TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-548am-3p
miRNA Sequence: CAAAAACUGCAGUUACUUUUGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000037chr852400 990 389 381 375 ------
NM_000112chr575291 4743 4464 1698 1127 869 502 --24416 4205 1542
NM_000248chr393081 2465 2209 1980 1142 1034 1005 708 80 22761 2234 1736 --
NM_000259chr15116247 5994 5587 4989 4978 4375 2276 1688 1594 1007 730 --12255 11440
NM_000332chr6137072 6405 6367 5747 5273 4385 2484 2472 2466 2033 1998 1793 1495 14773 15988 21955 1576
NM_000333chr361112 1043 914 790 304 293 --1287 --
NM_000346chr1761737 1391 680 125 107 99 --11278 --
NM_000430chr1793349 3123 1507 1190 1030 982 885 876 347 ------
NM_000489chrX93459 2878 2298 2238 1347 1233 1161 486 134 12524 ----
NM_000555chrX67247 6697 6157 4761 2038 1388 16741 11175 1107
NM_000610chr11112952 2861 2664 2096 920 894 887 880 874 576 144 ------
NM_000633chr1874997 4918 4894 4310 4083 1833 1510 23719 1842 14821 --
NM_000788chr461219 1078 960 505 187 114 ----1105
NM_000809chr4198921 8817 8339 7446 6811 6420 5929 5755 3400 3311 2153 2120 1720 1502 1412 1276 1232 985 184 36990 1648 65 11289 15717
NM_000813chr5105131 5125 5119 4954 4877 4498 1983 1051 879 200 1922 14123 13634
NM_000891chr1763128 2611 2425 651 435 260 43231 2456 344 241 ----
NM_000901chr461603 1587 1574 1552 315 167 182 12023 12209
NM_000950chrX93638 3166 3049 2653 2537 2440 2270 2232 148 11208 ----
NM_000963chr132355 2149 246 ----2349 213
NM_001001389chr11112952 2861 2664 2096 920 894 887 880 874 576 144 ------
NM_001001390chr11112952 2861 2664 2096 920 894 887 880 874 576 144 ------
NM_001001391chr11112952 2861 2664 2096 920 894 887 880 874 576 144 ------
NM_001001392chr11112998 2907 2710 2142 966 940 933 926 920 622 190 ------
NM_001001396chr154413 4311 3272 2832 756 13249 23288 2845 11170
NM_001001419chr5115208 5161 3994 3960 2086 1754 1089 1009 579 515 383 --11786 1872
NM_001001420chr5115208 5161 3994 3960 2086 1754 1089 1009 579 515 383 --11786 1872
NM_001001481chr843381 1248 382 337 --32204 1235 1049 12894
NM_001002860chr1474629 3358 3082 1832 1534 179 173 --1129 11577
NM_001003652chr18158690 8459 7429 6633 6545 6072 3448 2838 2767 1657 1378 1048 675 665 657 26249 1224 47564 6306 6150 1327 --
NM_001003674chr1865861 5434 4725 2451 1979 1571 14977 14836 26153 5926
NM_001003675chr1865861 5434 4725 2451 1979 1571 14977 14836 26153 5926
NM_001003712chr1263845 3091 1349 886 805 433 11236 1629 13508
NM_001003792chr32472 125 ----2982 166
NM_001003793chr32472 125 ----2982 166
NM_001004065chr953937 3891 3821 1533 1523 --23048 2607 14011
NM_001005404chr1764529 4348 4225 1141 1086 238 13542 23653 3301 13778
NM_001005473chr594594 4445 4305 4057 2419 2316 675 472 262 14191 34633 4042 1183 --
NM_001006600chr562387 2137 1789 959 426 270 32021 626 227 --1764
NM_001007278chr1394291 3355 3335 2076 2002 1992 946 938 24 25204 4057 14332 12018
NM_001007466chr6134960 4937 4705 1872 1752 1587 1581 1575 1568 1555 1542 993 277 13646 ----
NM_001007559chr1881925 1624 1610 1604 1595 1429 703 667 --1106 --
NM_001008239chr18123803 3708 3190 3153 2691 2675 1449 1348 1342 1326 1317 1097 --1346 13669
NM_001008393chr472928 2881 2240 2070 677 147 138 12306 --12088
NM_001008495chr872177 1759 1727 1535 460 393 253 12266 11869 1123
NM_001008801chr1961761 1468 799 548 278 194 52004 1897 1637 466 111 ----
NM_001008925chr41741 --3902 730 428 13224
NM_001009554chr483365 3119 2984 2874 1570 1467 439 418 24039 3442 ----
NM_001009554chr483365 3119 2984 2874 1570 1467 439 418 24039 3442 ----
NM_001010853chr672925 2319 2308 2149 1234 980 83 --22883 2236 --
NM_001010891chr5176669 6549 6497 6184 5960 5924 5458 5085 4473 2670 2268 2103 1444 1220 916 728 389 11200 ----
NM_001011666chr7115861 4980 2518 2310 2126 2050 1958 1891 1021 605 240 24130 862 25414 4305 --
NM_001014380chr13115812 5465 5169 4961 4783 3983 1958 1875 1795 1486 106 --1342 24030 1322
NM_001015048chr1473121 3011 3004 1044 751 618 515 22970 254 12931 12124
NM_001015049chr1473121 3011 3004 1044 751 618 515 22970 254 12931 12124
NM_001015508chr82221 215 --2576 208 1562
NM_001017999chr15527 363 357 351 315 --12167 1736
NM_001017999chr15527 363 357 351 315 --12167 1736
NM_001018000chr15527 363 357 351 315 --12167 1736
NM_001018000chr15527 363 357 351 315 --12167 1736
NM_001018001chr15527 363 357 351 315 --12167 1736
NM_001018067chr1125290 4531 3245 1473 1346 860 845 540 431 409 367 201 23849 1639 --15254
NM_001018068chr1125290 4531 3245 1473 1346 860 845 540 431 409 367 201 23849 1639 --15254
NM_001018069chr1125290 4531 3245 1473 1346 860 845 540 431 409 367 201 23849 1639 --15254
NM_001025076chr10105879 5577 4037 2026 1885 1721 1424 1299 1051 966 --45462 3911 3818 549 1523
NM_001025077chr1087237 6935 5395 2782 2657 2409 2324 1395 --56820 5269 5176 1907 1322 34636 1881 669
NM_001025079chr384185 4172 3839 3305 2845 2832 2816 1248 13609 33436 2639 239 1166
NM_001025108chr273935 3017 2731 2695 1344 834 57 --21331 1266 14126
