TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-548an
miRNA Sequence: AAAAGGCAUUGUGGUUUUUG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr51109 --1863 --
NM_000016chr12655 615 ------
NM_000037chr832390 999 355 --11908 --
NM_000038chr551815 1308 516 299 166 ------
NM_000044chrX3162 94 54 ----1284
NM_000051chr1133415 751 197 258 37 31353 1269 1030 12425
NM_000052chrX103271 3107 3079 2617 2527 2484 2164 904 608 527 --32943 587 391 --
NM_000055chr3166 ----1323
NM_000074chrX----1356 --
NM_000080chr172961 276 ----1701
NM_000081chr151544 1407 1162 616 499 ------
NM_000084chrX116951 6522 5896 5881 5295 5277 4770 2688 2202 942 620 --55407 2333 1898 450 273 --
NM_000089chr71326 ------
NM_000090chr2----2862 200 --
NM_000093chr952363 1739 1531 962 538 ------
NM_000109chrX72656 2632 2123 1865 1830 559 417 ------
NM_000112chr5105365 5187 4963 4267 4080 3430 1586 1568 1087 517 21772 959 65067 4213 3555 1473 759 684 24906 1338
NM_000125chr664187 3147 2708 1566 916 179 1542 34045 3778 3206 --
NM_000129chr631309 392 87 --1165 --
NM_000133chrX11105 --1121 --
NM_000138chr1521842 327 --12096 --
NM_000141chr1051341 1238 980 585 304 ------
NM_000142chr41274 1564 1372 --
NM_000146chr191137 ------
NM_000161chr1441783 1492 1374 719 11831 1758 --
NM_000163chr53362 333 259 --1134 --
NM_000168chr783303 2988 2872 2538 2369 2282 715 199 1433 22704 1226 12386
NM_000170chr91199 ------
NM_000176chr533638 2645 25 151 43952 3767 995 498 --
NM_000189chr232243 1903 101 ------
NM_000190chr112225 169 ------
NM_000192chr1231551 1354 393 11280 11360 --
NM_000194chrX1104 ------
NM_000210chr242337 1665 708 662 --1229 1435
NM_000214chr2031665 1314 293 --1433 --
NM_000217chr1274738 4320 4299 3338 2120 765 341 --44095 3250 1759 1271 11659
NM_000222chr431943 1850 1555 1590 21977 129 11580
NM_000227chr18----1290 --
NM_000228chr1279 43 1285 149 --
NM_000237chr8--11921 1446 11819
NM_000248chr33586 490 122 1527 1841 --
NM_000252chrX2401 144 1517 11067 --
NM_000253chr4----1769 --
NM_000254chr142350 638 361 66 12182 2317 22 --
NM_000259chr15106233 5208 4903 4671 4157 4002 2174 1315 650 300 14566 35853 5450 4278 12109
NM_000264chr922670 669 13211 13006 --
NM_000267chr1742964 2746 2275 372 --33134 1112 187 --
NM_000280chr113987 685 639 ------
NM_000297chr442009 476 313 110 --1590 --
NM_000314chr1023007 2254 --12080 --
NM_000319chr1231097 938 121 --1281 11104
NM_000321chr1341710 1612 348 281 11386 11719 1620
NM_000328chrX--196 ----
NM_000329chr11896 1296 ----
NM_000332chr6116942 6331 4754 4617 2847 2492 2020 1883 1709 1236 286 16861 54473 2767 991 738 177 --
NM_000333chr3----190 1236
NM_000334chr1731964 641 461 ----11730
NM_000335chr341864 1363 652 42 12092 1840 --
NM_000337chr576506 4826 4791 4523 4468 1409 43 --24814 2257 11212
NM_000340chr341490 1411 1158 489 ----11233
NM_000345chr43961 891 217 --1379 --
NM_000346chr1741504 735 607 572 --21682 1361 11869
NM_000353chr16----1142 --
NM_000362chr2293589 3419 3379 3145 2348 1373 1289 1276 776 --22997 815 --
NM_000368chr973967 3824 1903 1522 1097 900 373 --1527 24646 490
NM_000369chr1431854 761 580 --11766 11273
NM_000378chr11157 ------
NM_000386chr172789 159 ----1287
NM_000389chr6290 70 --21468 1259 --
NM_000391chr1161662 522 452 443 291 206 --11494 --
NM_000393chr241547 1348 606 535 ------
NM_000397chrX22295 1854 --12415 --
NM_000399chr1041013 912 864 292 ------
NM_000408chr263180 3089 2717 2632 2471 1125 23423 208 32440 1275 109 12144
NM_000411chr2142027 1273 1174 109 1877 11214 12371
NM_000424chr12124 ----1359
NM_000428chr141131 --22475 2348 --
NM_000430chr1773422 3001 2643 2555 1247 711 417 ------
NM_000437chr122096 799 --21507 697 --
NM_000439chr542212 1720 722 422 ----12328
NM_000447chr11398 ----1431
NM_000448chr1153113 2888 932 511 432 1191 22661 1163 --
NM_000450chr1------1120
NM_000459chr92926 586 ------
NM_000461chr354580 4335 3143 1477 454 --11571 --
NM_000462chr1541684 1429 738 369 11730 21558 522 --
NM_000480chr1131492 1353 419 ------
NM_000484chr2141067 679 380 125 ------
NM_000486chr1282846 2826 2484 1988 1190 1000 365 246 ------
NM_000489chrX33409 2712 527 --32888 2426 2406 1317
NM_000495chrX1450 --1777 --
NM_000522chr7158 --11227 --
NM_000523chr22741 60 ------
NM_000527chr1952471 2371 2102 1547 489 --1528 --
NM_000533chrX11498 --31244 403 89 --
NM_000539chr331473 1008 299 ------
NM_000555chrX117018 5893 5711 5485 4821 3158 2936 1396 1186 859 97 14788 11424 21508 1337
NM_000558chr16188 ------
NM_000565chr152142 1790 1553 487 112 1525 ----
NM_000590chr5------1132
NM_000599chr253903 3086 1851 1408 1191 11321 24602 3243 --
NM_000601chr71333 --144 --
NM_000609chr1083046 2727 2639 2254 869 795 760 257 --1271 --
NM_000610chr1152639 1121 441 262 195 12451 22836 1112 --
NM_000611chr1166801 6689 6128 5849 2778 1918 --31493 1283 704 1620
NM_000615chr1122499 845 --3970 786 144 1152
NM_000617chr1211504 12274 ----
NM_000618chr1246398 5698 5673 1063 14437 25856 5093 25156 170
NM_000618chr1246398 5698 5673 1063 14437 25856 5093 25156 170
NM_000633chr1825012 1805 --44936 4486 3857 292 1961
NM_000635chr1931670 1631 584 11385 --11564
NM_000676chr17------1218
NM_000679chr5----1153 --
NM_000685chr34762 681 556 167 --1311 --
NM_000685chr34762 681 556 167 --1311 --
NM_000686chrX3612 381 43 ------
NM_000693chr1531426 607 343 --1663 11594
NM_000702chr121907 1873 --11508 --
NM_000719chr1254978 2578 2376 787 25 --21764 351 --
NM_000721chr132285 2106 183 --12305 12231
NM_000723chr1741716 1065 562 402 --1123 --
NM_000724chr104676 495 111 77 ------
NM_000726chr211328 --21490 1076 --
NM_000735chr62243 22 ------
NM_000780chr821125 513 1936 11051 --
NM_000792chr11322 182 --1972
NM_000793chr1495055 4056 3829 3555 3508 3290 1070 399 318 13885 13425 --
NM_000800chr531342 1072 170 11473 ----
NM_000801chr2061127 1115 990 718 294 97 ------
NM_000806chr53693 96 82 31452 726 463 1504 --
NM_000809chr498494 8113 7057 6468 3393 3303 2523 1178 1167 39159 6605 3678 59037 6208 5742 1793 52 18148
NM_000810chr151148 --1496 --
NM_000811chr51281 ------
NM_000813chr585373 4394 3781 1628 1379 1175 978 897 --35458 1662 626 --
NM_000814chr1553825 2665 694 405 361 --13025 11196
NM_000816chr5----1633 --
NM_000817chr2----21030 38 --
NM_000826chr452588 2552 1656 414 193 1589 --11689
NM_000827chr552466 1847 1790 626 360 11655 22275 2146 11979
NM_000828chrX51540 814 716 228 172 ------
NM_000829chr113364 88 26 --22172 589 --
NM_000836chr192651 266 ------
NM_000838chr641978 1795 1754 156 --12754 --
NM_000841chr63826 793 91 --1369 --
NM_000844chr33897 335 162 ------
NM_000860chr431577 1299 1063 182 1278 --
NM_000868chrX52570 2500 1797 709 508 ------
NM_000875chr15136618 6284 4914 4829 4612 4540 2380 2350 2199 1676 1371 807 203 21203 241 67037 5884 2824 1960 1734 1456 --
NM_000876chr621229 326 ----1100
NM_000883chr71275 ------
NM_000883chr71275 ------
NM_000891chr1743682 1067 786 373 --23613 1417 1904
NM_000895chr121108 ------
NM_000899chr1273770 3365 1745 1634 1401 809 702 12968 13796 11273
NM_000901chr462271 1976 1698 695 639 29 12191 32535 1959 962 --
NM_000908chr52312 187 --1580 --
NM_000909chr41132 --41336 240 148 138 --
NM_000912chr853539 2546 1357 385 275 ------
NM_000917chr103911 840 385 ------
NM_000919chr51570 ----1209
NM_000921chr121490 ------
NM_000922chr111294 --2442 433 1395
NM_000924chr1221084 854 ------
NM_000933chr202670 327 11196 11522 --
NM_000935chr33810 251 63 --11011 --
NM_000937chr171120 --1381 --
NM_000938chr4265 45 --1134 --
NM_000944chr421601 360 --1232 --
NM_000945chr261852 1800 1384 537 268 36 1676 ----
NM_000949chr52853 776 ------
NM_000950chrX83619 2957 2847 2312 978 487 327 232 13011 63127 3121 2757 2367 1005 888 12239
NM_000958chr531206 393 138 1904 ----
NM_000960chr192496 36 ------
NM_000962chr922298 825 22384 1113 ----
NM_000963chr131781 639 255 ------
NM_000964chr17147 --157 --
NM_000965chr341246 475 392 381 ------
NM_000966chr122855 753 ------
NM_000983chr111001 --21581 339 --
NM_001001132chr214538 361 319 133 --11156 --
NM_001001323chr1263183 3149 2514 1258 961 348 12537 42886 1198 477 386 11938
NM_001001330chr104913 810 353 327 1898 ----
NM_001001331chr331725 826 740 ------
NM_001001389chr1152639 1121 441 262 195 12451 22836 1112 --
NM_001001390chr1152639 1121 441 262 195 12451 22836 1112 --
NM_001001391chr1152639 1121 441 262 195 12451 22836 1112 --
NM_001001392chr1152685 1167 487 308 241 12497 22882 1158 --
NM_001001395chr1222521 422 --52340 2300 2188 844 811 --
NM_001001396chr194448 3966 3878 3687 3315 2925 1581 1344 858 --21747 852 11078
NM_001001419chr564681 4282 4117 4043 3848 3783 --65177 2060 1902 1071 999 797 1278
NM_001001420chr564681 4282 4117 4043 3848 3783 --65177 2060 1902 1071 999 797 1278
NM_001001433chr2023001 565 ------
NM_001001481chr82280 72 1567 --1201
NM_001001483chr111427 --1373 --
NM_001001484chr1031666 831 144 ------
NM_001001523chr13995 532 402 ------
NM_001001549chr792757 2615 2566 2452 2139 1813 1058 966 750 ------
NM_001001550chr792757 2615 2566 2452 2139 1813 1058 966 750 ------
NM_001001555chr792757 2615 2566 2452 2139 1813 1058 966 750 ------
NM_001001557chr851821 1638 764 543 351 --1777 --
NM_001001560chr221758 --1529 --
NM_001001567chr21----1191 --
NM_001001568chr21----1191 --
NM_001001571chr21----1191 --
NM_001001572chr21----1191 --
NM_001001573chr21----1191 --
NM_001001574chr21----1191 --
NM_001001575chr21----1191 --
NM_001001576chr21----1191 --
NM_001001577chr21----1191 --
NM_001001579chr21----1191 --
NM_001001580chr21----1191 --
NM_001001581chr21----1191 --
NM_001001582chr21----1191 --
NM_001001584chr21----1191 --
NM_001001585chr21----1191 --
NM_001001664chr293784 3084 2879 2670 2620 928 620 270 233 --53175 2773 1310 1141 894 --
NM_001001668chr1933807 2812 1677 34055 985 557 33520 3389 39 --
NM_001001669chr532493 2249 851 1489 12455 --
NM_001001701chr432132 1444 870 --21848 329 11564
NM_001001787chr13163 79 64 ------
NM_001001890chr2184046 3297 3207 3110 3100 2977 1475 600 11517 13363 --
NM_001001924chr821671 1475 11680 21322 295 --
NM_001001925chr821671 1475 11680 21322 295 --
NM_001001928chr22138340 7936 6470 6039 5749 5389 2395 2314 1327 865 378 360 299 16621 1551 11250
NM_001001931chr821671 1475 11680 21322 295 --
NM_001001936chr104471 374 297 60 --31122 993 391 --
NM_001001938chr993978 3609 3116 2832 2611 1650 1630 929 265 13675 ----
NM_001001974chr1052296 1901 1523 702 652 ------
NM_001001995chrX2762 546 --11259 --
NM_001002032chr171500 --129 --
NM_001002233chr83626 491 74 12089 21573 603 1228
NM_001002243chr23909 690 366 --2274 32 --
NM_001002257chr263323 3145 3136 2346 1425 789 21360 272 1875 --
NM_001002258chr231910 518 329 --1618 --
NM_001002259chr122320 69 ------
NM_001002264chr13161 --1100 --
NM_001002265chr102804 719 ------
NM_001002266chr102804 719 ------
NM_001002295chr102966 792 ----11115
NM_001002814chr893851 3693 3266 3249 1327 904 626 491 74 --31573 919 603 1228
NM_001002838chrX3510 356 279 ------
NM_001002843chr1531206 1148 336 ----1824
NM_001002860chr1484390 4112 3290 3057 2949 1485 1369 1238 --33951 3618 213 11230
NM_001002876chr22------1369
NM_001002909chr1762116 2022 1838 1385 430 168 --41649 1431 836 328 --
NM_001002914chr17----11292 --
NM_001003406chr2252931 2255 1199 644 367 --23060 1021 --
NM_001003652chr18178623 8013 7206 6932 6896 6464 6440 3141 2976 2362 2288 2099 1792 1549 1144 874 248 37122 5901 3165 78490 6639 2749 1830 1581 554 474 12886
NM_001003665chr112766 11086 23246 165 --
NM_001003674chr18126840 5445 5341 5126 4683 4664 1443 1269 818 443 279 133 11655 55628 4964 4947 2691 647 --
NM_001003675chr18126840 5445 5341 5126 4683 4664 1443 1269 818 443 279 133 11655 55628 4964 4947 2691 647 --
NM_001003679chr142177 2124 1443 276 1892 --11877
NM_001003681chr2251481 481 418 409 280 --21896 780 1182
NM_001003682chr131397 586 330 ------
NM_001003698chr631679 1632 223 ------
NM_001003699chr631679 1632 223 ------
NM_001003712chr1253549 1315 793 319 234 21021 79 53021 2783 1526 1401 607 12792
NM_001003790chr83302 182 86 ----1210
NM_001003791chr83302 182 86 ----1210
NM_001003792chr351132 958 781 415 36 --1944 --
NM_001003793chr351132 958 781 415 36 --1944 --
NM_001003800chr953610 2966 2722 1241 1137 23532 2284 ----
NM_001003805chr142105 63 148 ----
NM_001003810chr42323 196 --1656 --
NM_001003891chr221131 ----1120
NM_001003940chr1553796 2345 468 210 83 --1849 --
NM_001003942chr1553796 2345 468 210 83 --1849 --
NM_001003943chr1553800 2349 472 214 87 --1853 --
NM_001003945chr921873 318 ----187
NM_001004051chrX161 ------
NM_001004065chr963931 3304 2929 2736 944 27 ------
NM_001004196chr331098 936 816 --21081 503 --
NM_001004304chr1243270 2901 2888 2165 --12262 1772
NM_001004317chr654473 3921 3868 3810 679 --24428 4165 24225 318
NM_001004329chr1221387 131 ----11498
NM_001004342chr1106021 5271 5018 4759 4676 4060 3982 2043 1636 1611 24024 528 25796 341 --
NM_001004346chr421003 987 ----11197
NM_001004360chr251889 1768 1699 1686 772 --12008 --
NM_001004441chr531602 1514 1372 11475 21411 1072 --
NM_001004720chr2----1663 --
NM_001004722chr2----1832 --
NM_001005158chr32394 64 ------
NM_001005159chr32394 64 ------
NM_001005242chr123664 231 94 21419 1283 11547 --
NM_001005266chr15165 ------
NM_001005267chr15165 ------
NM_001005268chr15165 ------
NM_001005269chr15165 ------
NM_001005353chr11885 --1183 --
NM_001005353chr11885 --1183 --
NM_001005366chr124749 649 46 23 172 1760 --
NM_001005372chr172370 50 ------
NM_001005375chrY11202 11510 21852 1740 11610
NM_001005386chr241785 243 142 37 2389 328 --1351
NM_001005404chr1774422 3975 3762 2797 1685 1258 191 --11748 --
NM_001005417chr12701 576 ------
NM_001005463chr1052105 1694 1007 946 658 ------
NM_001005473chr566493 5928 4941 4223 456 276 24960 1728 55560 5415 4734 4651 2333 --
NM_001005474chr351543 1057 279 261 82 ------
NM_001005502chr1294458 4293 4270 3439 3430 2042 1562 975 572 --14758 --
NM_001005609chrX41259 1125 829 663 --33732 3610 501 --
NM_001005611chrX1119 ------
NM_001005732chr21164 ------
NM_001005733chr21164 ------
NM_001005739chr22672 351 ------
NM_001005746chr211328 --21490 1076 --
NM_001005747chr211328 --21490 1076 --
NM_001005849chr17------1511
NM_001005861chr36721 658 138 127 110 73 --1360 --
NM_001005910chr37648 564 482 441 428 270 224 ------
NM_001005911chr37648 564 482 441 428 270 224 ------
NM_001006115chr352706 2478 2122 991 245 ----193
NM_001006600chr521588 479 1390 1662 --
NM_001006610chr1631009 851 766 ------
NM_001006612chrX----2185 49 --
NM_001006613chrX----2185 49 --
NM_001006614chrX----2185 49 --
NM_001006623chr252331 697 514 431 247 1870 42498 2465 539 484 1161
NM_001006635chr21143 --2351 102 --
NM_001006657chr262736 2721 2345 1195 1061 496 --1867 --
NM_001006665chr13803 752 163 --1291 --
NM_001006933chrX287 55 ------
NM_001006935chrX288 35 ------
NM_001006936chrX288 35 ------
NM_001006937chrX288 35 ------
NM_001006944chr111179 --1696 --
NM_001006946chr241389 1382 1292 338 --21438 1192 --
NM_001007023chr1495055 4056 3829 3555 3508 3290 1070 399 318 13885 13425 --
NM_001007024chr1783895 3385 3266 2671 1617 1512 731 88 --33580 386 248 14308
NM_001007025chr1783895 3385 3266 2671 1617 1512 731 88 --33580 386 248 14308
NM_001007075chr41905 --1841 --
NM_001007097chr954017 1774 1151 974 680 --33631 908 341 --
NM_001007098chr12378 152 1654 3826 211 133 --
NM_001007099chr14864 690 319 194 ------
NM_001007100chr14864 690 319 194 ------
NM_001007102chr631440 1319 37 1183 ----
NM_001007226chr1721135 1116 21378 99 ----
NM_001007227chr1721135 1116 21378 99 ----
NM_001007228chr1721135 1116 21378 99 ----
NM_001007229chr1721135 1116 21378 99 ----
NM_001007230chr1721135 1116 21378 99 ----
NM_001007237chr142089 983 973 774 --32377 1933 585 1841
NM_001007246chr2131927 1880 1191 ------
NM_001007267chr2----1174 --
NM_001007466chr663273 1222 1132 425 134 55 1515 25026 3950 15131
NM_001007467chr221107 ------
NM_001007471chr92126 95 --1705 --
NM_001007527chr54714 676 500 229 --1548 --
NM_001007553chr131187 459 411 ------
NM_001007565chr31332 ------
NM_001008220chr531244 961 230 ------
NM_001008222chrX1166 1124 ----
NM_001008225chr7--1184 --188
NM_001008239chr1873735 3502 2739 915 798 563 297 --33183 3133 2911 23020 2371
NM_001008392chr352877 2400 782 481 472 --2405 232 13230
NM_001008407chr711553 11718 21826 1390 --
NM_001008408chr786040 5948 5805 5514 5169 4697 1161 465 24925 4112 45277 5082 4818 1067 14715
NM_001008410chr242235 2077 1755 844 ------
NM_001008495chr82436 426 1849 --1323
NM_001008529chr1731323 1132 94 ------
NM_001008530chr142187 23 1334 1451 --
NM_001008539chr865379 5359 4231 3966 1350 1113 ------
NM_001008540chr21120 ------
NM_001008541chr101605 ----11866
NM_001008541chr101605 ----11866
NM_001008564chr1342280 1877 1578 414 --12228 --
NM_001008660chr1111170 --21601 239 --
NM_001008701chr1942836 2689 2153 1117 --12875 --
NM_001008707chr14----1330 11775
NM_001008726chr1421643 1195 ----1376
NM_001008783chr62687 649 ------
NM_001008800chr1188 ------
NM_001008883chr1188 ------
NM_001008938chr112457 331 ------
NM_001009185chr51125 2527 146 ----
NM_001009552chr82121 49 --124 --
NM_001009554chr464753 3341 1408 793 682 292 --2451 365 --
NM_001009554chr464753 3341 1408 793 682 292 --2451 365 --
NM_001009555chr431420 1095 689 11314 --11656
NM_001009565chr22593 438 --2427 46 --
NM_001009566chr121137 32 ------
NM_001009894chr1211221 --11548 --
NM_001009899chr3116190 5383 5047 4608 4505 4267 4256 1862 1831 1166 621 25257 546 14993 --
NM_001009955chr11442 ------
NM_001009955chr11442 ------
NM_001009958chr71234 --1462 --
NM_001009959chr242362 2236 664 81 11635 22657 496 1658
NM_001009960chr742273 1118 860 552 --12828 --
NM_001009993chr284360 3820 3672 3443 3277 3182 1765 944 ----1847
NM_001009996chr31110 ------
NM_001010000chr1873214 3033 2435 1283 923 741 480 --33452 2815 990 --
NM_001010853chr633241 2991 1170 --2816 507 12396
NM_001010861chr132020 1932 870 --2638 191 --
NM_001010862chrX32855 827 69 --23300 396 --
NM_001010867chr176483 4349 2464 1898 1744 1550 53 12340 26103 2452 12240
NM_001010888chrX94531 4344 4100 3678 3610 3477 3399 3263 1175 12901 14236 --
NM_001010891chr564985 1232 663 438 424 271 36472 1412 1066 66284 6110 765 742 546 294 --
NM_001010895chr941759 1646 1522 121 --183 --
NM_001010897chr131390 ------
NM_001010898chr163554 3213 2560 2296 2285 999 --33335 2817 2808 --
NM_001010908chr101504 1665 ----
NM_001010924chr102861 781 ------
NM_001010927chr61390 ------
NM_001010932chr71333 --144 --
NM_001010934chr72344 277 ------
NM_001010971chr13994 872 357 ------
NM_001010984chr151962 1753 1713 760 747 --1996 --
NM_001010986chrX42449 1639 833 530 1158 32495 2172 931 --
NM_001010989chr161508 --2492 131 1210
NM_001010990chr161508 --2492 131 1210
NM_001011513chr473996 3327 2764 2533 2509 838 393 --34053 2757 984 --
NM_001011515chr43953 946 94 --1786 11040
NM_001011516chr43953 946 94 --1786 11040
NM_001011537chr322293 2118 1595 32056 1693 456 11843
NM_001011546chr204742 694 673 108 ------
NM_001011645chrX3162 94 54 ----1284
NM_001011658chrX32096 1918 585 ------
NM_001011663chr102953 435 --1409 --
NM_001011666chr786441 6064 5207 4690 2551 2112 1535 488 21926 355 66052 4752 4503 812 230 155 14654
NM_001011713chr1471302 1110 1029 652 601 535 78 1374 21548 1158 --
NM_001011720chr841470 582 488 395 --11517 --
NM_001011885chr1531655 497 449 ------
NM_001012267chr921413 698 ------
NM_001012393chr1164959 3684 3376 1810 885 528 11340 14191 24509 158
NM_001012398chr162780 202 ------
NM_001012410chr31362 ------
NM_001012418chr6114226 4104 3955 3940 3754 3722 3653 3255 3205 596 90 --33659 633 448 11381
NM_001012426chr623063 1043 12538 13095 --
NM_001012427chr623063 1043 12538 13095 --
