chr7------22033 1244
NM_147156chr1011329 ----11186
NM_147166chr7----1686 1664
NM_147171chr72448 423 ------
NM_147181chr411313 11093 --21355 1229
NM_147182chr411313 11093 --21355 1229
NM_147183chr411313 11093 --21355 1229
NM_147185chr72448 423 ------
NM_147188chr1541367 1019 392 225 --11183 1902
NM_147223chr23921 420 152 11720 --12434
NM_147233chr22738 237 11537 --22251 910
NM_148898chr7------1357
NM_148899chr7------1357
NM_152253chr22123818 3487 3354 1649 1551 1524 1442 1311 1245 1005 585 150 11284 23056 2801 --
NM_152263chr186008 5018 4783 4195 3743 1492 1446 1147 23903 1278 15233 --
NM_152265chr111503 1380 ----
NM_152280chr142938 2507 667 163 --42353 933 782 105 --
NM_152330chr1442336 1887 1056 1035 1598 ----
NM_152347chr171116 ------
NM_152350chr17------1143
NM_152375chr152504 1927 1779 591 243 --1196 1211
NM_152388chr244006 3328 1533 384 21625 818 ----
NM_152423chrX----11198 11109
NM_152424chrX43706 1885 942 68 --23605 1155 14563
NM_152431chr112392 380 ------
NM_152446chr141638 ------
NM_152447chr141114 --1323 --
NM_152522chr2--1991 ----
NM_152529chr274344 4105 3609 3244 1054 562 536 --43919 3483 1767 1639 --
NM_152556chr71380 1218 2197 116 1372
NM_152562chr8------1150
NM_152624chr565166 5112 4914 1932 1550 104 36979 948 150 37201 5316 4520 35035 2242 1369
NM_152629chr943061 1615 159 146 --22614 119 1174
NM_152707chr102895 270 21023 812 ----
NM_152734chr665343 4256 3853 2091 1543 193 1310 15415 21333 921
NM_152744chr732759 463 30 12930 12900 23518 205
NM_152756chr532896 1445 575 23895 436 1350 --
NM_152758chr8145 ------
NM_152793chr764060 3977 3680 1401 930 329 2524 401 11283 14120
NM_152838chr2043509 1239 611 348 12554 --12302
NM_152857chr62757 287 ------
NM_152858chr62757 287 ------
NM_152903chr1342297 711 524 419 --12714 22874 747
NM_152914chr17104163 3292 1543 1520 1350 1192 807 562 516 330 14169 34364 3565 3056 2723 238
NM_152999chr744286 1440 1081 344 1427 11642 --
NM_153035chr1122916 2775 2520 2497 2426 2417 2379 2322 2139 1022 372 136 32598 728 35 32856 948 683 22787 176
NM_153188chr532208 1466 582 14069 21943 1343 25608 2102
NM_153207chr1253643 2939 2615 1140 280 11186 1559 11474
NM_153235chr642063 1988 815 141 31796 1613 789 21982 610 --
NM_153262chr132640 1997 818 --1748 --
NM_153331chr3--1633 ----
NM_153338chr176983 974 61 55 32 25 2282 147 1940 1317
NM_153347chr1182657 2489 2138 2095 2081 2069 614 169 --22400 67 12613
NM_153456chr1356142 5632 4498 2376 2272 --26288 307 15641
NM_153487chr674814 4195 3711 3604 3449 1377 898 1152 24026 3945 11704
NM_153499chr1282885 2719 2632 2076 689 634 340 204 1482 11971 --
NM_153500chr1282885 2719 2632 2076 689 634 340 204 1482 11971 --
NM_153607chr522769 767 ------
NM_153610chr5----1514 1551
NM_153616chr1531718 466 346 11614 11813 11579
NM_153617chr1531718 466 346 11614 11813 11579
NM_153618chr1531718 466 346 11614 11813 11579
NM_153619chr1542956 2473 375 55 12852 23051 122 12817
NM_153633chr121685 ------
NM_153695chr9--1243 ----
NM_153704chr82323 100 ----1131
NM_153748chr123914 793 260 ------
NM_153757chr41451 11025 1831 1443
NM_153836chr241830 534 189 129 ----11588
NM_170606chr7177 11258 21350 736 11459
NM_170665chr1284384 3365 3261 3026 1847 1639 484 250 --13020 23861 676
NM_170692chr11281 ------
NM_170706chr143829 3297 1537 1090 23652 3611 33872 1392 518 21409 149