NM_001025580chrX114280 4055 3747 3090 2995 1226 611 482 460 310 250 ----1430
NM_001032296chr1362738 2613 1907 617 30 24 22328 253 --12050
NM_001034841chr1685335 5297 5154 4397 4029 4023 4016 3411 21052 362 34983 3780 418 11963
NM_001037164chr761773 1448 1440 1434 655 37 11942 22015 1476 --
NM_001037165chr788918 8860 7524 7315 6620 1839 1401 1159 --58331 7647 7309 2743 575 --
NM_001039538chr233644 3211 2257 --33358 1454 476 12302
NM_001039547chr387775 7038 5998 5942 5018 2935 2805 1401 1874 --16597
NM_001039618chr11105686 4917 4706 4693 4659 4627 3883 1474 1340 801 11803 12359 --
NM_001039693chr274050 2774 1638 1516 1020 1013 942 --23684 698 11623
NM_001040284chr1684361 4354 2284 2140 1936 688 458 127 25564 2152 22311 2128 14311
NM_001040708chr84967 374 325 176 1402 --1205
NM_001042413chr994108 3879 3668 1463 1059 774 615 588 207 ------
NM_001042555chr1284340 4303 3797 3442 3168 1642 989 931 12960 2852 776 143
NM_001042683chr641174 398 358 75 11834 --1751
NM_001100108chr1148223 7922 7319 5381 3181 2908 2746 2489 2404 2397 2388 2379 1977 1666 ------
NM_001106chr3169772 9650 8864 8807 8293 8161 6989 6731 3639 3249 2710 2673 2654 2092 1236 329 17216 49704 9158 8638 2266 1199
NM_001167chrX96658 6511 6489 5510 4994 2323 2178 1046 812 2710 474 21087 977 11390
NM_001201chr452453 622 501 465 70 1278 23359 826 13822
NM_001204chr2137635 6794 6668 6244 6223 6216 5684 5193 2647 1512 833 205 197 11726 37184 2451 1362 1444
NM_001206chr993079 3031 2763 2040 1114 298 292 285 277 1165 ----
NM_001237chr45946 913 214 153 76 ----165
NM_001237chr45946 913 214 153 76 ----165
NM_001304chr1773819 3073 2971 2628 902 439 161 --23601 491 13763
NM_001364chr1164762 4458 1241 763 105 88 --21080 542 --
NM_001396chr2142441 398 278 54 42094 2021 486 38 --12368
NM_001412chrX102908 2857 2768 1152 1146 1139 1133 1127 616 146 ----11202
NM_001419chr1984673 4391 2987 1574 1225 1154 1064 385 34241 1166 139 --34621 1534 393
NM_001432chr432790 1023 394 33690 3554 139 --23445 3370
NM_001498chr651312 1103 1023 880 301 ----1898
NM_001684chr154130 4028 2989 2549 473 12966 23005 2562 1887
NM_001730chr1311371 31285 502 312 31332 592 422 --
NM_001730chr1311371 31285 502 312 31332 592 422 --
NM_001759chr12105294 4644 3517 3354 1939 1931 1912 1679 1349 69 15143 ----
NM_001777chr384185 4172 3839 3305 2845 2832 2816 1248 13609 33436 2639 239 1166
NM_001858chr6105077 4903 3954 3561 3135 1600 749 586 487 249 13971 ----
NM_001987chr1253864 3400 328 322 316 ------
NM_002006chr4105518 4347 3902 3642 3617 1748 1308 1262 955 455 --13712 --
NM_002009chr1572690 2558 2552 2290 1996 1882 930 --21946 802 --
NM_002025chrX109192 7674 6433 5658 3143 2989 1111 1045 734 708 39049 5768 118 27747 5750 --
NM_002035chr1862697 2570 2462 1511 1364 909 12766 --12913
NM_002040chr2143115 2115 989 770 22424 2042 12358 12571
NM_002092chr4134700 4518 4159 4153 4147 3438 3173 3090 1883 1819 1711 612 517 --14460 --
NM_002126chr1773812 3556 1607 1078 977 705 563 11130 --1439
NM_002128chr1331739 1686 649 1117 52382 2031 1627 312 21 --
NM_002158chr243240 765 133 80 2692 142 33746 2750 1260 --
NM_002210chr243364 3160 2349 1346 1213 --2955 250
NM_002214chr794666 4540 3545 1989 1648 1354 863 783 582 ----11564
NM_002270chr5125537 5273 5200 4771 4582 4137 3858 3807 3777 2155 2108 489 --45575 4929 4911 476 --
NM_002271chr1331754 777 80 1716 12150 1826
NM_002285chr273935 3017 2731 2695 1344 834 57 --21331 1266 14126
NM_002310chr5105979 5813 5390 5352 2392 2217 1482 1461 705 356 36560 4819 4352 16017 --
NM_002336chr1284556 4329 3350 1710 1276 1025 898 252 --11906 --
NM_002356chr6102879 2654 2166 2064 1831 1056 978 308 164 78 1800 ----
NM_002374chr233644 3211 2257 --33358 1454 476 12302
NM_002481chr1137901 7873 7715 7556 6743 6451 5418 2852 2540 1832 615 217 206 --11501 --
NM_002515chr1431977 487 329 1731 189 11809
NM_002577chr363460 2792 2483 1355 1344 659 --33931 3554 376 --
NM_002581chr985505 4368 4039 3867 3483 3475 3467 1423 15376 13992 --
NM_002612chr732076 290 278 --11792 11685
NM_002655chr864907 4157 4076 3860 1306 1146 23444 1652 13268 12032
NM_002736chr781971 1940 810 804 634 553 484 108 12088 ----
NM_002737chr1776491 6301 4290 4278 4268 1401 1110 14854 --25674 5479
NM_002740chr352513 2399 965 456 230 32744 2497 2430 --1240
NM_002844chr61447 --21057 921 21433 189
NM_002886chr3134700 4511 3754 3619 3330 2006 1954 1923 943 937 472 457 394 24954 3288 24468 1858 --
NM_002892chr1461416 1341 690 462 446 249 ----21386 1189
NM_002959chr1104232 4045 3544 1784 1519 1509 1346 1249 292 286 --21719 1395 --
NM_003082chr143879 292 36 --1474 124
NM_003108chr2126752 5761 5708 5569 5563 5049 4847 1523 1067 1010 806 349 --27282 5819 1240
NM_003199chr18125560 5171 4414 4231 4225 4219 4207 3752 3688 3678 2006 462 14238 22000 1781 --
NM_003262chr375008 4400 4230 1697 1152 898 313 24719 835 --1452
NM_003338chr1041872 1421 369 50 41661 1349 329 237 11975 --
NM_003392chr343585 3520 1211 72 23648 81 23310 1579 12992