NM_001012514chr241082 827 431 259 ------
NM_001012516chr241082 827 431 259 ------
NM_001012614chr41489 ------
NM_001012732chr421027 197 --165 --
NM_001012751chr1051651 1302 726 550 76 --21527 1216 --
NM_001012754chr1331663 766 459 2828 759 22003 493 --
NM_001012755chrX11794 24099 249 34729 4652 1776 13629
NM_001012761chr542613 1928 874 550 1445 --12537
NM_001012968chrX52662 2017 654 508 197 --42776 2196 888 458 1714
NM_001012977chrX11064 --21427 469 --
NM_001012979chrX187 --2166 56 --
NM_001012989chrX1163 ----1258
NM_001013031chr1063322 3026 2983 2221 757 534 --43032 1101 1082 1063 13282
NM_001013399chr64839 313 266 68 ------
NM_001013406chr711182 ------
NM_001013415chr41542 ------
NM_001013437chr184381 331 115 50 --167 --
NM_001013438chr31368 1250 ----
NM_001013439chr31214 196 ----
NM_001013620chr1236807 3351 1017 --108426 8012 7041 6918 5704 5312 2836 1657 1056 1029 18335
NM_001013635chr1241179 1041 915 904 --2342 38 --
NM_001013642chr13912 277 218 --1998 --
NM_001013693chr152921 2237 2142 903 232 --1617 --
NM_001013693chr152921 2237 2142 903 232 --1617 --
NM_001013699chr121412 ------
NM_001013703chr152501 383 ------
NM_001013746chr7--6904 582 498 418 166 81 --2666 334
NM_001013843chr15----2921 141 --
NM_001014283chr1352114 1468 235 203 164 ------
NM_001014434chr11249 ------
NM_001014443chr1----192 --
NM_001014797chr10128183 7767 7510 7318 7308 7153 5600 2874 2116 1497 1328 286 11075 22839 828 --
NM_001014831chr192819 516 ------
NM_001014832chr192819 516 ------
NM_001014834chr192819 516 ------
NM_001014835chr192819 516 ------
NM_001014839chr11133 ------
NM_001014841chr11133 ------
NM_001015045chr422412 162 11973 --11630
NM_001015048chr1483182 3038 2769 2744 1274 462 326 282 1808 2724 147 --
NM_001015049chr1483182 3038 2769 2744 1274 462 326 282 1808 2724 147 --
NM_001015053chr1751535 636 401 371 210 ----1464
NM_001015508chr82518 240 --1647 --
NM_001015877chrX92550 2446 2193 1091 1007 984 900 543 147 --32893 2410 628 --
NM_001015880chr1041603 1160 360 71 ----21550 1501
NM_001015881chrX1883 --1813 --
NM_001015885chr201347 ------
NM_001017368chr1792823 2562 2180 1963 1833 459 304 160 28 22748 1118 --12305
NM_001017371chr221021 146 ------
NM_001017395chr382699 2503 2219 1358 1022 969 887 396 --23280 1069 11250
NM_001017396chr261437 1374 1342 827 808 65 1452 ----
NM_001017402chr1279 43 1285 149 --
NM_001017415chr12518 294 --1307 --
NM_001017416chr12518 294 --1307 --
NM_001017423chr102314 56 ------
NM_001017424chr13564 479 451 --1247 --
NM_001017425chr13564 479 451 --1247 --
NM_001017440chr7117641 6884 5180 2798 2780 2329 1611 1081 731 216 207 11452 57270 7069 1914 1639 618 --
NM_001017523chr1251892 1430 1318 720 303 ------
NM_001017916chr1741599 469 142 37 ------
NM_001017917chr1741599 469 142 37 ------
NM_001017920chr21117 ------
NM_001017922chr11620 --21720 424 --
NM_001017923chr141257 164 1305 --
NM_001017926chr851665 1504 1440 1332 508 11782 1709 --
NM_001017962chr103911 840 385 ------
NM_001017963chr141683 --1200 --
NM_001017977chr11371 ------
NM_001018003chr83475 256 139 ------
NM_001018004chr151447 ------
NM_001018005chr151142 ------
NM_001018006chr151447 ------
NM_001018007chr151447 ------
NM_001018008chr153534 483 105 1212 ----
NM_001018009chr331198 1032 234 --1982 --
NM_001018020chr151447 ------
NM_001018050chr2252776 2661 2533 1151 1117 --12572 --
NM_001018052chr2252776 2661 2533 1151 1117 --12572 --
NM_001018053chr141798 1451 1327 555 11744 31969 1564 1432 --
NM_001018054chr131447 428 381 ------
NM_001018057chr1151289 475 396 265 67 ------
NM_001018064chr91425 1627 1442 --
NM_001018065chr9125471 5053 4991 4695 3817 1773 1476 1456 1364 1107 618 415 1308 35034 1405 168 14475
NM_001018066chr9125471 5053 4991 4695 3817 1773 1476 1456 1364 1107 618 415 1308 35034 1405 168 14475
NM_001018067chr165055 4674 3921 3323 443 56 --11360 --
NM_001018068chr165055 4674 3921 3323 443 56 --11360 --
NM_001018069chr165055 4674 3921 3323 443 56 --11360 --
NM_001018072chr1251892 1430 1318 720 303 ------
NM_001018074chr533638 2645 25 151 43952 3767 995 498 --
NM_001018075chr533638 2645 25 151 43952 3767 995 498 --
NM_001018076chr533638 2645 25 151 43952 3767 995 498 --
NM_001018077chr533638 2645 25 151 43952 3767 995 498 --
NM_001018078chr93671 444 176 --2158 78 --
NM_001018090chr1532493 751 556 11092 42485 359 316 149 --
NM_001018091chr1532603 861 666 --42595 469 426 259 --
NM_001018100chr153725 637 630 ------
NM_001018102chr1532493 751 556 11092 42485 359 316 149 --
NM_001018108chr1531419 902 724 21490 417 ----
NM_001018111chr793902 3845 3765 3177 3089 3009 2450 1082 429 13674 ----
NM_001018676chr8----1125 133
NM_001018677chr8----1125 133
NM_001020658chr11169 --1644 --
NM_001020658chr11169 --1644 --
NM_001020818chr1931464 688 90 ------
NM_001020819chr1931464 688 90 ------
NM_001020820chr1931464 688 90 ------
NM_001020821chr1931464 688 90 ------
NM_001020825chr521113 120 --21427 1242 --
NM_001023567chr1522366 572 --1356 --
NM_001023587chr32866 820 ------
NM_001024071chr143805 396 214 1853 ----
NM_001024094chr533638 2645 25 151 43952 3767 995 498 --
NM_001024218chr142667 245 1282 ----
NM_001024226chr141091 235 163 41 ------
NM_001024227chr141091 235 163 41 ------
NM_001024228chr141091 235 163 41 ------
NM_001024372chr841986 1724 921 240 11824 1730 --
NM_001024382chr112225 169 ------
NM_001024401chr1622800 1903 ------
NM_001024460chr621121 331 1964 1855 --
NM_001024463chr1511092 ------
NM_001024465chr6158 ------
NM_001024649chr552873 2457 2019 845 703 1321 22288 1976 --
NM_001024660chr331259 1093 195 ------
NM_001024666chrX3675 645 248 ------
NM_001024668chr123887 790 331 1291 1699 --
NM_001024680chr231464 1364 31 ------
NM_001024808chr1251798 1098 859 424 369 ------
NM_001024809chr17147 --157 --
NM_001024847chr311608 --32457 579 191 --
NM_001024855chr331334 335 123 --1161 --
NM_001024934chr62529 95 ------
NM_001024935chr62529 95 ------
NM_001024936chr62529 95 ------
NM_001024937chr172158 95 ----1102
NM_001024948chr173144 2922 2840 2259 2168 275 230 1946 42501 2435 1348 224 --
NM_001024956chr1195769 4782 4734 3847 3561 2215 1681 1560 344 15124 44316 3792 1719 1452 22046 1368
NM_001024959chr3----1304 --
NM_001024960chr3----1304 --
NM_001025068chr341591 1462 1261 157 1508 41692 1133 653 487 --
NM_001025069chr341591 1462 1261 157 1508 41692 1133 653 487 --
NM_001025076chr1066052 5206 4909 4243 2161 2018 --55471 4209 3795 1791 140 --
NM_001025077chr1087410 6564 6267 5601 5024 1044 1007 548 --66829 5567 5153 4951 1498 307 --
NM_001025079chr363739 3149 2691 2523 1470 730 14156 1303 23445 1364
NM_001025105chr51361 ------
NM_001025108chr242556 1360 946 769 --34180 3336 3227 --
NM_001025201chr21166 1710 ----
NM_001025205chr33401 110 102 ------
NM_001025233chr1231817 908 407 1136 ----
NM_001025252chr853153 2874 910 355 311 --13201 1104
NM_001025253chr853153 2874 910 355 311 --13201 1104
NM_001025266chr384918 4375 4274 3653 3494 3252 1953 45 --13435 1910
NM_001025356chr1222742 734 --42888 1084 988 593 --
NM_001025366chr621798 466 ------
NM_001025366chr621798 466 ------
NM_001025367chr621798 466 ------
NM_001025367chr621798 466 ------
NM_001025368chr621798 466 ------
NM_001025368chr621798 466 ------
NM_001025369chr621814 482 ------
NM_001025369chr621814 482 ------
NM_001025370chr621798 466 ------
NM_001025370chr621798 466 ------
NM_001025389chr1131492 1353 419 ------
NM_001025390chr1131492 1353 419 ------
NM_001025579chr17--11079 ----
NM_001025580chrX53477 3361 3052 2627 284 1455 31519 873 327 12783
NM_001025595chr411481 1646 11469 --
NM_001025596chr111387 ------
NM_001025616chr431544 1526 336 --1646 21551 611
NM_001025780chr921588 107 --21372 311 --
NM_001029858chr653410 2982 1063 772 658 --1697 --
NM_001029863chr642624 2365 2037 1134 1838 ----
NM_001029875chr542407 1082 1006 524 1416 1716 --
NM_001029884chr642300 2218 1077 229 --12512 --
NM_001030006chr1732687 526 286 --22432 587 --
NM_001030007chr1693555 3132 2846 2440 1503 1353 1281 698 583 12930 33997 1381 530 --
NM_001030055chr1464126 3935 3764 3557 1150 384 --33068 1219 373 --
NM_001030272chr11--2316 101 ----
NM_001030273chr11--2316 101 ----
NM_001030287chr14815 467 290 86 ------
NM_001031623chr651568 1215 1114 586 127 ----11349
NM_001031679chr1283454 3384 2983 2825 2493 1231 553 429 1639 12944 --
NM_001031690chr732389 2336 24 --32566 991 432 --
NM_001031692chr7------1309
NM_001031695chr2295422 4879 4576 3946 3335 1599 960 617 503 35384 5322 1230 34346 3570 2182 1206
NM_001031702chr32118 34 1346 ----
NM_001031716chr21379 1252 ----
NM_001031723chr4----1371 --
NM_001031732chr4103674 3648 3254 3229 2796 2566 2320 1283 1104 370 11298 2886 853 --
NM_001031804chr1663084 2882 1719 1432 1180 911 --22854 2735 13717
NM_001031812chr572177 1828 1784 675 231 152 53 --12129 11440
NM_001031855chrX1193 ------
NM_001032221chr911714 --1591 --
NM_001032279chr11----1382 --
NM_001032280chr61582 --11681 21405 1151
NM_001032282chr82946 505 1235 ----
NM_001032288chr2041583 1327 1209 376 --11087 11094
NM_001032296chr1362721 2466 2358 1996 567 374 ----2574 293
NM_001032363chr151986 475 464 246 118 ------
NM_001032363chr151986 475 464 246 118 ------
NM_001032367chr15----1445 --
NM_001032380chr1011488 11979 ----
NM_001032393chrX1571 --1494 --
NM_001032999chr2065245 4206 3789 1784 1605 1448 --21660 1340 --
NM_001033044chr12229 147 --11268 --
NM_001033045chr233937 3474 966 13763 11552 --
NM_001033047chr432404 2080 242 1956 1159 --
NM_001033056chr12229 147 --11268 --
NM_001033059chr6289 60 ------
NM_001033081chr161910 1729 751 492 235 29 --11759 --
NM_001033082chr161910 1729 751 492 235 29 --11759 --
NM_001033087chr20103262 3008 2921 2690 2340 2296 1015 998 936 341 --22307 265 --
NM_001033112chr51730 --2721 300 --
NM_001033117chr394051 3910 3808 3653 3587 3427 3291 1589 1419 13869 13545 13299
NM_001033506chr112388 324 ------
NM_001033518chr732882 1998 222 1196 21958 1005 --
NM_001033519chr732882 1998 222 1196 21958 1005 --
NM_001033520chr732882 1998 222 1196 21958 1005 --
NM_001033551chr1733174 2952 1338 --23141 324 --
NM_001033557chr2150 --129 --
NM_001033566chr172958 61 ------
NM_001033568chr172958 61 ------
NM_001033602chr1321881 569 --2830 636 --
NM_001033723chr852536 1121 1019 562 80 ------
NM_001033756chr631732 732 400 ------
NM_001033756chr631732 732 400 ------
NM_001033925chr1041616 1448 162 143 --1176 1764
NM_001034194chr41142 ------
NM_001034841chr1685537 5276 5219 4836 3529 1859 1823 44 1301 15201 23938 460
NM_001034850chr511546 --11471 --
NM_001034853chrX2959 51 ------
NM_001034915chr851455 986 470 453 167 ------
NM_001034954chr1032594 2502 261 32414 2213 793 ----
NM_001034955chr1032594 2502 261 32414 2213 793 ----
NM_001034956chr1032594 2502 261 32414 2213 793 ----
NM_001034957chr1032594 2502 261 32414 2213 793 ----
NM_001035003chr4----11279 --
NM_001035004chr4----11279 --
NM_001035254chr92670 36 ----12403
NM_001035260chr102424 289 --1323 --
NM_001035511chr141764 1729 593 206 --21750 478 --
NM_001035512chr141871 1836 700 313 --21857 585 --
NM_001035513chr141871 1836 700 313 --21857 585 --
NM_001037131chr211294 ------
NM_001037132chr741952 1514 839 514 --1464 --
NM_001037133chr741952 1514 839 514 --1464 --
NM_001037163chr74958 303 205 46 ------
NM_001037164chr72363 155 21680 1289 ----
NM_001037165chr7158504 8128 6821 6225 6052 6011 3332 3217 2790 2384 2055 1358 375 240 167 --1975 --
NM_001037317chr132020 1932 870 --2638 191 --
NM_001037324chr32628 177 ------
NM_001037331chr182370 178 ------
NM_001037332chr521902 730 11012 1248 --
NM_001037333chr521902 730 11012 1248 --
NM_001037334chr1882269 2213 1875 790 784 770 559 431 --2324 285 --
NM_001037339chr141687 1182 195 116 11300 1405 1430
NM_001037340chr141687 1182 195 116 11300 1405 1430
NM_001037341chr141687 1182 195 116 11300 1405 1430
NM_001037341chr141687 1182 195 116 11300 1405 1430
NM_001037631chr22939 854 1864 1455 --
NM_001037637chr5----172 --
NM_001037872chr2----1637 --
NM_001037954chr1133369 654 456 12141 12152 --
NM_001038493chr231522 1397 1358 ------
NM_001038640chr153693 640 253 ------
NM_001038702chr572782 2590 1904 1066 961 448 297 12512 1137 --
NM_001038707chr122206 1648 ----12231
NM_001038707chr122206 1648 ----12231
NM_001039348chr221054 420 ----1188
NM_001039349chr221054 420 ----1188
NM_001039465chr142371 29 --2201 99 --
NM_001039479chr1492296 2286 2127 2087 2001 1885 1824 1533 684 --1806 1162
NM_001039490chr111473 --1147 --
NM_001039538chr262730 2625 2592 2467 1068 979 --11352 --
NM_001039547chr365003 4885 2921 976 613 585 35819 5129 1830 57790 6189 2556 866 815 33102 946 141
NM_001039570chr2244060 3436 3367 447 24361 1112 14102 --
NM_001039571chr2244060 3436 3367 447 24361 1112 14102 --
NM_001039573chr171387 1487 ----
NM_001039574chr11281 --1662 --
NM_001039577chr174498 1683 1590 1331 1049 219 185 --11710 --
NM_001039580chr444797 3559 578 559 1922 14066 --
NM_001039582chrX162 --1293 --
NM_001039590chrX63972 3510 3056 2811 2591 138 1751 33545 3235 598 --
NM_001039591chrX63972 3510 3056 2811 2591 138 1751 33545 3235 598 --
NM_001039618chr1185767 5125 4860 4035 1927 1649 1412 331 14240 35845 5041 794 15716
NM_001039690chr1662329 1831 1636 1513 849 648 ------
NM_001039709chr2065245 4206 3789 1784 1605 1448 --21660 1340 --
NM_001039711chr12836 302 --1108 --
NM_001039712chr12836 302 --1108 --
NM_001039715chr11322 182 --1972
NM_001039716chr11386 1146 --11036
NM_001039762chr1031709 571 146 135 11521 1727
NM_001039772chr112447 61 ------
NM_001039775chr1136 ------
NM_001039802chr121362 908 ------
NM_001039840chrX135330 4959 4680 4172 3888 2430 1830 1543 953 510 415 320 55 1426 1177 41984 1474 464 449
NM_001039877chr192286 177 ----1321
NM_001039916chr12151 --11066 --
NM_001039917chr12151 --11066 --
NM_001039918chr12151 --11066 --
NM_001039919chr12151 --11066 --
NM_001039920chr12151 --11066 --
NM_001039937chr1343904 3580 2636 1372 1951 42541 1234 694 611 --
NM_001040001chr631437 1428 331 --11873 --
NM_001040057chr731144 998 973 1486 21192 537 --
NM_001040092chr8------1352
NM_001040100chr341051 909 200 80 --1139 --
NM_001040101chr41139 ------
NM_001040113chr162876 813 ------
NM_001040142chr272215 2006 1922 1899 1817 1802 1586 --22240 1728 --
NM_001040143chr272215 2006 1922 1899 1817 1802 1586 --22240 1728 --
NM_001040144chr1662329 1831 1636 1513 849 648 ------
NM_001040146chr1662329 1831 1636 1513 849 648 ------
NM_001040152chr734210 1887 416 13220 --25000 4583
NM_001040153chr132928 306 --1692 --
NM_001040158chr52482 373 ------
NM_001040159chr43979 433 184 ------
NM_001040181chr321007 765 1932 21145 959 --
NM_001040182chr321007 765 1932 21145 959 --
NM_001040183chr321007 765 1932 21145 959 --
NM_001040199chr321007 765 1932 21145 959 --
NM_001040200chr321007 765 1932 21145 959 --
NM_001040202chr462377 1976 1575 934 174 123 --22519 1709 --
NM_001040214chr652260 2046 752 561 416 11828 --1958
NM_001040260chr43790 386 191 --11145 --
NM_001040261chr43790 386 191 --11145 --
NM_001040284chr16135868 5606 5415 5322 4664 4120 3943 1930 1506 1269 1242 943 25 35392 4387 1623 25080 1208 --
NM_001040402chr472529 2381 2326 1043 972 831 193 --33009 2825 1242 --
NM_001040409chr23745 315 116 --1912 --
NM_001040429chr1352294 2219 1159 942 113 53133 2871 2843 1386 123 23585 3123 12896
NM_001040437chr6------164
NM_001040438chr6------164
NM_001040439chr1621484 485 ------
NM_001040441chr133346 493 140 --13330 --
NM_001040450chr1552612 2556 2467 999 37 1747 ----
NM_001040453chr1552612 2556 2467 999 37 1747 ----
NM_001040455chr1141216 840 353 250 ------
NM_001040619chr121265 536 --11025 --
NM_001040665chr754955 4808 4319 1855 1424 34738 3065 357 24594 4209 14263
NM_001040666chr73657 510 21 --1296 --
NM_001040709chr142307 546 536 115 ------
NM_001040712chr933200 2461 414 --23512 2709 13359
NM_001040875chr862290 2282 2096 501 177 82 --12330 11886
NM_001040876chr421615 496 --21438 1296 1605
NM_001042355chr1654830 4257 1603 419 365 24012 754 31190 159 106 --
NM_001042361chr102615 141 11495 ----
NM_001042364chr102615 141 11495 ----
NM_001042365chr102615 141 11495 ----
NM_001042387chr102615 141 11495 ----
NM_001042388chr182349 271 1810 2989 23 --
NM_001042393chr102615 141 11495 ----
NM_001042396chr102615 141 11495 ----
NM_001042397chr102615 141 11495 ----
NM_001042404chr161894 1675 692 598 238 122 11378 ----
NM_001042406chr62998 918 ------
NM_001042412chr1654830 4257 1603 419 365 24012 754 31190 159 106 --
NM_001042413chr993990 3716 3264 3199 2879 2699 2570 2532 682 24136 3045 1238 --
NM_001042414chr13------154
NM_001042424chr453287 2797 2739 827 367 ------
NM_001042425chr61582 --11681 21405 1151
NM_001042453chrX4502 403 375 348 --21127 99 1259
NM_001042473chr1022106 821 --31902 344 109 21765 1604
NM_001042481chr1452164 1776 953 819 791 --32695 2314 317 11856
NM_001042486chr202318 159 ------
NM_001042492chr1742964 2746 2275 372 --33134 1112 187 --
NM_001042494chr1553348 3282 2389 925 235 13018 13263 --
NM_001042495chr1553348 3282 2389 925 235 13018 13263 --
NM_001042496chr1553348 3282 2389 925 235 13018 13263 --
NM_001042497chr1553348 3282 2389 925 235 13018 13263 --
NM_001042498chrX3871 292 121 --1981 --
NM_001042506chrX11074 --41388 1061 579 469 --
NM_001042510chr872177 2002 1651 1404 1368 544 371 --180 --
NM_001042511chr872177 2002 1651 1404 1368 544 371 --180 --
NM_001042517chr131281 --2678 159 182
NM_001042533chr383066 3055 3014 2570 2202 1268 1163 754 ------
NM_001042537chrX11964 --2673 468 --
NM_001042543chr4----11388 --
NM_001042555chr1284729 4625 4244 888 875 600 559 484 1337 14390 34367 1783 1754
NM_001042599chr267768 7686 7271 6344 5917 2887 --37823 7159 5138 27316 6292
NM_001042601chr333286 3175 836 --1314 22882 532
NM_001042603chr12134766 4656 4236 4159 4026 2051 1822 1315 968 962 758 343 203 --53707 3554 1405 1302 881 23874 1687
NM_001042604chr384134 4032 3329 3153 1444 855 603 533 1553 34392 3999 3041 13625
NM_001042632chr2022235 182 ------
NM_001042633chr2022235 182 ------
NM_001042669chr431544 1526 336 --1646 21551 611
NM_001042681chr131889 560 525 --32362 2245 1035 --
NM_001042682chr131889 560 525 --32362 2245 1035 --
NM_001042682chr131889 560 525 --32362 2245 1035 --
NM_001042728chr122855 753 ------
NM_001042749chrX31864 1409 260 --1282 --
NM_001042750chrX31864 1409 260 --1282 --
NM_001042751chrX31864 1409 260 --1282 --
NM_001043318chr1463622 3399 3162 1246 790 701 12919 44051 3918 3180 1621 --
NM_001043351chr151807 906 774 453 116 --22068 150 1258
NM_001044305chr621607 1516 ------
NM_001044385chr243704 3689 2998 2676 --1448 13874
NM_001044722chr572177 1828 1784 675 231 152 53 --12129 11440
NM_001044723chr572177 1828 1784 675 231 152 53 --12129 11440
NM_001046chr553002 2463 461 403 336 1321 22965 1179 --
NM_001049chr1462293 2224 2030 1519 598 156 ------
NM_001068chr3156 --1288 --
NM_001071775chr131235 --11484 11207
NM_001077628chr11206 --1262 --
NM_001079874chr152071 1619 715 507 371 ------
NM_001083620chr452586 2550 1655 413 193 1588 --11688
NM_001083621chr154344 2921 1765 1051 963 34734 3226 1384 1730 --
NM_001092chr174652 635 388 153 --1832 --
NM_001094chr172802 325 1721 1769 --
NM_001096chr174717 710 332 90 ------
NM_001099678chr386434 6117 5699 5115 4332 2252 1847 692 14569 12351 --
NM_001100108chr1118326 8317 6532 5236 3053 2561 2535 2274 1415 1018 832 --65989 5747 2946 2326 1201 814 --
NM_001105518chr11897 --1802 --
NM_001106chr3158428 8144 7868 7255 7185 6329 6164 3770 3146 3074 2061 1717 1548 1515 391 --87269 7209 7034 6740 2799 2444 2337 564 --
NM_001109977chr43577 174 53 ------
NM_001113490chrX113549 3372 2876 2754 2583 1463 1065 1003 725 630 613 --12966 144
NM_001116chr1642577 1958 255 75 --22271 373 --