NM_172070chr221443 527 12207 12177 --
NM_172071chr167406 7379 7174 2854 2651 1879 12847 16582 --
NM_172103chr622476 712 11894 1985 12310
NM_172105chr622476 712 11894 1985 12310
NM_172127chr441945 1892 1564 602 ------
NM_172128chr441901 1848 1520 558 ------
NM_172169chr1031435 585 319 --31890 697 673 --
NM_172170chr1031435 585 319 --31890 697 673 --
NM_172171chr1031435 585 319 --31890 697 673 --
NM_172173chr1031435 585 319 --31890 697 673 --
NM_172216chr1282787 2621 2534 1978 591 536 242 106 1384 11873 --
NM_172226chr1282885 2719 2632 2076 689 634 340 204 1482 11971 --
NM_172373chr1321245 61 --1515 --
NM_172375chr143297 117 45 1779 2749 129 --
NM_173078chrX1158 ------
NM_173083chr121085 344 --31249 1236 925 --
NM_173198chr922896 723 42839 1008 495 314 1188 1125
NM_173200chr922896 723 42839 1008 495 314 1188 1125
NM_173353chr12----1601 --
NM_173468chr485684 5358 5070 2406 2118 1769 1747 759 11605 2858 583 --
NM_173471chr33953 767 351 --1688 1832
NM_173495chrX72067 2021 842 457 352 329 307 1409 21682 763 --
NM_173496chr1042987 2091 1949 509 ------
NM_173500chr151887 ------
NM_173511chr243723 2641 2457 1139 ----12965
NM_173517chr71464 1508 ----
NM_173576chr1012242 ------
NM_173582chr11115878 5281 4805 4728 3823 2256 2131 2106 1640 1422 779 --22193 1161 11205
NM_173602chr1262978 2796 2697 2404 1455 1293 1632 --11254
NM_173642chr1128648 8613 7871 7804 6654 5669 2871 2482 2220 1134 381 312 18601 26627 6407 21720 581
NM_173647chr211037 --1820 --
NM_173654chr3----1813 --
NM_173666chr52377 198 1941 --11186
NM_173694chrX42416 603 430 374 11870 ----
NM_173800chr5----11128 11449
NM_173829chr565259 4774 3768 2047 1416 590 25337 4602 31309 645 534 25676 735
NM_173851chr843280 1476 992 723 --12480 1226
NM_174887chr17231 25 ------
NM_174916chr1521898 315 --1836 1456
NM_174929chr771958 1916 1731 1598 741 594 418 --21491 243 1644
NM_175623chr1267070 5347 2140 2134 1404 331 12000 15544 22426 1891
NM_175624chr1267165 5442 2235 2229 1499 426 12095 15639 22521 1986
NM_175625chr1267165 5442 2235 2229 1499 426 12095 15639 22521 1986
NM_175709chr22102990 2665 2625 2462 2224 2077 965 724 500 242 11897 12707 1633
NM_175736chr12117299 6733 4826 2900 2048 2014 1254 635 605 597 378 67825 6142 5735 5063 2219 1609 37429 6173 2626 --
NM_175748chr1422000 1534 --11618 12104
NM_175768chr6166 ------
NM_175839chr201115 ----195
NM_175840chr201115 ----195
NM_175841chr201115 ----195
NM_175842chr201115 ----195
NM_175921chr522969 1321 ------
NM_176081chr1034892 2011 1306 35731 5597 1396 --11350
NM_176083chr1034892 2011 1306 35731 5597 1396 --11350
NM_176824chr42350 221 ------
NM_176871chr873181 2507 2312 2204 858 591 440 13329 --12465
NM_177438chr1441586 1043 401 116 --23584 3391 24173 2742
NM_177989chr31307 --191 --
NM_177990chr201314 22037 1827 11820 11885
NM_177996chr2082844 2767 2387 2362 2108 794 278 225 23086 2307 1399 12587
NM_177999chr983691 3160 2992 2980 2663 2385 2339 259 23116 366 23486 876 --
NM_178011chr101564 ----1339
NM_178037chr1273607 3581 3093 2909 2467 2365 691 --3277 269 211 12444
NM_178038chr1273607 3581 3093 2909 2467 2365 691 --3277 269 211 12444
NM_178042chr31307 --191 --
NM_178151chrX94847 3113 2244 1971 1549 1151 1076 662 349 ------
NM_178152chrX94847 3113 2244 1971 1549 1151 1076 662 349 ------