NM_003410chrX72760 2391 2306 2250 2183 1194 268 12062 23102 1930 --
NM_003482chr1252742 2470 2463 2358 1923 22771 840 --12299
NM_003574chr1865802 4808 4767 1047 967 292 24436 4050 35360 4389 543 --
NM_003576chr1362738 2613 1907 617 30 24 22328 253 --12050
NM_003583chr1243492 1492 1278 452 43655 347 165 88 12590 1198
NM_003615chr333683 3614 3603 1118 23646 1282 1583
NM_003672chr171987 1669 719 692 477 466 239 11369 --1535
NM_003685chr193927 897 818 1735 --1715
NM_003722chr352591 2457 2004 1852 1053 --32416 1943 774 --
NM_003759chr474218 3689 3014 2784 1396 937 193 --23378 240 12640
NM_003783chr1189 ----21223 1091
NM_003800chr651659 1644 1528 1507 722 11517 22250 580 --
NM_003913chr674087 3722 3466 3026 1375 988 857 --23356 1316 11391
NM_003930chr742422 2283 1792 1678 --1448 21890 255
NM_003955chr1761418 1386 1302 1296 1290 1284 --11277 --
NM_003966chr586629 6405 3109 2883 2789 2663 1327 281 ----1236
NM_004124chr1452566 2499 2339 1025 711 13228 --12222
NM_004136chr1563189 3020 2563 2504 1230 349 --12729 12346
NM_004171chr11117364 6700 5832 5826 3835 3472 3119 2392 1761 1334 593 26080 2783 25998 2601 13434
NM_004232chr1853379 3235 1008 213 113 23510 1266 --23001 498
NM_004338chr1865861 5434 4725 2451 1979 1571 14977 14836 26153 5926
NM_004397chr1184303 4213 2991 2655 1130 541 420 86 1249 23724 1006 --
NM_004412chr1085676 4667 4091 4048 3793 3759 1892 711 15476 1381 --
NM_004437chr1112586 1310 1229 1191 1026 925 917 630 589 268 260 1905 11303 --
NM_004480chr145550 526 520 514 504 --1827 --
NM_004537chr1231465 131 125 ----1250
NM_004586chrX55435 5338 4231 1265 459 14876 24772 4382 25087 4945
NM_004612chr9104457 3948 3182 1601 1464 1306 785 774 269 54 23719 1560 24211 478 --
NM_004674chr84496 64 58 52 ------
NM_004726chrX114460 4294 4121 3969 3710 1840 1833 1701 1568 1411 675 13657 13599 --
NM_004731chr124616 89 67 55 --11839 1162
NM_004745chr846895 6360 4361 1747 15579 14863 17042
NM_004760chr762350 2281 1879 1735 577 444 ----11711
NM_004775chr1852241 1768 677 563 397 --11947 12042
NM_004863chr1485267 5186 4394 4011 3732 2043 1957 522 11964 11827 --
NM_004873chr1473121 3011 3004 1044 751 618 515 22970 254 12931 12124
NM_004904chr7115861 4980 2518 2310 2126 2050 1958 1891 1021 605 240 24130 862 25414 4305 --
NM_004906chr63143 130 116 --2534 470 1608
NM_004949chr1882177 1780 1754 1347 852 780 773 311 ----11858
NM_004972chr94962 820 772 51 --1167 1376
NM_004985chr12103815 3312 3003 2960 2861 1312 921 544 207 201 1427 33399 1620 168 --
NM_004992chrX97944 7428 7015 5759 5412 3271 3056 1967 187 37041 2754 1954 28280 5425 --
NM_004992chrX97944 7428 7015 5759 5412 3271 3056 1967 187 37041 2754 1954 28280 5425 --
NM_004999chr6124146 3809 3211 3169 2875 1745 1714 1187 965 791 763 751 11627 13744 11253
NM_005065chr1454127 3842 3721 1399 1141 --1672 15023
NM_005116chr2084472 4418 4372 4362 4009 3386 3272 898 --24324 1507 14449
NM_005121chr1753517 3500 2531 1045 966 13299 --23152 459
NM_005156chr9135085 5055 4697 4645 4163 4138 4033 3698 1413 1272 1200 1142 986 12005 24327 3319 24970 1219
NM_005160chr22126791 6291 5454 4307 4267 2713 2408 1518 1386 1283 756 731 16761 ----
NM_005197chr14125751 5337 4009 1553 1527 1521 1514 1508 1502 1452 122 111 ----25145 3967
NM_005231chr1171320 1257 266 250 96 86 79 ------
NM_005238chr1173430 2989 2833 2653 1319 963 515 2667 418 23524 3470 --
NM_005342chrX42424 1847 823 381 1685 --1670
NM_005359chr18146551 5335 4999 4255 2407 2271 2254 2008 1933 1921 1502 1440 849 616 --24270 1110 --
NM_005433chr1852719 2353 2114 1040 552 1108 2484 448 11738
NM_005497chr1796170 5818 4714 4708 4219 2246 1565 1341 1105 14998 1293 2561 472
NM_005504chr1266446 5014 4085 1462 733 502 16057 15897 26115 5771
NM_005578chr375108 4472 4450 3790 2022 1879 1070 --21658 360 11671
NM_005591chr1182768 2016 2010 1999 1085 436 371 165 1501 21724 542 --
NM_005596chr9106308 6232 5456 4949 3995 2236 1859 1792 1769 454 --45202 4379 2331 1004 --
NM_005637chr1881925 1624 1610 1604 1595 1429 703 667 --1106 --
NM_005665chr1134946 4678 4633 4248 3101 1842 1779 1713 951 944 821 502 484 --21485 1442 14756
NM_005738chr761773 1448 1440 1434 655 37 11942 22015 1476 --
NM_005739chr1532406 1628 1572 12057 12386 11920
NM_005746chr752652 2502 2014 1805 1775 1812 --11013
NM_005748chr12103073 2893 2544 1185 874 623 604 559 455 120 ------
NM_005759chr244422 3887 1741 1560 23610 1754 --14519
NM_005798chr1394291 3355 3335 2076 2002 1992 946 938 24 25204 4057 14332 12018
NM_005839chr18892 696 682 676 367 349 341 328 ------
NM_005841chr45387 76 70 64 57 ------
NM_005843chr251755 1727 1487 244 162 --11233 11449
NM_005857chr13974 946 221 2208 77 --11114
NM_005880chr1651570 563 557 551 304 11247 1543 --
NM_005895chr12103517 3506 3474 3195 2639 1045 544 477 106 83 14024 ----
NM_005901chr18158690 8459 7429 6633 6545 6072 3448 2838 2767 1657 1378 1048 675 665 657 26249 1224 47564 6306 6150 1327 --
NM_005903chr5115208 5161 3994 3960 2086 1754 1089 1009 579 515 383 --11786 1872