NM_001117chr1822077 639 --12067 --
NM_001121chr1021823 453 --11711 --
NM_001122679chr51109 --1863 --
NM_001123chr101339 --1689 --
NM_001128chr1693555 3132 2846 2440 1503 1353 1281 698 583 12930 33997 1381 530 --
NM_001135chr15195 --1280 --
NM_001143chrY148 ------
NM_001145chr142164 44 ------
NM_001148chr421692 311 ------
NM_001149chr1011009 ------
NM_001153chr22719 182 --1888 --
NM_001157chr102655 132 --1201 --
NM_001160chr1292795 2515 2385 2056 1725 605 483 282 164 --1404 --
NM_001167chrX76703 4601 2456 1436 1107 1054 824 ------
NM_001173chr1464126 3935 3764 3557 1150 384 --33068 1219 373 --
NM_001174chrX1308 --11544 11672
NM_001177chr1242309 675 514 227 ------
NM_001178chr11--2316 101 ----
NM_001186chr2122074 2053 11274 22521 2352 --
NM_001198chr652445 2341 2187 2064 463 ------
NM_001200chr20----11079 --
NM_001201chr463747 3379 3372 1304 1101 423 --11190 43724 1529 948 878
NM_001204chr277662 7116 7070 4726 2361 134 86 16572 37492 7345 7289 --
NM_001206chr952444 2284 1098 838 760 --32370 2137 270 21051 598
NM_001207chr5----172 --
NM_001219chr721812 710 --1863 --
NM_001233chr742035 931 266 156 --1171 --
NM_001238chr19----1466 188
NM_001241chr241486 834 458 232 1276 ----
NM_001241chr241486 834 458 232 1276 ----
NM_001254chr1721010 73 --1930 --
NM_001256chr1782945 2898 2887 2179 1996 700 638 311 180 1372 --
NM_001257chr1631398 1305 1265 --11440 --
NM_001259chr7176356 5497 5472 4976 4749 4707 2292 1949 1735 1653 1596 1539 1213 1096 826 792 123 1894 22462 2201 21459 1441
NM_001260chr13----1342 --
NM_001262chr11259 --1336 --
NM_001264chr63773 134 30 ------
NM_001265chr131220 ------
NM_001268chr134748 413 150 30 --2828 776 --
NM_001270chr53744 72 22 ------
NM_001271chr1553051 2732 2269 2040 161 --1694 --
NM_001278chr1031164 791 290 ----11185
NM_001280chr191446 ------
NM_001282chr1732687 526 286 --22432 587 --
NM_001283chr71603 2487 263 1275 1671
NM_001286chr142900 2646 2309 384 ------
NM_001290chr411061 --1434 --
NM_001293chr112450 92 ------
NM_001300chr101142 ------
NM_001304chr1773711 3687 3585 3252 2779 2714 1318 11185 22435 1343 --
NM_001310chr1262994 2449 1948 982 326 174 22035 470 ----
NM_001315chr642059 1694 610 52 --31423 369 174 --
NM_001316chr201142 1403 ----
NM_001319chr1921105 1035 ------
NM_001328chr41489 ------
NM_001329chr102286 94 ------
NM_001331chr1172827 2193 2081 1935 1784 316 145 --21120 1080 12094
NM_001332chr51273 --1477 --
NM_001343chr52318 131 11077 1167 --
NM_001349chr21387 ------
NM_001351chr341483 1171 1158 1144 --21831 1713 --
NM_001356chrX42095 1608 554 517 21956 660 --1317
NM_001357chr1------1254
NM_001358chr41116 1103 ----
NM_001364chr1194193 3878 3021 2984 2931 2896 1085 1040 352 181 43809 1584 1440 346 --
NM_001385chr81171 ------
NM_001386chr852361 2133 1709 791 471 --41910 1801 1730 397 --
NM_001387chr53726 588 181 --1930 --
NM_001389chr21----1172 --
NM_001390chr1833089 1304 1151 ----23167 1028
NM_001391chr181281 --146 --
NM_001392chr181259 ------
NM_001396chr2152450 1751 1072 956 818 --52666 1128 1109 902 287 --
NM_001397chr122305 324 ----11762
NM_001399chrX41259 1125 829 663 --33732 3610 501 --
NM_001400chr111280 --1920 --
NM_001401chr91577 --11367 1475
NM_001402chr631981 1660 484 11798 ----
NM_001406chr1731595 1328 1232 ------
NM_001407chr33640 417 268 --1491 11611
NM_001408chr131468 79 72 --21327 1164 --
NM_001412chrX73414 3374 3142 2900 953 875 335 --22947 285 --
NM_001417chr1231916 680 233 21631 173 121 11388
NM_001418chr112548 173 ------
NM_001418chr112548 173 ------
NM_001419chr1994346 4093 4027 3743 3185 3162 1101 466 307 11381 54410 3508 1144 990 111 --
NM_001422chr111247 --31057 1043 42 --
NM_001424chr161630 1677 ----
NM_001427chr721759 1602 --31909 1464 1381 --
NM_001429chr223899 310 230 ------
NM_001430chr23640 445 157 ------
NM_001431chr62916 850 --11143 1319
NM_001432chr423269 979 11168 1849 --
NM_001438chr122366 334 --23645 798 --
NM_001448chrX51551 1427 1154 700 521 --185 --
NM_001451chr163518 485 74 11339 11276 --
NM_001453chr63379 349 229 --31301 605 335 --
NM_001454chr172894 621 ------
NM_001457chr351169 1093 1035 510 138 --144 --
NM_001460chr183260 2940 2384 2343 2234 1070 207 168 --1394 --
NM_001465chr541883 1518 1343 512 1823 1492 --
NM_001493chrX----2685 587 --
NM_001494chr101230 --189 --
NM_001497chr952516 2095 1902 1859 1694 --2541 223 22769 1852
NM_001511chr41607 --1587 --
NM_001514chr12431 83 ------
NM_001530chr141435 ------
NM_001542chr142089 983 973 774 --32377 1933 585 1841
NM_001543chr543020 1641 1127 659 14599 33749 3636 1937 --
NM_001546chr631486 1240 579 ------
NM_001552chr17----11092 --
NM_001554chr11549 ------
NM_001560chrX2877 327 1143 22669 1631 --
NM_001564chr4----137 --
NM_001567chr112729 202 ------
NM_001584chr1121010 321 11215 ----
NM_001604chr113987 685 639 ------
NM_001609chr1073806 3683 1775 292 154 81 63 ------
NM_001614chr171528 --1497 --
NM_001614chr171528 --1497 --
NM_001616chr222655 1270 --12579 11386
NM_001621chr772964 2954 2828 2577 1037 804 521 --2836 496 31081 462 159
NM_001621chr772964 2954 2828 2577 1037 804 521 --2836 496 31081 462 159
NM_001634chr6289 60 ------
NM_001635chr71236 ----1887
NM_001642chr1111093 1432 11138 --
NM_001650chr1863609 3014 2546 1519 1333 1013 1871 43468 3334 2975 1339 --
NM_001654chrX2455 332 --1149 --
NM_001655chr1131879 1551 1356 11647 ----
NM_001656chr532009 1884 159 --1429 --
NM_001658chr141091 235 163 41 ------
NM_001659chr1262536 2345 2061 1067 823 655 --1398 --
NM_001660chr31643 --2682 661 --
NM_001663chr1422265 2028 11791 2523 393 --
NM_001665chr11382 62 54 --2146 130 --
NM_001668chr142264 1734 735 346 1211 31786 857 643 12058
NM_001670chr222727 628 ------
NM_001674chr14815 467 290 86 ------
NM_001677chr14801 717 317 122 ----1866
NM_001678chr1741455 632 267 189 ----11486
NM_001679chr3146 ----1767
NM_001682chr1272897 2863 2228 1010 972 675 62 12251 42600 912 191 100 --
NM_001683chr331725 826 740 ------
NM_001684chr194165 3683 3595 3404 3032 2642 1298 1061 575 --21464 569 1795
NM_001689chr231910 518 329 --1618 --
NM_001690chr321031 481 ------
NM_001695chr833922 3428 867 33861 987 939 11356 23689 1264
NM_001699chr193524 329 116 ------
NM_001704chr61458 ------
NM_001706chr3121 --1837 --
NM_001707chr7----1222 --
NM_001709chr1162198 2180 1795 1128 514 308 --22652 819 1460
NM_001711chrX4790 774 664 285 --11075 --
NM_001716chr1131597 1361 1248 --130 --
NM_001717chr1541377 1073 222 36 ------
NM_001718chr641100 128 60 36 --11011 --
NM_001722chr82257 118 ------
NM_001730chr13------11128
NM_001730chr13------11128
NM_001731chr122772 56 ------
NM_001735chr92400 343 ----1147
NM_001742chr72604 173 --11394 --
NM_001743chr2----2507 54 --
NM_001744chr52188 169 ------
NM_001746chr552873 2457 2019 845 703 1321 22288 1976 --
NM_001748chr12931 923 ------
NM_001753chr741399 661 583 561 --11432 --
NM_001754chr2184046 3297 3207 3110 3100 2977 1475 600 11517 13363 --
NM_001755chr1642237 2070 1832 773 --12256 --
NM_001759chr12105007 4965 4734 4525 3815 3466 3273 2039 1597 841 13498 35204 4768 1531 14602
NM_001760chr64914 650 371 240 ------
NM_001769chr12----1167 1346
NM_001773chr1----11287 --
NM_001777chr363739 3149 2691 2523 1470 730 14156 1303 23445 1364
NM_001781chr122691 126 1199 --1670
NM_001789chr32410 131 1566 ----
NM_001791chr121362 908 ------
NM_001792chr181382 11079 1246 1403
NM_001794chr201241 ------
NM_001797chr162767 606 ------
NM_001802chr161118 1711 ----
NM_001806chr1932795 2785 2714 12261 ----
NM_001810chr201544 ------
NM_001822chr21166 1710 ----
NM_001826chr12152 86 ------
NM_001834chr5165 ------
NM_001838chr172960 865 ------
NM_001839chr12132 86 --1182 --
NM_001843chr121238 ------
NM_001845chr1331235 331 124 11313 1545 --
NM_001854chr1----2574 146 --
NM_001855chr92896 573 ------
NM_001858chr655107 3346 1249 370 219 11926 43500 1463 869 94 14922
NM_001859chr963886 2605 1323 1084 818 319 --2851 261 --
NM_001873chr4264 23 ------
NM_001874chr1294458 4293 4270 3439 3430 2042 1562 975 572 --14758 --
NM_001876chr112501 346 --1515 --
NM_001880chr2----1209 --
NM_001892chr51361 ------
NM_001894chr2221132 38 ------
NM_001895chr202856 775 --1902 --
NM_001901chr61697 1921 1675 --
NM_001903chr5----1615 1182
NM_001904chr34828 303 246 160 --11008 --
NM_001907chr16175 ------
NM_001913chr71628 ------
NM_001914chr18--1415 1329 --
NM_001915chr1741599 469 142 37 ------
NM_001918chr198194 6888 6752 6638 6579 6410 2341 964 829 38834 7510 7337 59241 9025 8483 6530 851 --
NM_001920chr121307 ------
NM_001921chr421027 197 --165 --
NM_001932chr174749 696 620 359 --2650 303 --
NM_001933chr1451337 933 925 513 161 --2314 278 --
NM_001935chr231025 897 177 ----1739
NM_001938chr111716 --1485 --
NM_001939chrX73850 3825 3402 1473 888 322 59 ------
NM_001946chr124809 757 387 78 1751 ----
NM_001949chr642757 2086 424 225 13153 1445 --
NM_001951chr82499 188 ------
NM_001955chr621072 210 ------
NM_001967chr31586 1422 --1386
NM_001968chr42874 155 --1965 --
NM_001969chr1463157 2448 1114 1036 886 799 13675 53496 2619 1019 991 697 --
NM_001977chr42494 138 1150 1584 1114
NM_001978chr82864 342 ------
NM_001981chr152156 2040 315 263 173 --1864 --
NM_001982chr121243 1147 1360 152
NM_001987chr1253113 1707 1566 755 681 --24270 3533 1573
NM_001991chr1721967 45 ------
NM_001995chr431438 1225 174 --1970 --
NM_001999chr541187 964 314 126 --1508 --
NM_002006chr4124787 4637 4416 3633 3596 3578 1719 1704 1500 1032 975 268 1287 35791 4034 1396 --
NM_002009chr1552769 2611 2541 2502 497 22583 856 1888 11013
NM_002010chr131384 ------
NM_002015chr1352731 2541 669 447 322 --23300 82 --
NM_002023chr151462 1263 1222 531 70 ----11644
NM_002024chrX21500 681 11928 1551 21831 220
NM_002025chrX139146 9070 8168 7905 7874 7609 6965 6757 6221 1786 1330 825 263 11560 36728 6249 3217 --
NM_002026chr22906 381 ------
NM_002027chr8----1125 133
NM_002028chr1421285 943 --1910 --
NM_002031chr61610 ------
NM_002037chr62360 316 ------
NM_002039chr41167 ------
NM_002040chr2152938 2417 420 408 32 --32215 1969 1254 12851
NM_002049chrX1119 ------
NM_002051chr102966 792 ----11115
NM_002052chr821468 1056 ----1189
NM_002054chr22425 111 ------
NM_002056chr23828 710 100 ------
NM_002063chrX1848 --21125 350 172
NM_002065chr12229 147 --11268 --
NM_002067chr192271 243 ------
NM_002069chr711473 --21685 635 --
NM_002072chr921014 933 --1783 --
NM_002073chr2231155 1073 319 ------
NM_002074chr12263 246 ------
NM_002077chr951670 1515 781 709 498 1472 1689 --
NM_002080chr16140 ------
NM_002084chr51850 --1268 --
NM_002086chr1741911 1787 1563 528 --2482 262 --
NM_002087chr17----1241 --
NM_002092chr4104031 3927 3484 1264 1155 1146 1030 937 739 267 --2890 637 1621
NM_002095chr8182 --1256 --
NM_002103chr1941015 813 711 330 1347 2720 201 --
NM_002107chr11478 ------
NM_002114chr61437 --2197 25 --
NM_002126chr1783266 3260 3148 2737 1663 956 545 250 23983 1618 21260 813 1282
NM_002128chr132596 520 --42344 1007 527 134 1170
NM_002129chr4----1393 --
NM_002133chr222422 409 ------
NM_002135chr123376 204 177 ----160
NM_002136chr121477 ------
NM_002137chr762003 1910 1680 1604 294 266 --1246 11764
NM_002138chr42323 196 --1656 --
NM_002139chrX1445 --2566 205 --
NM_002140chr92998 349 ------
NM_002141chr71600 --143 --
NM_002146chr171917 ----1172
NM_002148chr22606 597 ------
NM_002156chr22373 281 ------
NM_002158chr2123574 3142 3084 3065 2870 2610 1492 1210 749 728 484 281 --1782 --
NM_002163chr161112 ----1413
NM_002165chr201320 ------
NM_002166chr22679 658 ------
NM_002190chr621075 893 1533 2837 345 --
NM_002193chr2--1525 11719 11453
NM_002196chr203903 329 36 ------
NM_002196chr203903 329 36 ------
NM_002198chr54686 664 561 287 --1844 --
NM_002199chr42781 652 1964 ----
NM_002202chr52991 418 --11025 --
NM_002207chr3152 ------
NM_002211chr101838 --2941 243 11103
NM_002214chr7105497 4559 3685 3520 2060 1892 1748 1670 1153 202 15239 1566 1657
NM_002223chr1261443 1087 646 607 351 30 11362 1901 --
NM_002224chr62761 248 ------
NM_002226chr142804 729 ------
NM_002227chr1--11109 1382 --
NM_002230chr173441 164 40 --1178 --
NM_002233chr111434 --1455 --
NM_002234chr121624 --1600 1759
NM_002235chr1241644 1426 1140 352 1493 11333 --
NM_002240chr212537 89 ------
NM_002241chr163104 2970 2215 2082 1159 462 ------
NM_002247chr1051520 1500 905 643 397 ------
NM_002252chr2------1163
NM_002253chr431416 524 202 ------
NM_002264chr3154996 4875 4445 4363 3579 3089 1968 1703 1294 781 773 756 643 517 134 --11016 24523 4165
NM_002265chr174854 428 404 329 --1337 --
NM_002266chr17153 ------
NM_002267chr1321659 955 --21851 692 --
NM_002268chr321901 1619 ------
NM_002270chr5123954 3812 3741 3489 1909 1850 1595 1397 1226 570 451 222 11751 ----
NM_002271chr1352369 2161 1642 1576 417 ------
NM_002285chr242556 1360 946 769 --34180 3336 3227 --
NM_002293chr172686 2667 1731 1687 981 876 66 --12407 1578
NM_002294chrX2355 306 1147 1442 --
NM_002296chr131619 1137 369 11488 21561 701 --
NM_002310chr586354 5659 1934 1878 1813 1251 1061 715 24184 735 35952 5441 1448 25040 159
NM_002336chr1294984 4896 4847 4793 4524 4421 4091 1789 285 --21669 971 --
NM_002355chr1261235 1054 424 254 163 118 --1131 --
NM_002356chr652698 2356 1016 999 262 11821 2499 122 --
NM_002359chr1743511 3281 3042 28 13859 21284 817 --
NM_002360chr742391 2161 978 575 --32634 2509 2252 --
NM_002370chr1------197
NM_002374chr262730 2625 2592 2467 1068 979 --11352 --
NM_002381chr2----1781 1970
NM_002382chr1421291 277 --11171 --
NM_002383chr161325 --1796 --
NM_002387chr533226 1630 277 11417 14741 15060
NM_002389chr131545 1424 310 --11628 131
NM_002390chr1731782 1718 101 ------
NM_002395chr631436 1235 195 141 1983 --
NM_002397chr552235 1604 1430 880 745 ------
NM_002398chr221381 970 ------
NM_002401chr174873 853 805 594 ------
NM_002402chr711110 --1458 --
NM_002403chr1----174 --
NM_002408chr14197 ------
NM_002430chr2272091 954 929 888 473 417 288 --12104 --
NM_002436chrX2333 67 --1366 --
NM_002442chr1221650 354 ----1256
NM_002457chr112127 111 ------
NM_002465chr121225 ------
NM_002467chr8----1402 --
NM_002473chr2231302 1029 382 --11041 --
NM_002478chr111484 ------
NM_002480chr1241284 1095 545 470 21360 1341 --11035
NM_002481chr1137851 7811 7267 6974 6729 5577 5459 5447 5292 2880 831 383 75 26371 1719 77573 7214 6705 2745 2429 1670 775 17660
NM_002486chr942186 608 84 56 --12538 12308
NM_002487chr152236 229 ----2742 135
NM_002489chr72301 28 ------
NM_002499chr1572445 2412 766 648 507 393 172 --41810 1764 1522 325 --
NM_002500chr21922 --1154 --
NM_002501chr1953448 3408 1538 1312 350 --11529 11272
NM_002505chr621507 190 ------
NM_002518chr22395 102 --1997 --
NM_002519chr1121386 1100 11329 ----
NM_002521chr1273 50 ------
NM_002522chr1783813 3355 3218 3127 1584 1502 459 359 --63902 2935 2820 1329 551 495 --
NM_002523chr73940 780 267 ------
NM_002537chr1521022 684 1706 ----
NM_002538chr54524 213 168 130 ------
NM_002539chr2----196 --
NM_002540chr92694 587 --1438 --
NM_002543chr1221039 35 --21368 1126 --
NM_002545chr1164959 3684 3376 1810 885 528 11340 14191 24509 158
NM_002546chr81301 ------
NM_002547chrX54219 1170 922 207 61 11368 13650 14267
NM_002552chr22148 137 --31135 264 154 1330
NM_002556chr1172123 1974 1620 1560 818 181 94 --21634 853 --
NM_002568chr81423 ------
NM_002576chr11196 --1414 --
NM_002577chr3113948 3886 3711 3502 3083 1063 790 423 405 243 52 --53964 3937 2807 1561 457 12975
NM_002581chr944859 4445 930 821 --44155 3906 2016 1471 1134
NM_002583chr12----1243 --
NM_002586chr6----1313 11183
NM_002588chr521762 709 ----11534
NM_002590chr132455 102 ------
NM_002591chr201531 ------
NM_002594chr2062103 1709 1653 1617 1584 884 ------
NM_002595chr1241943 1239 135 38 --11524 --
NM_002600chr141687 1182 195 116 11300 1405 1430
NM_002606chr21----1191 --
NM_002607chr761176 902 504 441 122 102 --1416 --
NM_002613chr1675349 4934 3994 3480 1877 1302 876 ------
NM_002628chr33931 265 33 --1346 --
NM_002633chr12508 451 ------
NM_002636chr61460 ------
NM_002641chrX----31733 473 74 --
NM_002643chr21133 ------
NM_002645chr1182837 2330 2117 2041 1076 1064 621 576 1387 42182 2156 1959 554 22740 568
NM_002646chr141736 1636 795 665 ------
NM_002648chr631335 1196 447 ----1832
NM_002651chr12847 313 --1833 --
NM_002653chr5----1176 --
NM_002655chr8104676 4255 4070 3911 3753 3738 3488 3379 1487 834 2609 156 44298 3848 3682 106 --
NM_002656chr631078 1060 192 1951 ----
NM_002657chr2033360 2595 2472 1508 33324 2507 2460 --
NM_002668chrX1146 ----1128
NM_002674chr121158 ------
NM_002677chr822211 29 --2794 103 --
NM_002687chr1451204 1121 833 511 92 1451 1359 --
NM_002693chr15----186 --
NM_002697chr1131 --1234 --
NM_002698chr1932683 1057 338 --11994 --
NM_002699chr1189 ------
NM_002703chr471958 1846 1766 1533 1362 299 245 --11696 --
NM_002707chr2----171 --
NM_002709chr253563 2844 2597 1278 687 11430 ----
NM_002710chr122955 735 ------
NM_002711chr7----1730 1718
NM_002713chr151036 1023 1014 186 108 ------
NM_002715chr521003 275 ------
NM_002716chr1153001 2520 2487 916 261 127 23281 989 --
NM_002718chr322644 1885 11660 185 --
NM_002719chr1441755 1564 511 430 21843 953 22324 1783 --
NM_002721chr91377 --1122 --
NM_002731chr142684 1159 519 389 1130 22653 251 --
NM_002734chr1742272 2100 1919 66 --2699 285 1143
NM_002738chr165923 878 793 431 304 ------
NM_002740chr332422 1004 501 22830 2524 --12036
NM_002742chr142623 73 --1289 --
NM_002745chr22164588 4505 4452 4020 3598 3582 3571 3341 3199 1689 1528 1352 602 292 276 166 31015 660 160 13519 --
NM_002747chr184531 505 164 100 1179 ----
NM_002748chr151316 --153 --
NM_002750chr10151 ------
NM_002753chr41775 ------
NM_002756chr172877 672 ------
NM_002757chr151358 ------
NM_002758chr17--1492 ----
NM_002760chrY125813 5652 5459 5440 5407 5359 5148 4780 4429 1993 449 274 --11731 --
NM_002763chr11509 --1218 1208
NM_002764chrX122 --1855 --
NM_002767chr17----1430 --
NM_002773chr16170 --1169 --
NM_002788chr141105 ------
NM_002791chr141159 ------
NM_002806chr141231 ------
NM_002809chr171316 ------
NM_002811chr16121 ------
NM_002819chr1961343 1104 956 349 335 265 ------
NM_002821chr63827 609 152 1656 ----
NM_002822chr1241806 540 523 433 151 ----
NM_002823chr2----1231 --
NM_002827chr2021769 1410 --11479 --
NM_002829chr91267 --11234 --
NM_002833chr152244 150 --1409 --
NM_002835chr73652 213 150 ------
NM_002836chr20------139
NM_002837chr1254360 3546 3411 3155 1215 --24301 1366 --
NM_002839chr933200 2461 414 --23512 2709 13359
NM_002841chr33467 153 65 ------
NM_002843chr1133263 2777 421 --23398 524 --
NM_002844chr621110 874 11023 ----
NM_002845chr182624 107 ------
NM_002847chr721468 82 ------
NM_002849chr123894 412 391 ------
NM_002850chr191786 ------
NM_002852chr32230 193 ------
NM_002859chr1231816 1251 170 --2583 430 --
NM_002860chr102314 56 ------
NM_002865chr81257 ------
NM_002866chr19136 ------
NM_002868chr1242261 2231 1843 671 1924 22402 381 --
NM_002869chr1152146 2065 756 188 43 --21406 389 22130 1915
NM_002871chr12323 92 166 21978 412 --
NM_002873chr51388 --184 --
NM_002874chr942231 1831 341 242 1253 42240 940 881 810 --
NM_002881chr221422 199 ------
NM_002886chr3104665 4637 3860 3421 3298 1802 1049 930 119 82 33240 1215 979 15199 --
NM_002890chr51693 --1821 --
NM_002892chr1411268 --11661 --
NM_002894chr18----1152 --
NM_002895chr202909 687 --3845 217 141 --
NM_002897chr26766 703 675 611 582 85 1728 1557 --
NM_002902chr152239 149 ------
NM_002906chr1142425 730 530 64 12324 11742 --
NM_002912chr61628 --174 --
NM_002918chr1931130 1016 217 ------
NM_002923chr12639 610 ------
NM_002924chr12481 197 ------
NM_002926chr42980 391 ------
NM_002931chr6----2304 210 --
NM_002938chr421985 1335 --11911 --
NM_002940chr421615 496 --21438 1296 1605
NM_002941chr331269 1028 266 ------