NM_178153chrX94847 3113 2244 1971 1549 1151 1076 662 349 ------
NM_178190chr12234 40 ------
NM_178191chr151575 1494 1381 1252 595 ----11471
NM_178539chr121489 ------
NM_178585chr432187 162 37 12819 --53115 2445 2050 905 875
NM_178586chr1442409 1617 797 197 --1685 158
NM_178823chr61774 --153 --
NM_178832chr1031402 1276 115 ----11669
NM_181358chr144249 4063 142 125 ----12941
NM_181361chr31127 ------
NM_181443chr2032869 2532 2521 1747 1931 --
NM_181481chr18115568 5038 4797 2826 2463 2406 1964 1637 1412 1172 347 22546 2230 24552 782 15530
NM_181482chr18115568 5038 4797 2826 2463 2406 1964 1637 1412 1172 347 22546 2230 24552 782 15530
NM_181483chr18115568 5038 4797 2826 2463 2406 1964 1637 1412 1172 347 22546 2230 24552 782 15530
NM_181504chr542915 2804 407 310 1533 --1102
NM_181507chr1121141 374 ----11172
NM_181508chr1121141 374 ----11172
NM_181521chr1667220 5489 5416 2142 1091 749 25732 1376 36639 6424 6399 --
NM_181523chr542915 2804 407 310 1533 --1102
NM_181524chr542915 2804 407 310 1533 --1102
NM_181532chrX2290 23 ------
NM_181645chr111214 ------
NM_181670chr12----11221 --
NM_181723chr81751 --1714 --
NM_181787chr842854 1573 925 79 23302 2525 23803 3224 --
NM_181794chr61836 1914 --1414
NM_181795chr61836 1914 --1414
NM_181828chr2293254 2761 2601 2464 1200 828 720 707 249 12682 22640 23 --
NM_181829chr2293254 2761 2601 2464 1200 828 720 707 249 12682 22640 23 --
NM_181830chr2293254 2761 2601 2464 1200 828 720 707 249 12682 22640 23 --
NM_181832chr2293269 2776 2616 2479 1215 843 735 722 264 12697 22655 38 --
NM_181836chr522278 1651 1699 12684 --
NM_181897chr332369 2107 1052 ----1400
NM_182485chr443025 1003 686 675 --181 12647
NM_182515chr19104757 4441 4186 1345 1195 1182 979 55 29 23 21486 1414 46207 6003 5377 4731 --
NM_182537chr3------2361 293
NM_182646chr443025 1003 686 675 --181 12647
NM_182678chr24350 190 175 35 ------
NM_182697chr721537 1311 --11427 11326
NM_182767chr1241324 716 462 204 ----1194
NM_182796chr51298 ------
NM_182797chr2061631 1240 1128 710 461 252 ------
NM_182830chr14------32020 1964 1760
NM_182898chr724366 1317 15975 14416 11940
NM_182899chr724366 1317 15975 14416 11940
NM_182907chr63821 698 481 --21987 673 --
NM_182972chr131842 833 104 --11884 22373 1877
NM_183043chr132988 38 ------
NM_183044chr132988 38 ------
NM_183353chrX51158 1138 1060 870 856 1992 1934 --
NM_183380chr62404 119 ----2736 76
NM_183381chr31938 ----2931 92
NM_183383chr31938 ----2931 92
NM_183384chr31938 ----2931 92
NM_184234chr20------2691 243
NM_194277chrX2812 609 157 --175
NM_194282chr431993 413 53 22603 2273 12804 11962
NM_194285chr1173116 2892 567 515 509 198 139 1981 ----
NM_194286chr1255384 4181 1981 1464 1155 24944 1283 25444 1819 --
NM_194314chr114849 45390 2081 1554 1380 --11996
NM_194434chr1835710 2006 502 14930 24530 1759 --
NM_197968chr131554 ------
NM_197972chr11179 ------
NM_198086chr1441882 106 96 34 1739 ----
NM_198225chr1011791 ------
NM_198240chr12179 ----1294
NM_198268chr144249 4063 142 125 ----12941
NM_198269chr144249 4063 142 125 ----12941
NM_198273chr532450 628 89 1220 33081 2041 350 --
NM_198440chr2282423 2212 2187 1984 887 512 484 426 22280 265 2821 125 --
NM_198465chrX22689 2618 1842 21855 786 --
NM_198484chr3106061 5826 5357 5332 4676 2581 2349 1003 711 568 1482 25550 4748 14658