NM_005935chr474067 3646 3637 1948 946 481 453 11442 25153 4919 13497
NM_005966chr222356 1904 ----22125 1817
NM_006007chr9124428 3982 3811 3803 3796 3626 2838 1349 1207 1181 790 108 21519 36 --11323
NM_006037chr284767 4755 4437 3500 1915 1729 957 715 21710 1694 24427 3391 11502
NM_006095chr484355 4238 3690 3318 3233 1425 1374 553 --1910 --
NM_006106chr1192140 1367 1352 879 778 739 730 722 86 ------
NM_006108chr111101 ----2919 691
NM_006154chr152670 42 32764 1141 29 1359 --
NM_006203chr595422 4932 3960 1863 1596 1539 1267 941 695 34420 1239 225 1173 25609 1485
NM_006212chr165394 5127 5074 5047 3593 1468 1834 13385 11167
NM_006241chr392406 2066 1837 713 703 697 685 675 668 12005 1744 --
NM_006252chr177379 6066 5524 2995 2118 1860 1255 34739 2284 2247 46591 5201 1224 531 16465
NM_006282chr2074482 3037 878 439 310 295 246 24694 4366 --11692
NM_006352chr192039 1554 1448 550 395 366 359 213 127 --21801 351 --
NM_006420chr2063412 3044 655 552 484 446 ----12545
NM_006482chr1243492 1492 1278 452 43655 347 165 88 12590 1198
NM_006489chr1431977 487 329 1731 189 11809
NM_006544chr14125909 5502 5212 4225 3800 3707 2354 2026 1707 1596 486 167 35477 4056 284 --24127 441
NM_006547chr772048 1707 1625 1503 758 655 475 --11351 1109
NM_006561chr10105879 5577 4037 2026 1885 1721 1424 1299 1051 966 --45462 3911 3818 549 1523
NM_006599chr1686792 5621 3131 1917 1901 1653 1357 516 18182 16396 --
NM_006609chr242880 2494 2399 889 --21842 220 1418
NM_006620chr6104115 3439 3099 3031 1531 1326 934 722 411 353 34289 3761 107 ----
NM_006628chr15104568 4332 3277 3160 2841 1841 1667 1107 735 293 --1165 --
NM_006646chr1383091 2829 2726 2039 684 483 451 438 ----12779
NM_006654chr1284340 4303 3797 3442 3168 1642 989 931 12960 2852 776 143
NM_006722chr393081 2465 2209 1980 1142 1034 1005 708 80 22761 2234 1736 --
NM_006777chrX62399 1098 456 222 172 26 11078 22268 2187 --
NM_006815chr1251203 1172 1063 949 943 --11307 1282
NM_006885chr16164032 3616 3437 3430 2905 2899 2893 2886 2689 2683 1505 1493 1486 806 558 424 12775 33848 1468 567 --
NM_006915chrX52496 2066 1902 242 195 195 21649 689 1781
NM_006924chr1784052 3995 3595 3279 1678 1391 1078 46 23970 818 ----
NM_006938chr184948 816 212 126 --1220 177
NM_006939chr141756 --150 2456 443
NM_007006chr1693482 3429 3210 2467 944 862 794 673 98 22894 1170 21306 90 --
NM_007007chr1273822 3399 3048 1621 809 562 329 53200 1391 1320 955 700 13993 --
NM_007011chr1566593 6036 4666 1194 552 203 15178 14730 11227
NM_007042chr372389 2320 1966 865 858 846 377 --12017 --
NM_007136chr341185 1082 866 30 2873 822 --11130
NM_007137chrX85460 4385 1921 1310 1158 1142 1038 621 --13764 11911
NM_007175chr883518 3239 2749 1273 1192 725 589 189 32828 2584 1057 12739 --
NM_007195chr1873174 2829 2682 2302 1486 809 455 ----13553
NM_007203chr953937 3891 3821 1533 1523 --23048 2607 14011
NM_007212chr182156 1684 1535 1416 827 606 443 247 21835 1526 ----
NM_007249chr1399477 8908 7962 5930 3188 2805 2156 1637 665 29235 2469 12178 --
NM_007350chr12104376 4233 4104 3916 3763 3497 3491 581 167 31 --1329 --
NM_012081chr583495 3229 3152 3042 1017 890 882 874 --32808 2741 282 --
NM_012160chr6271 64 178 1525 --
NM_012164chr977245 5503 5458 2635 969 302 52 27008 4859 26478 659 32941 2689 2510
NM_012234chr383559 3527 2457 2449 1001 463 332 324 --13755 13261
NM_012294chr763814 3485 2655 405 293 102 ----23522 391
NM_012382chr584529 4126 3869 3040 1636 693 116 55 11376 23115 1663 --
NM_014048chr1655082 4878 4182 3951 581 11233 24856 1969 169
NM_014141chr785369 5109 5094 3820 1882 1144 343 206 1354 11007 1557
NM_014155chr11147500 7240 7030 6520 6059 4729 2829 2564 1070 732 301 295 276 68 46859 5082 2665 2251 15325 11652
NM_014181chr251984 479 473 467 460 ------
NM_014331chr486782 6494 5134 2116 712 690 382 368 26695 2725 26118 986 --
NM_014456chr1061824 1742 340 293 188 170 11308 175 --
NM_014574chr1441411 1401 1391 1186 1264 1310 1589
NM_014615chr166931 913 897 816 732 253 21015 827 22626 235 --
NM_014702chr633448 432 213 22822 139 22406 906 13350
NM_014735chrX42088 1445 1300 810 --2861 146 1171
NM_014743chr463078 2302 2170 1265 1076 1053 32978 2792 2417 ----
NM_014755chr264277 4083 4000 1083 589 365 23585 1073 43351 3041 1680 140 --
NM_014774chr162970 2513 2507 2501 2122 501 12958 11246 --
NM_014803chr1072747 2636 2630 2390 2042 1170 198 --22803 584 --
NM_014830chr12123817 3379 2685 2398 1514 1462 1271 395 337 319 261 240 13917 13290 --
NM_014839chr151898 641 289 258 226 --22030 739 12094
NM_014868chr125806 608 49 43 36 1244 ----
NM_014877chr17187673 7633 7220 6758 6273 5908 5902 5649 4865 2973 1947 1465 1135 949 758 663 570 511 37592 6628 732 --26213 2239
NM_014904chr1032960 1542 136 22917 541 1744 11134
NM_014924chr1482986 2741 2634 2435 2054 608 484 393 --1470 1708
NM_014953chr1324213 4131 23398 624 13737 13643
NM_014982chr1485191 4855 3945 3495 2050 2040 2034 1655 14351 23463 286 --
NM_014999chr1251154 242 232 221 211 ------
NM_015026chr1284724 3564 3126 2966 1545 1037 892 386 14493 23992 3685 --