NM_002945chr173863 848 259 ------
NM_002951chr20----1253 --
NM_002953chr13803 752 163 --1291 --
NM_002955chr631679 1632 223 ------
NM_002956chr1211177 --11258 1535
NM_002957chr973689 3386 3343 1564 1503 747 366 ------
NM_002958chr36721 658 138 127 110 73 --1360 --
NM_002959chr184170 3121 2964 1759 1207 816 498 278 12926 ----
NM_002968chr163967 757 205 ------
NM_002970chrX165 ------
NM_002971chr341017 837 808 71 ------
NM_002977chr262960 2190 929 713 421 305 ------
NM_002979chr14864 690 319 194 ------
NM_002994chr441829 1636 1433 332 11954 11659 --
NM_002997chr241389 1382 1292 338 --21438 1192 --
NM_002998chr851625 902 892 592 58 --41401 479 451 297 --
NM_003001chr141871 1836 700 313 --21857 585 --
NM_003002chr113813 285 54 --2823 291 --
NM_003009chr193262 153 99 ------
NM_003010chr1742289 1884 543 465 ------
NM_003011chr971562 1475 1366 1287 1192 374 73 ------
NM_003013chr41790 --1136 --
NM_003016chr1742039 1713 1410 70 ----2580 400
NM_003017chr62573 256 21213 426 1904 --
NM_003020chr151151 --1172 --
NM_003022chrX11290 11218 11257 153
NM_003026chr92405 61 --1213 --
NM_003030chr31782 ------
NM_003031chr1631009 851 766 ------
NM_003034chr12107002 6857 5120 5081 2848 1639 1621 1378 855 419 --48037 7569 5143 2960 16079
NM_003036chr121215 1156 --11193 --
NM_003038chr242672 838 478 117 ------
NM_003040chr71148 ------
NM_003042chr311567 1341 12009 --
NM_003043chr334173 1289 1173 12892 24281 4237 --
NM_003046chr865379 5359 4231 3966 1350 1113 ------
NM_003048chr252598 2389 2178 805 490 ----1272
NM_003051chr131651 1586 284 2299 253 ----
NM_003054chr10181 ------
NM_003059chr51248 ------
NM_003060chr551296 1198 1133 99 44 --2942 810 --
NM_003068chr83700 445 380 --1850 --
NM_003069chrX2576 297 ------
NM_003070chr94855 770 572 251 --1787 --
NM_003071chr341969 822 309 258 ------
NM_003074chr332100 1881 356 11984 42115 1841 1654 535 1325
NM_003077chr171272 ------
NM_003079chr172321 126 --1650 --
NM_003081chr201429 --3888 169 60 1457
NM_003088chr721085 1078 --1113 --
NM_003099chr1595686 5294 5072 4753 2615 1871 914 752 213 25784 1513 45596 5394 2216 42 21577 1530
NM_003100chr51381 ------
NM_003104chr1541282 1049 293 162 11178 ----
NM_003106chr31817 1407 ----
NM_003107chr622501 654 11988 12415 --
NM_003108chr296602 6479 6342 5666 4553 2046 942 673 466 --25142 4740 15109
NM_003110chr173709 189 89 1965 ----
NM_003111chr221021 146 ------
NM_003112chr773082 2079 1994 1986 1296 958 512 12102 --12642
NM_003113chr21164 ------
NM_003114chr8----1174 1782
NM_003115chr11425 143 ----
NM_003128chr21584 ----11100
NM_003130chr731281 247 71 --21209 925 --
NM_003131chr671718 1586 1533 1481 687 663 590 --161 --
NM_003133chr11230 1192 --1845
NM_003135chr5187 ------
NM_003137chr622018 745 --1547 --
NM_003139chr113800 94 71 ------
NM_003142chr2--166 1243 --
NM_003144chr641858 1395 879 400 2294 30 22104 527 --
NM_003149chr321503 1209 --11622 --
NM_003150chr174925 568 334 293 --12346 1205
NM_003155chr862794 2029 917 700 521 413 11842 11926 --
NM_003156chr1131321 365 264 ------
NM_003161chr1753514 1410 1259 1246 950 --23552 2644 --
NM_003162chr2--1254 11090 1755
NM_003174chr102698 284 --1309 --
NM_003178chr321986 1583 --31905 1442 488 --
NM_003179chrX----1117 --
NM_003182chr71490 --1359 --
NM_003182chr71490 --1359 --
NM_003184chr821001 351 ------
NM_003185chr20149 --21230 1212 --
NM_003188chr6196 1757 ----
NM_003189chr1113100 2768 2633 2346 1203 1022 691 670 552 386 170 22761 149 32575 332 305 1393
NM_003199chr1884195 3904 3815 3672 1324 1095 930 688 13649 ----
NM_003202chr53523 491 419 21736 1344 11163 --
NM_003204chr1721359 100 ----21721 1555
NM_003211chr1261507 1435 1425 537 233 203 11752 11308 --
NM_003216chr222481 411 ------
NM_003217chr123590 540 115 --11759 --
NM_003220chr61582 --11681 21405 1151
NM_003221chr683635 3509 3185 2892 2721 1464 1449 394 13493 13000 --
NM_003223chr161694 --1832 --
NM_003234chr352451 2429 955 456 254 1155 --1141
NM_003236chr252317 1147 609 325 137 --23310 2953 --
NM_003242chr311608 --32457 579 191 --
NM_003243chr141201 1187 473 321 ----1975
NM_003244chr181141 --1436 --
NM_003246chr1521739 241 --31989 1938 305 --
NM_003248chr5----128 --
NM_003250chr17----1183 --
NM_003253chr2121543 1281 1244 11510 --
NM_003255chr1782632 2194 2097 2079 2051 913 710 296 12168 ----
NM_003257chr151247 ------
NM_003262chr3104173 4046 3675 3634 3308 1332 1300 1195 1141 322 ----13282
NM_003263chr4----148 --
NM_003269chr61350 --11006 --
NM_003270chrX2991 379 --1952 --
NM_003274chr2121013 567 1819 4501 405 356 201 --
NM_003275chr91424 --41230 1182 388 26 --
NM_003286chr20--1964 ----
NM_003288chr2021248 1129 --1996 --
NM_003290chr192214 53 ------
NM_003292chr141607 1441 1406 469 ------
NM_003298chr3106098 5605 5484 3922 3862 2186 1941 1566 1521 1402 12131 55161 1579 1572 497 206 --
NM_003300chr14166 ------
NM_003304chr32273 203 --21367 568 --
NM_003305chr41338 ------
NM_003309chr671747 1630 1586 1564 1301 98 86 ----1292
NM_003311chr11----1255 --
NM_003317chr142784 171 --1299 --
NM_003320chr11114066 3670 3438 3148 3060 3008 1740 1651 1425 1162 734 --34374 4121 3113 14456
NM_003336chrX1917 1304 ----
NM_003337chr531724 1131 324 ----21742 1614
NM_003338chr1031950 1749 549 ------
NM_003339chr551393 1151 649 276 86 --11624 --
NM_003340chr42478 295 ----1202
NM_003342chr1752699 2654 1324 681 338 11144 22566 2476 1569
NM_003344chr721258 536 --1421 11745
NM_003345chr161206 --1451 --
NM_003348chr1231680 1310 163 1458 --1258
NM_003349chr2041583 1327 1209 376 --11087 11094
NM_003350chr84823 362 58 25 ------
NM_003368chr12518 294 --1307 --
NM_003369chr1132068 859 193 --2293 207 --
NM_003370chr19160 ------
NM_003371chr91689 --1455 --
NM_003373chr10----11805 21664 696
NM_003375chr10182 ------
NM_003376chr621798 466 ------
NM_003376chr621798 466 ------
NM_003380chr10----2262 88 --
NM_003387chr272618 1959 1900 1143 1123 258 178 12702 ----
NM_003390chr112240 201 --21098 308 --
NM_003392chr343930 3141 1416 539 --23147 3086 12861
NM_003400chr24843 796 659 183 ------
NM_003404chr2031859 1359 589 --22000 1474 --
NM_003405chr222801 192 ------
NM_003406chr821501 1430 ----11724
NM_003410chrX42197 2017 1998 503 --13074 11187
NM_003411chrY31750 1236 686 11831 ----
NM_003412chr342932 2455 1112 458 --22298 649 --
NM_003413chrX41648 728 713 443 --1577 --
NM_003418chr31222 ------
NM_003430chr191567 1400 ----
NM_003439chr732634 1406 281 13363 32203 1363 801 1159
NM_003454chr1641211 1099 1074 217 --11316 21433 1161
NM_003458chr373809 3798 3365 3126 2778 381 357 --32627 2518 262 --
NM_003463chr643301 2957 873 685 --32288 1058 803 1678
NM_003466chr222525 1678 11738 ----
NM_003467chr21120 ------
NM_003468chr283404 3003 1565 1467 1108 727 307 221 --21116 482 1419
NM_003470chr1691811 1667 1648 1587 1557 714 662 564 352 --21790 1177 --
NM_003471chr33904 646 81 ------
NM_003472chr611244 --21229 961 1237
NM_003474chr1041610 1571 1464 354 --11943 1293
NM_003478chr1123068 125 --1333 --
NM_003483chr1242795 2387 2139 97 12155 42062 1907 1178 1036 --
NM_003487chr17172 ------
NM_003488chr17127 ------
NM_003489chr2143118 3026 2831 844 12113 21237 366 1343
NM_003496chr72791 688 163 1664 --
NM_003498chr1631950 867 257 --11004 --
NM_003503chr121254 495 --1818 --
NM_003505chr731765 1209 381 1257 ----
NM_003506chr8--1496 21195 1166 --
NM_003507chr231263 610 441 --11771 --
NM_003557chr141315 1146 1104 368 --11390 --
NM_003558chr92505 261 --1615 --
NM_003559chr1763904 3198 2877 1375 1336 816 --43284 3190 3129 1074 --
NM_003563chr1721135 1116 21378 99 ----
NM_003566chr1233303 2996 882 22792 2713 43455 951 743 497 --
NM_003567chr11282 1117 ----
NM_003571chr32222 164 ------
NM_003574chr18105317 5130 4423 4043 3813 2073 2049 1667 1646 1148 --55052 3883 2291 1676 1489 25096 140
NM_003576chr1362721 2466 2358 1996 567 374 ----2574 293
NM_003581chr2----1663 --
NM_003583chr1273052 2925 2662 2469 2388 847 189 1636 42820 2668 790 735 --
NM_003590chr223821 1187 1142 23700 2627 11550
NM_003591chr10----2307 274 --
NM_003597chr252198 1853 1656 886 538 ------
NM_003600chr202297 147 ------
NM_003603chr43657 492 94 11591 ----
NM_003607chr164227 4176 3627 3148 348 255 --14031 11079
NM_003610chr201347 ------
NM_003615chr3133717 3668 3660 3098 2780 2686 2498 1298 847 837 822 412 278 13829 43955 3344 1288 755 --
NM_003618chr22327 101 --11134 --
NM_003620chr1741060 1047 394 52 ------
NM_003621chr112485 397 ------
NM_003622chr122482 39 --154 --
NM_003624chr1921355 37 --1406 --
NM_003626chr1131370 371 316 11125 11222 11242
NM_003629chr193454 3320 3152 2939 2911 2578 1324 1265 422 --53249 2271 2125 1336 359 1990
NM_003632chr172707 603 ------
NM_003633chr572404 1638 1012 940 783 717 263 ------
NM_003637chr131358 488 276 1605 ----
NM_003644chr17145760 5364 4813 4553 4413 4273 4122 1894 1634 1557 1163 1053 1028 596 --24308 4231 --
NM_003651chr121530 --1406 --
NM_003654chr112775 76 ------
NM_003658chr112217 188 --1580 --
NM_003659chr2----11074 1788
NM_003663chr393184 3044 2883 2545 2496 2433 2343 988 783 --1309 --
NM_003664chr52194 141 --169 --
NM_003670chr331123 297 25 ----21206 486
NM_003671chr953390 2609 1067 570 553 11417 31362 1029 108 --
NM_003672chr121265 108 ------
NM_003673chr17193 ------
NM_003676chr11650 1155 ----
NM_003677chr1232073 1497 69 ------
NM_003679chr1--12479 22717 319 --
NM_003681chr21105540 5279 5242 2366 1916 1591 1465 1239 168 80 --34904 2349 407 15890
NM_003685chr191947 --3997 643 204 --
NM_003688chrX1295 ------
NM_003692chr92204 173 --154 --
NM_003701chr131772 --21049 808 --
NM_003704chr4----1670 --
NM_003710chr15----1445 --
NM_003711chr51295 1101 ----
NM_003713chr121096 433 --11764 --
NM_003716chr31700 --1981 1740
NM_003718chr72487 476 ------
NM_003722chr332687 2662 2600 ------
NM_003726chr171279 --1266 138
NM_003735chr521762 709 ----11534
NM_003736chr521762 709 ----11534
NM_003743chr21324 --21951 163 1795
NM_003749chr1362311 2138 1837 1560 1530 878 --2933 326 --
NM_003750chr10132 1660 2749 724 --
NM_003758chr1531273 1122 451 ------
NM_003758chr1531273 1122 451 ------
NM_003759chr423368 2985 14058 2539 155 --
NM_003762chr1----11234 --
NM_003763chr2023001 565 ------
NM_003766chr17128 139 --1385
NM_003768chr141682 1532 1496 1285 11353 ----
NM_003769chr12292 51 --1262 --
NM_003774chr1262648 1047 1026 735 601 204 12553 12374 12060
NM_003780chr12701 576 ------
NM_003787chr1831321 615 102 --21481 226 --
NM_003795chr63199 173 105 ------
NM_003796chr191424 ----1244
NM_003797chr111169 ----1193
NM_003798chr92181 161 ------
NM_003800chr682362 2304 2277 2010 1897 1842 1578 820 --22310 1544 --
NM_003816chr841449 545 85 30 ------
NM_003818chr20----1110 --
NM_003822chr163035 2894 914 616 127 26 12415 ----
NM_003825chr1551282 1096 1025 293 189 1541 1375 --
NM_003829chr91159 ------
NM_003831chr186700 673 449 415 385 292 11590 21829 123 --
NM_003850chr131233 ------
NM_003861chr1442849 2421 2323 2218 --21951 1888 --
NM_003870chr1511434 --12097 --
NM_003872chr273037 2786 2718 1993 773 536 476 12967 42794 1985 865 467 1633
NM_003873chr1031690 205 124 --31941 945 755 --
NM_003876chr171285 1299 ----
NM_003884chr351792 1580 590 548 157 ----11670
NM_003885chr1742215 1721 856 613 ----12174
NM_003888chr1531261 371 54 --1323 --
NM_003895chr212770 443 11895 21638 35 12231
NM_003901chr1092682 2573 2448 1884 1771 1097 1041 824 458 --11708 --
NM_003902chr12339 278 ------
NM_003908chr2031160 1055 924 --2896 230 --
NM_003909chr842789 2685 1905 743 --42285 1231 689 489 12897
NM_003913chr684048 3751 3088 1321 1278 1129 971 183 --33230 1076 1030 13263
NM_003916chrX31213 1124 98 ----11510
NM_003919chr7193 ------
NM_003924chr41116 --11318 11431
NM_003927chr185769 266 226 123 82 --1146 --
NM_003930chr762237 2130 1920 1870 1849 45 12413 ----
NM_003931chr62529 95 ------
NM_003932chr2231359 480 120 --31723 1310 469 --
NM_003934chr911333 --1899 --
NM_003939chr1084049 3712 3337 2821 819 631 377 237 --11490 --
NM_003941chr742369 2341 2214 1909 --2133 124 --
NM_003942chr111179 --1696 --
NM_003947chr321026 130 --21337 1266 --
NM_003949chr1731866 1681 1400 ------
NM_003951chrX2283 38 ------
NM_003953chr1102692 2197 2063 1985 1936 1855 962 383 334 246 2513 475 ----
NM_003956chr102507 110 --146 --
NM_003957chr1121095 958 ------
NM_003958chr663829 3550 2711 2491 1398 157 --1832 --
NM_003968chr3----2674 107 --
NM_003970chr81451 --1134 --
NM_003980chr631041 236 170 21325 1238 ----
NM_003983chr1633188 385 101 --13836 --
NM_003992chr152306 275 ------
NM_003993chr11316 --169 --
NM_003994chr1273770 3365 1745 1634 1401 809 702 12968 13796 11273
NM_003998chr4----1477 --
NM_004006chrX72656 2632 2123 1865 1830 559 417 ------
NM_004007chrX72656 2632 2123 1865 1830 559 417 ------
NM_004009chrX72656 2632 2123 1865 1830 559 417 ------
NM_004010chrX72656 2632 2123 1865 1830 559 417 ------
NM_004011chrX72656 2632 2123 1865 1830 559 417 ------
NM_004012chrX72656 2632 2123 1865 1830 559 417 ------
NM_004013chrX72656 2632 2123 1865 1830 559 417 ------
NM_004014chrX72656 2632 2123 1865 1830 559 417 ------
NM_004015chrX72656 2632 2123 1865 1830 559 417 ------
NM_004016chrX72570 2546 2037 1779 1744 473 331 ------
NM_004017chrX72656 2632 2123 1865 1830 559 417 ------
NM_004018chrX72570 2546 2037 1779 1744 473 331 ------
NM_004020chrX72656 2632 2123 1865 1830 559 417 ------
NM_004021chrX72570 2546 2037 1779 1744 473 331 ------
NM_004022chrX72570 2546 2037 1779 1744 473 331 ------
NM_004023chrX72570 2546 2037 1779 1744 473 331 ------
NM_004024chr121174 445 ------
NM_004028chr1863609 3014 2546 1519 1333 1013 1871 43468 3334 2975 1339 --
NM_004035chr1784948 4782 4755 4331 4057 3410 3309 2052 --34911 4300 1624 --
NM_004036chr23698 687 657 --1663 --
NM_004037chr14830 686 342 113 ------
NM_004040chr221256 1019 --1259 --
NM_004050chr1421888 1045 ------
NM_004061chr51243 1491 ----
NM_004067chr741295 1154 628 219 --21251 592 --
NM_004068chr33401 110 102 ------
NM_004077chr121526 181 ----
NM_004078chr1142 ------
NM_004081chrY11202 11510 21852 1740 11610
NM_004085chrX--1594 1277 --
NM_004086chr142164 81 --1554 --
NM_004087chr361942 1713 763 684 592 78 ------
NM_004089chrX1883 --1813 --
NM_004093chr1363182 2858 2688 2074 1102 27 ------
NM_004094chr1452787 2048 1072 1058 747 --1666 1966
NM_004096chr1052070 1659 1607 666 545 1507 1674 --
NM_004098chr1011189 ------
NM_004099chr961977 1373 437 420 366 82 21635 56 11922 --
NM_004100chr672661 2282 2258 2117 1976 656 98 ------
NM_004102chr1----2251 243 1437
NM_004103chr8163 --1739 --
NM_004105chr221054 420 ----1188
NM_004112chr1721423 551 --1284 --
NM_004114chrX1904 --1878 --
NM_004116chr21307 --184 --
NM_004124chr1433552 3041 626 --33302 2170 798 12902
NM_004126chr72293 184 --177 --
NM_004130chr31135 --2607 208 --
NM_004133chr831962 543 333 ----1666
NM_004136chr1553010 2835 2359 708 49 ----12917
NM_004156chr82121 49 --124 --
NM_004161chr221042 258 ------
NM_004162chr32802 384 ------
NM_004163chr18----1109 --
NM_004170chr931501 324 158 ------
NM_004171chr11149510 9475 7812 6138 5844 2506 2341 1680 1372 891 841 650 531 198 49524 7219 6982 1855 47391 6362 1836 183 18575
NM_004175chr221216 ------
NM_004177chr1141737 706 318 71 ------
NM_004185chr1--1268 ----
NM_004187chrX21250 579 11491 ----
NM_004193chr101550 ------
NM_004200chr1131195 1034 230 --13270 --
NM_004202chrY149 ------
NM_004209chr161948 ------
NM_004225chr8----1140 --
NM_004227chr752884 2663 1057 946 848 1538 22738 547 --
NM_004229chrX41548 1537 1368 788 --42114 1981 1525 746 11693
NM_004232chr1843272 3219 661 170 --43320 2675 756 407 --
NM_004235chr94754 714 578 70 ------
NM_004236chr15----1133 --
NM_004237chr5----127 1828
NM_004238chr21275 ------
NM_004239chr141120 ----1155
NM_004241chr10----1735 --
NM_004242chr6----2346 162 --
NM_004253chr91955 ----1326
NM_004263chr231145 340 219 ------
NM_004268chr1151177 1095 953 936 177 --2972 287 --
NM_004272chr5----2448 379 --
NM_004273chr1075008 4576 4208 3554 1558 391 51 11334 34723 1381 1353 --
NM_004274chr1483137 2951 2459 2042 904 783 746 232 --12724 --
NM_004279chr752372 2175 1883 1850 172 11866 22349 866 1356
NM_004281chr10143 --1171 --
NM_004288chr23928 887 701 --1272 --
NM_004290chr511141 --11156 --
NM_004293chr952764 851 662 617 311 --13458 --
NM_004295chr1741088 985 382 269 --11281 --
NM_004301chr32265 251 --2348 315 --
NM_004311chr1042931 637 332 72 --22768 2512 --
NM_004316chr122951 79 --21097 1074 --
NM_004319chr132305 1258 260 --12479 --
NM_004321chr243507 2881 2700 1224 --1657 --
NM_004326chr16988 971 456 289 129 63 ------
NM_004329chr1021009 342 --2403 241 --
NM_004330chr151399 --1948 --
NM_004331chr831788 1756 624 1992 2794 726 --
NM_004338chr18126840 5445 5341 5126 4683 4664 1443 1269 818 443 279 133 11655 55628 4964 4947 2691 647 --
NM_004342chr731932 1487 800 11448 32303 738 202 1515
NM_004349chr81345 ----11238
NM_004354chr41600 ------
NM_004356chr112439 124 ------
NM_004357chr111473 --1147 --
NM_004359chr192498 127 ------
NM_004360chr1621846 213 --21542 464 --
NM_004362chr42685 569 ------
NM_004364chr195988 937 854 347 290 ------
NM_004369chr22592 114 ------
NM_004370chr642163 1948 1442 376 --31558 761 566 22129 1627
NM_004379chr241300 1273 593 367 --3578 246 156 --
NM_004380chr1632334 639 616 --1318 --
NM_004384chr572177 1828 1784 675 231 152 53 --12129 11440
NM_004385chr51527 1440 163 1462
NM_004386chr1952101 1893 1820 628 544 --22124 374 --
NM_004389chr22717 28 ------
NM_004392chr1322110 1955 11910 22341 926 --
NM_004393chr32558 232 --32222 1626 1467 22410 378
NM_004395chr51177 ------
NM_004397chr1183654 3238 2925 2726 1730 842 568 461 ----13462
NM_004405chr22994 283 ------
NM_004411chr71172 --1264 --
NM_004412chr1056020 6013 4359 716 211 --44187 3731 2253 743 15889
NM_004415chr61170 ----1655
NM_004416chr1231080 924 32 ------
NM_004419chr102914 293 ------
NM_004423chr342573 2156 2064 74 ------
NM_004424chr161147 ------
NM_004426chr121776 11517 ----
NM_004428chr1170 --1799 1270
NM_004429chrX21397 206 1130 21459 379 --
NM_004430chr811041 --21100 873 --
NM_004432chr941898 1767 327 253 21671 766 31809 385 87 --
NM_004433chr1101800 1708 1586 1552 1288 1161 722 692 677 667 ------
NM_004434chr14----1330 11775
NM_004438chr223252 2239 1471 1414 --
NM_004440chr631600 1380 289 ----11339
NM_004442chr121062 665 --1593 --
NM_004447chr122729 54 --11102 --
NM_004451chr111728 ------
NM_004454chr321989 1596 --22312 1607 1380
NM_004456chr72168 41 ------
NM_004457chr23604 521 406 --11629 --
NM_004458chrX52256 1063 1052 377 73 11749 31701 771 684 --
NM_004459chr172692 419 --1546 --
NM_004463chrX1423 1180 ----
NM_004469chrX2182 51 ------
NM_004475chr173369 152 101 --2268 252 --
NM_004481chr162452 1727 1701 961 757 526 --11904 --
NM_004483chr162197 56 ------
NM_004484chrX----1301 --
NM_004492chr151226 --150 --
NM_004496chr1431216 1160 862 --1404 --
NM_004499chr52516 40 ------
NM_004500chr1421557 1521 ----1236
NM_004501chr183961 3817 3318 2821 2675 1642 1146 314 --1329 23950 1419
NM_004502chr17----1387 --
NM_004504chr222872 76 1116 1997 1663
NM_004505chr1721325 667 --1563 --
NM_004506chr6195 --1141 --
NM_004514chr1732348 954 597 12443 12639 --
NM_004516chr194865 503 384 118 --51212 786 451 321 190 --
NM_004521chr101290 1304 ----
NM_004525chr211027 --1148 --
NM_004537chr1241294 1238 1205 185 --11259 --
NM_004540chr211832 1897 ----
NM_004554chr1451483 1215 1158 191 142 --11573 --
NM_004566chr1031783 881 807 --22534 2057 1217
NM_004571chr2163353 3089 2973 2109 1302 136 ----23416 2752
NM_004575chr421662 1214 --21627 1579 --
NM_004576chr5------1272
NM_004578chr1----1870 --
NM_004586chrX74221 3700 2166 2142 517 497 149 13670 11382 --
NM_004588chr1174037 3623 3351 3341 2792 975 832 --14003 --
NM_004591chr21172 ------