NM_198490chr3113477 3323 3174 3136 3057 2890 2752 2334 826 439 186 23305 895 ----
NM_198560chr3133810 3632 3555 3033 2825 2771 2727 1520 1476 1406 1058 630 307 11012 22873 2332 --
NM_198679chr992664 2502 2053 1972 1761 496 459 94 43 1344 22483 503 --
NM_198830chr171570 ----1695
NM_198859chr344170 3705 1191 738 24283 4026 13918 11292
NM_198889chr42464 26 1421 1130 --
NM_198900chr12117299 6733 4826 2900 2048 2014 1254 635 605 597 378 67825 6142 5735 5063 2219 1609 37429 6173 2626 --
NM_198902chr153749 729 276 ------
NM_198968chr1311350 --33720 3652 2788 13983
NM_199039chr41744 ------
NM_199044chr132373 1123 151 185 --22165 1176
NM_199144chr20198 ------
NM_199169chr2062663 1392 1128 725 445 47 11437 1804 1752
NM_199170chr2062663 1392 1128 725 445 47 11437 1804 1752
NM_199171chr2062663 1392 1128 725 445 47 11437 1804 1752
NM_199188chr1213060 --23080 1148 1289
NM_199189chr52780 240 --1296 --
NM_199190chr1213060 --23080 1148 1289
NM_199203chr20198 ------
NM_199280chr2--1113 ----
NM_199320chr452912 2796 2011 1844 760 183 121 --
NM_199320chr452912 2796 2011 1844 760 183 121 --
NM_199324chr442862 2718 798 252 --1843 --
NM_199421chr1454305 3357 1874 1353 626 ------
NM_199436chr252693 804 741 358 326 --22929 26 --
NM_199454chr1114665 4459 4158 3683 785 745 709 638 362 284 245 11270 24722 465 1947
NM_199461chr1053512 2854 2607 2425 674 13615 23375 2966 --
NM_199478chrX2684 674 11460 --11251
NM_199483chr20----1293 --
NM_201266chr252530 2195 1136 374 156 --12295 21940 226
NM_201279chr252530 2195 1136 374 156 --12295 21940 226
NM_201437chr8--21263 340 ----
NM_201591chr4----11912 1700
NM_201592chr4----11912 1700
NM_201595chr141123 ------
NM_201613chr12--1291 ----
NM_203327chr2063649 3100 2962 2851 2813 1256 --13288 --
NM_203341chr1----140 --
NM_203342chr143152 3096 3082 601 22529 467 13487 --
NM_203343chr143152 3096 3082 601 22529 467 13487 --
NM_203349chr1531949 1610 85 21880 1500 ----
NM_203350chr111707 ----11372
NM_203364chr11--1817 ----
NM_203399chr1--1547 ----
NM_203401chr1--1547 ----
NM_203406chr52453 361 12510 ----
NM_203437chr2----1870 --
NM_203451chr131104 --3932 417 216 1387
NM_203459chr132145 2052 855 --22113 171 --
NM_205842chr2158 ------
NM_206594chr153458 2692 2454 2331 1306 ------
NM_206595chr153458 2692 2454 2331 1306 ------
NM_206839chr151247 ------
NM_206853chr633937 3588 2944 23771 3519 23922 3808 --
NM_206854chr675198 4849 4205 1147 899 632 410 25032 4780 25183 5069 --
NM_206855chr686163 5814 5170 2112 1864 1597 1375 679 35997 5745 835 26148 6034 --
NM_206866chr2153049 3023 2319 1059 506 13080 22535 387 --
NM_206907chr533284 998 677 ----1174
NM_206909chr888185 7067 6878 6669 6653 1368 1158 469 27657 6885 23245 3037 57114 5943 5913 5378 816
NM_206943chr2------1815
NM_207297chr31421 --127 --
NM_207304chr1321919 458 --1687 1236
NM_207343chr111404 ----1191
NM_207380chr15103220 3211 2634 2617 2581 1205 1159 1066 682 411 ----12761
NM_207406chr476263 5673 5349 4830 1286 802 566 1325 ----
NM_207660chr14122 --11595 1664
NM_207661chr14122 --11595 1664
NM_207662chr14122 --11595 1664
NM_212467chr1541940 1687 1664 404 11862 42466 2173 1822 766 --
NM_212471chr17--1494 1426 --
NM_212472chr17--1494 1426 --
NM_213589chr244446 3949 3893 1000 14527 45158 4312 636 453 23970 1622
NM_213594chr121253 ------