NM_015032chr1332350 1921 1090 --11180 2861 815
NM_015040chr293182 3162 3099 3093 3087 770 602 431 185 22094 622 ----
NM_015092chr1674681 4268 3364 3357 3316 1164 1088 --24293 2935 --
NM_015097chr351690 761 732 440 116 --21658 123 --
NM_015137chr862545 2406 2047 2036 315 157 12061 12620 --
NM_015199chr381032 589 583 559 459 260 169 156 12411 23022 574 --
NM_015208chr1873715 3260 2912 2666 492 477 359 --23759 3543 --
NM_015209chr15527 363 357 351 315 --12167 1736
NM_015265chr25146 106 99 93 86 --171 11948
NM_015313chr1194563 4517 4371 4241 4170 3491 3208 1466 422 11759 13340 --
NM_015315chr593053 2901 2467 2461 2455 2449 2238 890 300 ------
NM_015349chr662589 963 920 470 463 304 12316 1495 --
NM_015355chr175782 746 526 349 76 21974 83 ----
NM_015365chrX114280 4055 3747 3090 2995 1226 611 482 460 310 250 ----1430
NM_015436chr41560 --3721 549 247 13043
NM_015458chr8124279 3683 3502 3257 1901 1718 943 860 762 754 533 435 --11282 --
NM_015554chr1592833 2430 2424 2300 1978 1079 829 586 104 --32950 2388 1008 --
NM_015575chr2103443 3314 3308 3301 2578 2434 2397 1025 671 381 ------
NM_015578chr196808 779 318 142 131 124 11294 --11867
NM_015640chr1125290 4531 3245 1473 1346 860 845 540 431 409 367 201 23849 1639 --15254
NM_015878chr851704 680 655 618 572 22203 1500 12077 1342
NM_015906chr1114863 4797 4676 3472 3106 1753 1031 896 832 601 538 --14703 1571
NM_016045chr203738 628 456 --1102 11510
NM_016132chr1573368 3362 1327 1320 799 449 432 2239 188 23146 313 --
NM_016206chr3138680 7375 7358 6239 5866 5561 2088 1581 1041 707 604 141 73 46714 5934 988 659 55644 5441 1561 736 284 --
NM_016248chr13103896 3659 3623 3553 3279 2710 2617 2441 1041 281 22646 494 --1996
NM_016260chr2167297 6639 5801 5476 5453 5168 4990 2780 2669 2147 1561 874 784 708 698 383 27342 4959 27173 1063 17609
NM_016322chr963117 2825 2142 1999 1990 1027 ----12179
NM_016356chr672941 2855 2622 2247 987 950 871 ----12848
NM_016507chr17103108 3017 2781 2650 2458 2267 2130 1001 449 388 --12818 --
NM_016530chr1574075 3143 1212 1109 1099 865 241 11127 33920 3226 2524 --
NM_016544chr2103738 3614 3594 3466 3021 2948 2673 2479 1186 80 12656 13239 --
NM_016651chr149938 760 416 317 303 263 245 223 35 11081 ----
NM_016952chr11113445 3196 3091 3080 1355 1331 1324 1305 642 451 395 ------
NM_016953chr286099 5850 5665 1572 1558 1536 710 679 16138 ----
NM_017420chr1473599 1447 1318 967 802 397 104 12368 1320 --
NM_017447chr2184059 3589 3157 3022 2988 1685 1561 93 11291 23103 2837 11190
NM_017628chr4105030 4855 4842 4429 3552 1652 1639 1632 1626 1620 --31158 1041 115 --
NM_017629chr161901 1793 1289 558 549 539 ------
NM_017637chr9139241 8329 8165 7882 3659 3556 2734 2424 2029 1534 486 346 221 29276 717 27557 3451 --
NM_017644chr384074 3977 3656 1379 1040 519 461 51 24688 626 --1758
NM_017658chr14114541 4492 4387 3757 3572 3328 578 285 165 135 71 --2884 774 --
NM_017736chr1673164 3105 2967 2285 1080 488 335 22749 2695 42154 453 163 93 1357
NM_017744chr162008 2001 1994 1988 1951 784 ------
NM_017758chr1791451 1197 146 117 110 103 96 79 73 ------
NM_017769chr1433108 2494 174 22520 542 12827 12970
NM_017778chr831137 294 288 1303 ----
NM_017811chr963003 2553 1072 1010 1004 700 1334 --11254
NM_017813chr8135716 5513 5148 5065 5055 4562 4411 4405 4189 4174 4076 1655 835 55708 4805 3988 1821 670 --15438
NM_017896chr2083547 3325 3307 2988 689 602 449 440 --1422 --
NM_017944chr1152451 1028 977 41 35 1567 23120 1184 --
NM_017958chr222857 103 --12124 192
NM_017994chr762864 2771 1968 584 576 570 --1556 --
NM_018011chr13493 87 81 73 1590 ----
NM_018017chr1092814 2756 2685 2341 808 603 524 483 206 12824 --1674
NM_018048chr1242004 1276 671 286 180 2483 279 --
NM_018126chr481562 1360 1283 1259 1023 498 486 181 --1253 --
NM_018155chr372864 2623 1074 971 516 288 131 --23252 910 12427
NM_018299chr843381 1248 382 337 --32204 1235 1049 12894
NM_018313chr392445 2262 2132 591 365 358 343 324 280 --12093 --
NM_018330chr1081613 1375 1338 1100 443 418 412 60 ------
NM_018351chr1254617 4466 3255 3028 175 1693 11777 13345
NM_018362chr11123924 3798 3172 3166 3159 2672 2652 2640 1482 447 353 50 23478 236 1590 1657
NM_018364chr173571 3506 2947 2692 979 84 61 43969 3450 2723 373 14097 --
NM_018374chr794827 3970 1596 1589 1556 1185 1171 679 553 24524 379 13427 --
NM_018403chr394141 4080 3858 3678 3514 3491 1646 934 446 23835 607 12704 21509 490
NM_018429chr532414 2260 1068 ----42655 2371 2271 2014
NM_018440chr8118727 8431 8124 7343 6763 5419 2463 1904 1826 727 390 58362 7020 3177 3057 1260 26883 2759 --
NM_018566chr1104640 3348 1933 1927 1797 1478 1383 1182 1040 60 24444 3148 1926 --
NM_018638chr12125408 5013 3841 2264 2099 1831 1325 1225 854 783 388 326 33622 1720 1042 24343 380 14198
NM_018695chr562387 2137 1789 959 426 270 32021 626 227 --1764
NM_018947chr793815 3723 3699 1946 1773 1138 1019 486 322 --1183 --
NM_018999chr10104837 4525 4157 3378 2992 1915 1901 1894 1557 1285 14447 24613 4438 --