NM_004593chr32672 189 2781 617 ----
NM_004596chr191202 ------
NM_004598chr543090 2557 1073 686 --13241 11170
NM_004602chr204557 434 330 65 --11175 --
NM_004603chr731097 779 309 --1450 --
NM_004606chrX1130 --1293 --
NM_004612chr9104841 4547 3852 3132 2967 1787 1170 924 619 373 34449 1594 1341 64621 4102 1485 1277 825 665 --
NM_004616chr12153 ------
NM_004622chr262246 1920 909 751 716 703 21667 182 ----
NM_004626chr113619 523 138 --1472 --
NM_004630chr1131139 248 239 ------
NM_004631chr131447 428 381 ------
NM_004637chr331150 855 427 ------
NM_004639chr6196 ------
NM_004643chr141184 --2734 567 --
NM_004645chr17136 ------
NM_004654chrY1376 ------
NM_004655chr174855 526 421 57 11390 11252 --
NM_004660chrY32020 1552 244 11885 ----
NM_004661chr5--1894 21215 271 --
NM_004663chr1541241 522 187 136 ------
NM_004666chr61214 1526 11395 --
NM_004670chr1041603 1160 360 71 ----21550 1501
NM_004671chr18----146 --
NM_004673chr111196 --1516 11103
NM_004686chr8--1525 1610 --
NM_004687chr1721809 1480 1502 21825 537 --
NM_004689chr14----1450 --
NM_004690chr62711 283 ------
NM_004694chr172187 159 ----2819 786
NM_004703chr1772469 1759 1708 1032 553 393 291 12212 ----
NM_004705chr111633 --1731 --
NM_004708chr19----194 --
NM_004709chrX2168 44 ------
NM_004713chr144758 722 119 49 ------
NM_004716chr113901 710 216 ------
NM_004719chr1252442 2419 2197 721 298 --22678 655 --
NM_004723chr12819 233 ------
NM_004724chr11128 --1502 --
NM_004726chrX125514 5328 4714 4483 4310 4000 3614 2170 1444 1398 776 767 21470 652 55522 3797 1782 1692 408 14794
NM_004729chrX72104 2063 1848 1485 1346 685 54 --31733 1536 113 --
NM_004730chr552112 1738 1731 1587 93 ------
NM_004733chr31184 --1611 --
NM_004734chr1382954 2703 2685 2372 2154 1149 899 487 --22303 1055 12692
NM_004736chr11843 --22029 1966 --
NM_004737chr221985 --2343 98 1436
NM_004738chr2062486 2032 1831 627 473 464 --12125 1123
NM_004739chr11----2561 411 --
NM_004742chr361833 1622 1254 476 60 33 ----1382
NM_004745chr836654 5514 4902 36505 4817 506 25128 199 --
NM_004747chr1061087 1072 1019 479 329 220 --1608 --
NM_004748chr15113972 3328 3086 2717 2682 1668 986 897 867 733 75 13872 23725 3380 1683
NM_004757chr42538 269 ------
NM_004759chr162062 1820 1692 778 503 441 ----12171
NM_004760chr731903 941 544 --32050 882 521 --
NM_004762chr1731990 1522 139 --1772 --
NM_004765chr16147 ------
NM_004766chr3180 ------
NM_004768chr1--2930 170 ----
NM_004772chr531518 278 129 --1329 11265
NM_004774chr1753017 2575 2459 2158 2143 1768 12497 --
NM_004775chr1832171 650 584 --42305 2285 2231 815 1315
NM_004776chr2092674 2463 2409 2402 2391 2270 2028 298 24 --32956 1051 641 --
NM_004779chr51526 ----1974
NM_004781chr151546 1202 539 443 387 --1147 1210
NM_004781chr151546 1202 539 443 387 --1147 1210
NM_004783chr16--1668 ----
NM_004785chr161316 --1366 --
NM_004788chr1141905 1891 1849 650 --22050 868 22540 392
NM_004796chr1452202 1898 1639 776 604 11978 22380 1693 --
NM_004798chr2062478 1108 925 687 301 42 --43106 2572 1470 598 --
NM_004799chr1193 ------
NM_004800chr132174 77 ------
NM_004801chr21550 ----1259
NM_004804chr262762 535 459 327 172 158 ----12010
NM_004808chr1042491 2328 2195 1264 12298 ----
NM_004817chr91218 --1603 --
NM_004822chr1763479 3132 3051 1494 1346 1298 --22784 1333 --
NM_004824chr61482 ----21332 1074
NM_004835chr34762 681 556 167 --1311 --
NM_004835chr34762 681 556 167 --1311 --
NM_004836chr23766 640 602 ------
NM_004840chrX82472 2358 910 794 347 283 94 32 ------
NM_004841chr12875 760 --2189 151 --
NM_004844chr331198 1032 234 --1982 --
NM_004845chrX52801 874 796 589 314 --11629 --
NM_004850chr211445 ------
NM_004857chr1431021 330 280 ----13265
NM_004859chr1721911 244 153 21953 694 12475
NM_004862chr1651625 495 393 355 127 1438 11609 11083
NM_004863chr1483485 3337 3318 1971 942 549 436 58 13519 34615 1437 235 15068
NM_004865chr61360 ------
NM_004866chr543949 1794 1017 158 11345 44888 3342 1093 469 --
NM_004867chrX1122 ------
NM_004869chr1831434 1311 317 --11587 --
NM_004871chr1783895 3385 3266 2671 1617 1512 731 88 --33580 386 248 14308
NM_004872chr1--164 ----
NM_004873chr1483182 3038 2769 2744 1274 462 326 282 1808 2724 147 --
NM_004874chr81427 ------
NM_004883chr51168 ------
NM_004888chr921031 161 --3879 258 243 --
NM_004893chr52482 373 ------
NM_004896chr102339 204 --1238 --
NM_004897chr10--195 1119 --
NM_004898chr432735 1962 923 --32673 2292 1994 --
NM_004902chr203592 287 33 --1224 --
NM_004904chr786441 6064 5207 4690 2551 2112 1535 488 21926 355 66052 4752 4503 812 230 155 14654
NM_004905chr12589 183 --1764 --
NM_004912chr711182 ------
NM_004924chr191402 --1259 --
NM_004926chr1431505 657 375 --31311 1203 297 --
NM_004929chr81264 --1469 11492
NM_004930chr1----1604 --
NM_004936chr962154 2030 1083 959 732 188 --32036 1185 284 --
NM_004943chr1921153 1003 --1428 --
NM_004947chr31273 ------
NM_004949chr1831667 585 461 --12085 --
NM_004952chr14936 924 775 62 ------
NM_004955chr62573 117 --1539 --
NM_004956chr784439 3907 1511 765 587 429 134 37 23549 1271 11120 13440
NM_004957chr93671 444 176 --2158 78 --
NM_004958chr1143 ------
NM_004960chr16134 ------
NM_004961chrX1409 --2399 156 --
NM_004962chr102163 45 1492 ----
NM_004965chr211709 --1167 --
NM_004969chr101442 ------
NM_004973chr651155 705 478 343 289 --192 --
NM_004975chr20179 ------
NM_004976chr1165166 5098 5027 3462 1583 385 1661 12022 --
NM_004982chr12127 --1629 --
NM_004985chr1284320 4167 1404 909 707 344 268 259 1130 21542 1186 --
NM_004992chrX98546 5694 5394 5372 3195 3124 3095 2205 1557 12303 68348 7005 6202 5405 1851 1239 27497 5419
NM_004992chrX98546 5694 5394 5372 3195 3124 3095 2205 1557 12303 68348 7005 6202 5405 1851 1239 27497 5419
NM_004993chr142373 343 ------
NM_004995chr1411495 ------
NM_004998chr152916 645 --1890 1385
NM_004999chr694467 3054 1657 1392 1369 957 547 137 34 24188 1614 31239 947 655 --
NM_005010chr741952 1514 839 514 --1464 --
NM_005012chr11143 ------
NM_005016chr121359 ------
NM_005020chr7140 --1593 --
NM_005026chr121885 404 11362 1126 --
NM_005028chr1011752 --21677 1552 32314 2081 2060
NM_005032chrX31004 761 396 ------
NM_005033chr41142 ------
NM_005036chr22138340 7936 6470 6039 5749 5389 2395 2314 1327 865 378 360 299 16621 1551 11250
NM_005045chr71204 ------
NM_005056chr12125010 4900 4480 4403 4270 2066 1559 1212 1206 1002 587 447 --63951 3798 1649 1546 1125 29 24118 1931
NM_005057chr141214 765 450 379 --1400 --
NM_005060chr13995 532 402 ------
NM_005063chr1062940 2906 2449 481 363 302 --43736 3501 3126 2511 1173
NM_005065chr1464374 4289 2052 1755 1510 244 25163 1578 32159 1445 467 1160
NM_005066chr11731 ------
NM_005067chr33618 335 88 --1650 --
NM_005068chr611432 ------
NM_005069chr2121227 296 --11706 1518
NM_005076chr143960 3069 832 320 --13141 --
NM_005078chr1531460 1142 566 ------
NM_005079chr853153 2874 910 355 311 --13201 1104
NM_005080chr223941 694 201 1616 ----
NM_005087chr31214 196 ----
NM_005093chr2065245 4206 3789 1784 1605 1448 --21660 1340 --
NM_005094chr93721 277 161 ------
NM_005095chr12769 578 --12089 --
NM_005096chrX2413 140 1161 ----
NM_005104chr63746 723 656 --2620 554 --
NM_005109chr352353 1700 973 314 245 1132 ----
NM_005110chr51142 --1158 --
NM_005112chr41755 --1772 --
NM_005113chr14--1121 2396 35 --
NM_005116chr2043277 3061 1073 469 --11731 --
NM_005119chr141204 1179 1091 216 --11008 --
NM_005121chr1743368 536 528 476 --23688 1345 1600
NM_005124chr62869 51 ------
NM_005126chr352180 1974 1683 1585 688 12073 12025 --
NM_005128chr212637 477 --194 --
NM_005132chr14------1154
NM_005133chr11----1382 --
NM_005134chr182349 271 1810 2989 23 --
NM_005135chr1553348 3282 2389 925 235 13018 13263 --
NM_005151chr1882269 2213 1875 790 784 770 559 431 --2324 285 --
NM_005154chr151534 --1497 --
NM_005156chr975106 4552 4072 3954 3803 3793 1057 14773 35382 3911 1442 14245
NM_005159chr1552281 1965 874 238 151 --21561 1459 --
NM_005160chr22116138 5852 5503 2275 2208 1744 1106 942 767 161 53 --45812 5307 5038 405 36235 5100 1297
NM_005161chr11102223 2200 1780 770 428 361 340 151 59 48 ------
NM_005168chr271613 1580 1558 1487 1471 623 582 --11785 --
NM_005171chr124815 523 109 96 ------
NM_005180chr1061547 1489 1342 1215 654 111 --1418 11192
NM_005188chr11238309 7984 7688 7460 7000 6895 6246 6078 5943 5927 5582 5576 5435 2865 2853 2829 2650 2545 1915 1681 1175 1000 961 21070 910 87612 7193 6187 6000 5351 2683 2238 1705 27888 1712
NM_005189chr17102488 2391 1620 1582 689 522 442 396 301 204 --22323 1848 --
NM_005190chr64839 313 266 68 ------
NM_005194chr201478 ------
NM_005197chr1486193 5374 5046 4337 1680 1481 902 257 --14799 --
NM_005204chr102996 844 ------
NM_005206chr1721164 899 ------
NM_005207chr2283379 2319 2289 1491 1233 1019 487 28 23677 1012 1418 --
NM_005208chr17195 ------
NM_005214chr22902 817 1827 1418 --
NM_005217chr82112 38 ------
NM_005219chr521256 273 --3397 334 127 --
NM_005220chr1711462 --11049 --
NM_005221chr72217 125 ------
NM_005222chr72958 837 --1245 --
NM_005227chr12455 407 ------
NM_005231chr1111292 --21194 176 1150
NM_005233chr33680 614 140 --22508 220 --
NM_005235chr267768 7686 7271 6344 5917 2887 --37823 7159 5138 27316 6292
NM_005238chr1152817 2346 1174 933 334 --43374 2958 2735 1373 --
NM_005239chr211775 32032 1912 1544 2724 366 1218
NM_005241chr331325 944 93 --11350 1432
NM_005244chr203666 611 492 ------
NM_005245chr44769 590 217 93 --1490 --
NM_005249chr143817 647 256 ------
NM_005252chr141712 ------
NM_005254chr1531256 1233 870 --11014 --
NM_005256chr112838 358 ------
NM_005257chr1821257 1154 --2881 64 1121
NM_005259chr21330 ------
NM_005273chr71296 ------
NM_005275chr61105 --144 --
NM_005277chr451835 1728 1327 381 225 11797 21760 731 --
NM_005279chr2261 35 ------
NM_005302chr71163 ------
NM_005308chr10------1529
NM_005311chr792757 2615 2566 2452 2139 1813 1058 966 750 ------
NM_005316chr1131119 839 350 --1330 --
NM_005318chr22----31263 1160 894 --
NM_005324chr1762021 1699 1584 1372 833 412 ------
NM_005327chr41257 --1658 1529
NM_005328chr81303 ------
NM_005329chr1642044 1715 1537 568 12213 22314 1445 1645
NM_005336chr242167 1984 902 822 --32148 1886 1734 --
NM_005339chr464223 4008 1426 995 741 564 23518 3120 12856 11705
NM_005342chrX21878 565 --22639 479 --
NM_005348chr141683 --1200 --
NM_005349chr41506 ------
NM_005359chr18166422 5700 5619 5378 5099 4828 4104 4069 2573 2484 1733 1718 602 319 138 100 --11270 34874 4227 1822
NM_005369chrX1425 1175 1194 --
NM_005375chr621158 1093 ------
NM_005376chr131121 1074 287 1970 ----
NM_005382chr81169 ------
NM_005385chr342498 1082 871 748 1777 ----
NM_005386chr20----1731 --
NM_005387chr11----1156 --
NM_005388chr981611 1441 1299 555 315 217 87 78 ------
NM_005389chr64814 568 521 115 ------
NM_005392chr921461 201 --11175 11276
NM_005397chr793902 3845 3765 3177 3089 3009 2450 1082 429 13674 ----
NM_005398chr102119 85 ------
NM_005399chr183793 3547 3477 2813 1768 1699 1052 98 12999 94293 4258 3779 1613 1582 1010 954 894 147 13275
NM_005400chr282951 2834 2359 2255 1935 640 608 595 --11106 --
NM_005402chr791800 1733 1506 713 599 533 396 380 277 ------
NM_005406chr182616 146 --1279 --
NM_005407chr141134 --31577 1337 94 --
NM_005410chr54638 581 268 222 --1237 --
NM_005415chr21105 --1155 --
NM_005417chr2031841 1409 418 11734 ----
NM_005418chr113256 138 32 ------
NM_005429chr4----1122 --
NM_005430chr122993 833 ------
NM_005433chr1832517 2502 525 ------
NM_005435chr71171 ------
NM_005436chr10104103 4075 3661 3611 3260 3182 2805 2672 2602 1517 22871 332 23933 2745 13137
NM_005437chr1061340 1125 1061 990 283 28 ------
NM_005439chr12------1516
NM_005442chr36559 510 430 158 102 69 ------
NM_005443chr42494 151 ------
NM_005447chr12128 ------
NM_005455chr161668 1525 1294 638 528 177 --31143 232 222 --
NM_005458chr942500 2192 2159 1942 11833 ----
NM_005461chr201388 --21484 1236 --
NM_005465chr131904 1552 249 ------
NM_005471chr531252 1104 49 ----21246 65
NM_005474chr1751535 636 401 371 210 ----1464
NM_005475chr1233024 2826 874 --12880 12024
NM_005476chr91206 ----165
NM_005479chr1041509 1243 409 99 --1517 --
NM_005487chr2251481 481 418 409 280 --21896 780 1182
NM_005488chr222643 93 --1736 --
NM_005493chr63757 608 306 ------
NM_005494chr72614 602 --1247 1212
NM_005497chr17105941 4201 3916 1334 1312 1273 1260 918 740 240 --21965 28 --
NM_005502chr942724 979 633 206 --22558 192 --
NM_005503chr151258 --1318 1185
NM_005509chr52153 101 --1729 11168
NM_005520chr51603 ----1488
NM_005522chr721253 944 ----1256
NM_005523chr721380 482 --1593 --
NM_005530chr1531183 1150 128 ------
NM_005536chr8--11020 135 --
NM_005537chr132894 335 --2161 66 --
NM_005539chr1021400 556 --1905 11003
NM_005541chr23989 900 412 --31187 1072 1057 --
NM_005542chr741706 1467 1448 1401 ------
NM_005544chr2----11016 --
NM_005552chr14----2577 531 --
NM_005563chr12634 215 ------
NM_005566chr111418 ------
NM_005570chr1831127 744 426 ------
NM_005575chr5167 --1178 --
NM_005578chr3125029 4772 4542 4374 4172 4041 3591 2060 493 328 212 124 24396 1909 31934 1863 947 21246 394
NM_005595chr1----1946 --
NM_005596chr9115834 5554 5517 4911 4774 4747 1489 1330 675 429 354 24367 629 24345 1940 11881
NM_005604chr621863 630 22051 1842 22250 1874 --
NM_005606chr142187 23 1334 1451 --
NM_005607chr82879 732 1277 1668 --
NM_005610chr1----2940 811 --
NM_005613chr131978 169 93 11705 11622 --
NM_005614chr711104 --11006 --
NM_005626chr1139 ------
NM_005627chr63392 159 63 --1360 --
NM_005634chrX1111 1695 ----
NM_005638chrX41359 236 166 75 --21747 416 --
NM_005644chr12301 97 --1416 --
NM_005647chrX73466 3347 3125 3065 952 923 620 --33140 697 670 --
NM_005650chr2211098 ------
NM_005652chr1621141 865 --11223 --
NM_005655chr82946 505 1235 ----
NM_005664chr1541060 1014 233 87 ------
NM_005665chr164219 3987 3645 3373 1121 64 23621 892 44925 4382 3145 166 --
NM_005667chr21161 --151 --
NM_005668chr564187 3199 3063 2810 1423 532 --22917 2801 --
NM_005682chr161174 --11345 --
NM_005686chr121496 353 21129 250 ----
NM_005688chr3----2936 97 --
NM_005707chr151137 ------
NM_005711chr5--1375 1172 --
NM_005715chr642600 1790 1017 210 --1979 --
NM_005717chr13932 870 115 --21268 124 --
NM_005718chr3----1304 --
NM_005720chr73200 77 22 --1186 --
NM_005721chr21961 ------
NM_005722chr241785 243 142 37 2389 328 --1351
NM_005724chr152137 24 ------
NM_005725chr13797 639 239 ----12392
NM_005730chr12133424 3060 3025 2917 2627 1443 1323 1297 1235 1081 680 642 420 --53280 2307 1148 968 469 160
NM_005731chr2--174 ----
NM_005734chr112555 280 --1187 --
NM_005736chr1011356 --11146 --
NM_005737chr262915 2689 2423 2095 948 723 --22051 764 --
NM_005738chr72363 155 21680 1289 ----
NM_005740chr225910 612 338 108 36 --1121 --
NM_005742chr21107 --1622 --
NM_005746chr742693 424 344 213 --1493 --
NM_005748chr1263447 3378 3105 2977 2911 1252 12156 12427 13204
NM_005749chr171693 --1549 --
NM_005751chr7----175 --
NM_005754chr55946 802 337 193 70 --2980 923 --
NM_005756chrX21364 1165 11000 21458 390 --
NM_005759chr243973 3758 3725 527 --43680 3141 3075 1862 23552 1789
NM_005761chr12--1157 1126 --
NM_005765chrX176 --1669 --
NM_005766chr1341360 1000 505 35 ------
NM_005767chr13--1126 2307 65 --
NM_005768chr122534 199 ------
NM_005775chr83475 256 139 ------
NM_005776chr142618 341 ------
NM_005778chr3192 --1391 --
NM_005779chr553110 2957 2778 2635 818 --23142 523 13208
NM_005786chr182986 88 --1424 --
NM_005789chr1772077 1912 1417 1335 751 324 56 ------
NM_005795chr21766 22505 445 --12240
NM_005801chr17--1127 ----
NM_005808chr352877 2400 782 481 472 --2405 232 13230
NM_005813chr22301 213 --2924 779 12310
NM_005819chr153498 3433 3298 1163 279 --1595 13004
NM_005822chr642164 1828 1686 940 --149 2858 83
NM_005826chr12408 161 ----1243
NM_005828chr1794544 4276 3878 1727 1663 634 549 112 36 --73764 1934 1393 1368 978 440 103 --
NM_005832chr311149 ----1171
NM_005839chr12877 795 ------
NM_005840chrX147390 6889 6047 5010 4726 4696 2824 2684 2312 2169 1433 1034 170 29 2234 212 36895 6458 384 37141 6844 556
NM_005841chr43933 274 263 --1955 --
NM_005842chr132499 120 1513 1143 --
NM_005851chr111354 --1394 --
NM_005853chr163604 512 187 ------
NM_005857chr131302 1274 1252 --21454 1436 11391
NM_005859chr511474 ----11510
NM_005862chr3----1428 --
NM_005863chr1031121 1001 541 ------
NM_005864chr143231 179 157 ----1654
NM_005868chr732078 834 170 ------
NM_005870chr1311385 194 ----
NM_005871chr101351 ------
NM_005875chr3166 --1405 --
NM_005880chr1621643 80 ------
NM_005884chr192819 516 ------
NM_005885chr531187 1113 1081 ------
NM_005895chr1242754 1559 466 190 23755 859 44008 3177 2734 913 1118
NM_005896chr21152 --134 --
NM_005898chr1142435 2126 970 479 --1626 --
NM_005899chr1721497 578 ----1310
NM_005901chr18178623 8013 7206 6932 6896 6464 6440 3141 2976 2362 2288 2099 1792 1549 1144 874 248 37122 5901 3165 78490 6639 2749 1830 1581 554 474 12886
NM_005903chr564681 4282 4117 4043 3848 3783 --65177 2060 1902 1071 999 797 1278
NM_005904chr1821377 1200 --189 --
NM_005907chr661659 1603 537 435 376 135 ------
NM_005909chr594145 4008 3281 2639 1463 1311 1299 942 314 13723 23582 1174 14229
NM_005910chr1753617 2649 1564 1483 846 --23750 144 --
NM_005911chr23454 281 155 11161 21415 1049 --
NM_005917chr2155 ------
NM_005920chr153789 3048 2866 2393 346 ------
NM_005924chr72917 218 --2430 277 --
NM_005927chr531167 869 829 11073 11158 1839
NM_005928chr152659 33 ------
NM_005933chr1162788 2476 2225 755 741 69 --12794 --
NM_005934chr1951965 1741 988 364 102 ------
NM_005935chr495104 4808 4511 3821 3570 3284 1534 1220 27 --34752 4236 3479 24007 939
NM_005937chr1763836 3801 3305 3251 1346 1041 ----23013 1178
NM_005938chrX2563 103 --1359 --
NM_005941chr853964 1378 564 453 252 --1227 --
NM_005944chr331098 936 816 --21081 503 --
NM_005955chr164746 4168 1576 883 756 375 --31877 1316 431 11709
NM_005962chr101605 ----11866
NM_005962chr101605 ----11866
NM_005964chr1721132 120 ------
NM_005966chr232069 1919 1650 ------
NM_005967chr121685 ------
NM_005969chr112986 341 ------
NM_005977chr132796 405 --1139 --
NM_005986chr1332007 729 92 12476 ----
NM_005996chr122172 21 --1580 --
NM_005998chr1188 ------
NM_005999chr1--198 1225 11083
NM_006003chr19--139 1240 --
NM_006007chr964168 3180 1354 1026 913 128 --1336 --
NM_006009chr122208 149 ----130
NM_006011chr1574182 3689 3409 3349 1166 1139 846 --24005 1049 --
NM_006016chr672054 1658 1514 1408 657 316 228 --11414 --
NM_006020chr141142 --1555 --
NM_006022chr131904 --1303 --
NM_006024chr73215 172 98 ------
NM_006033chr1832038 1755 405 --12243 --
NM_006035chr1431254 501 386 ------
NM_006037chr284781 3118 2974 1798 896 739 149 45 --43758 1826 1079 677 --
NM_006042chr171465 ------
NM_006047chr2093492 2945 2583 2367 1292 1103 766 576 432 1950 ----
NM_006048chr11300 ------
NM_006054chr1131294 1247 118 1273 11409 --
NM_006068chr42278 106 ------
NM_006070chr31332 ------
NM_006079chr63772 702 263 ------
NM_006080chr771130 1102 880 770 715 605 182 --21899 284 12301
NM_006089chrX----1280 --
NM_006091chr1541737 1625 631 582 --11549 --
NM_006095chr484453 3781 1252 1044 1005 901 516 227 --23466 1464 11488
NM_006106chr1153019 2579 2418 1361 1001 ----22940 2772
NM_006108chr1151700 1614 1527 664 565 --1738 11537
NM_006113chr152071 1619 715 507 371 ------
NM_006135chr141249 506 186 163 ------
NM_006136chr71233 --3334 220 37 --
NM_006141chr1672761 2448 2032 1076 1027 859 797 12259 12366 22374 1951
NM_006145chr193874 461 436 --1343 --
NM_006147chr1--183 1189 --
NM_006148chr1742677 2463 1190 24 --22647 715 --
NM_006152chr121210 ------
NM_006154chr1562039 1806 865 742 654 535 --11107 2900 218
NM_006158chr821777 1421 --11402 --
NM_006162chr1851695 1408 617 405 326 --11749 --