NM_019004chr741630 743 552 404 ----21960 1795
NM_019027chr482486 989 917 910 882 300 287 155 11652 1166 11823
NM_019050chr442121 1974 690 573 --31834 1805 1756 11576
NM_020122chr295560 4410 4175 2061 1950 1766 1069 400 380 1900 34280 1289 1222 1782
NM_020193chr1141201 1130 434 293 11017 21286 415 11193
NM_020205chr153328 2976 2581 2554 2306 33497 2698 2650 13479 13294
NM_020245chr6134866 4843 4611 1778 1658 1493 1487 1481 1474 1461 1448 899 183 13552 ----
NM_020390chr3104075 3833 3579 3215 1823 785 606 334 234 143 ----1730
NM_020475chr852337 927 326 318 312 ------
NM_020476chr852337 927 326 318 312 ------
NM_020477chr852337 927 326 318 312 ------
NM_020478chr852400 990 389 381 375 ------
NM_020480chr852337 927 326 318 312 ------
NM_020673chr20137602 7364 7062 7056 5768 5418 5373 3027 2917 2747 1010 300 84 11394 ----
NM_020718chr16125800 5719 5703 4435 4112 2378 2047 1901 1491 1321 1222 339 12216 --26231 1667
NM_020727chr21113846 3802 3770 3470 3447 3433 2910 1277 1250 326 319 23632 2725 ----
NM_020734chr1253356 1326 557 354 334 23318 2811 22893 1199 --
NM_020772chr17137840 7424 5510 5302 2593 2222 2135 2127 1610 1584 964 509 267 31206 1078 293 27866 286 --
NM_020774chr18136264 5957 5951 4948 4921 3790 2147 1853 1610 850 379 192 185 35251 1746 817 11442 11486
NM_020782chr1274868 4459 3928 3922 3889 1524 406 --34298 3967 43 --
NM_020794chr151127 255 249 237 201 1262 ----
NM_020796chr572329 2218 2175 2107 2008 1994 1104 22366 1968 12769 --
NM_020810chr1463516 3086 3006 2932 669 570 33191 677 90 1755 --
NM_020841chr1263845 3091 1349 886 805 433 11236 1629 13508
NM_020921chr1473356 3350 845 459 314 308 288 11036 2300 139 --
NM_021083chrX113347 2729 2482 2270 943 861 508 449 404 383 351 23070 2611 ----
NM_021148chr7102020 1674 1005 845 821 814 808 793 749 96 22313 1740 1692 --
NM_021163chr783556 2739 915 760 684 587 510 237 1715 --1453
NM_021190chr141090 1012 108 102 --1430 21320 540
NM_021215chr2082349 2335 2251 2243 2236 2118 1677 272 --12092 --
NM_021255chr1483844 3417 3359 1618 1466 1054 941 534 1290 1301 --
NM_021629chr354331 3399 1578 1155 386 24827 1528 23478 1257 13590
NM_021647chr483365 3119 2984 2874 1570 1467 439 418 24039 3442 ----
NM_021813chr6235788 5632 5519 5441 5023 4281 4275 4268 2338 2235 2228 1576 1563 1271 869 812 806 800 790 771 727 694 409 15646 ----
NM_021911chr5105131 5125 5119 4954 4877 4498 1983 1051 879 200 1922 14123 13634
NM_021960chr142785 1061 1035 968 12332 1759 12244
NM_021964chr3145974 5604 4209 4120 2516 2184 1915 1881 1863 1461 1343 802 794 576 35587 4510 1803 26564 376 22381 2219
NM_022048chr15105790 4809 4766 4615 4603 4597 4583 4577 1619 824 26239 356 1761 --
NM_022166chr1665947 5676 4051 4045 1877 1630 11147 14763 15850
NM_022459chr13146030 5695 5689 5596 4611 4246 4240 2222 1826 1505 782 631 592 552 --14698 --
NM_022473chr1583943 3652 3363 1189 1038 503 452 195 ----13378
NM_022574chr761517 1340 349 342 335 195 ------
NM_022817chr291671 1633 1625 868 617 518 478 233 147 1207 12107 --
NM_022893chr263133 1007 714 517 348 191 13026 12752 --
NM_022898chr1474560 1866 821 609 602 340 242 11295 33064 1572 568 --
NM_023000chr1461416 1341 690 462 446 249 ----21386 1189
NM_023001chr1461416 1341 690 462 446 249 ----21386 1189
NM_024422chr1871969 1572 1546 644 572 565 103 --2753 684 11650
NM_024524chr382879 2625 2034 1040 879 647 618 325 --32487 933 340 12691
NM_024546chr137909 337 293 287 281 275 29 ------
NM_024639chr632917 2317 218 --21960 889 12610
NM_024665chr3174500 4467 3833 3811 3564 3293 1832 1355 1023 994 987 797 758 752 485 259 182 24339 1254 33935 2861 325 --
NM_024930chr572796 606 261 229 223 217 211 --1537 --
NM_024947chr3129208 8913 8709 6414 5925 3826 2744 2427 2029 683 407 34 17676 28217 640 29159 2530
NM_024989chr2126192 5914 3181 3023 2843 2191 1659 1610 1431 1326 180 145 28075 5261 1518 17350
NM_025054chr843930 3341 3275 3045 12861 --23973 1577
NM_025073chr174683 4648 4587 4294 3499 1022 963 14037 1810 --
NM_025146chr372465 1924 1714 692 253 152 121 1441 12646 12414
NM_025191chr1103570 2882 2818 2708 2455 2432 1139 1132 1061 406 11146 22753 2395 --
NM_025208chr1182401 2170 2080 2042 821 763 697 297 11793 12392 --
NM_025248chr1751097 955 189 183 177 --23220 1124 --
NM_030621chr1484219 4126 3728 623 478 318 312 199 13133 1206 --
NM_030627chr533595 632 230 23451 343 1434 43898 3790 3721 2631
NM_030647chr785790 5726 4420 2363 2150 2130 1406 629 35836 2060 452 25692 985 --
NM_030648chr4104960 4619 3968 3889 1329 1323 1260 517 356 331 --15478 11867
NM_030751chr1051702 1602 1355 482 243 --11894 11642
NM_030751chr1051702 1602 1355 482 243 --11894 11642
NM_030755chr1482984 2390 2384 2378 2167 879 564 292 ----1610
NM_030806chr1117737 7703 6730 5854 3666 3475 2453 2165 1915 1891 315 1766 15878 --
NM_030816chr143405 2741 952 176 52655 1296 922 708 296 11342 --
NM_030885chr342030 1884 912 388 22249 2236 --1604
NM_031435chr125831 421 261 254 98 --12346 1493
NM_031845chr233644 3211 2257 --33358 1454 476 12302
NM_031847chr233644 3211 2257 --33358 1454 476 12302
NM_032116chr13115812 5465 5169 4961 4783 3983 1958 1875 1795 1486 106 --1342 24030 1322
NM_032228chr1192962 2616 2369 2352 768 704 482 476 454 ------
NM_032373chr10115449 5125 4878 4836 3863 2166 1753 1326 1219 478 372 13664 --24820 1461
NM_032433chr1941295 1289 1274 533 ----21556 1360
NM_032505chr382441 1858 1793 1775 1052 639 625 102 11800 ----
NM_032859chr1393932 3496 2836 2823 1160 1128 1078 698 571 13761 1155 12698
NM_032900chr1063837 2493 2423 492 456 419 1401 12447 --
NM_033020chr1114863 4797 4676 3472 3106 1753 1031 896 832 601 538 --14703 1571
NM_033135chr1182401 2170 2080 2042 821 763 697 297 11793 12392 --
NM_033222chr951376 437 377 77 50 1967 --1391
NM_033224chr7138051 7409 7145 6986 5574 3141 2237 2157 1834 1623 1469 811 662 12875 ----
NM_033285chr8154472 4345 4075 4050 3999 3907 3885 3379 2955 2781 1791 1569 1463 568 119 14303 ----
NM_033360chr12113936 3433 3124 3081 2982 2849 1433 1042 665 328 322 1548 33520 1741 289 --
NM_033393chr442127 1938 894 680 --1338 1354
NM_033430chr484120 3667 3579 3102 1626 968 345 312 1164 1839 11584
NM_033437chr484120 3667 3579 3102 1626 968 345 312 1164 1839 11584
NM_033551chr593053 2901 2467 2461 2455 2449 2238 890 300 ------
NM_033656chr21135971 5636 5574 4990 4727 4398 4050 3677 2330 1952 1679 982 611 12200 25284 4411 --
NM_052811chr1394291 3355 3335 2076 2002 1992 946 938 24 25204 4057 14332 12018
NM_052867chr1351241 1075 1069 1062 508 ------
NM_052879chr1293839 3827 3333 3281 2995 2898 1491 277 271 23431 184 ----
NM_052885chr12104881 4637 4423 4415 3528 1864 1260 740 452 110 31407 1185 786 21281 874 13679
NM_052907chr128766 714 659 650 589 237 172 44 14307 23995 1086 --
NM_053016chr957498 2258 1925 1543 1453 21266 440 11328 25167 1749
NM_053056chr1182598 2100 2094 1080 1054 917 486 140 1322 22142 2057 12445
NM_053064chr1432337 1918 808 ----22044 59
NM_080867chr1484939 4546 4171 4129 3294 1089 873 220 21262 228 21975 1009 --
NM_080872chr843610 3523 759 413 1361 11624 13097
NM_080927chr3123120 3100 2312 2263 2087 2080 2060 2047 1323 1265 1110 1024 33326 2299 511 12493 12204
NM_130436chr2142441 398 278 54 42094 2021 486 38 --12368
NM_130438chr2143018 975 855 631 42671 2598 1063 615 --12945
NM_133496chr184464 3211 2898 2890 2884 976 593 304 43491 3077 676 259 --13520
NM_138270chrX93459 2878 2298 2238 1347 1233 1161 486 134 12524 ----
NM_138286chr19103787 3777 3505 3400 3358 3307 3232 3183 1133 791 22995 2656 12895 23818 2912
NM_138348chr5115837 5181 4888 4492 4325 2469 1870 1515 1182 999 301 25065 1537 ----
NM_138444chr1394422 4170 3999 3509 3381 1946 1274 616 538 21886 1828 24353 1281 13925
NM_138459chr663248 3234 2900 2458 1421 894 ----12708
NM_138565chr1171320 1257 266 250 96 86 79 ------
NM_138576chr1474560 1866 821 609 602 340 242 11295 33064 1572 568 --
NM_138713chr1686792 5621 3131 1917 1901 1653 1357 516 18182 16396 --
NM_138714chr1686792 5621 3131 1917 1901 1653 1357 516 18182 16396 --
NM_138727chr162008 2001 1994 1988 1951 784 ------
NM_138728chr162008 2001 1994 1988 1951 784 ------
NM_139281chr593404 3231 2569 2277 1365 1189 1158 1045 1020 11438 12194 --
NM_139321chr2043946 2966 2574 654 11021 --1845
NM_144571chr4126734 6451 6256 5020 4928 4441 2536 2162 1584 1406 677 319 21365 230 21372 656 --
NM_144578chr1465479 4751 4413 4304 613 234 1680 43942 3779 1603 1379 --
NM_144599chr1595491 5348 5227 4864 4835 4513 4024 2118 1855 1517 24586 1476 --
NM_144664chr1172091 1954 545 449 396 361 347 2702 467 ----
NM_144973chr1255305 5177 3640 1399 1026 --13771 13426
NM_145055chr18123803 3708 3190 3153 2691 2675 1449 1348 1342 1326 1317 1097 --1346 13669
NM_145117chr1183227 3004 2292 2108 1022 1001 810 620 11030 ----
NM_145259chr266664 6033 5564 2273 1252 72 26341 2785 --22182 316
NM_145341chr1061824 1742 340 293 188 170 11308 175 --
NM_147150chr953937 3891 3821 1533 1523 --23048 2607 14011
NM_148174chr851704 680 655 618 572 22203 1500 12077 1342
NM_152519chr241388 888 849 154 --21505 625 1486
NM_152557chr751108 338 267 260 253 ------
NM_152594chr1572024 1950 1882 1823 904 485 472 21560 653 1893 --
NM_152622chr5113263 3216 2880 2674 2497 1181 1140 818 784 504 409 ------
NM_152624chr5127473 7092 6603 5181 2672 2489 1882 1860 1305 876 538 272 16204 1387 --
NM_152629chr994108 3879 3668 1463 1059 774 615 588 207 ------
NM_152756chr5114283 4244 3990 3317 1404 1169 1074 705 527 292 234 --13047 --
NM_152758chr852836 2443 2209 2195 153 11992 --1411
NM_152787chrX42994 2447 1436 797 1780 --12853
NM_152924chr1566593 6036 4666 1194 552 203 15178 14730 11227
NM_153020chr611123 ----21443 1332
NM_153188chr5125537 5273 5200 4771 4582 4137 3858 3807 3777 2155 2108 489 --45575 4929 4911 476 --
NM_153207chr1273769 3224 3043 1496 870 858 767 24087 3249 --11533
NM_170606chr781845 1764 1551 1368 1196 329 297 285 1500 1628 --
NM_172071chr1167069 6751 6732 6482 6319 5719 5161 4638 2998 2991 2958 1918 1192 668 373 252 37081 6049 682 ----
NM_173082chr63571 135 95 11571 --2530 488