NM_006166chr1272548 1946 1857 1054 882 693 457 --11609 1436
NM_006167chr851964 1583 1517 596 41 --22167 2129 --
NM_006178chr1721102 75 11417 11560 --
NM_006180chr91425 1627 1442 --
NM_006186chr211013 --11202 --
NM_006191chr122712 297 ------
NM_006194chr143332 272 111 ------
NM_006195chr931444 119 35 --1435 --
NM_006196chr21386 ------
NM_006197chr81863 --22254 115 --
NM_006201chrX4474 436 409 246 ------
NM_006203chr595471 4973 4233 4116 3469 3450 1284 1094 1005 33555 1438 876 21174 24 --
NM_006206chr432707 2266 2013 ------
NM_006209chr8------1352
NM_006212chr1125005 4788 4495 4089 1549 864 826 638 598 482 348 238 15301 24027 943 11661
NM_006216chr21597 --1433 --
NM_006224chr1741599 1012 921 342 11649 32507 945 357 --
NM_006226chr211168 1180 1446 11261
NM_006237chr1341621 927 906 501 --1170 --
NM_006243chr121092 761 --2379 49 --
NM_006245chr63966 944 89 --2746 685 --
NM_006246chr141977 --1388 11268
NM_006252chr1127579 7458 6898 6435 6172 5439 4619 2689 2346 1244 775 351 --47432 7344 1009 743 11207
NM_006256chr11566 --22266 615 --
NM_006258chr1051170 286 243 43 27 --1115 --
NM_006259chr42831 180 --1224 --
NM_006265chr831137 410 116 --1122 --
NM_006267chr251754 1612 1537 1174 88 --11582 --
NM_006268chr112461 280 --21159 138 --
NM_006275chr2062512 1953 1938 500 442 231 1666 --22421 885
NM_006279chr11568 ----1843
NM_006282chr2063664 2968 2881 1336 801 725 1234 44389 1603 963 742 12997
NM_006283chr864318 3654 1720 1426 818 70 --24428 1642 --
NM_006287chr272602 2516 2209 2196 2137 1633 897 --2586 162 191
NM_006292chr11--1162 ----
NM_006300chr1931933 617 194 ------
NM_006301chr121524 ----1608
NM_006306chrX45935 5912 5847 521 22208 1364 11414 --
NM_006312chr12----1758 --
NM_006313chr1231591 1539 1333 --11219 11275
NM_006315chr473852 3434 3059 1598 1346 618 322 23751 2766 22810 442 1475
NM_006320chr42723 76 --1956 --
NM_006321chr33894 622 499 --2832 85 --
NM_006324chr16152 ------
NM_006330chr811105 1609 ----
NM_006334chr9183 ------
NM_006336chr961479 1329 1225 1211 987 144 ------
NM_006345chr431316 950 113 --1488 --
NM_006350chr52380 72 ------
NM_006352chr141502 1374 610 283 --41920 1577 830 319 1462
NM_006353chr651419 1375 1220 1033 99 --1143 --
NM_006357chr2--174 --1122
NM_006359chrX11964 --2673 468 --
NM_006363chr20----2233 162 1576
NM_006364chr1411255 1247 ----
NM_006366chr631156 822 100 --1201 1838
NM_006367chr14807 298 215 138 ------
NM_006371chr3124855 4235 4215 3814 3522 3327 1545 917 591 570 530 457 12027 45198 752 613 169 --
NM_006372chr61326 ----1360
NM_006375chrX31523 564 506 11221 1462 2748 246
NM_006379chr741491 352 84 48 1419 ----
NM_006380chr1763736 3380 3205 2995 2765 2729 --23309 1226 --
NM_006386chr2242290 1760 449 84 --2150 60 1515
NM_006390chr1291695 1636 1485 1296 684 654 640 576 361 ----194
NM_006391chr111324 ------
NM_006393chr1054541 3219 2968 2884 1615 13899 53968 3458 2871 1735 430 11253
NM_006400chr121275 ------
NM_006401chr91402 --1408 --
NM_006403chr6----31690 1548 260 --
NM_006410chr11------1486
NM_006411chr61246 1845 ----
NM_006420chr2053459 2861 2567 2504 958 ------
NM_006421chr81262 ------
NM_006434chr1032594 2502 261 32414 2213 793 ----
NM_006439chr41546 --1389 --
NM_006451chr52809 707 ------
NM_006457chr473996 3327 2764 2533 2509 838 393 --34053 2757 984 --
NM_006458chr111407 ------
NM_006459chr1041929 1747 1531 186 ------
NM_006460chr1741361 632 622 169 --21594 210 --
NM_006465chr153774 470 389 --21976 1906 --
NM_006467chr532052 1479 851 ----12173
NM_006469chr12561 120 --2643 528 --
NM_006471chr18189 ------
NM_006482chr1273052 2925 2662 2469 2388 847 189 1636 42820 2668 790 735 --
NM_006496chr151960 1324 1276 1269 1237 --31686 1567 1255 --
NM_006504chr1021813 125 22779 550 1169 22968 2567
NM_006516chr11359 ----11277
NM_006517chrX31510 257 212 --12196 1195
NM_006521chrX3938 421 72 11421 ----
NM_006524chr71240 5829 409 325 157 73 --11074
NM_006526chr2021560 591 ------
NM_006527chr41142 --1759 --
NM_006529chr4----11379 --
NM_006532chr19----21734 318 --
NM_006534chr2043409 2529 1169 327 --32199 1231 883 12682
NM_006536chr12720 681 1874 11022 1238
NM_006537chr151215 --1401 1583
NM_006538chr263521 3500 2891 998 726 470 --1239 --
NM_006540chr831404 1055 396 ------
NM_006544chr1485357 2441 2206 1563 1333 966 667 52 --46050 1359 1030 205 --
NM_006546chr17106544 5787 5473 5117 4782 4210 2632 2510 2182 534 --12387 --
NM_006547chr741957 1848 769 360 ------
NM_006548chr341633 1487 586 561 --11151 --
NM_006549chr1252939 2659 2594 2560 1123 --1277 --
NM_006554chr21143 --2351 102 --
NM_006555chr722003 1822 ------
NM_006557chr941765 1301 1168 533 ------
NM_006559chr12835 80 --1250 --
NM_006560chr111387 ------
NM_006561chr1066052 5206 4909 4243 2161 2018 --55471 4209 3795 1791 140 --
NM_006565chr16----2435 429 11119
NM_006571chr81236 --249 36 --
NM_006572chr1783336 3247 2932 2686 2651 2614 1167 153 --23203 741 1573
NM_006574chr3------1137
NM_006575chr1441200 370 266 96 ------
NM_006584chr17----1119 --
NM_006587chr4----21336 461 --
NM_006590chr21295 ------
NM_006595chr1141451 626 263 157 --12049 11811
NM_006597chr111213 ------
NM_006599chr16108049 6942 6019 5727 5615 5262 2376 1197 997 421 25243 5114 47288 5039 2450 1731 12169
NM_006602chr201562 ------
NM_006603chrX31864 1409 260 --1282 --
NM_006609chr242585 2367 2351 2217 --12383 --
NM_006614chr343049 2847 2235 1102 --13287 1839
NM_006618chr131273 1059 631 11533 11387 11171
NM_006620chr674844 1515 1273 1085 1001 635 441 --33902 833 227 --
NM_006621chr121659 1580 ------
NM_006622chr51400 --1545 --
NM_006624chr1021828 1373 1113 ----
NM_006625chr11463 --1421 --
NM_006625chr11463 --1421 --
NM_006625chr11463 --1421 --
NM_006626chr932302 615 55 --21060 1005 11937
NM_006628chr1554557 3945 2995 932 848 13030 24591 1168 --
NM_006629chr1822539 1784 --12388 --
NM_006633chr5--1636 1158 --
NM_006636chr23745 315 116 --1912 --
NM_006640chr1721840 1388 --21870 1339 1634
NM_006644chr132488 188 1163 ----
NM_006646chr1372585 2242 2182 529 400 260 152 --21980 1968 --
NM_006650chr531244 961 230 ------
NM_006653chr62295 101 ------
NM_006654chr1284729 4625 4244 888 875 600 559 484 1337 14390 34367 1783 1754
NM_006656chr112843 155 --21198 235 --
NM_006660chr152265 34 1128 ----
NM_006662chr16----1282 --
NM_006667chrX31181 1000 732 ----169
NM_006675chr1242717 2384 2309 486 ------
NM_006682chr742449 2378 1012 76 22708 1058 12830 --
NM_006690chr2022344 757 ------
NM_006695chr171279 --1119 --
NM_006698chr203593 548 124 11437 11213 1181
NM_006699chr161004 829 690 372 233 81 --22648 2512 --
NM_006700chr124638 597 521 36 --1145 --
NM_006703chr62330 177 ------
NM_006704chr132317 130 --1426 1414
NM_006706chr51547 --1172 --
NM_006708chr631301 278 194 1918 1319 --
NM_006713chr53782 263 69 1341 155 --
NM_006716chr741317 1018 386 266 11373 21265 1112 --
NM_006717chr973046 2531 1159 1054 548 496 75 --22299 373 22239 1017
NM_006718chr631078 1060 192 1951 ----
NM_006721chr101339 --1689 --
NM_006722chr33586 490 122 1527 1841 --
NM_006726chr41151 --11224 --
NM_006727chr5--1357 ----
NM_006729chrX125488 5371 4883 4821 4597 4271 2155 2034 1961 1878 1848 597 --22119 1588 14496
NM_006734chr621412 324 1452 2538 247 1991
NM_006736chr23575 308 99 --11369 --
NM_006738chr1563739 3410 3340 1829 1744 1471 --51733 1445 1292 1286 366 --
NM_006749chr841044 1034 884 457 ------
NM_006750chr16148123 7735 7631 7216 7207 7067 7042 6582 6441 2194 1904 666 489 107 --77370 7326 5547 2723 1893 1263 860 47779 4962 2402 728
NM_006754chr731211 887 277 --41075 421 158 137 11227
NM_006761chr171263 1224 ----
NM_006763chr151769 1739 763 749 645 11762 31889 589 213 --
NM_006765chr8151 ------
NM_006766chr832325 1003 841 --32577 2503 2309 --
NM_006769chr13492 71 30 ------
NM_006775chr692930 2517 2373 2171 1159 1100 573 188 86 12948 32936 2177 1108 --
NM_006777chrX1427 11017 ----
NM_006788chr1862132 2123 1455 462 321 109 --1331 --
NM_006790chr51353 ------
NM_006791chr15183 --1420 --
NM_006800chrX1663 188 1568 --
NM_006802chr121093 25 --158 --
NM_006805chr51302 --11514 --
NM_006807chr1741355 1213 154 74 ------
NM_006810chr3123 ------
NM_006811chr203665 635 105 1848 ----
NM_006815chr124967 896 554 156 --11122 --
NM_006827chr1423195 2258 --43140 3078 2972 2866 --
NM_006828chr63456 181 89 --1198 --
NM_006832chr141126 ----1824
NM_006838chr121341 11658 2676 388 11913
NM_006846chr52131 101 ----1345
NM_006851chr1242793 2505 923 54 --22210 388 --
NM_006852chr1732861 2441 1037 12492 42693 2573 2472 133 1120
NM_006854chr761581 1567 1485 755 361 188 --11753 --
NM_006856chr124762 263 150 87 ------
NM_006861chr122692 338 --12109 --
NM_006870chr204742 694 673 108 ------
NM_006873chr213087 --2529 178 12629
NM_006884chr31782 ------
NM_006885chr16124057 3949 3109 2981 1540 1338 1145 1037 985 945 687 656 --43394 494 312 196 --
NM_006887chr22575 541 --1205 --
NM_006888chr1493542 3163 2800 2773 2649 1247 910 856 350 12269 12848 --
NM_006892chr2031365 1254 292 --1555 --
NM_006892chr2031365 1254 292 --1555 --
NM_006893chr1181 ------
NM_006895chr262086 1850 1763 1657 589 460 --31460 739 600 --
NM_006908chr751207 1099 1065 585 388 --1964 --
NM_006914chr92980 449 ------
NM_006915chrX32387 976 37 12529 --12260
NM_006916chr231167 1151 298 1408 1103 --
NM_006918chr1195769 4782 4734 3847 3561 2215 1681 1560 344 15124 44316 3792 1719 1452 22046 1368
NM_006920chr231689 1302 676 --11607 --
NM_006922chr23855 818 763 --11017 --
NM_006924chr1764167 4059 3745 2793 626 396 --64229 4154 632 358 347 171 1612
NM_006925chr142371 29 --2201 99 --
NM_006930chr531971 1364 106 --31877 1573 448 1133
NM_006931chr1252011 1680 1324 286 178 ------
NM_006937chr17------1511
NM_006939chr1451161 1150 1055 890 207 21036 140 2359 324 --
NM_006943chr2032811 876 694 11183 22770 2304 12315
NM_006947chr431421 543 407 11695 11312 --
NM_006948chr2142282 2199 2085 155 --11919 --
NM_006951chr103830 724 241 --1770 --
NM_006981chr982874 2826 2706 2638 2578 629 427 374 12200 --22881 1944
NM_006990chr141995 1788 981 50 --2633 537 --
NM_006997chr102373 328 ------
NM_006999chr521447 228 --31286 698 395 --
NM_007002chr20186 ------
NM_007005chr951418 1214 1080 1053 962 --11258 --
NM_007006chr1662870 2807 2597 1090 726 385 --13113 --
NM_007007chr1253914 3756 1808 1227 247 --44726 1737 687 621 13874
NM_007008chr21169 ------
NM_007010chr1741260 1227 649 267 --21176 185 --
NM_007011chr1596304 5858 5338 4439 2534 2348 1394 354 337 --42673 1254 1145 945 1281
NM_007013chr81359 --1814 --
NM_007017chr51169 --1655 --
NM_007019chr20134 --1126 --
NM_007033chr132304 2251 1566 1881 2591 65 --
NM_007038chr2175934 5723 5563 5305 4049 3980 1753 24669 1026 36092 4850 1854 32317 1788 331
NM_007039chr1421754 898 --12095 --
NM_007040chr191958 --1772 --
NM_007050chr20107649 7379 7252 6070 6049 6022 5813 5317 2496 1001 13000 56585 5829 761 701 307 --
NM_007064chr331259 1093 195 ------
NM_007067chr1741512 1308 523 343 --11356 --
NM_007073chr673765 3737 362 261 227 96 40 32969 191 82 24191 316 14035
NM_007078chr103847 614 322 12907 1840 --
NM_007084chr132356 288 ------
NM_007097chr5165 ------
NM_007106chr1352648 2601 2322 1903 35 11736 141 --
NM_007107chr322401 241 1115 ----
NM_007121chr19------1356
NM_007123chr131270 244 120 11013 21107 256 --
NM_007124chr641764 1642 804 346 11676 ----
NM_007125chrY2462 277 1421 21467 1060 --
NM_007126chr9----1465 --
NM_007129chr133834 397 218 --1764 --
NM_007145chr1921222 1129 ------
NM_007146chr1742539 2444 1003 887 --22769 1863 --
NM_007150chrX21635 1394 --2529 131 11976
NM_007158chr131187 459 411 ------
NM_007159chr321384 141 --11449 --
NM_007166chr1111170 --21601 239 --
NM_007174chr1282319 2028 1937 1740 1726 1545 626 522 --1673 11519
NM_007175chr853550 3512 802 552 101 --33318 3215 893 --
NM_007185chr141023 817 287 241 ------
NM_007187chr131912 1300 21036 727 130
NM_007189chr71149 11107 ----
NM_007191chr123713 217 47 ------
NM_007195chr1873618 2926 2850 2792 2782 2636 914 12438 12801 --
NM_007197chr122754 380 --154 --
NM_007200chr1563739 3410 3340 1829 1744 1471 --51733 1445 1292 1286 366 --
NM_007203chr963931 3304 2929 2736 944 27 ------
NM_007204chr12505 128 --1621 --
NM_007212chr1----1774 11779
NM_007214chr63886 850 163 --1964 --
NM_007216chr111380 ------
NM_007217chr3------154
NM_007218chr81276 ------
NM_007219chr202863 348 ------
NM_007222chr851665 1504 1440 1332 508 11782 1709 --
NM_007235chr12190 ------
NM_007236chr1562439 2137 639 475 442 371 1960 2483 161 --
NM_007241chr172309 145 ------
NM_007246chr42276 190 1261 11053 1138
NM_007249chr1399100 8762 6802 3313 3180 2867 2774 2440 1115 25870 199 29273 7940 --
NM_007259chr1----1382 --
NM_007269chr13226 194 115 ------
NM_007271chr671804 1640 1444 1268 1153 735 228 --2671 57 --
NM_007275chr32390 324 ------
NM_007276chr721019 281 ------
NM_007292chr1784948 4782 4755 4331 4057 3410 3309 2052 --34911 4300 1624 --
NM_007294chr1721131 62 ------
NM_007295chr1721131 62 ------
NM_007296chr1721131 62 ------
NM_007297chr1721131 62 ------
NM_007298chr1721131 62 ------
NM_007299chr1721131 62 ------
NM_007300chr1721131 62 ------
NM_007302chr1721131 62 ------
NM_007303chr1721131 62 ------
NM_007304chr1721131 62 ------
NM_007305chr1721131 62 ------
NM_007308chr41217 ------
NM_007322chr19137 --1406 --
NM_007324chr1193 ------
NM_007325chrX51540 814 716 228 172 ------
NM_007331chr422556 1930 ------
NM_007345chr1822354 1586 --32153 2079 149 11761
NM_007346chr202326 219 --2299 252 --
NM_007347chr151881 ----13093
NM_007349chr71108 ------
NM_007350chr1254527 3922 1266 837 72 --11142 31610 1318 796
NM_007353chr763059 2499 1943 1019 411 280 --32542 1125 579 2368 287
NM_007358chr122000 1481 2738 80 11681 11914
NM_007363chrX21089 879 ------
NM_007365chr12855 145 --11684 11894
NM_007368chr1331228 397 58 --1236 --
NM_007372chr172773 724 1715 ----
NM_007373chr1021797 719 --11591 11347
NM_007375chr152652 1837 1780 671 628 ------
NM_009585chr34762 681 556 167 --1311 --
NM_009585chr34762 681 556 167 --1311 --
NM_012074chr141327 --1123 --
NM_012081chr573694 3274 2940 1349 638 513 459 --33343 1363 407 23385 1447
NM_012082chr8--1331 ----
NM_012084chrX2412 231 ----1572
NM_012086chr2155 ------
NM_012090chr15984 977 497 335 131 ------
NM_012095chr1093462 3403 3328 3274 2669 993 754 506 495 ----42702 1052 826 791
NM_012096chr343499 2365 1448 650 --23356 379 --
NM_012102chr131889 560 525 --32362 2245 1035 --
NM_012104chr1193531 2988 2520 1333 1311 1218 996 480 138 12426 ----
NM_012104chr1193531 2988 2520 1333 1311 1218 996 480 138 12426 ----
NM_012105chr212658 138 --1155 --
NM_012110chr4155 --142 --
NM_012115chr61583 ----1392
NM_012120chr642745 2390 996 402 12926 ----
NM_012124chr111918 --1159 --
NM_012129chr732338 1987 700 12027 42173 1947 1639 913 --
NM_012137chr152716 2613 851 537 344 1863 52859 2425 2158 488 371 --
NM_012139chr11127 ------
NM_012141chr1343904 3580 2636 1372 1951 42541 1234 694 611 --
NM_012154chr81150 ----1843
NM_012156chr2053111 2872 2863 932 694 ------
NM_012158chr1311506 ----11855
NM_012160chr62388 36 --1468 --
NM_012161chr441079 930 265 216 --2988 797 --
NM_012164chr9147359 6999 6672 6573 6064 6057 6026 6019 5387 4636 2453 547 393 380 12874 37105 4918 4728 --
NM_012174chr1262969 2934 2927 760 410 369 1553 11121 --
NM_012175chr111177 --1820 --
NM_012176chr5----2260 97 --
NM_012180chr41488 ------
NM_012191chr3----127 --
NM_012193chr11125191 4983 3562 1966 1715 1691 1660 1567 1552 680 427 22 24788 1467 1599 35342 1445 1133
NM_012197chr931462 1109 54 --11472 --
NM_012199chr1134548 4075 3335 3322 2919 1724 1701 1202 1053 954 779 747 122 --13279 --
NM_012207chr1031025 728 271 --1993 --
NM_012210chr911464 1534 11066 --
NM_012214chr246352 6223 4862 2291 14565 1535 1907
NM_012215chr1021846 1496 11785 21766 542 --
NM_012218chr1962913 2339 2237 824 397 202 --1357 1318
NM_012219chr313228 --32699 1230 426 --
NM_012223chr2--1107 ----
NM_012233chr221037 238 --1943 --
NM_012234chr373715 3472 3104 2515 1448 1254 995 ----13499
NM_012238chr1051651 1361 1261 1216 688 ----1617
NM_012244chr1441694 1223 341 60 --1108 --
NM_012247chr106978 894 748 359 308 296 --1166 --
NM_012248chr161671 1161 ----
NM_012249chr282608 2589 2488 2478 2421 1390 609 422 ------
NM_012250chr112932 451 11199 ----
NM_012252chr765277 4621 4473 3812 3491 85 --54736 4037 3554 3446 457 --
NM_012255chr202434 166 ------
NM_012257chr73942 219 167 --1917 --
NM_012259chr611392 11433 ----
NM_012261chr201531 ------
NM_012262chr184940 4008 1996 1980 1815 911 393 49 --34682 4243 3338 13691
NM_012281chr722197 526 11511 12059 --
NM_012286chrX163 ------
NM_012287chr3104290 4105 3798 3542 1480 1204 839 452 382 82 --21540 1231 --
NM_012288chr6145604 4978 4322 4245 3948 3906 3679 1804 1302 1227 861 327 271 126 --55646 5638 1960 890 342 --
NM_012294chr763904 3352 2789 1150 708 74 --44074 3696 1530 1165 --
NM_012295chr22----1412 --
NM_012296chr1153729 3640 3510 2485 2434 12474 ----
NM_012297chr42899 98 22255 2031 1412 1854
NM_012300chr522100 369 --11781 --
NM_012301chr731976 1767 891 --11745 --
NM_012302chr12925 823 1840 11174 --
NM_012307chr181695 --1354 --
NM_012308chr111847 --22057 1996 --
NM_012309chr11144953 4853 4735 4455 3837 3738 3616 1762 1208 1165 942 441 399 198 14587 --24052 3315
NM_012316chr175274 5261 4062 3555 1742 1508 1082 --45289 1914 1605 1075 35441 4594 276
NM_012325chr2041616 1557 1270 400 1188 ----
NM_012326chr21102 ------
NM_012327chr1811049 --21572 1128 --
NM_012328chr7----3909 548 248 --
NM_012329chr1721240 1206 --11042 11293
NM_012330chr102541 368 --21498 466 21554 406
NM_012333chr141061 650 610 519 --1443 --
NM_012339chr102624 496 ------
NM_012341chr102427 130 ------
NM_012342chr10146 --1383 1200
NM_012347chr652886 2653 2416 1941 561 1805 ----
NM_012382chr574267 3675 3589 1709 1438 231 177 1774 64379 2842 1740 893 426 34 --
NM_012383chr91328 --264 42 --
NM_012388chr1562700 2035 816 673 524 85 --73165 2952 2369 2041 418 381 144 --
NM_012399chr221484 --11427 --
NM_012405chr143564 3238 2533 541 --13598 --
NM_012413chr2----1136 --
NM_012414chr1----2712 104 --
NM_012416chr91224 11080 ----
NM_012417chr17190 --1640 --
NM_012419chr61138 ------
NM_012421chr11401 ------
NM_012425chr103406 282 105 22158 193 ----
NM_012428chr151132 --2680 239 --
NM_012432chr11353 ------
NM_012433chr2156 ------
NM_012434chr631513 1364 67 --2608 95 --
NM_012446chr53650 643 472 ------
NM_012448chr1741622 909 645 359 --3967 522 496 --
NM_012453chr721344 91 --1218 --
NM_012454chr61390 ------
NM_012460chr14150 ------
NM_012463chr121110 --11824 --
NM_012464chr472932 2796 2531 1972 797 418 268 --2898 765 --
NM_012471chrX31931 1605 295 11363 2301 198 --
NM_012475chr1----192 --
NM_012479chr722587 1838 150 32595 2050 138 --
NM_012482chr1--1626 ----
NM_012486chr11398 ----1431
NM_013227chr15195 --1280 --
NM_013229chr1292795 2515 2385 2056 1725 605 483 282 164 --1404 --
NM_013231chr1453569 2746 2706 1528 1141 --23604 225 --
NM_013232chr52386 376 --1290 1326
NM_013233chr221339 202 ------
NM_013236chr221845 --2477 218 --
NM_013238chr1341875 1690 1651 448 --1168 --
NM_013243chr1551160 1001 529 268 26 --1503 --
NM_013253chr1151289 475 396 265 67 ------
NM_013254chr12------175
NM_013255chr7198582 8184 8077 7368 7015 6455 6410 6287 5800 5643 5480 3100 2481 2085 1980 1204 976 578 53 18568 47568 7060 5497 427 11488
NM_013261chr473669 3189 3137 2961 2600 1350 626 --1265 23386 2740
NM_013262chr651276 946 925 473 287 11379 11465 1511
NM_013263chr16----165 --
NM_013264chr112158 90 ------
NM_013266chr10158 ------
NM_013277chr1221096 967 2227 115 ----
NM_013279chr1152367 2004 1915 1650 692 ------
NM_013281chr2011320 11349 11447 --
NM_013282chr1921289 132 ------
NM_013283chr52866 744 ------
NM_013293chr71257 ----1280