NM_173214chr1686792 5621 3131 1917 1901 1653 1357 516 18182 16396 --
NM_173468chr4166043 5336 5249 5019 4909 4614 4322 3973 1476 1470 1435 1281 1257 969 244 94 42086 378 233 80 35448 5330 263 11404
NM_173470chrX52887 2337 2133 1047 304 31776 984 975 22163 476 1527
NM_173536chr4175044 4973 4655 4629 3911 3670 3485 3398 1963 1453 1268 1179 1093 1077 1036 497 432 11009 11599 11525
NM_173642chr187576 6302 3521 3329 1218 948 823 55 39224 868 174 ----
NM_173829chr575684 3912 2029 1219 984 672 624 44968 1816 1741 44 35463 1772 499 15953
NM_175854chr1382386 2354 2006 1860 921 869 404 273 ----12340
NM_175861chr1295245 4841 4493 4250 3729 2333 1349 1286 586 --21837 1421 --
NM_176081chr1085676 4667 4091 4048 3793 3759 1892 711 15476 1381 --
NM_176083chr1085676 4667 4091 4048 3793 3759 1892 711 15476 1381 --
NM_177438chr1484219 4126 3728 623 478 318 312 199 13133 1206 --
NM_177925chr1242562 2461 2229 1924 12954 12239 12438
NM_177966chr361835 336 330 324 318 303 11308 ----
NM_178135chr471260 907 900 878 870 261 206 11307 1191 --
NM_178151chrX67247 6697 6157 4761 2038 1388 16741 11175 1107
NM_178152chrX67247 6697 6157 4761 2038 1388 16741 11175 1107
NM_178153chrX67247 6697 6157 4761 2038 1388 16741 11175 1107
NM_178154chr145550 526 520 514 504 --1827 --
NM_178155chr145550 526 520 514 504 --1827 --
NM_178156chr145550 526 520 514 504 --1827 --
NM_178157chr145550 526 520 514 504 --1827 --
NM_181358chr174197 2920 2780 1225 898 575 148 --11578 13429
NM_181481chr1865861 5434 4725 2451 1979 1571 14977 14836 26153 5926
NM_181482chr1865861 5434 4725 2451 1979 1571 14977 14836 26153 5926
NM_181483chr1865861 5434 4725 2451 1979 1571 14977 14836 26153 5926
NM_181521chr16126983 5976 5968 4854 2758 2700 2646 2541 2278 2019 1282 57 11302 67163 5582 4704 4669 2615 1219 --
NM_181787chr863791 3698 3505 789 459 51 --21209 685 --
NM_182485chr4103521 3205 3196 2603 2546 1129 943 718 236 169 1366 ----
NM_182646chr4103521 3205 3196 2603 2546 1129 943 718 236 169 1366 ----
NM_182763chr142774 1050 1024 957 12321 1748 12233
NM_182765chr1032041 1634 638 ----32296 1803 130
NM_182898chr7115861 4980 2518 2310 2126 2050 1958 1891 1021 605 240 24130 862 25414 4305 --
NM_182899chr7115861 4980 2518 2310 2126 2050 1958 1891 1021 605 240 24130 862 25414 4305 --
NM_182964chr1183227 3004 2292 2108 1022 1001 810 620 11030 ----
NM_183075chr423010 1069 ----21845 635
NM_194071chr7105337 5252 5009 4703 3415 1501 1416 1302 898 810 --11294 --
NM_194247chr294189 3869 3630 2906 1720 1414 1101 877 750 --1407 --
NM_194314chr1125525 4843 4658 3799 3575 1518 1413 1400 1391 779 765 665 35436 4723 4109 ----
NM_194434chr1865802 4808 4767 1047 967 292 24436 4050 35360 4389 543 --
NM_198158chr393081 2465 2209 1980 1142 1034 1005 708 80 22761 2234 1736 --
NM_198159chr393081 2465 2209 1980 1142 1034 1005 708 80 22761 2234 1736 --
NM_198177chr393081 2465 2209 1980 1142 1034 1005 708 80 22761 2234 1736 --
NM_198178chr393081 2465 2209 1980 1142 1034 1005 708 80 22761 2234 1736 --
NM_198268chr174197 2920 2780 1225 898 575 148 --11578 13429
NM_198269chr174197 2920 2780 1225 898 575 148 --11578 13429
NM_198270chrX83050 3028 2636 2421 2299 1336 1150 222 --11326 12315
NM_198273chr552822 2512 2091 1135 770 2723 120 12878 13117
NM_198400chr152670 42 32764 1141 29 1359 --
NM_198465chrX102740 2513 2491 1923 1005 679 635 605 148 91 ------
NM_198715chr1116063 5777 5146 4893 4499 2230 2169 1104 1025 754 216 24142 388 11269 --
NM_198793chr384181 4168 3835 3301 2841 2828 2812 1244 13605 33432 2635 235 1162
NM_199054chr1952068 1767 171 157 59 11959 31995 1352 1344 --
NM_199132chr1961761 1468 799 548 278 194 52004 1897 1637 466 111 ----
NM_199188chr1293839 3827 3333 3281 2995 2898 1491 277 271 23431 184 ----
NM_199190chr1293839 3827 3333 3281 2995 2898 1491 277 271 23431 184 ----
NM_199327chr45387 76 70 64 57 ------
NM_199421chr1484939 4546 4171 4129 3294 1089 873 220 21262 228 21975 1009 --
NM_203327chr2084472 4418 4372 4362 4009 3386 3272 898 --24324 1507 14449
NM_203342chr1112586 1310 1229 1191 1026 925 917 630 589 268 260 1905 11303 --
NM_203343chr1112586 1310 1229 1191 1026 925 917 630 589 268 260 1905 11303 --
NM_205768chr192039 1554 1448 550 395 366 359 213 127 --21801 351 --
NM_206853chr653850 3088 1005 987 696 --33692 3029 934 --
NM_206854chr675111 4349 3486 3448 1957 516 187 13756 44953 4290 3540 3428 --
NM_206855chr696076 5314 4451 4413 1481 1152 864 272 60 14721 55918 5255 4505 4393 3946 --
NM_207303chr1054023 3412 3295 2676 172 --23424 384 1213
NM_207361chr1366141 4637 4088 2194 487 436 --25782 1743 15167
NM_207372chr10102448 2355 2283 2012 1989 1907 698 687 410 47 11580 ----
NM_207406chr4126369 5922 5841 4673 4666 2047 1987 1921 1407 1355 727 595 14986 16420 --
NM_212460chr761773 1448 1440 1434 655 37 11942 22015 1476 --
NM_213589chr2125553 5449 5435 4831 4519 4056 3447 2134 2127 2043 1899 523 --23707 2183 --
NM_213590chr1394291 3355 3335 2076 2002 1992 946 938 24 25204 4057 14332 12018