NM_013304chr161241 ------
NM_013309chr1592662 2273 2177 988 859 824 444 306 28 ------
NM_013313chr2272741 2443 2245 2205 304 221 90 --22801 327 1679
NM_013316chr7--1924 1247 --
NM_013322chr731458 1193 166 11294 1511 --
NM_013336chr3----1174 --
NM_013346chrX----177 --
NM_013351chr171721 --1264 --
NM_013354chr821459 1009 1963 1134 --
NM_013357chr81833 ------
NM_013363chr32420 394 --143 --
NM_013365chr221758 --1529 --
NM_013368chr193591 229 148 ------
NM_013372chr1583384 2917 2871 2405 1210 941 766 249 ------
NM_013373chr221719 ------
NM_013377chr121472 --1573 1495
NM_013381chr1232003 746 58 12096 ----
NM_013390chr921534 477 1355 --11275
NM_013396chr2131548 587 59 --1260 21039 294
NM_013400chr71990 --1372 --
NM_013403chr192286 177 ----1321
NM_013410chr11885 --1183 --
NM_013423chrX1321 --1506 --
NM_013427chrX1321 --1506 --
NM_013433chr1921352 138 --11467 --
NM_013437chr831422 1013 969 --1388 --
NM_013438chr931697 1288 72 11817 21683 306 --
NM_013443chr91938 --1218 --
NM_013444chrX----21117 972 --
NM_013446chr741340 996 365 144 ------
NM_013449chr1242907 2103 770 694 --42254 1986 1161 549 11855
NM_013450chr221060 496 --1888 --
NM_013943chr152347 599 53 34 26 13087 12675 --
NM_013951chr222525 1678 11738 ----
NM_013952chr232602 1755 65 11815 ----
NM_013953chr232602 1755 65 11815 ----
NM_013958chr8274 25 ------
NM_013959chr8274 25 ------
NM_013960chr83567 516 146 ------
NM_013961chr8274 25 ------
NM_013962chr8274 25 ------
NM_013981chr51168 ------
NM_013982chr51168 ------
NM_013983chr51168 ------
NM_013989chr1495055 4056 3829 3555 3508 3290 1070 399 318 13885 13425 --
NM_013992chr232602 1755 65 11815 ----
NM_013995chrX3774 644 264 --2592 581 --
NM_013996chr71490 --1359 --
NM_013996chr71490 --1359 --
NM_013997chr71490 --1359 --
NM_013997chr71490 --1359 --
NM_013998chr71490 --1359 --
NM_013998chr71490 --1359 --
NM_014000chr10----11805 21664 696
NM_014007chr93923 908 787 ------
NM_014010chr9--1497 ----
NM_014011chr272602 2471 2120 696 565 478 94 ----12326
NM_014016chr331610 170 95 21294 62 --1107
NM_014021chr143029 2978 2341 135 1375 ----
NM_014023chr1082879 2771 1981 1178 928 196 116 63 12077 2630 398 --
NM_014028chr642587 2395 2270 703 23368 1147 11237 1668
NM_014034chr651229 1039 367 344 325 11269 ----
NM_014038chr71423 ------
NM_014041chr3155 --127 --
NM_014043chr341614 1146 603 512 --1418 --
NM_014048chr1634951 4634 1706 --25106 1630 15072
NM_014057chr91658 1374 1363 --
NM_014059chr13------1292
NM_014079chr33264 256 248 1750 1164 --
NM_014089chr1342280 1877 1578 414 --12228 --
NM_014106chr1551957 1879 1047 868 577 1393 12230 --
NM_014109chr81463 --1880 --
NM_014110chr151036 1023 1014 186 108 ------
NM_014112chr874126 4038 4032 2041 1912 111 71 14681 45268 4073 2170 846 --
NM_014117chr1632260 2134 1953 --1352 --
NM_014141chr775021 4210 3807 3446 3300 989 289 --15310 1247
NM_014153chr161623 --1729 --
NM_014154chr3--11232 1168 --
NM_014155chr11117575 7273 6865 6691 5757 5742 5715 5635 2947 2444 255 17440 46378 5896 5158 1000 17511
NM_014159chr32541 73 ----1438
NM_014170chr32325 148 --2403 331 --
NM_014171chr23784 177 49 ------
NM_014181chr232775 777 672 --31131 821 739 --
NM_014188chr12299 285 ------
NM_014212chr121310 ------
NM_014217chr13564 479 451 --1247 --
NM_014231chr12----32102 610 247 --
NM_014232chr1731119 573 271 --11415 --
NM_014232chr1731119 573 271 --11415 --
NM_014240chr332599 917 567 --74095 2651 2615 1348 1112 202 144 --
NM_014241chr101305 --126 --
NM_014243chr461917 1411 794 763 587 161 ------
NM_014246chr2251618 1600 707 575 433 --12199 --
NM_014250chr2251481 481 418 409 280 --21896 780 1182
NM_014252chr131123 1302 1117 --
NM_014253chrX42485 2303 1698 497 22338 790 2425 131 12407
NM_014264chr41103 ------
NM_014267chr112605 139 ------
NM_014268chr1821282 433 ------
NM_014271chrX1678 --1196 --
NM_014280chr12765 259 1841 1110 --
NM_014282chr9----31222 931 106 1372
NM_014283chr141330 1306 1007 476 --21064 371 21570 1077
NM_014284chr11133 ------
NM_014285chr94859 782 311 151 ------
NM_014286chr983645 2557 2384 1379 1226 1134 1039 446 --43125 1247 625 332 --
NM_014289chrX21436 1422 --1325 --
NM_014292chr2241731 1563 1538 102 ------
NM_014294chr84985 538 213 45 ------
NM_014299chr1931645 648 638 --11627 --
NM_014309chr2295412 4869 4566 3936 3325 1589 950 607 493 35374 5312 1220 44336 3560 2178 2172 1196
NM_014319chr1251752 1492 1279 67 61 --21506 84 --
NM_014320chr6194 1230 1141 --
NM_014323chr22--1173 ----
NM_014325chr122232 217 --22156 392 --
NM_014326chr151185 11244 11477 --
NM_014329chr16--187 1342 --
NM_014333chr1142817 1925 490 299 ----21885 775
NM_014338chr222845 58 ------
NM_014342chr11193 --21371 143 --
NM_014345chr63888 795 326 --1765 --
NM_014351chr2221380 333 31069 913 188 1299 --
NM_014352chr115313 268 139 88 66 --11407 --
NM_014361chr11133 1366 124 --
NM_014368chr942129 2118 1889 160 1386 21372 461 --
NM_014372chr141977 1958 539 531 --22032 1821 --
NM_014374chr71990 --1372 --
NM_014376chr521902 730 11012 1248 --
NM_014382chr341766 1705 664 216 11398 1691 --
NM_014390chr71503 ------
NM_014392chr41139 ------
NM_014393chr891738 1614 866 849 807 547 333 311 267 ------
NM_014394chr1031048 451 295 21199 919 2800 163 --
NM_014396chr741848 908 466 199 --12273 --
NM_014397chr941420 1319 399 45 ------
NM_014405chr172608 601 --22365 463 --
NM_014410chr18----1358 --
NM_014415chr341354 576 518 391 11265 21616 228 --
NM_014423chr575597 4056 2148 2097 1635 1595 1422 14655 45179 4720 4183 1083 2958 212
NM_014426chr201621 1266 1708 --
NM_014431chr101149 11693 11239 --
NM_014432chr621229 1134 --123 --
NM_014445chr341906 1651 1601 194 --21955 1547 11665
NM_014447chr411480 1646 11468 --
NM_014452chr651193 932 920 308 237 1455 ----
NM_014454chr61782 --21050 238 1308
NM_014455chr12437 322 ------
NM_014456chr102471 438 ------
NM_014458chr11877 --11393 --
NM_014469chr11----3621 613 154 --
NM_014470chr12----1752 --
NM_014472chr101168 ------
NM_014480chr191682 1270 --1542
NM_014491chr721083 879 ------
NM_014494chr1662044 1500 858 503 387 282 11549 ----
NM_014504chr712011 --21501 313 21803 540
NM_014515chr122658 168 ------
NM_014517chr321638 307 1393 2784 316 --
NM_014521chr251777 1450 630 621 549 ------
NM_014552chr241494 1184 1020 346 --1594 --
NM_014554chr1212008 --41624 1444 254 161 1601
NM_014562chr23778 314 87 ------
NM_014563chrX32096 1918 585 ------
NM_014569chr741040 614 378 203 1142 ----
NM_014572chr132573 205 --21448 563 --
NM_014573chr1741832 1818 1720 1284 ------
NM_014574chr144598 502 432 376 1992 --1274
NM_014577chr222592 270 ------
NM_014584chr1411515 --1118 --
NM_014585chr221119 120 --11024 --
NM_014586chr2144485 3812 3326 3290 21805 1522 24133 471 --
NM_014587chr1611517 --11587 11310
NM_014588chr203684 677 144 ------
NM_014591chr1021306 957 ------
NM_014603chr1751680 1442 1372 1150 357 ------
NM_014606chr421063 627 11473 11417 --
NM_014607chr251877 1393 779 543 86 ------
NM_014608chr152405 379 --3181 117 41 --
NM_014612chr911108 2344 298 ----
NM_014613chr542651 2242 2076 884 11215 11016 1367
NM_014615chr1633387 647 586 11267 1415 1966
NM_014616chr352596 1390 838 468 427 --1868 1815
NM_014620chr121238 ------
NM_014630chr15133604 3273 3141 2933 2741 2674 2624 970 730 539 367 229 48 --33980 1401 749 1429
NM_014633chr11----1579 1401
NM_014636chr95710 698 591 400 323 --14135 --
NM_014637chr821054 532 11018 21001 173 --
NM_014644chr13978 851 203 ------
NM_014646chr1892996 2526 2196 1254 1001 903 886 411 145 ----1798
NM_014647chr1641675 588 410 181 11633 1458 --
NM_014659chr1511092 ------
NM_014660chr71333 --3363 273 162 --
NM_014661chr1063652 3336 3010 1284 499 283 22475 1330 21567 1478 --
NM_014665chr862432 1240 359 311 159 61 --32889 2298 795 --
NM_014666chr5--1266 --1952
NM_014667chr331648 803 679 --1370 --
NM_014670chr21239 --11200 11596
NM_014671chr711408 --3564 506 200 --
NM_014674chr3103863 3321 3299 2999 2739 2585 2573 2497 1235 1116 --31293 1241 895 1372
NM_014676chr11169 --1644 --
NM_014677chr81104 ------
NM_014682chr822201 791 --11434 --
NM_014683chr1762185 2157 1990 1549 829 186 11462 151 --
NM_014685chr161508 --2492 131 1210
NM_014686chr1952480 1993 965 691 470 1170 11872 --
NM_014690chr732389 2336 24 --32566 991 432 --
NM_014693chr32628 177 ------
NM_014701chr1533422 2247 1351 2165 137 1185 12345
NM_014702chr663431 3145 2774 2735 1351 942 1929 12118 --
NM_014705chr721845 1764 --21770 580 11601
NM_014707chr742270 2090 1888 131 ------
NM_014709chr21508 ------
NM_014711chr1621723 1700 --31989 1373 426 --
NM_014713chr24191 170 149 40 --1112 --
NM_014717chr191661 ------
NM_014720chr1021779 1739 11172 ----
NM_014721chr6157189 7048 6725 6309 5999 5968 5645 5526 5503 5356 5305 5072 1991 1833 1439 16138 24800 1954 1730
NM_014723chr2052333 2089 2062 1023 338 ------
NM_014729chr862217 1974 1855 870 289 64 --32073 1529 725 --
NM_014730chr12125286 4627 3937 3791 3783 2116 1666 1636 1070 1020 890 566 --24337 3642 --
NM_014730chr12125286 4627 3937 3791 3783 2116 1666 1636 1070 1020 890 566 --24337 3642 --
NM_014733chr51386 --21912 578 --
NM_014735chrX62073 1802 1503 763 511 137 --41818 1694 1497 36 --
NM_014738chr172703 154 ------
NM_014739chr683863 3336 2686 2641 1265 1131 690 280 13779 34008 2928 1554 14092
NM_014742chr2011612 --21774 233 --
NM_014743chr432990 2163 272 --3563 467 290 --
NM_014746chr284343 4000 3143 1492 870 846 375 99 23624 2703 34260 768 552 11323
NM_014747chr195632 5282 5118 4597 1299 1232 458 446 282 --44063 3830 464 87 15433
NM_014751chr872058 1880 1659 1511 406 295 61 ------
NM_014752chr1121255 513 --31821 640 242 1559
NM_014755chr2114097 3727 3475 2872 1589 1449 1270 821 474 165 145 11063 54148 2768 2652 1028 96 23461 2932
NM_014756chr112457 331 ------
NM_014757chr542102 1757 930 558 --21539 912 --
NM_014761chr1661139 1094 986 852 831 174 ------
NM_014764chr123410 303 71 1393 2457 123 1310
NM_014766chr7103748 3550 3491 3074 2988 1303 624 534 395 302 --22653 2606 --
NM_014770chr1211198 ------
NM_014771chr161774 ------
NM_014772chr1863598 3398 2730 1077 725 557 ------
NM_014774chr172606 2557 2406 889 862 432 373 --1412 --
NM_014775chr221107 ------
NM_014776chr1252748 2095 2046 519 188 --23027 1924 12269
NM_014779chr33152 119 100 1286 2955 822 --
NM_014781chr8----1908 --
NM_014782chrX----183 --
NM_014787chr132807 2092 1750 1511 22799 533 --
NM_014791chr9----1212 --
NM_014795chr2----11357 --
NM_014802chr121140 ------
NM_014803chr101918 ----12384
NM_014810chr1113387 3056 3032 1468 1381 1198 1117 762 607 174 51 --1180 12319
NM_014811chr91193 ------
NM_014812chr161894 1675 692 598 238 122 11378 ----
NM_014813chr13499 394 98 ------
NM_014819chr511926 --1441 --
NM_014820chr311481 2820 198 11274 --
NM_014822chr4------1596
NM_014824chr1141976 1598 1380 418 --1179 11745
NM_014826chr164227 4176 3627 3148 348 255 --14031 11079
NM_014827chr12375 342 --21589 496 --
NM_014828chr1422471 460 --32543 2206 201 --
NM_014830chr1241482 908 865 101 --13307 --
NM_014836chr1011488 11979 ----
NM_014838chr2272402 2132 1058 429 408 351 156 --1830 12279
NM_014839chr162335 1865 1818 868 667 572 --12186 --
NM_014840chr1283273 2986 2650 2082 1061 850 386 234 12249 23195 1255 --
NM_014841chr6----1282 --
NM_014847chr11528 ------
NM_014848chr1522654 2346 12451 ----
NM_014850chr394051 3910 3808 3653 3587 3427 3291 1589 1419 13869 13545 13299
NM_014853chr1731435 1009 237 ------
NM_014859chr1731046 959 221 --1239 --
NM_014862chr1533870 1418 625 --14195 --
NM_014864chr123688 3047 1585 33646 416 137 1982
NM_014868chr122816 266 --166 1194
NM_014870chr154344 2921 1765 1051 963 34734 3226 1384 1730 --
NM_014871chr122569 502 ------
NM_014872chr941820 485 455 441 --32003 823 74 --
NM_014873chr154567 4178 3663 3597 819 23804 3239 31509 1197 663 --
NM_014877chr17116887 6547 5445 5003 4929 2686 2591 1234 1042 521 134 1216 67801 6638 5666 2938 1643 1144 27614 1969
NM_014883chr422412 162 11973 --11630
NM_014884chr19166 ------
NM_014893chrY52066 1469 768 715 243 32348 671 457 11675 --
NM_014897chr1772760 2099 2054 1169 983 841 448 ----1322
NM_014898chr1932043 249 165 ------
NM_014902chr202318 159 ------
NM_014903chr1252317 826 781 755 684 --1895 137
NM_014904chr1043385 3312 3073 2624 23294 1356 43021 2929 1398 1087 22618 923
NM_014906chr1721355 832 --41238 1191 919 722 --
NM_014909chr141990 --33449 2958 2727 --
NM_014912chr1063250 3138 2879 2167 689 133 1553 ----
NM_014914chr211294 ------
NM_014917chr11973 ------
NM_014918chr1531441 1295 497 --1175 --
NM_014921chr1942836 2689 2153 1117 --12875 --
NM_014923chr1351622 1495 1468 483 265 ----2731 74
NM_014924chr1442807 2110 643 228 --1133 --
NM_014925chr121774 1699 ----
NM_014926chr31235 --2365 29 --
NM_014932chr311278 --11811 --
NM_014936chr672901 2341 1893 1761 1106 652 284 --22127 30 1740
NM_014937chr10--133 --11212
NM_014944chr121137 32 ------
NM_014945chr521979 1938 --21880 121 --
NM_014946chr293050 2914 2537 2387 1240 1093 443 386 212 --11135 --
NM_014947chr162935 2645 2544 1972 418 256 --1699 2474 171
NM_014949chr13685 318 238 ------
NM_014950chr1431363 331 108 ------
NM_014951chr1042473 2441 2303 1887 --42482 2365 609 75 --
NM_014952chr153838 570 347 --11841 --
NM_014953chr1344206 1202 1017 937 34185 3617 752 --1511
NM_014956chr113947 314 74 1800 1852 --
NM_014961chr431934 1743 602 --21640 873 1339
NM_014962chr2052566 2418 887 460 272 22453 185 12539 --
NM_014964chr1752148 2056 844 660 111 --2967 358 21617 145
NM_014969chr12329 177 ------
NM_014974chr1041784 1747 306 230 --11757 --
NM_014977chr141103 ------
NM_014978chr1051374 1366 1313 558 495 11226 21664 90 --
NM_014982chr1464288 4093 3911 3684 1831 307 15233 45045 1125 997 647 --
NM_014988chr412182 12821 ----
NM_014989chr622015 1954 ----12035
NM_014991chr432833 596 444 1375 22718 992 --
NM_014992chr14177 --1772 --
NM_014994chr151252 ------
NM_014997chr752928 2351 1139 1123 1007 --1138 --
NM_014999chr1231198 1031 562 --11146 --
NM_015001chr11207 --1353 --
NM_015005chr1431637 563 50 --11719 1325
NM_015008chr382699 2503 2219 1358 1022 969 887 396 --23280 1069 11250
NM_015011chr1341125 1092 1043 73 ------
NM_015017chr141127 253 218 96 --1867 11320
NM_015023chr171799 1644 1394 1325 343 268 88 --1675 --
NM_015024chr821235 320 ------
NM_015025chr24550 446 337 148 ----22244 2161
NM_015026chr12104116 4020 3073 3010 1703 1607 1451 1069 637 470 13961 1979 12936
NM_015027chr1621736 365 2708 439 11584 --
NM_015032chr1372754 2676 2358 1811 702 169 89 1312 --11034
NM_015035chr2086076 5958 5636 4224 1930 1709 711 627 21094 315 45212 1729 1332 747 11229
NM_015039chr1114248 4208 4195 3536 3420 1665 1623 1616 1355 1175 435 ------
NM_015040chr273379 2865 2633 2599 2280 634 117 --23206 946 --
NM_015042chr1583764 3306 3173 2848 1466 1430 1315 498 --23530 877 --
NM_015045chr1031432 1422 303 1520 32237 485 479 --
NM_015046chr962469 2393 2362 2176 1821 363 --32689 1789 1698 --
NM_015049chr272597 2422 1209 1154 1101 626 268 12670 12851 --
NM_015051chr953278 2957 1118 864 28 12184 1362 --
NM_015052chr73858 413 167 ------
NM_015054chr12------1432
NM_015055chr1132536 2389 1810 --31909 805 586 21868 421
NM_015056chr2152687 1909 695 628 80 --22552 34 --
NM_015061chr94823 627 235 215 ------
NM_015064chr1251349 936 817 549 374 --1542 --
NM_015068chr743062 1411 1227 739 ----23852 3435
NM_015069chr161521 ----2607 235
NM_015071chr585512 5159 4961 4550 4207 2283 1405 1277 56397 5898 5889 4235 1935 56409 4336 4299 2081 437 --
NM_015073chr1922074 1465 --12052 --
NM_015074chr1114716 4531 3776 1880 1868 1553 1502 722 667 553 523 13041 1938 --
NM_015075chrX----22238 1486 --
NM_015076chr684434 4350 3808 3104 3046 2740 1370 650 --24456 3725 11056
NM_015079chr1573028 1019 738 704 594 530 436 --32771 1306 306 11989
NM_015082chr542043 684 341 210 --22302 505 --
NM_015087chr1332028 649 151 --22379 336 --
NM_015090chr175400 4188 3874 2185 1549 1336 362 --24175 579 --
NM_015091chr142787 705 ------
NM_015092chr1674502 4475 4131 3698 3037 3027 1305 11624 34012 3137 264 12946
NM_015093chr641196 723 660 630 --1516 --
NM_015094chr2231734 1460 1323 11773 1860 --
NM_015097chr321956 290 --1813 1399
NM_015100chr131889 1776 1727 11401 51978 1782 1582 732 428 --
NM_015101chr162885 2843 2590 1858 743 505 ----11029
NM_015107chrX82335 1879 1554 697 294 205 120 44 --32394 2055 2035 --
NM_015110chr942513 2384 976 643 1550 22396 767 1122
NM_015115chr472529 2381 2326 1043 972 831 193 --33009 2825 1242 --
NM_015116chr1351074 563 388 106 75 --11199 --
NM_015124chr2262527 1700 1581 995 490 107 --1671 --
NM_015129chrX71705 1607 1439 1136 716 291 40 11484 --11583
NM_015130chr41387 --11168 --
NM_015132chr771773 1660 1517 1344 682 199 102 ------
NM_015133chr1621484 485 ------
NM_015137chr862577 2021 766 491 477 217 --21838 235 --
NM_015138chr1552739 1728 1033 930 402 --22805 274 1257
NM_015143chr441432 1301 324 160 ----1286
NM_015144chr1663283 3113 2635 1280 950 115 ------
NM_015149chr122094 1687 --12153 12132
NM_015153chr61543 ------
NM_015156chr14123527 2566 1501 1475 1429 1080 903 854 723 716 499 156 --23702 1250 13309
NM_015157chr1141194 790 729 39 ------
NM_015158chr92826 615 ------
NM_015161chr1631458 354 172 ----1274
NM_015163chr1411767 2750 143 --1286
NM_015170chr812238 --11869 --
NM_015172chr131400 1142 1116 --11034 --
NM_015176chr141616 1348 1243 1143 --1497 --
NM_015180chr143785 691 563 ------
NM_015184chr3172 ------
NM_015185chrX32840 401 324 --1354 1708
NM_015187chr42346 103 ------
NM_015191chr1142654 1062 506 69 11965 11045 --
NM_015192chr2043009 2484 508 310 --12846 12472
NM_015197chr1423388 2916 --1555 --
NM_015199chr332794 2286 1950 --22213 50 --
NM_015200chr42636 128 1934 11009 1389
NM_015206chr1563627 2575 1367 1217 912 812 --13714 --
NM_015208chr1853523 2750 2735 1118 503 --2963 72 195
NM_015215chr173170 3027 2722 2502 866 814 640 12018 42166 2093 2031 41 --
NM_015216chr531449 1085 338 --1440 --
NM_015221chr1021004 272 --31351 1046 35 --
NM_015225chr952901 2640 2615 874 646 13134 130 --
NM_015231chr113907 251 22 1938 1230 --
NM_015233chr1321881 569 --2830 636 --
NM_015236chr4----1364 --
NM_015247chr1654830 4257 1603 419 365 24012 754 31190 159 106 --
NM_015250chr931912 1268 532 21834 586 ----
NM_015251chr1662322 2072 2015 1596 1559 251 --32343 236 140 1588
NM_015252chr22845 602 ------
NM_015254chr862930 2774 1285 1072 831 372 --43174 1977 403 123 --
NM_015256chr51125 2527 146 ----
NM_015263chr1521058 73 ------
NM_015265chr272503 2150 1712 1651 563 311 52 --22308 127 --
NM_015267chr1222032 1355 ------
NM_015268chr31740 --190 --
NM_015270chr1231782 1455 262 --21650 472 --
NM_015271chr494267 4233 4004 3276 2757 1380 727 540 357 11355 13875 --
NM_015272chr16--11488 1653 --
NM_015275chr123666 637 143 --1603 --
NM_015278chr673044 2943 2596 1368 716 596 571 2610 588 32779 2467 897 --
NM_015282chr282922 2678 2322 1868 822 556 257 148 --12612 --
NM_015288chr552595 2458 2370 1527 1149 --43484 2625 929 171 --
NM_015291chr142815 2714 803 324 12536 31402 1004 814 --
NM_015292chr125548 247 149 42 34 1198 ----
NM_015294chr1711098 --1381 --
NM_015296chr133351 182 157 1998 ----
NM_015299chr1453605 1268 1122 232 118 --11416 13349
NM_015305chr1451898 1359 1285 393 346 ------
NM_015308chr113892 669 208 ----1224
NM_015310chr8108111 7230 6740 6188 5146 2885 1843 1780 1019 187 37696 2979 436 55658 5631 1984 707 166 --
NM_015313chr1163996 3469 3455 2928 803 392 14343 13100 34457 3700 437
NM_015315chr553428 3388 2422 919 125 --23460 859 1695
NM_015317chr231792 1111 1000 --22346 887 --
NM_015320chr21809 --1169 --
NM_015321chr1931819 1105 434 11239 44898 4892 1910 577 --
NM_015326chr152922 2295 2158 654 351 1826 ----
NM_015328chr792878 2777 2613 2459 2315 2070 970 503 50 12762 2712 402 --
NM_015329chr1922090 1810 --22787 1895 12849
NM_015335chr1241908 1733 541 299 --22025 1842 --
NM_015336chr1231638 534 138 --22199 65 --
NM_015339chr20292 75 --2328 284 --
NM_015344chr811654 --32048 673 239 --
NM_015346chr1461804 1561 1216 632 453 147 1482 11642 --
NM_015347chr1252852 2367 2224 2087 700 11045 12794 12501
NM_015349chr632907 2290 2065 --1671 1704
NM_015353chr1782715 2556 1927 979 841 826 297 227 --22537 2440 --
NM_015354chr9----1360 --
NM_015355chr1711335 11377 11864 --
NM_015356chr8173 ------
NM_015358chr213956 839 315 ------
NM_015359chr842069 1982 1929 624 --22621 1902 --
NM_015361chr23944 814 129 127 ----
NM_015365chrX53477 3361 3052 2627 284 1455 31519 873 327 12783
NM_015367chr2221628 436 --31456 1423 1390 --
NM_015375chr164707 4140 4119 3994 1576 1132 24840 1396 34701 3793 311 --
NM_015378chr153007 2783 2023 734 562 --12523 --
NM_015379chr7------1214
NM_015381chr2211444 ----1447
NM_015385chr1032594 2502 261 32414 2213 793 ----
NM_015387chr231518 759 444 --31995 1500 136 --
NM_015393chr473613 3013 2987 2743 1152 995 965 --12648 13606
NM_015397chr931729 735 239 --21422 185 --
NM_015401chr1231115 917 137 188 11021 --
NM_015416chr123887 790 331 1291 1699 --
NM_015423chr1151749 1495 1341 663 638 --1531 --
NM_015429chr31728 --1925 --
NM_015435chr8----11109 --
NM_015436chr441273 939 451 316 --12133 --
NM_015443chr1731477 1389 957 --21446 1427 --
NM_015444chr31144 1640 153 --
NM_015446chr151301 1268 1168 1123 278 11135 --11676
NM_015447chr92687 242 ------
NM_015453chr341563 1534 836 482 --11682 --
NM_015455chr584107 4099 3709 2843 2724 1252 1075 193 33638 3457 449 62523 1575 1240 1057 351 233 14144
NM_015458chr8114971 3264 1856 1809 1561 1457 1380 1025 1011 496 309 14325 13226 --
NM_015460chr351610 475 301 208 58 ------
NM_015464chr76952 895 141 118 111 44 ------
NM_015470chr231112 228 100 --2912 211 --
NM_015475chr221078 852 ----1257
NM_015477chr152981 834 --193 --
NM_015483chr7140 ------
NM_015488chr241522 1503 1470 464 ------
NM_015507chrX2426 168 --1139 --
NM_015508chr32989 470 --1148 --
NM_015516chr1131475 1401 294 --11186 --
NM_015523chr11------1242
NM_015530chr23915 861 645 ------
NM_015532chr1532493 751 556 11092 42485 359 316 149 --
NM_015534chr1193 ------
NM_015535chr272591 1123 909 560 467 412 204 --22652 1336 1340
NM_015541chr31375 ----11442
NM_015542chr1021041 217 1920 21031 930 --
NM_015548chr6----1144 --
NM_015549chr141458 --1415 --
NM_015553chr655184 5060 3959 3231 1971 --43864 3782 537 515 --
NM_015554chr1552397 1988 1894 1817 251 --12687 --
NM_015555chr651568 1215 1114 586 127 ----11349
NM_015556chr14----1175 --
NM_015559chr1811067 --1738 --
NM_015564chr542842 2768 2574 1014 --11048 --
NM_015567chr133448 113 27 ----11209
NM_015568chr2053201 2998 1632 1247 1082 --42842 1253 1005 116 --
NM_015569chr174713 4665 4627 4567 4469 4290 301 --14221 --
NM_015570chr72657 625 ------
NM_015571chr662194 2100 880 541 523 237 ------
NM_015575chr262805 2451 1003 348 224 134 --11061 --
NM_015577chr521713 560 --31800 421 43 --
NM_015601chr101825 ------
NM_015602chr111535 --11746 --
NM_015605chr102615 141 11495 ----
NM_015608chr10272 39 --1233 --
NM_015609chr112427 --12328 --
NM_015610chr732882 1998 222 1196 21958 1005 --
NM_015626chr171929 1152 31150 888 290 --
NM_015627chr121835 205 --11176 11364
NM_015630chr2----2947 253 --
NM_015634chr102504 202 ------
NM_015635chr972102 2011 1897 605 390 180 76 ----1741
NM_015640chr165055 4674 3921 3323 443 56 --11360 --
NM_015652chr102494 95 ----177
NM_015657chr22988 675 ------
NM_015658chr12385 368 ------
NM_015680chr23653 630 537 ------
NM_015686chrX22470 1988 11561 ----
NM_015691chrX32968 2387 2037 --1672 180
NM_015695chr632030 597 528 ------
NM_015704chr222118 39 ------
NM_015713chr832699 2190 678 --43275 2770 1427 196 12622
NM_015714chr1----1322 --
NM_015716chr172158 95 ----1102
NM_015723chr7--1202 1480 --
NM_015726chr131862 1497 113 --11553 11196
NM_015836chr141223 148 37 30 --11543 --
NM_015852chr7--101417 1087 1003 919 751 583 499 331 247 163 12522 --
NM_015874chr41506 ------
NM_015879chr18118648 8590 8461 7159 6100 3132 2768 2752 1725 1401 91 --1129 --
NM_015881chr1151289 475 396 265 67 ------
NM_015886chr885729 5360 4868 3708 3499 1864 1295 670 --34587 1886 1373 13734
NM_015888chr112066 13029 1261 1863
NM_015889chr221131 ----1120
NM_015891chr611940 ------
NM_015902chr81902 --1328 --
NM_015904chr21531 --1570 --
NM_015905chr71407 ------
NM_015906chr123686 971 23359 142 11605 13142
NM_015907chr43143 33 22 ------
NM_015912chr842482 2327 1634 23 --22214 152 170
NM_015932chr132230 149 1567 --1237
NM_015934chr22193 148 ------
NM_015955chr22405 186 169 ----
NM_015975chrX21285 275 ------
NM_015981chr52628 313 --32563 2397 796 --
NM_015982chr171129 --1311 --
NM_015984chr13375 218 128 ----1135
NM_015990chr41905 --1841 --
NM_015995chr1531728 594 54 ------
NM_015999chr1------146
NM_016003chr732882 1998 222 1196 21958 1005 --
NM_016009chr184941 4821 4252 4078 3824 485 319 135 13262 24609 4463 --
NM_016018chr862803 2522 2440 2417 904 462 --11752 --
NM_016019chr73910 332 299 ------
NM_016021chr663008 2745 2248 1126 812 234 12557 1827 --
NM_016022chr11139 ------
NM_016023chr882031 1632 1414 854 806 562 385 178 1885 1733 12083
NM_016027chr83446 203 36 ------
NM_016032chrX1166 1124 ----
NM_016037chr11246 --1140 --
NM_016039chr14----1152 --
NM_016047chr21169 ------
NM_016048chr5--1382 11004 1236
NM_016060chr1741110 1038 886 273 --1132 --
NM_016061chr231687 1637 1606 --1662 --
NM_016072chr1232421 2360 1811 --1380 --
NM_016073chr152331 187 ------
NM_016076chr193014 2507 2312 2225 1291 1110 646 471 350 ----1911
NM_016078chr1721081 22 ------
NM_016083chr623329 2454 1867 1330 --
NM_016087chr711406 --1693 --
NM_016096chr872177 2002 1651 1404 1368 544 371 --180 --
NM_016098chr61173 ----1367
NM_016107chr521371 315 --2404 294 --
NM_016120chrX2309 126 --2843 792 166
NM_016131chr272002 1921 1672 1454 944 782 514 ------
NM_016132chr1533356 2512 2149 1131 23133 1132 --
NM_016133chr221341 374 --1482 11434
NM_016141chr32747 619 --161 --
NM_016147chr1141053 937 393 356 1445 ----
NM_016152chr341246 475 392 381 ------
NM_016156chr1142247 2146 1496 796 ------
NM_016162chr121323 ------
NM_016169chr1072635 2096 1246 1043 887 724 437 ------
NM_016179chr131211 --1193 --
NM_016192chr22190 101 ------
NM_016201chr31509 --21839 831 --
NM_016206chr3128471 7631 6960 3324 2874 2321 2071 1787 776 577 223 149 --25966 3551 1263
NM_016217chr673549 3229 2867 1221 1198 402 162 1751 33306 2326 729 12495
NM_016220chr7--6904 582 498 418 166 81 --2666 334
NM_016221chr532359 816 446 11444 12076 --
NM_016224chr661358 737 523 327 184 36 ------
NM_016227chr141330 1306 1007 476 --21064 371 21570 1077
NM_016228chr41460 --1483 --
NM_016230chr61371 ------
NM_016231chr17------1197
NM_016233chr13937 402 147 ------
NM_016235chr16--11413 31387 1101 63 --
NM_016248chr1362597 2508 1226 814 543 484 --23839 1232 --
NM_016252chr22986 637 ----1194
NM_016257chr1103494 3294 3060 2860 1388 1324 479 349 272 211 ----12579
NM_016258chr1----2772 298 1534
NM_016260chr297236 6895 6085 5933 4983 4789 2911 2101 288 --22704 2256 --
NM_016269chr421108 317 ------
NM_016271chr1842345 2045 1636 691 --1312 12074
NM_016274chr1170 ------
NM_016275chr372707 2092 1999 1831 1813 675 119 22538 713 21757 641 1397
NM_016279chr51159 --1458 --
NM_016281chr121348 11165 ----
NM_016284chr163934 385 156 ------
NM_016287chr111829 --31490 311 86 1176
NM_016289chr211975 --1607 11736
NM_016297chr253506 2775 990 690 593 23534 837 22851 675 12523
NM_016300chr3146 ----1208
NM_016303chrX----2185 49 --
NM_016307chr91284 ----1291
NM_016308chr142090 1762 287 46 --21849 1332 11861
NM_016315chr221598 279 11526 ----
NM_016316chr2----1637 --
NM_016320chr113923 161 62 11019 ----
NM_016322chr973134 3061 2659 1052 544 377 80 11107 42852 2762 1007 477 13180
NM_016329chr32394 64 ------
NM_016339chr1741463 624 505 345 11142 1697 --
NM_016352chr71233 --11091 21411 423
NM_016359chr151668 ----1678
NM_016374chr131042 630 271 --1185 --
NM_016374chr131042 630 271 --1185 --
NM_016376chr1743450 1654 515 102 ----14262
NM_016396chr1532514 1967 610 1218 31975 948 116 --
NM_016410chr93473 451 177 ------
NM_016413chr13------1445
NM_016418chr2263502 842 372 311 290 231 --12860 --
NM_016422chr1152771 1253 727 471 171 --12714 1873
NM_016423chr141449 ------
NM_016424chr1771938 1493 1403 531 523 427 69 ------
NM_016436chr2062671 1843 638 608 532 266 ----12485
NM_016441chr231907 866 776 12104 12132 1683
NM_016442chr552182 2171 1994 752 41 --12278 --
NM_016448chr121898 1626 1109 3679 503 123 --
NM_016467chr21944 --21379 1021 --
NM_016470chr20126 ------
NM_016480chr51730 --2721 300 --
NM_016485chr62765 650 ------
NM_016486chr11181 ------
NM_016488chr1231962 1908 367 11318 1752 --
NM_016492chr171143 ------
NM_016506chr112272 163 ------
NM_016507chr1742430 2080 1963 501 ----1579
NM_016516chr22672 351 ------
NM_016519chr41173 --1358 --
NM_016522chr1121400 205 --21429 1189 --
NM_016525chr92812 295 ------
NM_016530chr1542855 501 477 311 23826 2970 21323 1178 --
NM_016531chr453180 1471 1194 1037 615 11102 --13224
NM_016539chr19129 --1432 --
NM_016542chrX4502 403 375 348 --21127 99 1259
NM_016544chr263912 2725 2554 1068 1055 715 --13365 1469
NM_016545chr12830 253 ----1747
NM_016561chr1641008 634 624 122 ------
NM_016569chr122172 21 --1580 --
NM_016575chr12135266 4502 4281 4228 4054 4027 3933 3756 3371 1802 1237 189 109 --44518 1552 244 86 --
NM_016578chr112551 146 ------
NM_016587chr721019 281 ------
NM_016588chr6------1721
NM_016596chr1231115 917 137 188 11021 --
NM_016598chr331350 1003 590 ------
NM_016599chr451435 540 507 495 210 ------
NM_016603chr51336 --21561 415 --
NM_016604chr53815 249 40 ------
NM_016605chr542226 1715 793 357 ------
NM_016607chrX--1155 1213 --
NM_016612chr82269 130 --1238 --
NM_016618chr2----1173 --
NM_016620chr121437 1178 ------
NM_016621chr1144333 2983 1709 1171 --11702 --
NM_016623chr81407 ----1107
NM_016626chr1831339 1186 428 11687 ----
NM_016628chr102352 320 ------
NM_016630chr153439 209 81 --1557 1513
NM_016631chr212940 390 ------
NM_016641chr1641735 1516 1265 665 ----11347
NM_016644chr5----1385 --
NM_016651chr14----2982 110 1174
NM_016654chr1531256 1233 870 --11014 --
NM_016823chr1721034 471 ------
NM_016824chr1021823 453 --11711 --
NM_016830chr12----1464 --
NM_016831chr131877 1821 237 --21506 949 --
NM_016834chr1753617 2649 1564 1483 846 --23750 144 --
NM_016835chr1753617 2649 1564 1483 846 --23750 144 --
NM_016836chr26766 703 675 611 582 85 1728 1557 --
NM_016839chr26766 703 675 611 582 85 1728 1557 --
NM_016841chr1753617 2649 1564 1483 846 --23750 144 --
NM_016929chr674489 4388 4313 3925 1061 346 90 --14517 --
NM_016930chr43760 309 59 ------
NM_016932chr24706 661 365 309 --3373 315 29 1937
NM_016936chr1622139 1948 ----1754
NM_016937chrX51005 885 849 221 200 1359 ----
NM_016946chr183494 2823 2337 1213 524 102 93 38 ------
NM_016950chr43979 433 184 ------
NM_016952chr11123985 3572 3487 3350 3180 2727 1158 1008 821 606 414 182 --11483 --
NM_016954chrX1147 ----2653 488
NM_017409chr121576 --1584 1525
NM_017410chr1221286 1168 1408 ----
NM_017412chr851036 1008 321 225 101 --2148 62 --
NM_017415chr5124295 3643 3549 3350 3192 3056 2904 1282 1224 1208 756 485 12994 33326 2968 2893 --
NM_017416chrX--1128 ----
NM_017420chr1473609 3282 3048 1375 1095 1004 194 13667 33111 2733 988 --
NM_017423chr432051 2025 311 --1512 3435 273 204
NM_017433chr102561 415 ------
NM_017437chr1431681 287 72 ------
NM_017447chr2184172 3723 3182 2723 1679 1610 1400 582 13119 1927 --
NM_017449chr121062 665 --1593 --
NM_017450chr1731013 1002 236 --2323 131 --
NM_017451chr1711002 ------
NM_017452chr204557 434 330 65 --11175 --
NM_017453chr204557 434 330 65 --11175 --
NM_017454chr204557 434 330 65 --11175 --
NM_017455chr151132 --2680 239 --
NM_017456chr1731990 1522 139 --1772 --
NM_017459chr1----174 --
NM_017491chr41755 --1772 --
NM_017514chrX3831 816 172 ------
NM_017522chr131447 428 381 ------
NM_017540chr583065 3050 2999 2078 495 401 276 238 22927 441 22560 2018 --
NM_017544chrX2838 718 --1211 --
NM_017545chr20----1163 1387
NM_017546chr23875 208 139 --1198 --
NM_017548chr331756 832 824 --1792 --
NM_017551chr1092669 2607 2249 2226 2177 606 413 324 55 ------
NM_017553chr1521220 66 ------
NM_017577chr341600 512 378 339 ----11247
NM_017580chr1011676 1522 1954 21486 670
NM_017582chr141791 1551 1468 554 --1379 --
NM_017583chr111285 --11129 --
NM_017588chr951971 1700 575 522 69 --11448 --
NM_017593chr41459 ------
NM_017602chrX1654 ------
NM_017610chr1551863 1490 343 319 196 --11534 --
NM_017615chr101118 --1149 --
NM_017617chr9193 --1189 --
NM_017628chr465113 4879 4600 1592 1026 83 23848 759 34828 4648 4501 14549
NM_017629chr111497 ----2785 514
NM_017632chr4----1102 --
NM_017633chr653752 3447 2508 832 531 --13032 --
NM_017634chr821974 1563 --1245 1310
NM_017635chr1131547 536 452 ------
NM_017637chr9148848 8626 8460 8338 7567 6797 6085 3637 3538 3311 2706 2465 1081 759 --109361 9268 8757 8228 7964 3437 1826 904 468 192 --
NM_017640chr62105 39 2795 770 1153 1278
NM_017641chr1221115 232 --1318 --
NM_017643chr1732381 2240 229 11974 --21103 979
NM_017644chr3155066 5024 4992 4849 4486 4358 3600 3432 1271 1084 720 608 325 232 172 --65182 4711 3592 1541 1337 131 14032
NM_017646chr1121 --1634 --
NM_017649chr101959 --1377 --
NM_017650chr795979 5092 4305 4039 2209 1917 1900 1848 1558 15804 13873 15597
NM_017657chr23909 690 366 --2274 32 --
NM_017658chr1474349 4297 3129 1835 1013 396 97 13214 74192 1193 1115 900 677 502 326 1619
NM_017660chr1952321 1135 473 464 449 13187 1440 21208 268
NM_017661chr1531206 1148 336 ----1824
NM_017664chr132917 820 --1270 --
NM_017666chrX52235 1901 705 337 276 --1246 --
NM_017672chr1531119 1100 415 ------
NM_017673chr11897 --1802 --
NM_017679chr17----1587 --
NM_017684chr1522004 70 ------
NM_017686chr14985 808 697 106 ------
NM_017697chr83470 453 167 ------
NM_017700chr42496 124 ------
NM_017709chr1104168 4145 3422 3329 3015 2795 1634 1428 1183 1163 195 2852 124 --
NM_017712chr19116108 6020 5304 5145 4302 2346 748 646 552 536 347 1403 66242 4984 4893 1472 1239 1061 --
NM_017714chr204682 329 175 53 ------
NM_017715chr73579 271 243 --1479 --
NM_017719chr352230 2074 755 584 162 --1342 --
NM_017728chr1721971 1140 ------
NM_017730chr32739 119 --1580 --
NM_017737chr161853 1631 1549 877 344 316 1374 157 1494
NM_017740chr1621271 483 21728 1167 11407 --
NM_017742chr182734 411 --2269 176 --
NM_017744chr162206 958 729 438 243 215 12113 ----
NM_017745chrX1239 ------
NM_017747chr5--1435 ----
NM_017752chrX31486 1386 787 --31613 1560 580 22153 1536
NM_017753chr931026 706 677 1885 ----
NM_017754chr694663 4076 3644 3460 3262 917 266 249 150 24296 1046 43854 3231 861 571 13679
NM_017757chr18----2835 460 --
NM_017758chr1751469 1225 1154 943 373 ------
NM_017762chr1522222 746 --21745 653 1570
NM_017772chr631232 497 32 --1355 --
NM_017778chr831289 1087 170 --21170 437 --
NM_017779chr152734 2275 2010 1724 570 --21104 728 --
NM_017780chr8----2270 240 1941
NM_017784chr311188 11018 11178 --
NM_017798chr20----2361 120 --
NM_017799chr1451676 1329 563 262 236 --11692 --
NM_017801chr372620 2582 2244 1696 1612 998 352 ------
NM_017811chr922137 360 --13102 --
NM_017813chr885627 5202 3884 3819 3657 1630 1238 187 1788 45722 1251 1041 943 21057 208
NM_017822chr121778 --1329 1518
NM_017824chr1022660 1709 11790 ----
NM_017830chr42995 75 ----1760
NM_017831chr1864532 4267 3220 1158 857 160 --44578 4260 3431 1616 --
NM_017842chr121677 --1536 --
NM_017845chr4193 ------
NM_017847chr14886 389 179 165 ------
NM_017848chrX54003 3163 1875 1657 655 13023 24482 4411 --
NM_017851chr1581045 945 912 512 430 382 270 43 --1156 --
NM_017866chr821068 310 1122 167 --
NM_017873chr922943 87 --32502 2171 631 --
NM_017896chr20103253 2931 2603 2444 2412 2339 815 570 379 158 --53349 2952 2450 2369 777 12541
NM_017902chr10105447 5149 4783 4410 4381 4349 4336 4092 1561 278 11078 35214 2214 613 14592
NM_017905chr13--1151 1533 --
NM_017907chr112484 194 ------
NM_017915chr12------1325
NM_017919chr9125427 4708 4073 4042 3920 1688 1413 1400 1122 827 703 432 --23622 3590 --
NM_017922chr142506 108 ------
NM_017923chr41514 ----1285
NM_017925chr921699 1529 --21492 233 1536
NM_017926chr142905 779 2808 371 3924 319 305 1938
NM_017933chr221572 363 1529 --1593
NM_017938chrX62072 2055 1970 1910 604 40 --12181 --
NM_017944chr1142967 2076 1932 1189 12463 12200 --
NM_017952chr264193 4000 3832 1555 854 733 11630 34381 2804 371 13938
NM_017955chr1441153 855 378 228 ------
NM_017964chr22899 849 ------
NM_017972chr142905 779 2808 371 3924 319 305 1938
NM_017987chr1041657 1619 892 263 11971 21938 1787 --
NM_017994chr743006 894 779 203 ----21009 659
NM_018000chr211791 1147 22117 2109 --
NM_018009chr12----2160 119 --
NM_018010chr331325 1075 391 21440 161 1451 --
NM_018018chr123498 438 277 --1765 --
NM_018027chr1032041 1053 173 ----23237 2197
NM_018028chr1941257 1016 877 168 ------
NM_018030chr1811064 --1271 --
NM_018036chr1474169 3941 3905 3668 3264 3196 321 34254 2958 1431 54332 4214 3016 2718 1043 --
NM_018046chr52695 563 1149 ----
NM_018061chr121272 1183 --3407 151 56 --
NM_018062chr22415 402 ------
NM_018070chr11442 ------
NM_018084chr252962 2707 2547 2418 808 175 23032 358 --
NM_018086chr241786 1669 1397 367 ------
NM_018087chr1----2213 195 --
NM_018095chr112272 163 ------
NM_018100chr673409 2975 890 798 789 181 50 --13232 11347
NM_018105chr82847 784 ------
NM_018112chr92677 209 1334 1958 --
NM_018114chr31110 ------
NM_018115chr43746 694 664 ------
NM_018117chr102685 624 ------
NM_018120chr831217 453 203 --31011 506 431 --
NM_018121chr1042694 2670 2230 53 12838 53210 2633 2503 2490 2470 --
NM_018124chr1662435 2406 1604 824 720 602 1876 11807 --
NM_018131chr10----1842 --
NM_018133chr361777 1729 1714 1541 428 310 ----11721
NM_018155chr373037 1041 880 729 700 396 173 22206 1193 22957 1097 1225
NM_018156chr153007 2783 2023 734 562 --12523 --
NM_018157chr1263247 2362 2302 2208 97 33 --11230 --
NM_018171chr123228 215 137 ------
NM_018179chr122634 236 1617 ----
NM_018181chr181503 --2581 418 --
NM_018182chr1772022 1768 1682 1513 665 227 60 --11737 --
NM_018184chr351850 872 658 330 236 11588 21550 112 --
NM_018191chr1331907 468 171 ------
NM_018195chr1151934 842 474 145 110 --11830 1461
NM_018200chr1571936 1924 1652 1032 927 820 452 --22178 2003 --
NM_018201chr972523 2468 1634 1008 844 740 685 ------
NM_018202chr11694 --1281 --
NM_018205chr1052285 2223 2165 1689 875 ------
NM_018206chr161205 --187 --
NM_018211chr162207 1657 1543 731 601 65 ------
NM_018214chr63280 157 33 ------
NM_018217chr20----159 --
NM_018222chr1131754 1177 73 --21838 584 --
NM_018234chr242235 2077 1755 844 ------
NM_018239chr1052285 2223 2165 1689 875 ------
NM_018241chr41279 --1763 --
NM_018243chr453781 3575 3451 3377 645 --43917 460 246 41 13019
NM_018244chr201308 --11170 --
NM_018247chr642909 2892 2511 135 --1253 --
NM_018254chr152259 2135 1878 1838 431 --1570 22124 864
NM_018257chr2032222 2155 1633 --32187 1607 967 11854
NM_018264chr72945 848 ------
NM_018266chr321090 1017 1707 1327 --
NM_018270chr202743 266 ------
NM_018279chr1252846 2575 2391 321 179 --22525 1096 --
NM_018285chr151511 --129 --
NM_018287chr1021222 181 ------
NM_018290chr421242 295 ------
NM_018293chr352170 1898 1881 1831 664 --12237 22268 2048
NM_018294chr102316 50 1632 ----
NM_018298chr1--1942 1172 1918
NM_018299chr82280 72 1567 --1201
NM_018301chrX2140 34 ------
NM_018307chr172958 61 ------
NM_018312chr1131934 1484 806 --22005 851 --
NM_018313chr342664 1067 565 330 12424 --11622
NM_018315chr41542 ------